Upload
phamthuy
View
218
Download
2
Embed Size (px)
Citation preview
Title: Experimental arthritis inhibits the insulin-like growth factor-I (IGF-I) axis and induces muscle wasting through cyclooxygenase-2 (COX-2) activation
Authors: Miriam Granado, Ana I Martín, Mª Ángeles Villanúa, and Asunción López-Calderón. Departamento Fisiología, Facultad de Medicina, Universidad Complutense. 28040 Madrid. Spain.
Abbreviated title: COX-2, IGF-I axis and muscular wasting in arthritis
CORRESPONDING AUTHOR AND REPRINT REQUESTS: A. López-Calderón.
Dpt Fisiología, Fac Medicina.Univ Complutense.28040, Madrid.Phone: 3491-3941491FAX: 3491-3941628e-mail: [email protected]
Page 1 of 46Articles in PresS. Am J Physiol Endocrinol Metab (February 6, 2007). doi:10.1152/ajpendo.00502.2006
Copyright © 2007 by the American Physiological Society.
COX-2, IGF-I axis and muscular wasting in arthritis
2
ABSTRACT
Chronic arthritis induces cachexia associated with an inhibition of the GH-IGF-I
system and an activation of the E3 ubiquitin-ligating enzymes MAFbx and MuRF1 in
the skeletal muscle. The aim of this work was to study the role of COX-2 in chronic
arthritis-induced cachexia. Arthritis was induced in rats by Freund’s adjuvant
injection, and the effect of two COX inhibitors; indomethacin, a nonspecific inhibitor,
and meloxicam, a selective COX-2 inhibitor, on pituitary GH, and on liver and serum
IGF-I levels were tested. Arthritis decreased body weight gain and GH and liver IGF-I
gene expression. In the arthritic rats, both inhibitors, indomethacin and meloxicam,
prevented the inhibitory effect of arthritis on body weight gain. Indomethacin and
meloxicam administration to arthritic rats increased pituitary GH and liver IGF-I
mRNA as well as serum levels of IGF-I. These data suggest that induction of COX-2
during chronic inflammation is involved in the inhibition of the GH-IGF-I axis and in
the body weight loss. In the gastrocnemius muscle, arthritis increased the gene
expression of TNF-α, the E3 ubiquitin-ligating enzymes MAFbx and MuRF1 as well
as of IGF-I and IGFBP-5. Inhibition of COX-2 by meloxicam administration increased
gastrocnemius weight and decreased MAFbx, MuRF1, TNF-α and IGFBP-5 gene
expression. In summary, our data indicate that chronic arthritis-induced cachexia and
muscle wasting are mediated by the COX-2 pathway resulting in a decreased GH-
IGF-I secretion and increased expression of MAFbx and MuRF1 mRNA.
KEY WORDS: indomethacin, meloxicam, TNF-α, MuRF1, MAFbx,
Page 2 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
3
INTRODUCTION
Chronic inflammation is associated with a decrease in body weight and
cachexia. One of the numerous factors that can be involved in inflammatory
cachexia is the neuroendocrine system. The neuroendocrine response to
inflammation is characterized by an increase in the secretion of catabolic hormones
such as glucocorticoids and a decreased secretion of anabolic factors such as
insulin-like growth factor-I (IGF-I) (24). These modifications, together with the
increased release of cytokines, can result in hypermetabolism and a decrease in
body weight.
Adjuvant-induced arthritis is an experimental model of rheumatoid arthritis that
is induced in rats by an intradermal injection of Freund’s adjuvant. Ten days after
adjuvant injection rats start to lose body weight even before the external signs of the
illness are manifested (37). Cachexia and hypermetabolism have also been reported
in rheumatoid arthritis patients (52). Rheumatoid cachexia has been postulated as
an important contributor in increasing morbidity and premature mortality in
rheumatoid arthritis patients (62). Cachexia in experimental arthritis is associated
with a decreased secretion of the growth hormone (GH)-IGFI axis, whereas GH
administration to arthritic rats is able to increase body weight gain (28). The
increased production of cytokines, mainly tumor necrosis factor-α (TNF-α) seems
also to be involved in inflammatory cachexia, since the neutralization of TNF-α in
arthritic rats increases body weight gain as well as pituitary GH and liver IGF-I gene
expression (21).
Possible factors that can mediate the cachetic effect of TNF-α are
prostaglandins. Pro-inflammatory cytokines induce the production of prostaglandin
E2 (PGE2), which plays an important role in the inflammatory response.
Page 3 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
4
Cyclooxygenases (COXs) are the key enzymes in regulating the biosynthesis of
prostaglandins. There are two COX isoforms, encoded by different genes, COX-1
which is constitutively expressed and COX-2 which is inducible by pro-inflammatory
cytokines and other stimuli. COX-2-induced synthesis of prostaglandins has been
associated with chronic inflammation including arthritis, since the anti-inflammatory
effect of selective COX-2 inhibitors is as effective as non-selective inhibitors (17).
However, the role of COX-1 in inflammation has also been proposed (13).
Body weight loss in cachexia is secondary to muscle wasting and to
enhanced protein breakdown by the ubiquitin-proteasome proteolitic pathway (34).
MAFbx (Muscle Atrophy F-box) and MuRF1 (Muscle Ring Finger 1) are muscle
specific E3 ubiquitin-ligating enzyme that play an important role in muscle atrophy,
and serve as early markers of skeletal muscle atrophy, aiding in the diagnosis of
muscle disease. MAFbx overexpression in C2C12 cells induces a decrease in
myotube diameter, and mice deficient in MAFbx or MuRF1 are resistant to
denervation induced muscle atrophy (5). In addition, MAFbx and MuRF1 mRNA are
increased in atrophying muscle of many inflammatory conditions including sepsis
(64) and chronic arthritis (20).
Proinflammatory cytokines such as IL-1 and TNF-α have been reported to
increase muscle protein proteolysis by the ubiquitin-proteasome pathway (for review
see 1). In addition to cytokines, the increased activity of COX can be responsible for
muscle wasting and cachexia. Activation of COX-2 pathways has been observed in
several cachetic states conditions such as cancer and sepsis (15, 19). COX
inhibitors are able to ameliorate cancer cachexia and to improve body composition
both in experimental animals and humans (15, 26, 39). Inhibition of COX activity
prevents muscular wasting in cancer and reduces the ubiquitin ligases (25).
Page 4 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
5
However, the anti-cachexic effect of the inhibitors of prostaglandin synthesis has
been reported in several types of cancer, whereas they are unable to prevent cancer
cachexia in others (23).
The use of non-steroidal anti-inflammatory drugs (NSAIDS) or unspecific COX
inhibitors has possible side effects on gastrointestinal function and hematological
tissues especially in chemotherapy treatments in cancer patients. However, NSAIDS
are widely used in inflammatory conditions such as rheumatoid arthritis due to their
effective anti-inflammatory activity. Accordingly, the aim of this work was to elucidate
the effect of COX inhibition on experimental arthritis-induced cachexia. For that
reason, we compared the response in arthritic rats to treatment with an unspecific
COX inhibitor, indomethacin, and a COX-2 inhibitor, meloxicam, on body weight, on
the GH-IGF-I system and in the gene expression of the E3 ubiquitin-ligating
enzymes, MAFbx and MuRF1, in skeletal muscle. We have previously observed that
arthritis increases TNF-α and IGF binding protein-5 (IGFBP-5) gene expressions in
the gastrocnemius (20). Since they can be a negative regulators of IGF-I signaling
and of muscular growth, the expression of these two genes were also analyzed.
