OPEN

The transcriptional repressor HIC1 regulatesintestinal immune homeostasisK Burrows1,2, F Antignano1, M Bramhall3,4, A Chenery1,2, S Scheer3,4, V Korinek5, TM Underhill1,6 andC Zaph1,2,3,4

The intestine is a unique immune environment that must respond to infectious organisms but remain tolerant to

commensal microbes and food antigens. However, the molecular mechanisms that regulate immune cell function in the

intestine remain unclear. Here we identify the POK/ZBTB family transcription factor hypermethylated in cancer 1

(HIC1, ZBTB29) as a central component of immunity and inflammation in the intestine. HIC1 is specifically expressed in

immune cells in the intestinal lamina propria (LP) in the steady state and mice with a T-cell-specific deletion of HIC1 have

reduced numbers of T cells in the LP. HIC1 expression is regulated by the Vitamin A metabolite retinoic acid, as mice

raised on a Vitamin A-deficient diet lack HIC1-positive cells in the intestine. HIC1-deficient T cells overproduce IL-17A

in vitro and in vivo, and fail to induce intestinal inflammation, identifying a critical role for HIC1 in the regulation of T-cell

function in the intestinal microenvironment under both homeostatic and inflammatory conditions.

INTRODUCTION

The intestinal immune system is constantly interacting withnon-pathogenic commensal organisms and innocuous foodantigens that must be tolerated immunologically, whilesimultaneously maintaining the ability to rapidly respond toinfectious organisms and toxins. To maintain this balance,unique immune cell populations are found in the intestinalmicroenvironment. For example, intestinal-resident dendriticcells that express the surface marker CD103 have been shown toaffect intestinal homeostasis by producing the vitamin Ametabolite retinoic acid (RA).1 Intestinal macrophages havealso been shown to have a central role in tolerance in theintestine.2,3 Specific subsets of CD4þ T helper (TH) cells,primarily FOXP3-expressing regulatory T cells (Treg cells) andIL-17A-producing TH cells (TH17 cells) are enriched in theintestinal lamina propria (LP),4 whereas CD8þ T cells and gdTcells are found in the intraepithelial compartment,5 acting inconjunction with IgA-producing B cells that are required tomaintain tolerance to the commensal flora.6 However, themolecular mechanisms that regulate intestinal immune cellfunction in health and disease are not fully defined.

The POZ and Kruppel/Zinc Finger and BTB (POK/ZBTB)proteins are a family of transcription factors that have criticalroles in a variety of biological processes such as gastrulation,limb formation, cell cycle progression, and gamete formation.7

In the immune system, POK/ZBTB proteins are key regulatorsin cellular differentiation and function.8 For example, B-cellCLL/Lymphoma 6 (BCL6, ZBTB27) is critical for the devel-opment of germinal centers following immunization orinfection. BCL6 is expressed at high levels in germinal centerB cells9 and T follicular helper cells10 that together control thegerminal center response. Promyelocytic leukemia zinc finger(ZBTB16) is required for natural killer T-cell development11

and expression of promyelocytic leukemia zinc finger hasrecently been shown to identify a multipotent progenitor ofinnate lymphoid cells.12 TH-inducing POZ/Kruppel-Like factor(ThPOK, ZBTB7B) is a master regulator of TH-cell develop-ment in the thymus.13,14 Hypermethylated in cancer 1 (HIC1,ZBTB29) is a member of this family and has been shown toregulate proliferation and p53-dependent survival in a widerange of tumors. HIC1 is epigenetically silenced through DNAmethylation in various human cancers15,16 and it has been

1The Biomedical Research Centre, University of British Columbia, Vancouver, British Columbia, Canada. 2Department of Pathology and Laboratory Medicine, University ofBritish Columbia, Vancouver, British Columbia, Canada. 3Infection and Immunity Program, Monash Biomedicine Discovery Institute, Clayton, Victoria, Australia. 4Departmentof Biochemistry and Molecular Biology, School of Biomedical Sciences, Monash University, Clayton, Victoria, Australia. 5Department of Cell and Developmental Biology,Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, Czech Republic and 6Department of Cellular & Physiological Sciences, University ofBritish Columbia, Vancouver, British Columbia, Canada. Correspondence: C Zaph (colby.zaph@monash.edu)

Received 11 November 2016; accepted 9 February 2017; advance online publication 22 March 2017. doi:10.1038/mi.2017.17

ARTICLES

MucosalImmunology 1

proposed that HIC1-dependent repression of SIRT1 wascritical for the function of p53.17 However, the role ofHIC1 in immune cells has not been examined.

In this study, we identify HIC1 as a regulator of intestinalimmune responses under homeostatic and inflammatoryconditions. We demonstrate that HIC1 is expressed in immunecells specifically in the intestinal LP but not in other lymphoidor non-lymphoid tissues in the steady state. In the absenceof HIC1 in T cells, we observe a significant reductionin the frequency of T cells in the LP and intraepithelialcompartment, coincident with increased TH17-cell responses.HIC1 expression in the LP is regulated by the vitamin Ametabolite RA and under inflammatory conditions in theintestine, loss of HIC1 specifically in T cells renders miceresistant to the development of intestinal inflammation,suggesting that HIC1 is required for the pathogenicity of Tcells in vivo. Thus, HIC1 has a central role in intestinal immunehomeostasis and inflammation.

