To Degrade or Not to Degrade: Substrate Recognition by Lon

Protease

Amy Dinh

Department of Microbiology

Mentor: Janine E. Trempy, Ph.D.

Protein Misfolding Diseases

normal protein abnormal protein

protein aggregate

Treatment Issues

• Aggregates cause disease or caused by disease

• Cause of abnormal proteins?

• Result of malfunction of related protein?

ADDL aggregates (yellow) coating a neuron in Alzheimer’s Disease. Scientific American

Studying Human Lon with E. coli

• lon

– ATP dependent protease

– highly conserved in evolution

– four known substrates in E. coli

– NO known substrates in humans

Aims

• Study how E. coli Lon interacts with its substrates

• Help identify human Lon substrates

• Substrates with effects on central nervous system

• Identify relationship between CNS substrates and abnormal proteins

Research Methods

• E. coli Lon interactions with two substrates– RcsA– SulA

• Control physiological effects

• Clear phenotypes

RcsA– transcriptional activator of capsular polysaccharide genes

(mucoidy)

lon-lon+

RcsA intiates CPS transcription

RcsA initiates CPS transcription

Lon degrades RcsA RcsA not degraded

Non-mucoid cell Mucoid cell

SulA• SulA (SOS gene)

– halts cell division – filament formation

Cells exposed to MMS/UV

SulA causes filament formation

SulA degraded (lon+) SulA not degraded ((lon-)

Filaments resolved into new cells Cell death

Prior Research

RcsA

SulA

SulA

RcsA

Competition Hierarchy

Proteolytic Binding Site

Lon Domains

369

679

Ser

411 421351

ATP Binding Site

C-terminus

Proteolytic Bindng Site

aa residue #211-271

Met

7831

N-terminus velcro domain

RcsA recognition Site

SulA recognition Site?

Making Mutants

• Mutagenesis– K11 and Tll strains

– Contain antibiotic resistance gene linked to lon

– methylating agent: nitrosoguanidine (NTG)

– Generation of random point mutations

GCATTGCGGGGCTATCGGTCACACTGCATCGTCATCGAATCGGGCGCGCCCTGATTGACGTAACGCCCCGATAGCCAGTGTGACGTAGCAGTAGCTTAGCCCGCGCGGGACTAACT

Making Mutants

100/0

45

50

75

Tetr / Kanr

11 minutes

10 minuteslon

• DNA Packaging– P1vir Lysates– P1vir Bacteriophage– ~100 kb (20 genes)

Making Mutants

• Transduction– Infection of healthy E. coli with P1vir

Infection Recombination

tetr/ kanr

mutated lon

normal lon

E.coli P1 vir

tetr/ kanr

mutated lon

normal lon

P1 virE.coli

Making Mutants

• Requires several phases of screening– 1. Selection for mutations on lon

• Mutant behavior re: RcsA

Screening for Mutants

100/0

45

50

75

Tetr / Kanr

11 minutes

10 minuteslon

• Limited DNA capacity

Screening for Mutants

• Requires several phases of screening– 1. Selection for mutations on lon

• Mutant behavior re: RcsA

– 2. Screening using temperature selection

Temperature Selection Hypothesis

• Low temperatures• Protein folding normal• Wild type behavior

• High temperatures• Abnormal protein

folding• Mutant behavior

Screening for Mutants

• Requires several phases of screening– 1. Selection for mutations on lon

• Mutant behavior re: RcsA

– 2. Screening using temperature selection– 3. Screening using temperature selection and

MMS• Mutant behavior re: SulA

Mutant Classes

• I: Lon defective with RcsA

Normal cells Mucoid

Mutant Classes

• II: Lon defective with SulA

Normal CellFilamentation/

Cell Death

On MMS at 42º

• III: Lon defective with RcsA and SulA

Mutant Classes

Normal cells Mucoid On MMS at 42º

Cell Death

Mutant Classes

• IV: Lon Gone Wild

Normal Cell Cell Death

At 42º

Mutants Isolated

• 8 Class I Mutants– Lon Defective with RcsA

• 3 Class II Mutants– Lon Defective with SulA– Intermediate MMS sensitivity

• 2 Class IV Mutants– Lon Gone Wild– Validates Temperature Selection Hypothesis

Next Steps

• Mutant Verification/Identification– Presence of Lon/RcsA/SulA

• Western Blot

– Amplify lon using PCR – Sequence DNA– Compare Mutant Sequence with E. coli lon

sequence

Why Bother?

• Learn how Lon selects its substrates in E. coli

• A model for Lon in humans

• Help identify Lon substrates in humans

• Understand more about age-related protein misfolding diseases

Acknowledgements

• Dr. Janine Trempy

• Howard Hughes Medical Institute

• HHMI Selection Committee

• Undergraduate Research, Innovation, Scholarship and Creativity (URISC) Program

• URISC Selection Committee