MATERIAL AND METHODS
Arthritic and control male Wistar rats were purchased from Charles River
(Barcelona, Spain) weighing 150-175 g (6 weeks old) at the beginning of the
experiment. Arthritis was induced in the rats by a intradermal injection of 1 mg heat-
inactivated Mycobacterium butyricum in incomplete Freund’s adjuvant in the right
paw. Control animals were injected with mineral oil. Rats were housed 3-4 per cage
under controlled conditions of light (lights on from 7:30 to 19:30 h) and temperature
(22 ± 2º C). Food and water were available "ad libitum". Assessment of arthritis was
Page 5 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
6
performed by measuring the arthritis index of each animal, which was scored by
grading each paw from 0 to 4. Grading was determined as: 0- no erythema or
swelling. 1- slight erythema or swelling of one or more digits. 2- swelling of entire
paw. 3- erythema and swelling of the ankle. 4- ankylosis, incapacity to bend the
ankle. The severity score was the sum of the clinical scores of each limb, the
maximum value being 16. The procedures followed the guidelines recommended by
the EU for the care and use of laboratory animals, and were approved by the
University animal care committe.
Indomethacin administration
On day 15 after adjuvant injection, control and arthritic rats were randomly
divided into 2 groups; one was injected daily with the unspecific COX inhibitor
indomethacin (4 mg/ kg sc Sigma, Madrid, Spain) and the second was injected with
vehicle (250 µl of 0.5% NaHCO3). Indomethacin dose was selected after a study
showing that this dose prevents muscle wasting in cancer and weight loss in arthritic
rats (25, 58). Body weight, food intake and the arthritis index scores were examined
daily. Food intake per cage was calculated by measuring the difference between the
initial and the remaining amount of pellets in the feeder, and expressed as g per rat
per 100 g body weight per day. All rats were killed by decapitation 22 days after
adjuvant or vehicle injection and after 8 days of indomethacin treatment, 2.5 h after
the last injection. Trunk blood was collected in cooled tubes, allowed to clot,
centrifuged and the serum was stored at -20º C until IGF-I assay was performed and
at - 80º C until PGE2 analysis was performed. The left hind paw was amputated at
the ankle level, and the volume measured by water displacement. Immediately after
decapitation the pituitary and the liver were removed, dissected, frozen in liquid
nitrogen and stored at -80 C until ribonucleic acid (RNA) extraction.
Page 6 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
7
Meloxicam administration
The effect of meloxicam administration, a COX-2 inhibitor, was examined. On
day 15 arthritic and control rats were divided into two groups; one was injected with
meloxicam (1 mg/kg sc, Sigma), and the second received 250 µl of saline sc, from
day 16 to 22. This dosage was selected, since it was reported to be close to an
optimal anagelsic dose as previously described (54). Rats were injected, weighed
and the arthritis score index and the food intake were examined daily. None of the
rats died during the experimental procedures. On day 22 after adjuvant injection rats
were killed and blood was allowed to clot, centrifuged and the serum was stored until
IGF-I and PGE2 assays were performed. The left hind paw volume, gastrocnemius
muscle, pituitary, kidney and heart weights were measured. The pituitary, liver and
gastrocnemius muscle were dissected, frozen in liquid nitrogen and stored at -80 C
until ribonucleic acid (RNA) extraction.
Serum IGF-I and PGE2
Serum IGF-I concentrations were measured by a double-antibody RIA. Serum
IGF-I binding proteins (IGFBPs) were removed by acid-ethanol extraction. The IGF-I
antiserum (UB2-495) was a gift from Dr. Underwood and Dr. Van Wyk, and it is
distributed by the Hormone Distribution Program of NIDDK through the National
Hormone and Pituitary Program. Levels of IGF-I were expressed in terms of IGF-I
from Gropep Ltd. (Adelaide, Australia). The intra-assay coefficient of variation was
8%. Samples from one experiment were run in the same assay.
Serum concentrations of PGE2 were measured by an enzymeimmunoassay
(EIA) system using a commercial kit (Amersham Biosciences, Buckinghamshire, UK)
Page 7 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
8
following the manufacturer’s instructions (http://amersham.com).
Real-time PCR
RNA was extracted by the guanidine thiocyanate method using a commercial
kit (UltraspecTM RNA, Biotecx Laboratories Inc. Houston, Texas, USA). The integrity
of the RNA was confirmed using agarose gel electrophoresis. For RT-PCR analysis,
2 µg pituitary, liver or skeletal muscle total RNA was reverse-transcribed in a total
volume of 30 µl at 37ºC for 15 min with 125 U of MMLV reverse transcriptase
(Maxim Biotch Inc, San Francisco, CA, USA).
Primers for PCR (table 1), were obtained from Qiagen (Valencia, CA, USA)
from previously published sequences of IGF-I, TNF-α and MuRF1 (16),
hypoxanthine-guanine phosphorybosyl transferase (Hprt) (47), COX-2 (6) or by
using the rat GenBank and the EXIQON ProbeLibrary GH, IGFBP-5 and MAFbx.
Primers were designed to span a single sequence derived from two exons (i.e.,
separated by an intron in genomic DNA and primary RNA transcripts to minimize
amplification).
Each real-time PCR reaction contained 10 ng of synthesized cDNA, 1x
Takara SYBR Green Premix Ex Taq (Takara BIO INC, Japan), and 300 nM forward
and reverse primers for the candidate gene in a reaction volume of 25 µl. Reactions
were carried out on a SmartCycler® (Cepheid, Sunnyvale, CA, USA).
Parameters included an initial activation of hotStarTaq DNA polymerase at
95º C for 15 min, followed by 40 cycles of denaturation at 94ºC for 15 s, annealing at
60º C and extension at 72 ºC for 30 s. Specific amplification was confirmed by the
presence of one single peak in the melting curve plots. In addition, the PCR products
were analyzed by agarose gel electrophoresis. Results were calculated as percent of
Page 8 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
9
control rats, using the cycle threshold 2(∆∆Ct) method (36) with the Hprt as reference
gene.
Statistical analysis
All data are presented as the mean ± SEM. Statistics were computed using
the statistics program STATGRAPHICS plus for Windows. Differences among
experimental groups were analyzed by one-way (organ weights) or two-way analysis
of variance. Where there were differences among the groups, post-hoc comparisons
were made by using the unpaired Student’s t-test. Significance was assumed when
P<0.05.
Page 9 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
10
RESULTS
Arthritis induced a significant increase in COX-2 gene expression (P<0.01) in
all the tissues analyzed; pituitary, liver and skeletal muscle (Fig.1). As expected,
when the serum concentration of PGE2 was measured in arthritic rats treated with
the two COX inhibitors, both treatments were able to induce a significant (P<0.01)
decrease in the serum levels of PGE2 (Fig.2).
