The yeast RME1 gene encodes a putative zinc finger protein ...genesdev.cshlp.org/content/5/11/1982.full.pdf1982/05/11 · The yeast RME1 gene encodes a putative zinc finger protein

The yeast RME1 gene encodes a putative zinc finger protein that is directly repressed by a l Peter A. Covitz , ~ Ira Herskowi tz , 2 and Aaron P. Mitche l l 1'3

1Institute of Cancer Research and Department of Microbiology, Columbia University, New York, New York 10032 USA; 2Department of Biochemistry and Biophysics, University of California, San Francisco, California 94143 USA

In the yeast $accharomyces cerevisiae, a/cx cells can enter meiosis whereas a and ~ cells cannot. The ahx cell type is determined by presence of a repressor, al-~2. Previous studies indicate that a/a cells lack an inhibitor of meiosis, the RME1 gene product, and that a and o~ cells express RME1. We report here the sequence of RME1 and functional analysis of its regulatory and coding regions. The 5'-region of RME1 includes a sequence resembling al-ot2 repression sites. Deletion of this site at RME1 relieves repression by al-o~2, and insertion of the site into a heterologous regulatory region (CYC1) confers weak repression in ahx cells. These observations indicate that RME1 is directly repressed by al-~2. The RME1 product has three regions that resemble C2H2 zinc fingers, which are characteristic of a class of nucleic-acid-binding proteins. Substitution of serine for cysteine in each of the putative fingers abolishes RME1 function; serine substitutions in the second and third putative fingers do not affect RME1 stability. These findings indicate that at least two putative zinc fingers are critical for RME1 structure or activity. Therefore RME1, which is formally a negative regulator of the meiotic gene IME1, may act directly as a repressor.

[Key Words: Yeast; meiosis; RME1 gene; al-s2; zinc finger protein]

Received July 10, 1991; revised version accepted August 19, 1991.

The two fundamental transitions in the yeast life cycle, mating and meiosis, depend on the unique properties of a, s, and a/s cells, a and s cells, which are typically haploid, are able to mate with each other to produce an a/s diploid cell (for review, see Cross et al. 1988; Fields 1990). a/s cells go through meiosis as part of a spomlation process; their meiotic spores germinate to yield a and s cells {for review, see Esposito and Klapholz 1981; Malone 1990; Kassir and Simchen 1991). a/(x cells are induced to spomlate by starvation; a and s cells become arrested in the cell cycle G 1 phase by starvation but do not initiate meiosis.

Cell type is determined by alleles of the mating type locus (MAT~: a cells have a MATa allele; s cells have a M A T s allele; a/s cells have both alleles. The properties of a/s cells depend on one MATa product, al, and one M A T s product, ~2, which are subunits of a repressor called al-~2 (Goutte and Johnson 1988; Dranginis 1990). al-s2 determines a/s cell properties by blocking expression of haploid-specific genes (for review, see Herskowitz 19891.

Two pathways that govern meiosis relay cell-type information. One pathway involves RME1 {regulator of meiosis), a haploid-specific gene that specifies a negative regulator of meiosis (Kassir and Simchen 1976; Rine et

aCorresponding author.

al. 1981; Mitchell and Herskowitz 1986). A second pathway, which is independent of RME1, is altered by a dom- inant mutation, RESI-1 (Kao et al. 1990).

Three candidate RME1 target genes have been identi- fied by dosage-suppression screens: increased dosage of the genes MCK1, IME1, or IME2 permits cells that express RME1 to enter meiosis (Kassir et al. 1988; Smith and Mitchell 1989; Neigeborn and Mitchell 19911. These genes lie in a cascade: MCK1, a protein kinase, is a positive regulator of IME1 expression (Neigebom and Mitchell 1991); IME1 is a positive regulator of IME2 expression [Smith and Mitchell 1989; Yoshida et al. 19901. Ultimately, IME1 and IME2 are positive regulators of several meiotic genes {Engebrecht and Roeder 1990; Mitchell et al. 1990; Smith et al. 1990). Epistasis and gene expression studies argue that RME1 acts upstream of IME1, and upstream or independently of MCK1, to inhibit meiosis (Kassir et al. 1988; Neigeborn and Mitch- ell 19911.

One key question in control of meiosis is how RME1 transmits cell-type information to govern expression of meiotic regulatory genes. Specifically, how is RME1 repressed in a/s cells, and what is the mechanism of RME1 action? We report here the sequence of the RME1 gene and functional analysis of its regulatory and coding regions. We have found an al-ot2 repression site in the RMEI upstream region. This observation suggests that

1982 GENES & DEVELOPMENT 5:1982-1989 �9 1991 by Cold Spring Harbor Laboratory ISSN 0890-9369/91 $3.00

Cold Spring Harbor Laboratory Press on June 20, 2021 - Published by genesdev.cshlp.orgDownloaded from

http://genesdev.cshlp.org/http://www.cshlpress.com

Meiotic control by yeast zinc finger protein homolog

al-c~2 may repress RME1 expression directly. The RME1 product has three regions similar to C2H2 zinc fingers, a motif found in many nucleic acid-binding proteins. Therefore, RME1 may act as a transcriptional repressor, for example, of IME1 expression.

Results

We have determined the nucleotide sequence of a 2833- bp fragment that complements an rmel mutation when carried on a low-copy plasmid, YCp50. The fragment has a single large open reading frame (ORF; Fig. 1). The ORF is oriented in the same direction as RME1 RNA and is interrupted at codon 119 by a previously described rmel ::LEU2 insertion mutation (Mitchell and Herskow- itz 1986). Those observations, together with studies in this paper, confirm that this ORF specifies the RME1 product.

