40
Today

Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Embed Size (px)

Citation preview

Page 1: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Today

Page 2: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

G Protein Coupled Receptors

Animals

Page 3: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

signal transduction pathway, i.e.;• cAMP• phospholipase C• cGMP phosphodiesterase• MAPK

activated receptor

something happens

plasma membrane

cycles

something else happens

Page 4: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

~ 4 Orthologs

> 23 Paralogs

Mammals

Page 5: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Why Arabidopsis?Why me?

Only one prototypical G protein.

Page 6: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Gene Families

Page 7: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Why G?Why did my collaborators care?

Looking for the Auxin Receptor,

– auxin is a plant hormone implicated in multiple physiological pathways.

Page 8: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

G Protein Coupled Receptors

Auxin Functions

gravitropism/thigmatropism, etc.

perception of light

general signal transduction

embryogenesis

development

cell growth and differentiation

“oncogenesis”

etc.

Page 9: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Auxin Receptor =

G Protein Coupled Receptor?

Maybe Reverse Genetics can supply an answer?

Page 10: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Homologous Recombination Range

• Yes...

– mice, many well characterized mammalian cells,– bacteria, – yeast, (remember the bar code deletion project),

• No (maybe)...

– C. elegans (no),– Arabidopsis (done once, not repeated),– Drosophila (shown in principle, not repeated often),– the rest?

Page 11: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Agrobacterium

Plant CellsNature

Ti-Plasmid T-DNA

Hormonegenes

Opinesgenes

Selectable MarkersReporter Genes

Genes

Lab

Out: Ti genes, opine genes,

In: DNA of choice.

T-DNA

Page 12: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

from ~500,000

seeds

Page 13: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Set-UpDNA Pooling

Seeds (9)

Seedlings (225)

DNA (225)

1 2 3 4 5 6 …30SuperPools(2000)

Germinate and grow seeds in liquid culture.

Extract DNA,

Super Pool DNA,

Maintain lines as pools of seed.

PCR Screen

60,000 mutants

Page 14: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

PCR Strategy

T-DNAReaction:

Product:

T-DNAReaction:

Product:

Page 15: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something
Page 16: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

T-DNA Insertion Confirmation

• Blot gel and hybridize with a WT probe.

• Band isolate and cycle sequence PCR fragment.

G wt

Page 17: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Sequence T-DNA Insertion Sites

T-DNA Unknown GTP

GPA1: \\GCAATGTGTTATTAAGTTGTCT --- ATGCTCTC--- GAAAATTTTCGCCACTGGAAAT//

GPA2: \\TGTCTAAGCGTCAATTTGTTTA --- GGGCTCTCTCT--- ACCTGCTCAGGAGCACCTTTAC//

Sequence using the PCR primer from the T-DNA sequence.

T-DNAReaction:

Product:

Page 18: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Probability of Finding an Insert in a Specific Gene

thousands of inserts

p = 1-(1-f)n

p = probability of insertion event

f = 1-(Genome/Size of Gene)

n = number of T-DNA inserts

Page 19: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Finding Random Insertion Mutants

• Use PCR based approach to identify sequence with foreign DNA inserted into genes of interest.

Page 20: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Knockology

Page 21: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

KO

G sub-units binding site.

GTP binding sites.

Receptor interaction domain.Effector domains.

Page 22: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Genotype?

wt gpa1het

gpa1hom

gpa2het

gpa2hom

Southern Analysis

Genomic DNA,

Cut with SpeI,

Probe with 3’ GPA.

~ 5 Kb

ProbeSpeI SpeI

SpeI

~ 11 Kb

…not drawn to scale.

Page 23: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Transcript?

wt

truncated

Northern Analysis

Extract total RNA

Use complementary DNA to probe for mRNA

Page 24: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Protein?

Western Analysis

Proteins extracted

Antibodies specific to GPA proteins facilitate probing for the presence of the protein.Antibody was raised to the N-

terminus of the gene.

Page 25: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

T-DNA Mutants Genetic Analysis

taggedseed line

taggedseed line

isolate homozygous

mutant

isolate homozygous

mutant

backcrossto wildtype

backcrossto wildtype

2x

phenotype analysis

phenotype analysis

tt x TT (wt)

Tt (R / D)

T-DNASegregation

TT Tt

Tt tt

T t

T

t

F2

Page 26: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Genetic AnalysisF2 Segregation

1 : 2 : 1

TT Tt

Tt tt

T t

T

t

Not Lethal

1 wt : 2 het

TT Tt

Tt tt

T t

T

t

Lethal

1 wt : 1 het

TT Tt

Tt tt

T t

T

t

GametophyteLethal

Page 27: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Arabidopsis Gantlet Projecthttp://thale.biol.wwu.edu/

Seed/seedlin

gMucilage

Germination timeCotyledon size

Cotyledon shapeCotyledon color

Time first true leaves

Petiole lengthLeaf size

Leaf shapeLeaf color

Leaf marginsStem lengthStem colorRoot length

Root branchingAdventitious roots

Root gravityShoot gravity

Etiolated growthDe-etiolation

Vegetative/Seeds

Initial health in soilLeaf AnatomyTime to boltingNo. of leaves

when boltsBolt lengthBolt gravityStem color

No. of flowers/boltFlower morphology

Anther lengthSilique lengthNo. of siliquesNo. of seeds

Leaf senescenceStop flowering

Silique shatteringSeed size

Seed shapeSeed color

Seed wrinkles

Physiology/SeedlingHormones: ABA, Auxin,

Brassinolide, Cytokinin, GACalcium , (low w/EGTA) (high)

Dimethylglutaric Acid (1) pH 4.0 – 6.0NaCl

Osmoticum (Mannitol, Sorbitol, PEG, Sucrose)

Nutrition/Seedling0.1X MS, +/- Sucrose

0.01X MS, +/- SucroseCa SO4 (0.2 mM) Minimal Media

Nutrient Dropouts: Base media (all) minus one:Ca(NO3), K2SO4, MgSO4, FeEDTA, KH2PO4, H3BO3, MnSO4,

CuSO4, ZnSO4, NaMoO

QuestionsName?Quest?

Air-speed velocity of an unladen swallow? How do you spell Guantlet?

Page 28: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

De-etiolated Plants?

Page 29: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

De-etiolated Plants?cell size vs. organ size

Page 30: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Mitosis?cyc1At-CDB-GUS

Page 31: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Overexpression?

Transgene:

GPA1 driven by an inducible promoter,

- dexamethason,

In “WT” plants.

Page 32: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

GPA1 function?BY-2 Cells

…over-express GPA1 in cell culture lines,

- measure G1 to G2 transitions,

- measure cell plate formations.

Page 33: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Conclusions

GPA1 operates in controlling cell proliferation, probably by modulating G1

control.

May be involved in auxin signal reception?

Page 34: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

something happensMAPK?

KO

Turns out agb1 (-sub-unit) phenotype identical to gpa1,

…what do you think that means?

Page 35: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

GPA1What Else?

Page 36: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

GPA1, What Else II?Brassinolide

Plant Physiol, June 2002, Vol. 129, pp. 897-907 Since 2001

Page 37: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

> 4 Orthologs

> 23 Paralogs

Mammals

Page 38: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

Assman, Science (310), 2005

Page 39: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something
Page 40: Today G Protein Coupled Receptors Animals signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK activated receptor something

FOR WEDNESDAY...