Three rats from the arthritic group injected with indomethacin died during the
experiment, whereas none of the arthritic rats injected with vehicle or meloxicam
died during the entire experimental procedure. In the control group injected with
indomethacin one rat died and two rats were excluded from the experiment because
they started to lose weight and have ascites. Indomethacin administration to arthritic
rats dramatically decreased arthritis index scores (Fig. 3), being significantly lower
than in the arthritic rats injected with vehicle on the third day of indomethacin
treatment (and 17 days after adjuvant injection). Arthritis increased the paw volume
(P<0.01), and indomethacin treatment reduced paw volume in arthritic rats (P<0.01,
Fig. 3), whereas indomethacin administration had no effect on paw volume in control
rats. The anti-inflammatory effect of treatment with meloxicam was similar to that of
indomethacin (Fig.4). Meloxicam administration decreased the external signs of the
arthritis, measured as arthritis scores, from the first day of treatment. This difference
was significant starting from the third day of treatment (Fig. 4). Meloxicam
administration for eight days also decreased the paw volume in the arthritic rats
P<0.01, but not in controls.
The effect of arthritis and indomethacin administration on body weight and
food intake is shown in Fig. 5. Arthritic rats had lower body weight than control rats
Page 10 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
11
when starting the indomethacin treatment 15 days after adjuvant injection. In the
arthritic rats injected with vehicle, the body weight gain during the 8 days of
treatment was lower than that of control rats injected with vehicle (P<0.01). In both
experiments, arthritis decreased (P<0.01) the cumulative food intake during the 8
days of treatment (Fig. 5 and 6), but this effect was not significant during the last two
days of treatment before the rats were sacrificed (Fig. 5 and 6). Indomethacin
induced a significant increase in body weight in arthritic rats starting 24 h after
administration. Moreover, indomethacin prevented the inhibitory effect of arthritis on
body weight gain, since the arthritic rats injected with indomethacin had a cumulative
body weight similar to that of control rats injected with vehicle, although the absolute
body weight remained lower than the control rats injected with vehicle (Fig. 5). In
contrast, indomethacin administration to non-arthritic rats induced a decrease in food
intake (P<0.01, Fig. 5) and in body weight gain, where the cumulative body weight
gain during the 8 days of treatment was lower than that of the arthritic rats injected
with indomethacin (Fig. 5).
The effect of meloxicam administration on body weight and food intake is
shown in Fig. 6. Meloxicam administration to arthritic rats prevented the inhibitory
effect of arthritis on body weight, since the evolution of body weight during the 8
days of treatment in the arthritic rats injected with meloxicam was similar to that of
the control rats. Meloxicam administration had no appreciable effect on food intake in
control rats, but induced a marked increase in food intake in arthritic rats (P<0.01),
even at higher levels than the food intake observed in control rats (Fig 6).
In the group treated with vehicle, arthritis induced a significant decrease in
pituitary GH (P<0.05) and liver IGF-I (P<0.01) gene expression, as well as in serum
concentrations of IGF-I (P<0.01, Fig. 7). As observed with food intake and body
Page 11 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
12
weight, indomethacin administration decreased serum concentrations of IGF-I and
IGF-I gene expression in the liver (P<0.01) in control rats. There was a significant
decrease in serum IGF-I levels in the control rats that received indomethacin. In
contrast, in arthritic rats indomethacin administration increased serum concentrations
of IGF-I (P<0.05) and liver IGF-I mRNA, although this increase was not statistically
significant. Indomethacin treatment did not modify pituitary GH mRNA in control rats
but blunted the inhibitory effect of arthritis on pituitary GH mRNA.
In contrast with the data obtained with the indomethacin treatment, meloxicam
administration to control rats did not modify liver IGF-I mRNA or serum
concentrations of IGF-I (Fig. 8). In arthritic rats, meloxicam administration increased
the serum concentration of IGF-I as well as its gene expression in the liver, reaching
levels similar to those observed in the control rats (Fig. 8). Similarly, meloxicam
administration also blunted the inhibitory effect of arthritis on GH mRNA (Fig 8).
Due to the observed side effects of indomethacin, and taking into account that
in the arthritic rats the effect of indomethacin and meloxicam on body weight and on
the GH-IGF-I axis was similar, we studied the skeletal muscle response only in the
rats treated with meloxicam. The effect of arthritis and meloxicam administration to
arthritic rats on gastrocnemius, heart, kidney and pituitary weights is shown in Fig. 9.
Arthritis decreased the weight of all organs studied, but there were differences
among them. Arthritis induced a dramatic decrease in skeletal muscle, where the
gastrocnemius was 28 % (P<0.01) of gastrocnemius weight of the control rats
injected with saline. The weight of organs such as the heart, kidney and pituitary
were also decreased by arthritis, but their decreases were lower (73 - 84 % of control
values) than that of skeletal muscle decrease. In the control rats meloxicam
administration had no effect in all the organs analyzed (data not shown). These data
Page 12 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
13
indicate that the inhibitory effect of arthritis on body weight is mainly due to skeletal
muscle atrophy. Similarly, the stimulatory effect of meloxicam on body weight in
arthritic rats is concomitant with an increase in the weight of the organs studied,
where this effect is more marked in skeletal muscle weights than in kidney, heart or
pituitary weights (Fig. 9).
The effect of arthritis on IGF-I gene expression in the gastrocnemius is
different than in the liver, since IGF-I mRNA was higher (P<0.05) in arthritic rats than
in control rats injected with saline (Fig.10). Meloxicam treatment, although it
increased IGF-I mRNA in the gastrocnemius, the increase had not statistical
significance in control or in arthritic rats. Arthritis also induced an increase (P<0.01)
in IGFBP-5 mRNA in the gastrocnemius (Fig. 10). Meloxicam administration did not
modify the IGFBP-5 mRNA in the gastrocnemius of control rats, whereas it
decreased the IGFBP-5 mRNA in the arthritic rats reaching levels similar to those of
control rats.
The effect of meloxican administration on MAFbx and MuRF1 gene
expression in the gastrocnemius of control or arthritic rats is shown in Fig. 11. In the
control rats meloxicam administration did not modify MAFbx, MuRF1 or mRNAs.
Arthritis induced a significant increase in MAFbx (P<0.01) and MuRF1 (P<0.05)
mRNAs in the gastrocnemius, and meloxicam treatment totally prevented the effect
of arthritis on these mRNAs (Fig. 11).
Arthritis also induced an increased on TNF-α gene expression in skeletal
muscle (Fig. 12). Meloxicam administration did not modify the TNF-α mRNA in
control rats, whereas in arthritic rats meloxicam induced a significant decrease in
TNF-α mRNA reaching control values.
Page 13 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
14
DISCUSSION
Our data show that arthritis increases COX-2 gene expression, whereas
inhibition of COX-2 activity prevents arthritis-induced muscle wasting and the
increase in the E3 ubiquitin-ligating enzymes MAFbx and MuRF1. These effects are
associated with an amelioration of the GH-IGF-I axis and a decrease in the gene
expression of IGFBP-5 and TNF-α in the skeletal muscle. Taking into account that
the anti-inflammatory effect of both treatments, indomethacin, a non-selective
inhibitor, and meloxicam, a preferential selective COX-2 inhibitor, was similar. The
inhibitory effect of arthritis on the GH-IGF-I system and on body and skeletal muscle
weights seems to be mediated through activation of the COX-2 pathway.