Analysis of RME1 regulatory sequences

RME1 RNA levels are 20-fold higher in a and c~ cells than in a/~ cells during vegetative growth (Mitchell and Her- skowitz 1986). HO and MATc~I display a similar expression pattern; these genes are repressed in a/R cells through binding of a l-~2 to upstream operator sites (Goutte and Johnson 1988; Dranginis 1990). The RME1 sequence has two sites that resemble al-e*2 repression sites (ATGTNNNNNNNTACATCA; Siliciano and Tatchell 1984; Miller et al. 1985; Goutte and Johnson 1988). These sites l i e a t - 4 0 4 to - 3 8 7 (ATGTCACA- GATTACATCA) and -165 to - 1 4 7 (ATTTATATC- TAGATCA}. We examined the consequences of deletion of each site on expression of a plasmid-borne rmel-lacZ fusion gene (Table 1). The fusion with an intact upstream region was expressed at similar levels in diploids lacking al or R2 (al-/c~ and a/e*2- strains, respectively) and at 10-fold lower levels in a/~ diploids. Deletion of - 181 to - 130 or - 181 to - 113, which removed the - 165/ - 147 site, caused 5- to 10-fold lower rmel-lacZ expression regardless of cell type. In addition, an XbaI restriction site fill-in mutation at - 154 had no effect on repression of rmel-lacZ in a/c~ cells (data not shown). Thus we have no evidence for a role of the - 165/ - 147 site in repression. Deletion of - 4 3 0 to -369, which removed the - 4 0 4 / - 3 8 7 site, caused sixfold elevated rmel-lacZ expression in the a/e* diploid but had little effect in non-a/a diploids. These results indicate that sequences between - 4 3 0 and -369 are necessary for repression of RME1 in a/~ cells.

We tested the effects of insertion of each site between the upstream region and TATA boxes of the heterologous CYC1 promoter. The parent cycl-lacZ gene was expressed at the same level in a/e*, a l-/e*, and a/c~2- diploids (Table 2). A synthetic - 165/ - 147 site inhibited expression of the cycl-lacZ fusion in all three diploids. This observation further argues that the - 165/ - 147 sequence is not an al-~2 site. Presence of a single - 404 / -387 site in either orientation conferred 2- to 3-fold repression in a/R cells; presence of two sites conferred 14-

to 19-fold repression in a/~ cells. We conclude that the - 4 0 4 / - 3 8 7 site is a weak al-~2 repression site.

Analysis of the RME1 product

The deduced RME1 product is a 300-amino acid polypeptide (33,882 daltons). Three regions similar to C2H2 zinc fingers lie at positions 178-199, 206-234, and 256-281 (Fig. 2). To facilitate functional analysis of these regions, we developed a system to express RME1 independently of cell-type control and to detect the product through an appended epitope.

The RME1 coding region was placed downstream of the GALl promoter to permit its expression in a/e* cells. We compared the effects of PGAL1-RME1 in gal80 mu- tants, which express the GALl promoter at high levels, and in GAL80 + strains, which express the GALl promoter weakly under our growth conditions (Torchia et al. 1984; Smith et al. 1990). PGALI-RME1 blocked sporulation of a/a gal80/gal80 mutant diploids [0.7% (Table 3, line 1 )], but not of a/e, GAL80 +/gal80 diploids [81% (line 2)]. These results confirm that expression of the RME1 ORF inhibits meiosis.

The PCAL~-RME10RF was modified by addition of an amino-terminal epitope to permit immunological detec- tion of the polypeptide (Field et al. 1988; Kolodziej and Young 1991). We employed the short $53 epitope from the guinea pig myelin-basic protein (Day et al. 1987). Anti-S53 antiserum cross-reacted with several yeast proteins in strains that lack the S53-RME1 hybrid gene (Fig. 3, lane 1). Only one immunologically reactive protein was dependent on PGAL1--S53--RME1 (cf. lanes 7 and 6) and on absence of GAL80 function (cf. lanes 7 and 2). The estimated size of the protein (34,000 daltons) is close to the predicted mass of S53-RME1 (34,796 daltons). We concluded that this protein is S53-RME1.

We tested the activity and specificity of S53-RME1 through assays of IME1 RNA accumulation, ime2-1acZ expression, and sporulation. In the control a/e* strain, IME1 RNA was present at low levels during vegetative growth and induced by starvation (Fig. 4, lanes 1-3). Ex- pression of PGAL1-S53-RME1 reduced IME1 RNA levels under vegetative and starvation conditions (lanes 4--6). Presence of a wild-type GAL80 allele restored normal IME1 expression (lanes 7-9). Similarly, irne2-1acZ expression and sporulation were induced by starvation in a/a GAL80/gal80 strains but not in a/e* gal80/gal80 strains that carried P~AL1--S53--RME1 (Table 3, cf. lines 4 and 3). Expression of IME1 from the GALl promoter overcame inhibition of ime2-1acZ expression and of sporulation by P~AL1-S53-RME1 (Table 3, cf. lines 5 and 6). S53-RME1 thus inhibits ime2-1acZ expression and sporulation through inhibition of IME1 expression. We conclude that S53-RME1 has the biological properties expected of a functional RME1 derivative.

We examined functional activity of S53-RME1 missense products with defects in either the first, second, or third putative zinc finger. The mutations create serine substitutions for cysteines at residues 183, 213, and 263. We refer to these alleles as PcAL1-S53-rmel-183, PGALI--

GENES & DEVELOPMENT 1983



Covi tz et al.

-1197

ATCA•TGCCTTTAGTAATTcCCTCGATGTAGTGATTCGGCCTTTCGTTAATAGTTccAT•GGGGATAATGcCAGCATCATCTATGGAAcTTCTCCCCTCCTTTATTTGAGTACTCAGAAG -1077 �9 . . . . . . . .

CCTATTAAACATGcTTACGTTCGTTGAATGGCATTTCAGCAGAAAcCGTAGACCATTTTcAGAAACTcGTAA•ATAACTT•AGGATATATCAAAGTAAAAAG•AGcTCcTATTAATT•AA -957 . . . . . . . . .

ATTATTAGCTCAATCCTATAGCAACGTTTCTCAAGTTTAATTGTTTTGAAGGTTTTAGAACCTTTTTCACATTATTTAGTCCGTCGAAACATCTACTCTTTACTATTTATGGCTAAACAG

-837 . . . . . . . . �9

GcTGAAGGGTATGATTTCTTTTCTTTTCTTTATTCATGTCGGGTAAGAGAAGGTCACTTGACCTATGATGTGGGGGCAAATAATAACGTGGGAATAACAAGCGCGCTACTGGTAAGTGAA

-717

AAACTAAGATAACAGTTGAATTTCGTGTTTAGATGCTATAGAGAGTCTGGTAcAGCATTGGCGATTTAAGACTTCTCTAGTCCACATTT•TTAAATTCAAAATCACAAGCG••TGTTAAC -597

GATCATTTTATAATCTACGATGTGTAAATGCAAAAAGTGCTTTCCTCC•T•TTTAGTTTGGACAGGGATAGTGGGTAAACGAGTAGCATTATGAGTGCATACATTGCCAGAAAGAAA•CG -477

�9 �9 . . I l l l l l l l l l l l l l l

C ~ G C G G C A T A T C T T T T T T C T T C T T T C T G T T G T A A G G G A T G C T T C G T C A C G T ~ T G G C C G C C G G A G T G A G A T G T C A C A G A T T A C A T C ~ G G T C G G C G T A T A C T G G A T ~ G A ~ T

- 3 5 7 �9 �9 . . . . . . �9

c C G A A C T T T T C C G G T G G G C T T T A C C A G c A G ~ G T G G C C G G G C A T G T A T T ~ T A T A T C A C C G T A T T T T C T G C T G G C T T T T T C T T A T G C A G A G A A C ; ~ G G C C A G AGTGCCTTCGAGGA

-237 . . . . . . . . . .