RESULTS

HIC1 expression in immune cells is restricted to theintestine

To begin to address the role of HIC1 in the immune system, weexamined the expression of HIC1 in CD45þ leukocytes invarious tissues of mice with a fluorescent reporter gene insertedin the Hic1 locus (Hic1Citrine mice).18 Citrine expression inCD45þ cells was restricted to the intestine, with the onlydetectable Citrine-positive cells in the LP and intraepithelialspace (Figure 1a). Further characterization of the leukocytes inthe LP revealed that a majority of T-cell receptor b (TCRb)chain-expressing CD4þ and CD8þ T cells and TCRgdþ

CD8þ T cells in the LP-expressed HIC1 (Figure 1b) and thatTCRbþ CD8þ and TCRgdþ CD8þ intraepithelial lympho-cytes also expressed HIC1 (Figure 1c). We also found that mostMHCIIþ CD11cþ CD64- dendritic cells and MHCIIþ

CD64þ F4/80þ macrophages expressed HIC1 (Supple-mentary Figure 1 online). However, HIC1 expression wasnot generalized for all lymphocytes in the LP, as B220þ B cellsdid not express HIC1 (Figure 1b). Thus, HIC1 expression inimmune cells specifically identifies intestinal residentpopulations.

T cell-intrinsic expression of HIC1 regulates intestinalimmune homeostasis

As HIC1 was expressed in multiple immune cell populations inthe LP, we next sought to determine the cell-intrinsic functionsof HIC1 by focusing on its role specifically in T cells. To do this,we crossed mice with loxP sites flanking the Hic1 gene (Hic1fl/fl

mice) with mice that express the Cre recombinase undercontrol of the Cd4 enhancer and promoter (Cd4-Cre mice) togenerate mice with a T cell-intrinsic deletion of Hic1 (Hic1DT

mice). Hic1DT mice displayed normal thymic development(Supplementary Figure 2a and b) and had normal frequenciesof CD4þ and CD8þ T cells in the spleen (SupplementaryFigure 2c) or mesenteric lymph nodes (SupplementaryFigure 2d). HIC1 also had no effect on the activation state

of splenic CD4þ T cells, as we observed equivalent expressionof CD62L and CD44 between Hic1f/f and Hic1DT mice(Supplementary Figure 2e). Finally, HIC1 was not requiredfor the development of FOXP3þ CD25þ CD4þ T cells in thespleen or mLNs (Supplementary Figure 2f). Thus, HIC1expression is dispensable for peripheral T-cell homeostasis.However, we found that the frequency and number of CD4þ

and CD8þ TCRbþ cells in the LP (Figures 2a and b) andCD8þ T cells in the intraepithelial compartment (Figures 2aand b) were significantly reduced in the absence of HIC1,demonstrating that T cell-intrinsic expression of HIC1 isrequired for intestinal T-cell homeostasis.

Lamina propria lymphocytes (LPLs) and intraepitheliallymphocytes display an activated, memory phenotype thatincludes the markers CD69 and CD103, cell surface moleculesthat are important for retention in the intestinal microenvir-onment. CD69 has been shown to negatively regulateexpression of sphingosine-1-phosphate receptor, which mustbe downregulated to establish tissue-residency,19,20 whereasCD103 binds to the epithelial cell-expressed E-cadherin and isrequired for maintenance of intestinal T cells.21 We foundthat HIC1-deficient CD4þ and CD8þ T cells in the LP andintraepithelial compartments expressed significantly reducedlevels of CD69 and CD103 (Figures 2c and d). Strikingly, therewas an almost complete loss of CD103þ CD69þ CD4þ T cells

Figure 1 HIC1 expression in immune cells is restricted to the intestine.(a) Steady state thymus, spleen, blood, lung, mesenteric lymph node(mLN), peyer’s patch (PP) and intestinal lamina propria (LPL), andintraepithelial leukocytes (IEL) were analyzed by flow cytometry forHic1Citrine reporter expression in total CD45þ leukocytes. (b) TCRbþ

CD4þ T cells, TCRbþCD8þ T cells, TCRgdþ T cells, or B220þ B cellswere analyzed by flow cytometry for Hic1Citrine reporter expression fromthe intestinal lamina propria or (c) intraepithelial compartment. (a–c) Dataare representative of three independent experiments.

ARTICLES

2 www.nature.com/mi

in the LP (Figures 2c and d). Thus, the reduced frequency andnumber of CD4þ and CD8þ LPLs and intraepitheliallymphocytes in Hic1DT mice is associated with reducedexpression of CD69 and CD103.