The anti-anorexigenic effect of COX inhibitors is well known, and it has been
postulated that eicosanoids are more important in anorexia than host cytokines (51).
In the present data, the two COX inhibitors increased food intake and body weight
gain in the arthritic rats. The anti-anorexigenic effect of indomethacin in the arthritic
rats contrasts with its effect in control rats, in which indomethacin decreased food
intake, body weight gain, IGF-I gene expression in the liver and circulating IGF-I.
Toxicity to indomethacin but not to meloxicam was observed, as indicated by
mortality and a decrease in body weight gain in the control rats injected with
indomethacin. A toxic effect of 5 mg/kg indomethacin has previously been reported,
but without mortality (17). In arthritic rats undergoing treatment with a lower
indomethacin dosage (3 mg/kg), one group did not report having adverse effects of
indomethacin (49), whereas other one reported mortality (58). Indomethacin side
effects have been attributed to gastrointestinal damage due to COX-1 inhibition. A
detrimental effect of a COX-1 inhibitor on body weight has been reported, since
COX-1 inhibition or genetic inactivation of COX-1 augmented and prolonged body
Page 14 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
15
weight loss during inflammation (29). In control rats injected with indomethacin the
gastrointestinal damage can be the cause of the decrease in food intake. The
decrease in body weight gain and in IGF-I gene expression in the control rats
injected with indomethacin can be related to the decrease in food intake. According
to this, pituitary GH gene expression is not affected by indomethacin in the control
rats, since GH is not as related to food intake as IGF-I is.
Although the rats in this study were not pair-fed, we have previously found
that the inhibitory effect of arthritis on body weight and IGF-I is not due to anorexia,
since pair-fed rats gained similar body weight to control rats fed “ad libitum” (38). A
possible explanation is that the anorexic effect of arthritis is small, the food intake is
90% that of the control rats, whereas the body weight gain is 11% of the control rats,
during the 8 days of the experiment. In addition, there is no difference in food intake
from day 21 to 23 (the last two days before sacrificing the animals) between arthritic
and control rats injected with vehicle. Furthermore, rhGH administration to arthritic
rats increased body weight gain without increasing food intake (28). On the contrary,
anti-TNF-α administration to arthritic rats increases food intake to control levels, but
the body weight gain was still lower than the control rats (21). In cancer it has been
reported that initially body wasting occurs independently of anorexia (7, 25, 63). In
other cachectic conditions such as lipopolysaccharide (LPS) administration, the
mechanism by which LPS reduces food intake is also dissociated from its effect on
weight loss (42). All these data indicate that in addition to the decrease in food
intake, the decrease in body weight in adjuvant-arthritis is related to other
mechanisms.
The effect of both COX inhibitors on body weight in the arthritic rats can be
Page 15 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
16
secondary to its effect on GH and IGF-I, since the immunosuppesor cyclosporine A
blocks the inhibitory effect of arthritis on circulating GH and IGF-I and also prevents
the inhibitory effect of arthritis on body weight (59). Taking into account that
exogenous GH is able to counteract the decline in skeletal muscle function in chronic
cardiac failure (14), part of the effect of meloxicam in preventing cachexia can be
secondary to the increased gene expression on GH, and liver and serum IGF-I. The
inhibitory effect of arthritis on GH does not seem to be mediated by the increased
release of PGE2, since this prostanoid has been reported to be a GH secretagogue
(12, 43). A stimulatory effect of lipoxygenase products on pituitary GH synthesis and
secretion has also been reported (12, 53). Therefore, the inhibitory effect of arthritis
on pituitary GH can be secondary to another inhibitory substance that is released
after COX-2 activation. In the liver COX-2 upregulation potentiates liver injury
induced by allyl alcohol, where PGD2, but not PGE2, has a similar effect in isolated
hepatocytes (19). A direct inhibitory effect of prostaglandin A and J on IGF-I gene
expression has been reported (9, 10), whereas PGE2 have a stimulatory effect on
IGF-I gene expression in osteoblasts (8, 54). Therefore, it is also possible that
another prostaglandin different from PGE2 inhibits the pituitary GH and liver IGF-I
during inflammation.
IGF-I has a prominent role in muscle hypertrophy, but when chronically
deactivated it has also an important role in muscle atrophy (31). Accordingly, the
increased IGF-I mRNA in skeletal muscle of arthritic rats contrasts with the notable
muscle wasting induced by arthritis. One possible explanation for this fact is that
muscular IGFBP-5 might inhibit IGF-I activity in skeletal muscle by preventing its
interaction with the IGF-I receptor. In addition to its IGF-I-dependent action, IGFBP-5
is also able to decrease cell proliferation by an IGF-I-independent effect in myoblast
Page 16 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
17
cultures (44). Similarly, transgenic mice overexpressing IGFBP-5 show growth
retardation and decreased skeletal muscle mass relative to body weight (57). In the
present data COX-2 inhibition in arthritic rats decreased IGFBP-5 mRNA in the
skeletal muscle. It is possible that meloxicam directly decreases IGFBP-5 gene
expression by decreasing prostanoid biosynthesis in skeletal muscle. A stimulatory
effect of PGE2 on IGFBP-5 in osteoblast cells has also been described (46).
Moreover, PGE2-responsive elements have been reported in the IGFBP-5 promoter
(4, 40). Changes in pituitary GH secretion can also modify muscular IGFBP-5
mRNA, since GH inhibits the expression of IGFBP-5 in mammary epithelial cells
(56).
Local COX-2 pathways can play an important role in muscle wasting. Arthritis
increases COX-2 and specific E3 ubiquitin-ligating enzymes, MAFbx and MuRF1,
gene expression in the muscle. In septic patients, an increase in COX-2 and
activation of the ubiquitin proteolitic pathway in muscle have been reported (50). In
addition, COX-2 inhibition by celecoxib decreases muscle weakness in elderly
patients with acute inflammation (35). The preservation of muscle mass in the
arthritic rats injected with meloxicam was associated with a decrease in the muscular
expression of both atrogenes. These results suggest that the COX-2 pathway is
involved the upregulation of MAFbx and MuRF1 during chronic arthritis. Taking into
account that these genes are considered as markers of skeletal muscle atrophy, our
data suggest that COX-2 pathway is involved in muscular wasting.
It is possible that the improvement in mobility, rather than the decrease in
prostaglandins “per se”, may lead to the observed changes in gene expression in the
gastrocnemius. We cannot exclude this possibility, because we did not measure
mobility. However, this does not seem to be the cause, since with systemic anti-TNF-
Page 17 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
18
α administration, inflammation was also decreased in a similar way (21), but no
modifications in IGFBP-5, MAFbx or MuRF1 mRNA or gastrocnemius weight were
observed (22). Taking into account that TNF-α is also an important trigger of
muscular atrophy and it upregulates MAFbx and MuRF1 gene expression (31, 35),
the lack of effect of systemic anti-TNF-α in preventing muscular wasting was
unexpected (22). A possible explanation can be that the “in vivo” anti-TNF-α therapy
is not able to suppress COX activity in the muscle, as is the case of the synovial
tissue from rheumatoid arthritis patients (33). These data emphasize the importance
of the COX pathway in the inflammatory cachexia. Another explanation could be that
muscle proteolysis by the ubiquitin-proteasome pathway is activated by local TNF-α
rather than by circulating TNF-α, since systemic anti-TNF-α therapy is not able to
prevent the increased gene expression of TNF-α in the gastrocnemius muscle (22).