AATTAAAGGGAGCAATGTGATAGATATGTCCTGTGTCATTTGcTTCAATTTTT•CTGCCATTTATTTGTAGTTATATTTATATCTAGATCAACCGAAACTATACCAACGACGAAGCTGCT

-117 �9 . . . . . . . �9

TCTTAGTAAATATATTTTCTA~TGTGTCAACGCATTGGAACTGACATTGTTCTTATCCTATAAGTCATACAGTTGAATTTGTTAATTCTTTACTAGAAGTTGGGATTTTCAGCACTTATG M 1

4 �9 o TCACC GTGT T ATGGA C AAAACAGTG CCATCGCCAAGGGG TCTTGGAACAGAGAGG TTTTACAAGA G GT GCAAC C GAT TTAT C ATT GG C ACGAT T T CGGG C AJ%AACATGAAAGAAT AT T C G

S P C Y G Q N S A I A K G S W N R E V L Q E V Q F I Y H W H D F G Q N M K E Y S 41

124 �9

GCATCACCCTTAGAGGGGGATTCCAGCCTGCCTTCcAGCCTGCCTTCCAGCACTGAGGACTGTTTACTACTATCATTAGAAAACACAATCACAGTTATAGCCGGAAATCAGAGACAGGCT

A S P L E G D S S L P S S L P S S T E D C L L L 5 L E N T I T V I A G N Q R Q A 81

244

TATGACTcTAcGT~GTCTAcTGAGGAAGGTACAGCACCTCAATTACGGCCGGATGAAATAGCGGACAGTACACACTGTATCACGTcATTAGTTGATCCGGAGTTCAGAGATcTTATTAAT Y D S T S S T E E G T A P Q L R P D E I A D S T H C I T S L V D P E F R D L I N 121

364 �9

TATGGACGTCAAAAAGGAGCAAATCCTGTATTTATTGAGAGCAATACAACAGAACAATCCCATTCACAGTGTATTCTAGGCTATCCCCAAAAATCGCACGTGGCACAGCTATATCACGAC

Y G R Q K G A N P V F I E S N T T E Q S H S Q C I L G Y E Q K S H V A Q L Y H D 161

484 .

CCCAAAGTACTCAGCACAATTTCCGAAGGGCAAACAAAAAGAGGAAGTTACCACTGTTCTCATTGTTCTGAAAAGTTCGCAACGTTAGTTGAGTTTGCCGCGCA~TTAGACGAATTCAAC

P K V L S T I S E G Q T K R G S Y H C S H c S E K F A T L V E F A A H L D E F N 201

604

CTTGAAAGACCGTGTAAGTGTCCCATAGAGCAATGTCCCTGGAAAATATTGGGTTTCCAACAAGCAACTGGTCTGAGAAGACATTGTGCTTCCCAACATATAGGAGAGCTTGATATAGAG

L E R F C K C P I E O C P W K I L G F O O A T G L R R H C A S O H I G E L D I E 241 ,

724 �9 . .

ATGGAGAAATCATTAAATCTAAAAGTAGAAAAATATCCAGGACTGAATTGCCCATTTCCTATCTGTCAGA~ACGTTTAGGCGCAAAGACGCCTATAAGAGACATGTGGCCATGGTGCAT

M E K S L N L K V E K Y P G L N C F ~ ~ I C Q K T F R R K D A Y K R H V A M V H 281 ,

844

AACAACGCTGATTCAAGATTTAACAAGCGTTTGAAGAAAATTTTGAACAATACCAAATAGTTGAGGCATT~TGTACCCCATGAAACTCTTGTTAAATTTGTGCAGGCATGAAAGCT

N N A D S R F N K R L K K I L N N T K 300

964 �9 . .

ACTGTATTTTTTCTTA~KAGTAATAAAAATAAAACACAATGATATTAAAGAAAACGCATGCAACTATGGACACTTGCTATGTCGTGAATATGGCACCACGTTGGTTACTTAGCTAAATAAA

1084 . . . . . . . . . . .

AAAT•GTAAGTACT•GCATTTTTTCTTCTATATTCACTTTGCTTCTTTGGACAGTTATTTCAATAATAAATATTTCTTTTTTTCTAAT•TCCCTTATCACCTAAGAGGAAAAAGTTTGAA 1204 . . . . . . . . . . .

AATAAACTTATGG•TAGAGGTTATTTGGTATTCCGAGAAAACATTTGAAACTAGGAAGTTTACATATCAGTGCAATTATGTTTCCTTCGATGATTCACGTACCCTCAAAGTCAGTACCAT

1324 . . . . . . . . . . .

AAAATTGAAAATAAGACAGGTGTTTTTTTTTTTTTTTTAATCATACAAGAATTCAACCACTTAAGTAGGATATTAGCGCTTCTTGTGCCGAAAGTCTCGTAATTTCCAATTTATATGTTT

1444 . . . . . . . . . . .

TTTAGTTGCATCGCCCTGGTTCCACAAACCGTATTTACGAACCCTCTAGGTAATAGTATCTTTGGCAGTTCTTTTCCAGCTAAGATTTTTATGTTCTCACGTTGGCGGTTATTTTTCTAA

1564 1636 . . . . . .

ATACCCTCAATGAA~CTCACATCGCACGCACATTTCCTGAAAATATCTTTGAGAAATATAGCAATCCTCGA

Figure 1. RME1 nucleotide sequence. The nucleotide sequence of the RMEl-coding strand and deduced protein sequence are shown. A solid bar appears over a functional a l-~2 repression site (nucleotides -404 and -387); a broken line appears over a URS-like sequence (nucleotides -421 to -409). Underlining refers to three regions of the deduced polypeptide that resemble zinc fingers. Asterisks (*) are placed under cysteine residues 183, 213, and 263, the sites of serine substitutions.