HIC1 is a negative regulator of IL-17A production by CD4þ

T cells

In the intestinal LP, CD4þ TH17 and Treg cells are found athigher frequencies than other TH-cell subsets. Analysis of the

Figure 2 T cell-intrinsic expression of HIC1 regulates intestinal T-cell homeostasis. Intestinal lamina propria (LPL) and intraepithelial (IEL) lymphocyteswere isolated from Hic1fl/fl or Hic1DT mice. (a) Frequency of TCRbþ T cells and (b) total number of TCRbþCD4þ and TCRbþCD8þ T cells were analyzedby flow cytometry. (c) Flow cytometry analysis and (d) quantification of CD103 and CD69 surface marker expression from IEL and LPL TCRbþCD4þ andTCRbþCD8þ T cells. (a,c) Data are representative of three independent experiments. (b,d) Data are pooled from three independent experiments(n¼ 6–7 per group). *Po0.05. Error bars indicate s.e.m.

Figure 3 HIC1 is a negative regulator of IL-17A production by CD4þ T cells. (a,b) Steady-state intestinal lamina propria (LPL) CD4þ T cells wereisolated from Hic1fl/fl or Hic1DT mice and analyzed by flow cytometry for intracellular expression of RORgt, FOXP3, and IL-17A. Data are pooled from threeindependent experiments (n¼ 5–6 per group). Hic1fl/fl or Hic1DT splenic CD4þ T cells were activated under TH17 cell-polarizing conditions and analyzedfor: (c) Hic1 mRNA expression by quantitative RT-PCR, (d) intracellular RORgt and IL-17A frequency and mean fluorescence intensity (MFI) by flowcytometry, (e) IL-17A protein production by ELISA, and (f) Il17a mRNA expression by qRT-PCR. Data are pooled from four independent experiments(n¼ 4–8 per group). (g,h) Analysis of IL-17A expression from TH17 cells that were retrovirally transduced with MigR1-IRES GFP (empty vector) or MigR1-Hic1-IRES GFP expression vectors. GFPþ indicated successful retroviral infection. (h) Data are pooled from three independent experiments (n¼3 pergroup). *Po0.05. Error bars indicate s.e.m.

ARTICLES

MucosalImmunology 3

CD4þ LPLs showed that although frequency of FOXP3þ Treg

cells were equivalent between Hic1fl/fl and Hic1DT mice, thefrequency of RORgtþ IL-17A-expressing TH17 cells inHic1DT mice was significantly increased (Figures 3a and b).Further, splenic T cells in Hic1DTmice displayed a small butsignificant increase in the frequency of IL-17A expression TH17cells (Supplementary Figure 3). These results suggest that inaddition to regulating T-cell numbers in the intestine, HIC1deficiency in T cells had a specific effect on TH17-celldifferentiation. To directly examine the role of HIC1 in TH-cell differentiation, we stimulated TH cells that were purifiedfrom the spleen and peripheral lymph nodes of naive Hic1fl/fl

and Hic1DT mice (Figure 3c) under diverse polarizingconditions. HIC1 deficiency had no effect on thedevelopment of TH1, TH2, or tumor growth factor (TGF)-b-induced Treg cells (Supplementary Figure 4). Consistent withour in vivo results, we observed a significant increase in theproduction of IL-17A by HIC1-deficient TH cells activatedunder TH17 cell-promoting conditions, with heightenedfrequency and mean fluorescence intensity of IL-17Aþ cells(Figure 3d), resulting in a significant increase in the levels ofsecreted IL-17A (Figure 3e), which was also associated withincreased Il17a expression in HIC1-deficient TH17 cells(Figure 3f). Retroviral transduction of HIC1 into differe-ntiating TH17 cells resulted in a complete inhibition of IL-17A

production (Figures 3g and h). Taken together, these resultssuggest that HIC1 is a cell-intrinsic negative regulator of IL-17Aproduction during TH17-cell differentiation.

RA regulates expression of HIC1 in T cells in vitro andin vivo

The vitamin A metabolite RA has a critical role in intestinalimmune homeostasis.22 Previous studies have shown thatmice raised on a diet lacking vitamin A (VAD diet) havedefects in TH-cell activation and intestinal migration, resultingin an overall impairment in T-cell-driven immune responses inthe intestine.23–25 To test whether RA influenced HIC1expression in intestinal TH cells, we raised Hic1Citrine miceon a VAD diet. We found that LP TH cells from VAD mice failedto express HIC1 (Figure 4a), suggesting that HIC1expression in TH cells in the LP is dependent on thepresence of RA. Consistent with this, addition of RA to TH cellsisolated from spleen or lymph nodes of mice activated in vitrowith antibodies against CD3 and CD28 resulted in anupregulation of HIC1 at the mRNA and protein levels(Figures 4b and c). Analysis of HIC1 expression usingHic1Citrine mice further demonstrated that treatment ofactivated TH with RA led to increased HIC1 expression(Figure 4d). Expression of HIC1 was dependent upon TH-cellactivation, as addition of RA to TH cells in the absence of