In the present data, normalization of MuRF1 and MAFbx is associated with a
decrease in muscular TNF-α, which means that there is a relationship between
prostaglandin inhibition and TNF-α gene expression. Supporting these data,
normalization of TNF-α gene expression by NSAID administration has previously
been reported in cancer (32), in endotoxemic rats (3), in diabetic retinopathy (30),
and has been explained by the inhibitory effect of the NSAIDs on NFkB signaling.
NF-kB plays an important role in muscle atrophy as well. It is upregulated in
muscle in several conditions of muscle wasting such as disuse, sepsis, cancer and
angiotensin administration (27, 48, 55 60). Blockade of NF-kB prevents muscle
atrophy, and transgenic mice with activated NF-kB have muscle wasting and
increased MuRF1 gene expression (11). All these data indicate that NF-kB is a
central component of the muscular atrophy process involved in the activation of
proteolytic pathways. Taking into account that meloxicam inhibits the activation of
Page 18 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
19
NF-kB (2, 30, 61), this can be one of the mechanisms by which meloxicam
prevented arthritis-induced increase of MAFbx and MuRF1 expression and muscle
wasting.
In conclusion, our data suggest that over-activation of COX-2 is responsible
for chronic inflammation-induced cachexia, through an inhibition of the GH-IGF-I axis
and an activation of the ubiquitin-proteasome pathway and muscle wasting. At
muscular level, COX-2 seems to be also involved in the increase in local IGFBP-5
and TNF-α gene expression that contribute to the activation of the MAFbx and
MuRF1 ubiquitin-ligases. These findings have implications not only on the
knowledge of the mechanism leading to cachexia in chronic inflammation, but on
therapeutic strategies in managing chronic arthritis.
ACKNOWLEDGMENTS
The authors are indebted to Antonio Carmona for technical assistance and to
Christina Bickart for the English correction of the manuscript.
GRANTS
This work was supported by Programa Nacional de Promoción General del
Conocimiento, Plan Nacional de Investigación Científica, from Ministerio de
Educación Ciencia (BFI-2003-02149), by a grant from Universidad
Complutense/SantanderCentralHispano PR27/05-14055, and a Fellowship from
Ministerio de Educación y Ciencia to M Granado (FPU, AP2003-2564).
Page 19 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
20
REFERENCES
1. Argiles JM, Busquets S, López-Soriano FJ. The pivotal role of cytokines in
muscle wasting during cancer. Int J Biochem Cell Biol 37: 1609-1619, 2005
2. Asano K, Sakai M, Matsuda T, Tanaka H, Fujii K, Hisamitsu T. Suppression of
matrix metalloproteinase production from synovial fibroblasts by meloxicam in-vitro. J
Pharm Pharmacol 58: 359-66, 2006.
3. Azab AN, Kobal S, Rubin M, Kaplanski J. Effects of nimesulide, a selective
cyclooxygenase-2 inhibitor, on cardiovascular alterations in endotoxemia. Cardiology
103: 92-100, 2005.
4. Beattie J, Allan GJ, Lochrie JD, Flint DJ. Insulin-like growth factor-binding
protein-5 (IGFBP-5): a critical member of the IGF axis. Biochem J 395: 1-19, 2006.
5. Bodine SC, Latres E, Baumhueter S, Lai VK, Nunez L, Clarke BA,
Poueymirou WT, Panaro FJ, Na E, Dharmarajan K, Pan ZQ, Valenzuela DM,
DeChiara TM, Stitt TN, Yancopoulos GD, Glass DJ. Identification of ubiquitin
ligases required for skeletal muscle atrophy. Science 294: 1704-1708, 2001.
6. Bianchi A, Moulin D, Sebillaud S, Koufany M, Galteau MM, Netter P, Terlain
B, Jouzeau JY. Contrasting effects of peroxisome-proliferator-activated receptor
(PPAR)gamma agonists on membrane-associated prostaglandin E2 synthase-1 in
IL-1beta-stimulated rat chondrocytes: evidence for PPARgamma-independent
inhibition by 15-deoxy-Delta12,14prostaglandin J2. Arthritis Res Ther 7:
R1325-R1337, 2005.
7. Bibby MC, Double JA, Ali SA, Fearon KC, Brennan RA, Tisdale MJ.
Characterization of a transplantable adenocarcinoma of the mouse colon producing
cachexia in recipient animals. J Natl Cancer Inst 78: 539-546, 1987.
Page 20 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
21
8. Bichell DP, Rotwein P, McCarthy TL. Prostaglandin E2 rapidly stimulates
insulin-like growth factor-I gene expression in primary rat osteoblast cultures:
evidence for transcriptional control. Endocrinology 133: 1020-1028, 1993.
9. Bui T, Kuo C, Rotwein P, Straus DS. Prostaglandin A2 specifically represses
insulin-like growth factor-I gene expression in C6 rat glioma cells. Endocrinology
138: 985-993, 1997.
10. Bui T, Straus DS. Effects of cyclopentenone prostaglandins and related
compounds on insulin-like growth factor-I and Waf1 gene expression. Biochim
Biophys Acta 1397: 31-42, 1998
11. Cai D, Frantz JD, Tawa NE Jr, Melendez PA, OH BC, Lidov HG, Hasselgren
PO, Frontera WR, Lee J, Glass DJ, Shoelson SE. IKKbeta/NF-kappaB activation
causes severe muscle wasting in mice. Cell 119: 285-298, 2004.
12. Canonico PL, Speciale C, Sortino MA, Cronin MJ, MacLeod RM, Scapagnini
U. Growth hormone releasing factor (GRF) increases free arachidonate levels in the
pituitary: a role for lipoxygenase products. Life Sci 38: 267-272, 1986.
13. Chillingworth NL, Morham SG, Donaldson LF. Sex differences in inflammation
and inflammatory pain in cyclooxygenase-deficient mice. Am J Physiol Regul Integr
Comp Physiol Mar 291: R327-R334, 2006.
14. Dalla Libera L, Ravara B, Volterrani M, Gobbo V, Della Barbera M, Angelini
A, Danieli Betto D, Germinario E, Vescovo G. Beneficial effects of GH/IGF-1 on
skeletal muscle atrophy and function in experimental heart failure. Am J Physiol Cell
Physiol 286: C138-C144, 2004.
15. Davis TW, Zweifel BS, O'Neal JM, Heuvelman DM, Abegg AL, Hendrich TO,
Masferrer JL. Inhibition of cyclooxygenase-2 by celecoxib reverses tumor-induced
Page 21 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
22
wasting. J Pharmacol Exp Ther 308: 929-934, 2004.
16. Dehoux M, Van Beneden R, Pasko N, Lause P, Verniers J, Underwood L,
Ketelslegers JM and Thissen JP. Role of the insulin-like growth factor I decline in
the induction of atrogin-1/MAFbx during fasting and diabetes. Endocrinology 145:
4806-4812, 2004.
17. Egan CG, Lockhart JC and Ferrell WR. Pathophysiology of vascular
dysfunction in a rat model of chronic joint inflammation. J Physiol 557: 635-643,
2004.