S53-rmel-213 and PGAL1--S53--rmel-263, respectively. These altered residues correspond to the second cysteine of each putative zinc finger; analogous zinc finger mutations inactivate Drosophila Kriippel, Aspergillus brlA, and SV40 T antigen (Redemann et al. 1988; Loeber et al. 1989; Adams et al. 1990). Each mutat ion inactivated

RME 1, as indicated by failure of the mutant products to inhibit ime2-1acZ expression and sporulation (Table 3, cf. l ines 7, 9, and 11 and 8, 10, and 12). Therefore, cysteines 183, 213, and 213 are essential for S53-RME1 function.

Missense mutations may lead to defects through direct

1984 GENES & DEVELOPMENT




Table 1. Effects of upstream deletions on rmel-lacZ expression

rmel-lacZ expression (Miller units) a

rmel-lacZ upstream region b a/a al - /a a/a2-

Wild type 0.18 2.0 2.2 (-1197to -1)

Deletion 0.038 0.15 0.25 (- 181 to - 130)

Deletion 0.033 0.19 0.24 (-181 to -113)

Deletion 1.1 1.8 1.8 (-430 to -369)

aPlasmids were carried in strains 1788 (a/c~), 1789 (al-/ct), and 1791 (a/~2-), grown in SC-uracil medium. brmel-lacZ fusions were carried on low copy, YCp50-based plasmids.

Table 2. Effects of al-a2 sites derived from RME1 on cycl-lacZ expression

cycl-lacZ expression (Miller units) a

cycl-lacZ plasmid insert b a/a al - /a a/a2-

None 220 186 198 - 1 6 6 / - 147 122 57 61 - 1 4 7 / - 166 74 36 50 -406/ -387 61 129 171 -387/ -406 50 127 148

(-406/-387) (-406/-387) 7 99 136 ( '406/-387) (-387/-406} 8 116 141

aplasmids were carried in strains 1788 (a/a), 1789 (al-/a), and 1791 (a/c~2-), grown in SC-uracil medium. bDouble-stranded oligonucleotides were inserted into the SalI site of muhicopy plasmid pLGA312S. Inserts are designated by coordinates of corresponding RME1 upstream sequences to indicate orientation relative to the cycl-lacZ-coding region.

effects on protein funct ion or for other reasons such as effects on protein stability. To dist inguish among these possibilities, we est imated steady-state levels of the S53-rmel mutan t products on immunoblo ts (Fig. 3). Mutant S53-rme1-213 and -263 products accumulated to the same level as the S53-RME1 + product in vegetative cells (Fig. 3, lanes 7, 9, and 10) and after 4 hr in sporulation m e d i u m (data not shown). The mutan t S53-rmel- 183 product was present at lower levels than the S53- RME1 + product (Fig. 3, lane 8). In addition, S53-rmel- 183 migrated more slowly than S53-RME1 + in SDS gels, perhaps due to differences in SDS binding or in dena- tured polypeptide conformations. Identical results were obtained wi th a second set of PcaLl - rme l transfor- mants. Thus a serine subst i tut ion for cysteine-183 re- duces levels of the product. Because serine substi tutions for cysteines at positions 213 and 263 do not alter product levels, these substi tut ions mus t cause defects in RME1 structure or activity.

D i s c u s s i o n

One of the ma in questions in understanding regulation of meiosis in yeast is how cell-type signals control meiotic gene expression. Several studies suggest that expression of early meiot ic genes is restricted to a/e~ cells because IME1, an activator of meiosis, is induced by starvation only in a/a cells (Kassir et al. 1988; Mitchel l et al. 1990; Smith et al. 1990). Prior studies have shown that

RME1 is regulated by cell-type signals (Mitchell and Her- skowitz 1986), that RME1 expression t ransmits cell-type signals (Kassir and Simchen 1976; Rine et al. 1981 Mitchel l and Herskowitz 1986), and that RME1 acts upstream of IME1 (Kassir et al. 1988; Smith and Mitchel l 1989). However, the mechan isms involved in regulation of and by RME 1 have been unclear. Findings in this paper speak to these mechanis t ic issues.

Our results argue strongly that repression of RME1 by al-~2 is direct. The interval between - 4 3 0 and - 3 6 9 is essential for repression of RME1 in a/a cells. This interval includes a site that contains the bases shared among functional a l-~2 repression sites (Siliciano and Tatchell 1984; Miller et al. 1985; Goutte and Johnson 1988). The site derived from RME1 is clearly functional, because its insertion into the CYC1 promoter conferred repression in a/e~ cells. In addition, in vitro competi t ion assays indicate that al-e~2 binds to the site derived from RME1 (Goutte and Johnson 1988). These observations indicate that al-e~2 represses RME1 through binding at this upstream site.

Although al-~2 may repress RME1 directly, we believe that al-c~2 does not act alone. A site homologous to the CAR1 upstream repression site (URS) lies at position - 4 2 1 / - 4 0 9 : ATGGCCGCCGGAG (with matches to CAR1 underlined; Luche et al. 1990). Similar sites have been found upstream of many yeast genes, including several early meiotic genes (Buckingham et al. 1990). A1-

Consensus: (Tvr, Phe)

RME1178-199" Tvr

RMEI206-234: Cys

RMEI256-281: Leu

x r x2_ 4 r x 3 P.ha x 5 ~eu x 2 His X3, 4 His

HIs ~ Ser His Cvs Ser Glu Lys PheAla Thr Leu Val Glu Phe Ala Ala His Leu Asp Glu

Lys ~y_~Pro Ile GIu Gln ~ Pro Trp Lys Ile Leu Gly Phe Gln Gln Ala Thr GlyLeu Arg Arg His Cys Ala Set Gln His

Ash ~.3L~Pro Phe Pro Ile ~ Gln Lys Thr Phe Arg Arg Lys Asp Ala Tyr Lys Arg His Val Ala Met Val His

Figure 2. Comparison of zinc finger-like segments of RME 1. The top line shows consensus residues and spacing for a C2H2 zinc finger (Berg 1990}. Zinc finger-like segments of RME1 are displayed below the consensus, with common amino acids underlined.