Figure 4 Retinoic acid regulates expression of HIC1 in CD4þ T cells. (a) HIC1 reporter expression in intestinal lamina propria (LP) CD4þ T cells fromHic1Citrine mice fed a control diet, Hic1Citrine mice fed a vitamin A-deficient (VAD) diet, and controls fed a control diet was analyzed by flow cytometry. Dataare representative of three independent experiments. (b–d) Splenic TH cells were activated with antibodies against CD3 and CD28 in the presence orabsence of 10 nM RA and HIC1 levels were measured by (b) quantitative RT-PCR (c) western blot and (d) HIC1 reporter expression. (b) Data are pooledfrom two independent experiments (n¼ 4 per group). (c,d) Data are representative of two independent experiments. (e) Expression of Hic1 in naivesplenic CD4þ T cells that were treated with 10 nM RA for 16 h was analyzed by qRT-PCR. Data are pooled from two independent experiments (n¼ 4 pergroup). *Po0.05. Error bars indicate s.e.m.

Figure 5 HIC1 is not required for all RA-mediated effects on CD4þ T cells. (a) Splenic TH cells were activated with antibodies against CD3 and CD28 inthe presence of 10 nM RA; a4b7þ and CCR9 levels were measured by flow cytometry and quantitative RT-PCR. Data are pooled from two independentexperiments (n¼ 4 per group). (b) Splenic CD4þ T cells were activated under TH17 cell-polarizing conditions in the presence or absence of 10 nM RA andanalyzed for intracellular IL-17A and FOXP3 by flow cytometry. Data are representative of three independent experiments. *Po0.05. Error bars indicates.e.m.

ARTICLES

4 www.nature.com/mi

TCR stimulation had no effect on the expression of Hic1 mRNA(Figure 4e). Thus, these results identify HIC1 as anRA-responsive gene in activated TH cells.

HIC1 is dispensable for expression of intestinal homingreceptors

RA is critical for migration of immune cells to the intestine24

through the upregulation of intestinal homing molecules,including a4b7 integrin and CCR9.25 Our results showing thatHic1DT mice had reduced numbers of intestinal T cells could beowing to reduced expression of intestinal homing molecules,resulting in impaired intestinal migration. However, we failedto observe any reduction in expression of a4b7 and CCR9 onTH cells in the presence or absence of HIC1 following activationin the presence of RA (Figure 5a). Further, we found that TH

cells isolated from the Peyer’s patches or mLNs of Hic1DT micewere not deficient in expression of CCR9 (SupplementaryFigure 5). These results demonstrate that other HIC1-depe-ndent mechanisms such as reduced expression of CD69 andCD103 were responsible for the paucity of TH cells in the LP andthat HIC1 is dispensable for RA-dependent induction ofintestinal homing molecules.

HIC1 is not required for inhibitory effects of RA on TH17-celldifferentiation

Several studies have demonstrated that RA can negatively affectthe differentiation of TH17 cells26–29 although the precisemechanisms remain unclear. Based on our data showingheightened IL-17A production by HIC1-deficeint TH17 cellsin vitro and in vivo, we hypothesized that expression of HIC1would be required for the RA-dependent reduction in TH17-celldifferentiation. In contrast to our expectations, addition ofRA to either HIC1-sufficient or -deficient TH cells led to asignificant reduction in the expression of IL-17A (Figure 5b).Thus, although HIC1 is upregulated by RA in TH cells andHIC1-deficient TH17 cells express increased levels of IL-17Ain vitro and in vivo, HIC1 is dispensable for RA-dependentregulation of TH17 cell responses in vitro.

HIC1 regulates T cell-mediated inflammation in theintestine

We next examined whether dysregulated TH-cell responsesobserved in naive Hic1DT mice had any effect on the developmentof intestinal inflammation. Despite the reduced numbers ofTH cells in the LP of Hic1DT mice and the dysregulatedproduction of IL-17A by HIC1-deficient TH17 cells, we failed toobserve any significant differences in intestinal architecturebetween naive Hic1fl/fl or Hic1DT mice (Figure 6a, left panels).After induction of intestinal inflammation with intraperitonealinjection of a monoclonal antibody against CD3,30–32 Hic1DT

mice displayed less intestinal inflammation compared withcontrol Hic1fl/fl mice (Figures 6a and b). Although we observedfewer CD4þ T cells in the intestine of treated Hic1DT mice(Figure 6c), we did observe an increase in the number of CD4þ

T cells in the LP of treated Hic1DT mice compared with naiveHic1DT mice (Figures 2a and b), further demonstrating thatintestinal migration is not completely impaired in the absence ofHIC1. Analysis of cytokine production by TH cells from the LP

and mLN of anti-CD3-treated mice identified an increasedfrequency of IL-17A-producing TH cells without any changes inthe frequency of IFN-g-producing cells (Figures 6c and d),similar to our results under steady-state conditions. Thus, T cell-intrinsic expression of HIC1 modulates inflammation in theintestine, potentially by negatively regulating IL-17A production.