18. Fafeur V, Tiberghien C, Haour F, Dray F. Control of growth hormone release
by growth hormone-releasing factor and prostaglandin E2 in a system of perfused rat
anterior pituitary cells. Reprod Nutr Dev 28: 229-231, 1988.
19. Ganey PE, Barton YW, Kinser S, Sneed RA, Barton CC, Roth RA.
Involvement of cyclooxygenase-2 in the potentiation of allyl alcohol-induced liver
injury by bacterial lipopolysaccharide. Toxicol Appl Pharmacol 174: 113-121, 2001.
20. Granado M, Priego T, Martín AI, Villanúa MA, López-Calderón A. Ghrelin
receptor agonist GHRP-2 prevents arthritis-induced increase in E3 ubiquitin-ligating
enzymes MuRF1 and MAFbx gene expression in skeletal muscle. Am J Physiol
Endocrinol Metab 289: E1007-E1014, 2005.
21. Granado M, Priego T, Martín AI,Vara E, López-Calderón A, Villanúa MA.
Anti-tumor necrosis factor agent PEG-sTNFRI improves the growth hormone/insulin-
like growth factor-I system in adjuvant-induced arthritic rats. Eur J Pharmacol 536:
204-210, 2006.
Page 22 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
23
22. Granado M, Martín AI, Priego T, López-Calderón A, Villanúa MA. TNF
blockade did not prevent the increase of muscular MuRF-1 and MAFbx in arthritic
rats. J Endocrinol 191: 319-326, 2006.
23. Graves E, Ramsay E, McCarthy DO. Inhibitors of COX activity preserve
muscle mass in mice bearing the Lewis lung carcinoma, but not the B16 melanoma.
Res Nurs Health 29: 87-97, 2006.
24. Heemskerk VH, Daemen MA, Buurman WA. Insulin-like growth factor-1 (IGF-1)
and growth hormone (GH) in immunity and inflammation. Cytokine Growth Factor
Rev. 10: 5-14, 1999.
25. Hitt A, Graves E, McCarthy DO. Indomethacin preserves muscle mass and
reduces levels of E3 ligases and TNF receptor type 1 in the gastrocnemius muscle of
tumor-bearing mice. Res Nurs Health 28: 56-66, 2006.
26. Hussey HJ, Tisdale MJ. Effect of the specific cyclooxygenase-2 inhibitor
meloxicam on tumour growth and cachexia in a murine model. Int J Cancer 87: 95-
100, 2000.
27. Hunter RB, Stevenson E, Koncarevic A, Mitchell-Felton H, Essig DA,
Kandarian SC. Activation of an alternative NF-kappaB pathway in skeletal muscle
during disuse atrophy. FASEB J 16: 529-38, 2002.
28. Ibáñez de Cáceres I, Villanúa MA, Soto L, Martín I and López-Calderón A.
IGF-I and IGF-I-binding proteins in rats with adjuvant-induced arthritis given
recombinant human growth hormone. J Endocrinol 165: 537-544, 2000.
29. Johnson PM, Vogt SK, Burney MW, Muglia LJ. COX-2 inhibition attenuates
anorexia during systemic inflammation without impairing cytokine production. Am J
Physiol Endocrinol Metab 282: E650-E656, 2002.
30. Joussen AM, Poulaki V, Mitsiades N, Kirchhof B, Koizumi K, Dohmen S,
Page 23 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
24
Adamis AP. Nonsteroidal anti-inflammatory drugs prevent early diabetic retinopathy
via TNF-alpha suppression. FASEB J 16: 438-440, 2002.
31. Kandarian SC, Jackman RW. Intracellular signaling during skeletal muscle
atrophy. Muscle Nerve 33: 155-165, 2006.
32. Konturek PC, Rembiasz K, Burnat G, Konturek SJ, Tusinela M, Bielanski W,
Rehfeld J, Karcz D, Hahn E. Effects of cyclooxygenase-2 inhibition on serum and
tumor gastrins and expression of apoptosis-related proteins in colorectal cancer. Dig
Dis Sci 51: 779-787, 2006.
33. Korotkova M, Westman M, Gheorghe KR, af Klint E, Trollmo C, Ulfgren AK,
Klareskog L, Jakobsson PJ. Effects of antirheumatic treatments on the
prostaglandin E2 biosynthetic pathway. Arthritis Rheum 52: 3439-3447, 2005.
34. Lecker SH, Jagoe RT, Gilbert A, Gomes M, Baracos V, Bailey J, Price SR,
Mitch WE and Goldberg AL. Multiple types of skeletal muscle atrophy involve a
common program of changes in gene expression. FASEB J 18: 39-51, 2004.
35. Li YP, Chen Y, John J, Moylan J, Jin B, Mann DL, Reid MB. TNF-alpha acts
via p38 MAPK to stimulate expression of the ubiquitin ligase atrogin1/MAFbx in
skeletal muscle. FASEB J 19: 362-370, 2005.
36. Livak KJ and Schmittgen TD. Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-
408, 2001.
37. López-Calderón A, Soto L, Martín AI. Chronic inflammation inhibits GH
secretion and alters the serum insulin-like growth factor system in rats. Life Sci 65:
2049-2060, 1999.
38. López-Calderón A, Ibañez de Cáceres I, Soto L, Priego T, Martín AI and
Villanúa MA. The decrease in hepatic IGF-I gene expression in arthritic rats is not
Page 24 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
25
associated with modifications in hepatic GH receptor mRNA. Eur J Endocrinol 144:
529-534, 2001.
39. Lundholm K, Daneryd P, Korner U, Hyltander A, Bosaeus I. Evidence that
long-term COX-treatment improves energy homeostasis and body composition in
cancer patients with progressive cachexia. Int J Oncol 24: 505-512, 2004.
40. McCarthy TL, Casinghino S, Mittanck DW, Ji CH, Centrella M, Rotwein P.
Promoter-dependent and -independent activation of insulin-like gr owth factor
binding protein-5 gene expression by prostaglandin E2 in primary rat osteoblasts. J
Biol Chem 271: 6666-6671, 1996.
41. Mets T, Bautmans I, Njemini R, Lambert M, Demanet C. The influence of
celecoxib on muscle fatigue resistance and mobility in elderly patients with
inflammation. Am J Geriatr Pharmacother 2: 230-238, 2004.
42. Ogimoto K, Harris Jr. MK, Wisse BE. MyD88 is a key mediator of anorexia,
but not weight loss, induced by lipopolysaccharide (LPS) and interleukin-1beta
(IL1beta). Endocrinology 147: 4445-4453, 2006.
43. Ojeda SR, Jameson HE, McCann SM. Prostaglandin E2 (PGE2)-induced
growth hormone (GH) release: effect of intrahypothalamic and intrapituitary implants.
Prostaglandins 13: 943-955, 1977.
44. Pampusch MS, Xi G, Kamanga-Sollo E, Loseth KJ, Hathaway MR, Dayton
WR, White ME. Production of recombinant porcine IGF-binding protein-5 and its
effect on proliferation of porcine embryonic myoblast cultures in the presence and
absence of IGF-I and Long-R3-IGF-I. J Endocrinol 185: 197-206, 2005.