Covitz et al.

Table 3. Functional activity of PGAL~-RME1 and its derivatives

GALl-promoter fusion

ime2-1acZ expression (Miller units) a

Gal80 veg spo Sporulation (%) Strain b

RME1 - 0.8 2.7 0.7 934 x 942 RMEI + 4.2 368 81 934 x 943 S53-RME1 - 1.0 3.3 0.7 935 x 942 S53-RME1 + 7.1 367 88 935 x 943 IME1 - 50 203 85 1046 x 1008 S53-RME1 and IME1 - 28 264 88 1047 x 1008 S53-rmel-183 - 0.9 282 66 936 x 942 S53--rmel-183 + 9.7 363 77 936 x 943 S53-rmel-213 - 5.6 267 64 937 x 942 S53--rmel-213 + 7.5 422 75 937 x 943 S53--rmel-263 - 1.1 302 69 938 x 942 S53--rmel-263 + 3.7 359 78 938 x 943

af3-Galactosidase levels were measured during log-phase growth in YEP acetate {veg) and 8 hr after a shift to sporulation medium {spo). bStrains were all a/or diploids, homozygous for a deletion of the natural RME1 gene, carrying PCAL1-RME1 or derivatives integrated at the URA3 locus or PCALI-IME1 at the IME1 locus, as indicated in the first column.

though we have not demonstrated functional activity of the RME1 URS-like site, its existence explains why mutations in SIN3 (also called UME4 or RPD1 ), which cause elevated expression of several URS-containing genes (Stemberg et al. 1987; Strich et al. 1989), lead to elevated expression of RME1 (M. Vidal, R. Strich, R.E. Esposito, and R.F. Garber, in prep.). The presence of a second negative regulatory site at RME1 (in addition to the al-ot2 site] also explains why r m e l - l a c Z is repressed 10-fold in a/oL cells, whereas cyc l - lacZ containing the a l -a2 site derived from RME1 is repressed only 2- to 3-fold in a /a cells. Thus, repression of RME1 in a/or cells may require al-et2 bound the - 4 0 4 / - 387 site and a second repressor bound at the - 4 2 1 / - 4 0 9 URS-like site.

The deduced RME1 protein has three regions that are similar to C2Ha zinc fingers {Berg 1990). C2H2 zinc finger consensus residues include two cysteine and two histidine residues which, together, coordinate a zinc cation, and an aromatic and two hydrophobic residues that sta- bilize the zinc-binding pocket. None of the putative RME1 zinc fingers matches this consensus sequence pre- cisely (Fig. 2). The 178-199 segment lacks the second histidine residue. However, glutamate side chains assist in binding zinc in many metalloproteases {Vallee and Auld 1990); a glutamate at position 199 in RME1 may fulfill a similar role. The 206-234 segment has the four zinc-binding residues but lacks the first hydrophobic residue. In addition, the number of residues within the segment exceeds the zinc-finger consensus. The 256-281 segment contains all zinc-binding residues, but positions of the aromatic residue and leucine are reversed. These comparisons raise the possibility that RME1 contains two or three zinc fingers. However, RME1 has six cysteines and eight histidines outside of the consensus zinc- finger positions; these residues may permit an unusual metal-binding structure to form.

Our muta t ional analysis has shown that at least one cysteine of each zinc finger-like segment is essential for

RME1 function: subst i tut ion of serine at position 183, 213, or 263 abolishes biological activity. Accumula t ion of RME 1 is reduced severalfold by a serine-183 substitution, perhaps due to decreased stability. This result gives no clear indication conceming the natural role of cysteine-183. Accumulat ion of RME1 is unaffected by serine-213 and serine-263 substitutions. Therefore, the natural cysteines at 213 and 263 mus t play a more direct role in RME1 structure or activity. The conclusion that RME 1 function depends on integrity of at least two zinc finger-like regions raises the possibility that RME1

Figure 3. Immunoblot analysis of PGAL1--S53--RMEI polypep- tides. An immunoblot of YEP acetate-grown cell extracts was stained with rabbit anti-S53 antiserum. Strains (listed in Table 1) carried integrated plasmids bearing PcAL1-RME1 (lanes 1,6),PcAL1-S53--RME1 (lanes 2,7), PGAL1-S53-RMEl-183 (lanes 3,8), PcArl-S53--rmel-213 (lanes 4,9), or PcAL1-S53--rmel-263 (lanes 5,10) and were either GAL80/gal80 (lanes 1-5) or gal80/ gal80 (lanes 6-10). Mobilities of molecular weight markers are indicated at left.





Figure 4. Effect of PGAL1--S53--RME1 expression on IME1 RNA levels. RNA was prepared from a/c~ diploids after growth in YEP acetate (0 hr) and at 2 and 4 hr after transfer to sporulation medium, as indicated below each lane. A single Northern filter was probed for IME1 RNA and stripped and probed with the control probe pC4. Strains were 1041 x 1042 (lanes 1-3), 935 x 942 (lanes 4--6), and 935 x 943 (lanes 7-9).

blocks expression of a target gene, such as IME1, by acting as a transcriptional repressor.

Materials and methods

Yeast strains and genetic me thods

Isogenic sets of strains (Table 4) were constructed by standard methods of transformation, mating, sporulation, and mutagenesis. The rme1-5::LE U2 and PaAL~-RME1 markers are described below. Other markers have been described previously {Torchia et al. 1984; Mitchell and Herskowitz 1986; Alani et al. 1987; Smith et al. 1990; Neigeborn and Mitchell 1991).

RME1 deletion constructions

Four sets of deletions were constructed from plasmid pAM240 (Fig. S), which carries RME1 on a 3-kb Sau3AI-BglII fragment in the pBR322 BamHI site. Set I deletions were created by Bal31 digestion from the HindIII site, cleavage with XhoI, and ligation into SaIL and Sinai-digested M13mpl9. Set II deletions were created by Bal31 digestion from the BglII site and ligation with BamHI linkers (CGGATCCG). Set III deletions were created by Bal31 digestion from the HpaI site and ligation with BamHI linkers. Set IV deletions were created by Bal31 digestion from the XhoI site, cleavage with BglII, and ligation into BamHI- and Sinai-digested M13mp 19.

rmel-5::LEU2 construction

The rmel-5::LEU2 deletion, which contains a 2.2-kb LEU2 XhoI-SalI fragment (Rose and Broach 1991) in place of RME1 nucleotides - 181 to + 1018, was constructed by combining set I and II RME1 deletions, rmel-5::LEU2 was placed in the ge- nome through transformation with HindIII- and XhoI-digested pAM2S1 (Fig. 5).

rmel-lacZ plasmi d constructions

The lacZ gene of plasmid pMC1871 (Casadaban et al. 1983) was excised with BamHI and inserted into the pAM240 BglII site.