To directly assess the cell-intrinsic role of HIC1 in intestinalinflammation, we employed a T-cell transfer model of intestinalinflammation.33 We adoptively transferred naive CD4þ

CD25– CD45RBhigh T cells isolated from either Hic1fl/fl orHic1DT mice into Rag1–/– mice. Rag1–/– mice that receivedcontrol T cells from Hic1fl/fl mice began losing weightB4 weekspost transfer (Figure 7a) and showed significant intestinalinflammation by 6 weeks post transfer (Figure 7b). Strikingly,we found that Rag1–/– mice that received T cells from Hic1DT

mice continued to gain weight and did not develop severeintestinal inflammation (Figures 7a–c). Associated with thereduced disease, there were significantly fewer CD4þ T cells inthe intestinal LP (Figure 7d). Furthermore, consistent with ourresults under homeostatic conditions as well as followinga-CD3 treatment, we found that the absence of HIC1 in T cellsresulted in heightened production of IL-17A in the LP andspleen with no significant effect on the frequency of IFN-g-positive cells (Figures 7e and f). Thus, HIC1 expression inT cells is critically required for the development of intestinalinflammation, possibly by limiting expression of IL-17A.

Figure 6 HIC1 is required for the development of intestinal inflammation.Mice received anti-CD3e antibody by intraperitoneal injection. (a) At 48 hpost injection, mice were killed and analyzed for intestinal tissue pathologyand inflammatory infiltrate by H&E staining. Scale bar represents 100 mm.(b) Histological scores. (c) Total numbers of intestinal lamina propria (LPL)TCRbþCD4þ T cells were quantified by flow cytometry. (d,e) Intracellularexpression of IL-17A and IFN-g from (d) LPL and (e) mLN CD4þ T cellswere analyzed by flow cytometry. (a–e) Data are from three independentexperiments (n¼ 8–9 per group). *Po0.05. Error bars indicate s.e.m.

ARTICLES

MucosalImmunology 5

Finally, to determine whether HIC1-deficient T cells have aprotective role in a non-T-cell driven model of intestinalinflammation, we employed dextran sodium sulfate (DSS)-induced colitis. This model involves chemically inducedepithelial cell damage, which leads to bacterial translocationand activation of sub-epithelial innate immune cells andtherefore does not require T or B cells for development ofdisease.34,35 Hic1fl/fl mice and Hic1DT mice were exposed to3.5% DSS in their drinking water for 7 days before returning toregular drinking water for one final day. DSS-treated Hic1DT

mice exhibited attenuated weight loss in comparison withtreated Hic1fl/fl mice (Supplementary Figure 6a). At day 8 afterDSS treatment, sections from the colon of DSS-treated Hic1DT

mice revealed negligible damage to the epithelium and aminimal presence of inflammatory cells. In contrast, tissuesections from DSS-treated Hic1fl/fl mice exhibited severemucosal inflammatory cell infiltrate, sloughing of epithelialcells, and complete loss of crypt architecture (SupplementaryFigure 6b and c). Therefore, HIC1-deficient T cells offer aprotective function in the development of innate immune celldriven intestinal inflammation.

HIC1 is required to limit STAT3 signaling in TH17 cells

In addition to directly repressing target genes, HIC1 has beenshown to negatively regulate gene expression by severalmechanisms including the recruitment of co-repressors suchas the CtBP, NuRD, and polycomb repressive complex 2complexes to target genes to mediate gene repression.36,37

Further, HIC1 has also been shown to indirectly represstranscription by binding to transcriptional activators andpreventing binding to target genes. HIC1 has been shown tointeract with and inhibit DNA binding of transcription factorssuch as T-cell factor-4, b-catenin, and STAT3.38–40 As HIC1-deficient TH17 cells produce heightened levels of the STAT3target gene IL-17A,41 we hypothesized that increased STAT3activity was associated with HIC1 deficiency. We first examinedthe levels of IL-6-induced active phosphorylated STAT3 inHIC1-sufficient and -deficient TH17 cells by flow cytometry.We found that loss of HIC1 had no effect on the frequencyof phosphorylated STAT3-positive TH cells (Figure 8a),suggesting that HIC1 did not affect upstream STAT3activation. However, co-immunoprecipitation studies inTH17 cells of either native HIC1 (Figure 8b) or retrovirallytransduced FLAG-tagged HIC1 (Figure 8c) demonstrated thatHIC1 and STAT3 interacted in TH17 cells. Thus, our resultssuggest that HIC1 limits TH17-cell differentiation by binding toSTAT3, inhibiting its DNA binding and transcriptionalactivation. Consistent with this hypothesis, we foundincreased STAT3 binding to the Il17a promoter in theabsence of HIC1 (Figure 8d), whereas there was nodifference in binding at an irrelevant site (Il5 promoter).Examination of mRNA expression for other known STAT3target genes associated with TH17-cell differentiation41

revealed slight but insignificant increases in gene expressionof Rorc, Socs3, Irf4, Ahr, or Il23r (Figure 8e). Thus, HIC1 doesnot appear to directly regulate the molecular machinery that