45. Pash JM, Delany AM, Adamo ML, Roberts CT Jr, LeRoith D, Canalis E.
Regulation of insulin-like growth factor I transcription by prostaglandin E2 in
osteoblast cells. Endocrinology 136: 33-38, 1995.
Page 25 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
26
46. Pash JM, Canalis E. Transcriptional regulation of insulin-like growth factor-
binding protein-5 by prostaglandin E2 in osteoblast cells. Endocrinology 137: 2375-
2382, 1996.
47. Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarencon D, Agay
D, Chancerelle Y & Multon E. Rat pro-inflammatory cytokine and cytokine related
mRNA quantification by real-time polymerase chain reaction using SYBR green.
BMC Immunology 5: 3-10, 2004.
48. Penner CG, Gang G, Wray C, Fischer JE, Hasselgren PO. The transcription
factors NF-kappab and AP-1 are differentially regulated in skeletal muscle during
sepsis. Biochem Biophys Res Commun 281: 1331-1336, 2001.
49. Philippe L, Gegout-Pottie P, Guingamp C, Bordji K, Terlain B, Netter P,
Gillet P. Relations between functional, inflammatory, and degenerative parameters
during adjuvant arthritis in rats. Am J Physiol 273: R1550-R1556, 1997.
50. Rabuel C, Renaud E, Brealey D, Ratajczak P, Damy T, Alves A, Habib A,
Singer M, Payen D, Mebazaa A. Human septic myopathy: induction of
cyclooxygenase, heme oxygenase and activation of the ubiquitin proteolytic
pathway. Anesthesiology 101: 583-590, 2004.
51. Ross JA, Fearon KC. Eicosanoid-dependent cancer cachexia and wasting. Curr
Opin Clin Nutr Metab Care 5: 241-248, 2002.
52. Roubenoff R, Roubenoff RA, Cannon JG, Kehayias JJ, Zhuang H, Dawson-
Hughes B Dinarello CA, Rosenberg IH. Rheumatoid cachexia: cytokine-driven
hypermetabolism and loss of lean body mass in chronic inflammation. J Clin Invest
93: 2379-2386, 1994.
53. Roudbaraki MM, Drouhault R, Bacquart T, Vacher P. Arachidonic acid-
Page 26 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
27
induced hormone release in somatotropes: involvement of calcium.
Neuroendocrinology 63: 244-256, 1996.
54. Roughan JV, Flecknell PA. Evaluation of a short duration behaviour-based
post-operative pain scoring system in rats. Eur J Pain 7: 397-406, 2003.
55. Russell ST, Wyke SM, Tisdale MJ. Mechanism of induction of muscle protein
degradation by angiotensin II. Cell Signal 18: 1087-1096, 2006.
56. Sakamoto K, Yano T, Kobayashi T, Hagino A, Aso H, Obara Y. Growth
hormone suppresses the expression of IGFBP-5, and promotes the IGF-I-induced
phosphorylation of Akt in bovine mammary epithelial cells. Domest Anim Endocrinol.
Apr 18 [Epub ahead of print], 2006.
57. Salih DA, Tripathi G, Holding C, Szestak TA, Gonzalez MI, Carter EJ, Cobb
LJ, Eisemann JE, Pell JM. Insulin-like growth factor-binding protein 5 (Igfbp5)
compromises survival, growth, muscle development, and fertility in mice. Proc Natl
Acad Sci U S A 101: 4314-4319, 2004.
58. Shelton DL, Zeller J, Ho W-H, Pons J, Rosenthal A. Nerve growth factor
mediates hyperalgesia and cachexia in auto-immune arthritis. Pain 116: 8-16, 2005.
59. Soto L, Martín AI, Vara E, López-Calderón A. Cyclosporin a treatment is able
to revert the decrease in circulating GH and IGF-I and the increase in IGFBPs
induced by adjuvant arthritis. Horm Metab Res 33: 590-595, 2001.
60. Tisdale MJ. Protein loss in cancer cachexia. Science 289: 2293-2294, 2000.
61. Yamamoto Y, Yin MJ, Lin KM, Gaynor RB. Sulindac inhibits activation of the
NF-kappaB pathway. J Biol Chem 274: 27307-27314, 1999.
62. Walsmith J, Abad L, Kehayias J, Roubenoff R. Tumor necrosis factor-alpha
production is associated with less body cell mass in women with rheumatoid arthritis.
Page 27 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
28
J Rheumatol 31: 23-29, 2004.
63. Wang W, Lonnroth C, Svanberg E, Lundholm K. Cytokine and
cyclooxygenase-2 protein in brain areas of tumor-bearing mice with prostanoid-
related anorexia. Cancer Res 61: 4707-4715, 2001.
64. Wray CJ, Mammen JM, Hershko DD, Hasselgren PO. Sepsis upregulates the
gene expression of multiple ubiquitin ligases in skeletal muscle. Int J Biochem Cell
Biol. 35: 698-705, 2003.
Page 28 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
29
LEGEND OF FIGURES
Fig. 1. Effect of adjuvant-induced arthritis on COX-2 gene expression in the pituitary,
liver and skeletal muscle (gastrocnemius). Tissues were obtained on day 23 after
adjuvant injection. COX mRNA was measured by real-time PCR as described in
material and methods. Results are expressed as percentage of the control (non-
arthritic) rats for at least 7 rats per group. **P<0.01 vs. control rats.
Fig. 2. Serum concentration of PGE2 in arthritic rats treated with the COX inhibitors
indomethacin and meloxicam (gray bars) or with vehicle (white bars). Both inhibitors
decreased the serum concentrations of PGE2 in arthritic rats. Values shown are the
mean ± SEM for 8-10 rats per group.ºº P<0.01 vs. respective group injected with
vehicle.
Fig. 3. Evolution of arthritis scores (upper panel) and paw volume (lower panel) in
arthritic rats (AA) or control rats injected with indomethacin (4 mg/kg sc) or vehicle
(250 µl) for 8 days (treatments started 15 days after adjuvant injection). Values
shown are the mean ± SEM (n=8-10 rats). There was an interaction between the
effect of arthritis and indomethacin on paw volume (F1,31 = 11, P<0.01), since
indomethacin decreased paw volume in arthritic rats, but not in control rats.
**P<0.01, vs. control rats injected with vehicle, ++P<0.01 vs. control rats injected
with indomethacin, º P<0.05 , ºº P<0.01 vs. arthritic rats injected with vehicle.
Fig. 4. Evolution of arthritis scores (upper panel) and paw volume (lower panel) in
arthritic rats (AA) or control rats injected with meloxicam (1 mg/kg sc) or saline for 8
Page 29 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
30
days (treatments started 15 days after adjuvant injection). Values shown are the
mean ± SEM (n=10-12 rats). There was an interaction between the effect of arthritis
and meloxicam on paw volume (F1,36 = 15, P<0.01), since meloxicam decreased paw
volume in arthritic rats, but not in control rats. **P<0.01, vs. control rats injected with
vehicle, ++P<0.01 vs. control rats injected with meloxicam, ºº P<0.01 vs. arthritic rats
injected with saline.
Fig. 5. Effect of 8-day indomethacin administration (4 mg/kg sc) on cumulative body
weight gain (A), absolute body weight evolution (B), daily food intake during the 8
days (C) or during the last 2 days of treatment (D), in control or arthritic (AA) rats.