The resulting r m e l - l a c Z fusion was transferred to plasmid YCpSO as a HindIII-SalI fragment, making plasmid pAM247. r m e l - l a c Z fusion plasmids carrying 5'-deletions were constructed by combining set II and III pAM240 deletion fragments.

cyc 1-1acZ plasmid constructions

All c y c l - l a c Z plasmids were derived from plasmid pLGA312S (Guarente and Mason 1983). Double-stranded, phosphorylated oligonucleotides corresponding to the upstream and downstream a 1-c~2 candidate sites were ligated into the unique plasmid SalI site. Oligonucleotides representing the upstream al-c~2 candidate site were 5'-TCGAGATGTCACAGATTACAT- CAAAAAG-3' and 5'-TCGACTTTTTGATGTAATCTGTGA- CATC-3'. Oligonucleotides representing the downstream al-a2 candidate site were 5'-TCGAGTTATATTTATATCTAGATCA- 3' and 5'-TCGACGGTTGATCTAGATATAAATATAAC-3'. Constructions were analyzed by dideoxy sequencing.

POAL~-RME1 construction

A BamHI site that lies 61 nucleotides downstream of the GALl RNA start site was fused to a natural XbaI site that lies 154-bp upstream of the RMEI initiation codon (Fig. 5, plasmid pAC20). The RMEI-coding region was isolated on an XbaI-XhoI restriction fragment from plasmid pAM240, prepared from d a m - Escherichia coli strain NK7420. This fragment was inserted be-

Table 4. Yeast strains

Strain Genotype

SKI derivatives a

235 934

935

936

937

938

942 943

1008 1040 1041 1042 1046 1047

1266-3A 1266-3D 1788

1789

1791

a rmel-5::LEU2 ime2-4--lacZ::LEU2 ura3::PGALZ-- RME1 :: URA3

a rmel-5::LEU2 ime2-4-1acZ::LEU2 ura3::PcAL1-- S53-RME1 :: URA3

a rmel-5::LEU2 ime2-4-1acZ::LEU2 ura3::PGaL~-- S53-rme1-183: : URA3

a rmel-5::LEU2 ime2-4--lacZ::LEU2 ura3::PGALZ-- S53-rme1-213: : URA3

a rmel-5::LEU2 ime2-4--lacZ::LEU2 ura3::PcAL~-- S53-rme1-263: : URA3

oL rmel-5::LEU2 TRP1 LEU2 b c~ rmel-5::LEU2 TRP1 LEU2 b GAL80 c, arg6 IMEI-14::TRP1

rmel-5::LE U2 a rmel-5::LEU2 TRP1 his3 LEU2 b

rmel-5::LEU2 ime2-4-1acZ::LEU2 a ime2-4-1acZ::LEU2 TRP1 his3 LEU2 b a ime2-4-1acZ::LEU2 TRP1 his3 LEU2 b ura3::

PCAL1--S53--RME1 :: URA3

EG123 derivatives

c~ ura3 leu2 trpl canl his4 a ura3 leu2 trpl canl his4 a/c~ ura3/ura3 leu2/leu2 t rp l / t rp l can l / can l his4~

his4 a 1 - / ~ ura3/ura3 leu2/leu2 t rp l / t rp l can 1/can 1

his4/his4 a/e~2- ura3/ura3 leu2/leu2 t rp l / t rp l can l / can l

his4/his4

aAll SK1 derivatives have additional markers ura3 leu2 trpl lys2 ho::LYS2 gal80::LEU2, except as indicated. bStrain may have wild-type or mutant LEU2 locus.




Covitz et al.

(A)

Hi (BaYSa)

lkb v

"'"'

Hp Xb Ea Bg RI Sp RI Xh (Bg/Ba) SI

pAM240

Figure 5. Plasmid insert restriction maps. Restriction maps are diagramed for (A) pAM240, the source of RME1 for sequencing, carried in the vector pBR322; (B) pAM251, the rm el -5::LE U2 deletion allele in plasmid YCp50; (C) pAC20, the PCAL1-- RMEI construct in plasmid pRS314; (D) pAC34, the PGALI-S53-RME1 construct in plasmid pRS314. Restriction sites are indicated for BamHI (Ba), BgllI (Bg), EagI (Ea), EcoRI (RI), HindlII (Hi), HpaI (Hp), SalI (S1), SphI (Sp), XbaI (Xb), XhoI (Xh). Hybrid Sau3AI/BamHI (Sa/Ba), BglII/BamHI (Bg/ Ba), and BamHI/XbaI (Ba/Xb) sites gener- ated by constructions are also indicated.

(B)

Hi (BaJSa)

Yopso

I I

Hp Ba Sp RI Xh (Bg/Ba) SI

(C) ~PGAL,-,O~,- ~/fl/~///A, jK , , ~\pRS314

Ea Ba RI (Ba/Xb) Ea Bg RI Sp RI SI

(D) $53

Ea Ba RI (Ba/Xb) Bg Ea Bg RI Sp RI SI

pAM251

pAC20

pAC34

tween the XbaI and SalI sites of plasmid pSPl9 (BRL), then excised using plasmid- derived BamHI and HindIII sites. These sites were rendered flush with Klenow polymerase and the fragment was ligated into flush-ended, BamHI-digested pBM272 (provided by Mark Johnston; Johnston and Davis 1984; Smith et al. 1990). The resulting plasmid was designated pAC11.