Figure 7 HIC1-deficient T cells fail to promote intestinal inflammation following adoptive transfer into Rag1� /� mice. CD4þCD25–CD45RBhi naiveT cells (4� 105) from Hic1fl/fl or Hic1DT mice were transferred into Rag1–/– mice and monitored for colitis. (a) Weight loss (percentage of initial weight) wascalculated for each mouse over 6 weeks. (b) At 6 weeks post transfer, mice were killed and analyzed for intestinal tissue pathology and inflammatoryinfiltrate by H&E staining. Scale bar represents 100 mm. (c) Histological scores. (d) Total number of TCRbþCD4þ T cells isolated from intestinal laminapropria (LPL). (e,f) Intracellular expression of IL-17A and IFN-g from (e) LPL and (f) Spleen CD4þ T cells were analyzed by flow cytometry. (a–f) Data arepooled two of four independent experiments (n¼4–8 per experiment). Statistics compare Rag1–/– mice that received Hic1fl/fl T cells to those that receivedHic1DT T cells. *Po0.05. Error bars indicate s.e.m. ns; not significant.

ARTICLES

6 www.nature.com/mi

controls TH17-cell differentiation. Instead, our results identifyan important role for HIC1 in limiting expression of IL-17A inTH17 cells by inhibition of STAT3 DNA binding.

DISCUSSION

We have identified the transcriptional factor HIC1 as a novelregulator of intestinal immune homeostasis. In the steady state,HIC1 is specifically expressed in immune cells of the intestinalLP and intraepithelial niches in an RA-dependent manner, andmice with a T cell-intrinsic deletion of HIC1 have a markeddecrease in the number of T cells in intestinal tissues. HIC1deficiency leads to increased expression of IL-17A, possiblythrough the loss of STAT3 inhibition. Under inflammatoryconditions, HIC1 expression in T cells is required for intestinalpathology, identifying HIC1 as a potential therapeutic target totreat intestinal inflammation.

Our results suggest that the micronutrient RA regulatesHIC1 expression in immune cells in the intestine. In support ofthis, two unrelated genome-wide expression screens for genesin TH cells regulated by RA signaling have identified HIC1 as anRA/RARa-dependent gene, although no functional analyseswere carried out.22,42 These results are consistent with an insilico study showing that the Hic1 gene contains multiple RAreceptor response elements.43 However, HIC1 is dispensablefor RA-mediated expression of intestinal homing moleculesand RA-dependent suppression of IL-17A production in vitro,

suggesting that the RA-HIC1 axis has a specific role in regulat-ing intestinal T-cell homeostasis that remains to be defined.

T cell-intrinsic deletion of HIC1 resulted in a significantreduction in the frequency and number of T cells in theintestinal microenvironment. Interestingly, mice raised on aVAD diet also display reduced numbers of intestinal T cells.24

As RA has been shown to regulate expression of intestinalhoming molecules such as CCR9 and a4b7 integrin, we firstsuspected that defective trafficking to the intestine wasresponsible for the paucity of T cells in the intestines ofHic1DT mice; however, we did not observe any defects in theability of HIC1-deficient T cells to express CCR9 or a4b7. Inaddition, we observed a significant influx of T cells intointestinal tissues upon induction of inflammation, furthersuggesting that migration to the intestine is not regulated byexpression of HIC1. However, we did observe that the HIC1-deficient T cells present in the intestine at steady state expressedsignificantly lower levels of the surface molecules CD69 andCD103. These molecules are expressed by tissue-resident cellsand are required for retention in tissues. Indeed, similar to ourresults, CD103-deficient mice have a severe reduction in thenumber of T cells in the intestine.21 Thus, HIC1 appears to berequired for the optimal expression of CD69 and CD103 andretention of T cells in the intestinal microenvironment.

In addition, CD69 and CD103 are characteristic markers of asubset of memory T cells known as tissue resident memory T

Figure 8 HIC1 regulates STAT3 signaling in TH17 cells. CD4þ T cells were activated under TH17 cell-polarizing conditions. (a) Flow cytometric analysisof STAT3 phosphorylation from TH17 cells restimulated with or without IL-6 for 15 min. Numbers represent mean fluorescence intensity. Data arerepresentative of two independent experiments. (b) Inputs, anti-STAT3 immunoprecipitates (IP), and normal rat serum IP from TH17 cells wereimmunoblotted with anti-STAT3 and anti-HIC1 antibodies. 1 and 2 represent duplicate TH17 cultures. Data are representative of two independentexperiments. (c) Inputs and anti-FLAG IP from TH17 cells retrovirally transduced with MigR1 (empty) or MigR1 FLAG-HIC1 vectors were immunoblottedwith an anti-STAT3 antibody. Data are representative of two independent experiments. (d) Chromatin Immunoprecipitation (ChIP) analysis of STAT3binding to the Il17a and Il5 promoters in TH17 cells. Data are from three independent experiments (n¼6 per group). (e) Analysis of Rorc, Socs3, Irf4, Ahr,Il23r mRNA expression by quantitative RT-PCR. Data are from two independent experiments (n¼6 per group). *Po0.05. Error bars indicate s.e.m.