There was an interaction between the effect of arthritis and indomethacin on body
weight gain (F1,33 = 37, P<0.01) and on food intake during the 8 days (F1,24 = 41,
P<0.01) or during the last 2 days (F1,24= 40, P<0.01) of treatment, since
indomethacin decreased the body weight gain and food intake in control rats,
whereas it increased body weight gain and food intake in arthritic rats. Values
represent the mean ± SEM for n= 6-12. **P<0.01 vs. control rats injected with
vehicle, ºP<0.05 ººP<0.01 vs. arthritic rats injected with vehicle, ++ P<0.01 vs. control
rats injected with indomethacin.
Fig. 6. Effect of 8-day meloxicam administration (1mg/kg sc) on cumulative body
weight gain (A), absolute body weight evolution (B), daily food intake during the 8
days (C) or during the last 2 days of treatment (D), in control or arthritic (AA) rats.
There was an interaction between the effect of arthritis and meloxicam on body
weight gain (F1,36 = 25, P<0.01) and on food intake during the 8 days (F1,24 = 16,
P<0.01) or during the last 2 days (F1,20= 44, P<0.01) of treatment, since meloxicam
Page 30 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
31
increased the body weight gain and food intake in arthritic rats but not in control rats.
Values represent the mean ± SEM for n= 4-12. *P<0.05, **P<0.01 vs. control rats
injected with vehice,º P<0.5 ºº P<0.01 vs. arthritic rats injected with vehicle, ++
P<0.01 vs. control rats injected with meloxicam.
Fig. 7. Effect of indomethacin administration over 8 days on pituitary GH mRNA (A)
liver IGF-I mRNA (B) and on serum concentrations of IGF-I (C) in control or in
arthritic (AA) rats. mRNAs were quantified using real-time RT-PCR as described in
material and methods and are presented as percentage of the mean value in control
group injected with vehicle. There was an interaction between the effect of
indomethacin and arthritis on liver IGF-I mRNA (F1,24 = 11, P<0.01) and on serum
concentrations of IGF-I (F1,32 = 17, P<0.01), since arthritis decreased circulating
IGF-I and its gene expression in the liver in vehicle injected rats, but not in the rats
treated with indomethacin. Values represent the mean ± SEM for n= 7-10. *P<0.05,
**P<0.01 vs. control rats injected with vehicle, º P<0.05 vs. arthritic rats injected with
vehicle.
Fig. 8. Effect of meloxicam treatment over 8 days on pituitary GH mRNA (A), liver
IGF-I mRNA (B) and on serum concentrations of IGF-I (C) in control or in arthritic
(AA) rats. mRNAs were quantified using real-time RT-PCR as described in material
and methods and are presented as percentage of the mean value in control group
injected with vehicle. There was an interaction between the effect of meloxicam and
arthritis on serum concentrations of IGF-I (F1,35 = 5, P<0.05), since arthritis
decreased serum concentration of IGF-I in the rats treated with saline but not in the
group treated with meloxicam. Values represent the mean ± SEM for n= 7-10.
Page 31 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
32
*P<0.05, **P<0.01 vs. control rats injected with vehicle, ºP<0.05 vs. arthritic rats
injected with vehicle.
Fig. 9. Weight of gastrocnemius, heart, kidney and pituitary of arthritic rats injected
with vehicle (AA-vehicle) or meloxicam (AA-meloxicam, 1 mg/kg sc). Data are
expressed as percentage of the weight of the control rats injected with vehicle, for 10
rats per group. **P<0.01 vs. control rats injected with vehicle, ºº P<0.01 vs. arthritic
rats injected with saline.
Fig. 10. Effect of meloxicam administration on IGF-I (upper panel) or IGFBP-5 mRNA
(lower panel) in the gastrocnemius of control or arthritic (AA) rats. mRNAs were
quantified using real-time RT-PCR as described in material and methods and are
presented as percentage of the mean value in control group injected with vehicle.
There was an interaction between the effect of arthritis and meloxicam on IGFBP-5
mRNA (F1,33 = 7.2, P<0.05), since arthritis increased the IGFBP-5 mRNA in the
gastrocnemius of the rats injected with vehicle, but not in those injected with
meloxicam. Results are expressed as means ± SEM for n=8-10 per group; *P<0.05,
** P<0.01 vs. control rats injected with vehicle, ºº P<0.01 vs. arthritic rats injected
with vehicle.
Fig.11. MAFbx (upper panel) and MuRF1 (lower panel) mRNAs in gastrocnemius of
control and arthritic (AA) rats, injected with vehicle or 1 mg/kg meloxicam for 8 days.
MAFbx and MuRF1 mRNA were analyzed by real-time PCR, and the data were
normalized to the expression of Hprt RNA. There was an interaction between the
effects of arthritis and meloxicam administration on MAFbx (F1,32 = 25, P<0.01) and
Page 32 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
33
on MuRF1 (F1,30 = 8, P<0.01) gene expression in the gastrocnemius, since arthritis
increased both mRNAs in vehicle but not in meloxicam treated rats. Results
represent means ± SEM for 7-10 rats per group. ** P<0.01 * P<0.05 vs. control rats
injected with vehicle, ºº P<0.01, º P<0.05 vs. arthritic rats injected with vehicle.
Fig. 12 Effect of meloxicam administration (1 mg/kg for 8 days) on TNF-α mRNA in
control and arthritic (AA) rats. mRNAs were quantified using real-time PCR as
described in material and methods and are presented as percentage of the mean
value in control group injected with vehicle. There was an interaction between the
effect of arthritis and meloxicam on TNF-α mRNA (F1,30 = 5, P<0.05), since
meloxicam decreased TNF-α in arthritic rats, whereas it had no effect in control rats.
Results represent means ± SEM for 8-9 rats per group. ** P<0.01 vs. control rats
injected with vehicle, ºº P<0.01 vs. arthritic rats injected with vehicle.
Page 33 of 46
COX-2, IGF-I axis and muscular wasting in arthritis
34
Table I. Primers for real-time PCR
Gene Forward Primer (5' to 3') Reverse Primer (5' to 3') Product bp
GH TCTGCTTCTCAGAGACCATCC GCGAAGCAATTCCATGTCA 77
IGF-I
GCTATGGCTCCAGCATTCG TCCGGAAGCAACACTCATCC 62
IGFBP-5
GGCGAGCAAACCAAGATAGA GGTCTCCTCAGCCATCTCG 75
COX-2
TACAAGCAGTGGCAAAGGCC CAGTATTGAGGAGAACAGATGGG 303
TNF GCCACCAGCTCTTCTGTCT GTCTGGGCCATGGAACTGAT 100
MAFbx GAACAGCAAAACCAAAACTCAGTA GCTCCTTAGTACTCCCTTTGTGAA 74
MuRF1 TGTCTGGAGGTCGTTTCCG ATGCCGGTCCATGATCACTT 58
HPRT CTCATGGACTGATTATGGACAGGAC GCAGGTCAGCAAAGAACTTATAGCC 122
Page 34 of 46
Page 35 of 46
Page 36 of 46
Page 37 of 46
Page 38 of 46
Page 39 of 46
Page 40 of 46
Page 41 of 46
Page 42 of 46
Page 43 of 46
Page 44 of 46
Page 45 of 46
Page 46 of 46