The template for oligonucleotide-directed mutagenesis, pAC20, contained the PGAL1--RME1 hybrid gene (derived by par- tial EcoRI digestion of pACll) in the EcoRI site of vector pRS314 (Sikorski and Hieter 1989), which contains an fl origin. Mutations (underlined) were introduced through hybridization with oligonucleotides RMESER183 (5'-CTGTTCTCATAGT- TCTGAAAAG-3'), RMESER213 (5'-CCCATAGAGCAAAGT- CCCTGG-3'), and RMESER263 (5'-CCCATTTCCTATCAGT- CAGAAAACG-3'). Presence of these mutations was confirmed by dideoxy sequencing. The $53 epitope (SQRSQDENG; Day et al. 1987) was inserted at the amino-terminus of RMEI through hybridization with RMES53-N (5'-GAXTFTCAGCACTTATG- TCACAAAGATCTCAAGACGAAAACGGTCCGTCTTATGG- AC-3'). PGALI--RME1 and derivatives were excised with BamHI and SalI from pRS314 and inserted into BamHI-SalI-digested YIp5 {Rose and Broach 1991). YIp5 derivatives were integrated at the URA3 locus.

Immunoblots

Cells from a 50-ml YEP acetate culture were extracted in 0.2 ml of 0.1 M Tris (pH 8), 5 mM MgC12, 5-mM ZnCI2, 50 rnM ammo- nium sulfate, 1 mM EDTA, 7 mM 13-mercaptoethanol, 10% glyc- erol, 0.2 mM PMSF, 0.5 I*g/ml of leupeptin, 0.7 ~g/ml of pep- statin A, 1 txg/ml of aprotonin by vortexing with 0.45-mm glass beads. The 150 ~g of soluble protein was analyzed on immunoblots with rabbit anti-S53 antiserum (Day et al. 1987; G. Hashim, pers. comm.) and peroxidase-conjugated goat anti-rabbit IgGs following standard procedures (Harlow and Lane 1988).

Miscellaneous

The nucleotide sequence of both strands of RME1 was determined by dideoxy sequencing from restriction sites and deletion

endpoints. Methods for B-galactosidase assays, RNA prepara- tion, Northern blots, and probes have been described previously (Smith and Mitchell 1989). Culture conditions and media reci- pes were as described previously (Smith and Mitchell 1989) for YEP acetate (rich acetate medium), sporulation medium (am- monia-free acetate medium), and S C - uracil (synthetic glucose medium lacking uracil). Sporulation ability was determined by microscopic examination of 200-500 cells after 2-5 days incu- bation on sporulation plates (Smith and Mitchell 1989).

A c k n o w l e d g m e n t s

We are grateful to Marian Carlson and members of the Mitchell laboratory for comments on this manuscript. We are indebted to George Hashim for providing anti-S53 antiserum, to Shelly Es- posito for providing unpublished information, and to Mark Goebl for conducting homology searches. Work in the Her- skowitz laboratory was supported by U.S. Public Health Service grant AI 18738 (to I.H.) and a Damon Runyon-Walter Winchell Cancer Fund postdoctoral fellowship (to A.M.). Work in the Mitchell laboratory was supported by U.S. Public Health Ser- vice grant GM 3951 and by funds from the Irma T. Hirschl Charitable Trust and the Searle Scholars Program/The Chicago Community Trust. P.A.C. was a predoctoral trainee on a Cancer Biology training grant.

The publication costs of this article were defrayed in part by payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 USC section 1734 solely to indicate this fact.

N o t e added in proof

Sequence data for RME1 has been submitted to the EMBL/Gen- Bank Data Libraries under accession number M76447.

R e f e r e n c e s

Adams, T.H., H. Deising, and W.E. Timberlake. 1990. brIA re- quires both zinc fingers to induce development. Mol. Cell. Bioi. 10: 1815-1817.





Alani, E., L. Cao, and N. Kleckner. 1987. A method for gene disruption that allows repeated use of URA3 selection in the construction of multiply disrupted yeast strains. Genetics 116: 541-545.

Berg, J.M. 1990. Zinc finger domains: hypotheses and current knowledge. Annu. Rev. Biophys. Biophys. Chem. 19: 405- 421.

Buckingham, L.E., H.-T. Wang, R.T. Elder, M.R. Slater, and R.E. Esposito. 1990. Nucleotide sequence and promoter analysis of SPO13, a meiosis-specific gene of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. 87: 9406-9410.

Casadaban, M.J., A. Martinez-Arias, S.K. Shapira, and J. Chou. 1983. Beta~galactosidase gene fusions for analysing gene expression in Escherichia coli and yeast. Methods Enzymol. 100: 293-308.

Cross, F., L.H. Hartwell, C. Jackson, and J.B. Konopka. 1988. Conjugation in Saccharomyces cerevisiae. Annu. Rev. Cell Biol. 4: 429--457.

Day, E.D., G.A. Hashim, and D.J. Ireland. 1987. The potyclonal antibody response of Lewis rats to the synthetic encephal- itagenic neuropeptide $55S (residues 72-84 of guinea pig myelin basic protein) and its analogs. I. Neurosci. Res. 18" 214-- 221.

Dranginis, A.M. 1990. Binding of yeast al and a2 as a heterodi- mer to the operator DNA of a haploid-specific gene. Nature 347: 682-685.

Engebrecht, J. and G.S. Roeder. 1990. MER1, a yeast gene re- quired for pairing and genetic recombination, is induced in meiosis. Mol. Cell. Biol. 10: 2379-2389.

Esposito, R.E. and S. Klapholz. 1981. Meiosis and ascospore development. In The molecular biology of the yeast Saccharo- myces: Life cycle and inheritance (ed. J.N. Strathern, E.W. Jones, and J.R. Broach), pp. 211-287. Cold Spring Harbor Lab- oratory, Cold Spring Harbor, New York.

Field, J., J. Nikawa, D. Broek, B. MacDonald, L. Rodgers, I.A. Wilson, R.A. Lerner, and M. Wiglet. 1988. Purification of a RAS-responsive adenylyl cyclase complex from Saccharo- myces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8: 2159-2165.

Fields, S. 1990. Pheromone response in yeast. Trends Biochem. Sci. 15: 270-273.

Goutte, C. and A.D. Johnson. 1988. al protein alters the DNA binding specificity of a2 repressor. Cell 55: 875-882.

Guarente, L. and T. Mason. 1983. Heme regulates transcription of the CYC1 gene of Saccharomyces cerevisiae via an upstream activation site. Cell 32: 1279-1286.

Harlow, E. and D. Lane. 1988. Antibodies: A laboratory man- ual. Cold Spring Harbor Laboratory Press, Cold Spring Har- bor, New York.

Herskowitz, I. 1989. A regulatory hierarchy for cell specializa- tion in yeast. Nature 342: 749-757.