ARTICLES

MucosalImmunology 7

cells. Tissue resident memory T cells are long-lived quiescentcells that are thought to have derived from effector T cells thathave migrated into non-lymphoid tissues. Interestingly, HIC1has been shown to control fundamental cellular processes suchas cell growth and survival.44,45 HIC1 has been shown tointeract with and regulate key transcription factors involved incell cycle progression and cellular metabolism.37,46 Forexample, HIC1 is involved in a regulatory feed back loopwith the deacteylase SIRT1,17 which is a key regulator of fatty-acid oxidation.47 Further, it has been demonstrated that fatty-acid metabolism is key to memory T-cell development andsurvival.48,49 Thus, it is possible that in addition to directlyregulating T-cell retention in tissues, HIC1 may also berequired in T cells to promote quiescence through metabolicpathways. Future studies will aim to characterize the role forHIC1 in T-cell quiescence and memory development.

Another observation was the increase in the frequency ofIL-17A-producing TH17 cells in the intestine of Hic1DT mice.TH17 cells have been shown to have an important role in hostdefense to extracellular bacteria and fungi.50 However, theyhave also been described as pathogenic in multiple inflam-matory diseases such as psoriasis and rheumatoid arthritis, andtargeting IL-17A has proven to be an effective therapy.51–53

However, the role of IL-17A in inflammatory bowel disease iscontroversial. Initial studies using the T-cell transfer model ofcolitis provided the first evidence that IL-23-driven TH17 cellswere pathogenic.54 Further, STAT3 was shown to be required todrive both colitis and systemic inflammation not only bymodulating TH17-cell differentiation but also by promotingT-cell activation and survival.41 However, targeted therapiesagainst IL-17A in Crohn’s disease have been proven ineffec-tive55,56 and recent studies have shown that IL-17A is importantfor maintaining intestinal barrier integrity and has a protectiverole in regard to the development of colitis.57,58 Further, it isbecoming more apparent that the TH17-cell lineage has a degreeof heterogeneity with regards to pathogenicity. For example,TH17 cells differentiated in the presence of TGFb are lesspathogenic and produce higher levels of IL-10, whereas cellsdifferentiated in the presence of IL-23 are more pathogenic andcan produce IFN-g.59,60 In addition, TH17 cells have a degree ofplasticity and fate-mapping studies have shown that ‘‘ex-TH17’’cells lose their ability to produce IL-17A altogether andexclusively produce IFN-g under certain conditions.61 As ourstudies show increased production of IL-17A from TH17 cellsand a lack of pathogenicity in multiple mouse models ofintestinal inflammation, we hypothesize that in the absence ofHIC1, TH17 cells are skewed to a more protective lineage and donot transition into pathogenic cells. Further, it has been shownthat STAT3 can inhibit transcription of key genes from otherTH-cell lineages62 and therefore may provide TH17 lineagestability in the absence of HIC1. However, the precise molecularmechanism of how HIC1 regulates the pathogenicity of T cellsremains to be fully elucidated.

In summary, we have identified the transcription factorHIC1 as an RA-responsive cell-intrinsic regulator of T-cellfunction in the intestine. Through its interaction with STAT3,

HIC1 limits IL-17A production by TH17 cells and is required forthe development of intestinal inflammation. Together, theseresults suggest that HIC1 is an attractive therapeutic target forthe treatment of inflammatory diseases of the intestine such asCrohn’s disease and potentially other diseases associated withdysregulated TH17-cell responses.

METHODS

Ethics statement. Experiments were approved by the University ofBritish Columbia Animal Care Committee (Protocol numberA15-0196) and were in accordance with the Canadian Guidelines forAnimal Research.

Mice. The generation of Hic1Citrine mice has been described18 and thegeneration of Hic1fl/fl mice will be described elsewhere (manuscript inpreparation). Cd4-Cre mice were obtained from Taconic (German-town, NY). Animals were maintained in a specific pathogen-freeenvironment at the Biomedical Research Centre animal facility.

Diet studies. VAD (TD.09838) diet was purchased from HarlanTeklad Diets (Madison, WI). At day 14.5 of gestation, pregnant femaleswere administered the VAD diet and maintained on diet until weaningof litter. Upon weaning, females were returned to standard chow,whereas weanlings were maintained on special diet until use.