Johnston, M. and R.W. Davis. 1984. Sequences that regulate the divergent GAL1-GALI O promoter in Saccharomyces cerevisiae. Mol. Cell. Biol. 4: 1440-1448.

Kao, G., J.C. Shah, and M.J. Clancy. 1990. An RMEl-independent pathway for sporulation control in Saccharomyces cerevisiae acts through IME1 transcript accumulation. Genet- ics 126: 823-835.

Kassir, Y. and G. Simchen. 1976. Regulation of mating and meiosis in yeast by the mating-type region. Genetics 82: 187- 206.

~ . 1991. Monitoring meiosis and sporulation in Saccharo- myces cerevisiae. Methods Enzymol. 194:94-110.

Kassir, Y., D. Granot, and G. Simchen. 1988. IME1, a positive regulator gene of meiosis in S. cerevisiae. Cell 52: 853-862.

Kolodziej, P.A. and R.A. Young. 1991. Epitope tagging and pro-

tein surveillance. Methods Enzymol. 194: 508-520. Loeber, G., R. Parsons, and P. Tegtmeyer. 1989. The zinc finger

region of Simian Virus 40 large T antigen. J. virol. 63: 94- 100.

Luche, R.M., R. Sumrada, and T.G. Cooper. 1990. A cis-acting element present in multiple genes serves as a repressor protein binding site for the yeast CAR1 gene. Mol. Cell. Biol. 10: 3884--3895.

Malone, R.E. 1990. Dual regulation of meiosis in yeast. Cell 61: 375-378.

Miller, A.M., V.L. MacKay, and K.A. Nasmyth. 1985. Identifi- cation and comparison of two sequence elements that confer cell-type specific transcription in yeast. Nature 314: 598- 603.

Mitchell, A.P. and I. Herskowitz. 1986. Activation of meiosis and sporulation by repression of the RME1 product in yeast. Nature 319: 738-742.

Mitchell, A.P., S.E. Driscoll, and H.E. Smith. 1990. Positive control of sporulation-specific genes by the IME1 and IME2 products in Saccharomyces cerevisiae. Mol. Cell. Biol. 10:2104-2110.

Neigeborn, L. and A.P. Mitchell. 1991. The yeast MCK1 gene encodes a protein kinase homolog that activates early meiotic gene expression. Genes & Dev. 5: 533-548.

Redemann, N., U. Gaul, and H. Jackle. 1988. Disruption of a putative cys-zinc interaction eliminates the biological activity of the Kruppel finger protein. Nature 332: 90-92.

Rine, J.D., G.F. Sprague, and I. Herskowitz. 1981. The rmel mutation of Saccharomyces cerevisiae map position and by- pass of mating type locus control of sporulation. Mol. Cell. Biol. 1" 958-960.

Rose, M.D. and J.R. Broach. 1991. Cloning genes by comple- mentation in yeast. Methods Enzymol. 194: 195-230.

Sikorski, R.S. and P. Hieter. 1989. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122: 19-27.

Siliciano, P.G. and K. Tatchell. 1984. Transcription and regulatory signals at the mating type locus in yeast. Cell 37: 969- 978.

Smith, H.E. and A.P. Mitchell. 1989. A transcriptional cascade governs entry into meiosis in yeast. Mol. Cell. Biol. 9: 2142- 2152.

Smith, H.E., S.S.Y. Su, L. Neigebom, S.E. Driscoll, and A.P. Mitchell. 1990. Role of IME1 expression in control of meiosis in Saccharomyces cerevisiae. Mol. Cell. Biol. 10: 6103- 6113.

Sternberg, P.W., M.J. Stem, I. Clark, and I. Herskowitz. 1987. Activation of the yeast HO gene by release from multiple negative controls. Cell 48: 567-577.

Strich, R., M.R. Slater, and R.E, Esposito. 1989. Identification of negative regulatory genes that govern the expression of early meiotic genes in yeast. Proc. Natl. Acad. Sci. 86: 10018- 10022.

Torchia, T.E., R.W. Hamilton, C.L. Cano, and J.E. Hopper. 1984. Disruption of regulatory gene GAL80 in Saccharomyces cerevisiae: Effects on carbon-controlled regulation of the galac- tose/melibiose pathway genes. Mol. Cell. Biol. 4: 1521- 1527.

Vallee, B.L. and D.S. Auld. 1990. Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochem- istry 29: 5647-5659.

Yoshida, M., H. Kawaguchi, Y. Sagata, K. Kominami, M. Hirano, H. Shima, R. Akada, and I. Yamashita. 1990. Initiation of meiosis and spomlation in Saccharomyces cerevisiae re- quires a novel protein kinase homologue. Mol. Gen. Genet. 221: 176-186.




10.1101/gad.5.11.1982Access the most recent version at doi: 5:1991, Genes Dev.

P A Covitz, I Herskowitz and A P Mitchell directly repressed by a1-alpha 2.The yeast RME1 gene encodes a putative zinc finger protein that is

References

http://genesdev.cshlp.org/content/5/11/1982.full.html#ref-list-1

This article cites 39 articles, 18 of which can be accessed free at:

License

ServiceEmail Alerting

click here.right corner of the article or

Receive free email alerts when new articles cite this article - sign up in the box at the top

Copyright © Cold Spring Harbor Laboratory Press

http://genesdev.cshlp.org/lookup/doi/10.1101/gad.5.11.1982http://genesdev.cshlp.org/content/5/11/1982.full.html#ref-list-1http://genesdev.cshlp.org/cgi/alerts/ctalert?alertType=citedby&addAlert=cited_by&saveAlert=no&cited_by_criteria_resid=protocols;10.1101/gad.5.11.1982&return_type=article&return_url=http://genesdev.cshlp.org/content/10.1101/gad.5.11.1982.full.pdfhttp://genesdev.cshlp.org/cgi/adclick/?ad=55564&adclick=true&url=https%3A%2F%2Fhorizondiscovery.com%2Fen%2Fcustom-synthesis%2Fcustom-rna%3Futm_source%3DCSHL_RNA%26utm_medium%3Dbanner%26utm_campaign%3Dcustom_synth%26utm_term%3Doligos%26utm_content%3Djan21http://genesdev.cshlp.org/http://www.cshlpress.com

Documents

The yeast RME1 gene encodes a putative zinc finger protein ...genesdev.cshlp.org/content/5/11/1982.full.pdf1982/05/11 · The yeast RME1 gene encodes a putative zinc finger protein