Antibodies and flow cytometry. Absolute numbers of cells weredetermined via hemocytometer or with latex beads for LP samples.Intracellular cytokine staining was performed by stimulating cells withphorbol 12-myristate 13-acetate, ionomycin, and Brefeldin-A (Sigma,St. Louis, MO) for 4 h and fixing/permeabilizing cells using theeBioscience intracellular cytokine buffer kit. All antibody dilutions andcell staining were done with phosphate-buffered saline containing 2%fetal calf serum, 1 mM ethylenediaminetetraacetic acid, and 0.05%sodium azide. Fixable Viability Dye eFluor 506 was purchased fromeBioscience (San Diego, CA) to exclude dead cells from analyses. Priorto staining, samples were Fc-blocked with buffer containing anti-CD16/32 (93, eBioscience) and 1% rat serum to prevent non-specificantibody binding. Cells were stained with fluorescent conjugated anti-CD11b (M1/70; in house), anti-CD4 (GK1.5), anti-CD8 (53-6.7), anti-TCRb (H57-597), anti-MHCII (I-A/I-E) (M5/114.15.2), anti-CD11c(N418), anti-F4/80 (BM8), anti-IL17a (17B7), anti-FOXP3 (FJK-16s),anti-B220 (RA3-6B2), anti-TCRgd (eBioGL3), anti-CD45 (30-F11),anti-CD45RB (C363.16A) anti-a4b7 (DATK32), anti-CCR9(eBioCW-1.2), anti-IFN-g (XMG1.2), CD25 (PC61.5), IL-13(eBio13A) purchased from eBioscience, anti-CD103 (M290), anti-CD69 (H1.2F3), anti-CD62L (MEL-14), anti-CD44 (IM7), anti-CD64(X54.5/7.1.1), anti- phosphorylated STAT3 (pY705) purchased fromBD Biosciences (San Jose, CA). Data were acquired on an LSR II flowcytometer (BD Biosciences) and analyzed with FlowJo software(TreeStar, Ashland, OR).

RNA isolation and quantitative real-time PCR. Tissues weremechanically homogenized and RNA was extracted using the TRIzolmethod according to the manufacturer’s instructions (ThermoFisherScientific, Waltham, MA). cDNA was generated using High CapacitycDNA reverse transcription kits (ThermoFisher Scientific). Quanti-tative PCR was performed using SYBR FAST (Kapa Biosystems,Wilmington, MA) and SYBR green-optimized primer sets run on anABI 7900 real-time PCR machine. Cycle threshold (CT) values werenormalized relative to beta-actin (Actb) gene expression. The primersused were synthesized de novo:

Hic1:forward 50-AACCTGCTAAACCTGGACCAT-30

reverse 50-CCACGAGGTCAGGGATCTG-30

Il17a:

ARTICLES

8 www.nature.com/mi

forward 50-AGCAGCGATCATCCCTCAAAG-30

reverse 50-TCACAGAGGGATATCTATCAGGGTC-30

Ifng:forward 50- GGATGCATTCATGAGTATTGCC-30

reverse 50-CCTTTTCCGCTTCCTGAGG-30

Il13:forward 50-CCTGGCTCTTGCTTGCCTT-30

reverse 50- GGTCTTGTGTGATGTTGCTCA-30

Foxp3:forward 50- CCCAGGAAAGACAGCAACCTT-30

reverse 50- TTCTCACAACCAGGCCACTTG-30

Rorc:forward 50- TCCACTACGGGGTTATCACCT-30

reverse 50- AGTAGGCCACATTACACTGCT-30

Socs3:forward 50- TGCAAGGGGAATCTTCAAAC-30

reverse 50- TGGTTATTTCTTTTGCCAGC-30

Irf4:forward 50- CCGACAGTGGTTGATCGACC-30

reverse 50- CCTCACGATTGTAGTCCTGCTT-30

Ahr:forward 50- GCCCTTCCCGCAAGATGTTAT-30

reverse 50- GCTGACGCTGAGCCTAAGAAC-30

Il23r:forward 50- AACAACAGCTCGGATTTGGTAT-30

reverse 50- ATGACCAGGACATTCAGCAGT-30

Actb:forward 50-GGCTGTATTCCCCTCCATCG-30

reverse 50-CCAGTTGGTAACAATGCCATGT-30.

Cell culture. CD4þ T cells were isolated from spleen and LNs bynegative selection using an EasySep Mouse CD4þ T cell isolation kit(StemCell Technologies, Vancouver, BC). In total, 5� 105 CD4þ cellswere cultured for up to 5 days in Dulbecco’s Modified Eagle’s medium-supplemented with 10% heat-inactivated fetal bovine serum, 2 mM

glutamine, 100 U ml-1 penicillin, 100 mg ml-1 streptomycin, 25 mM

HEPES, and 5� 10-5 2-ME with 1 mg ml-1 plate bound anti-CD3 (145-2C11) and anti-CD28 (37.51). CD4þ T cells were polarized underTH17 cell- (20 ng ml-1 IL-6, 10 ng ml-1 IL-23, TNF-a, IL-1b, 1 ng ml-1

TGF-b1, 10 mg ml-1, anti-IFN-g and anti-IL-4), TH1 cell- (10 ng ml-1

IL-2, IL-12, and 5 mg ml-1 anti-IL-4), TH2 cell- (10 ng ml-1 IL-2, IL-4,and 5 mg ml-1 anti-IFN-g) or induced Treg cell- (10 ng ml-1 IL-2 andTGFb1) promoting conditions. In some cases, cells were plated asabove in the presence of 10 nM RA (Sigma-Aldrich).

ELISA. IL-17A production was analyzed from supernatants taken onday 4 of CD4þ T cell in vitro culture using commercially availableantibody pairs (eBioscience).

Anti-CD3-induced intestinal inflammation. Mice were administered30 mg of anti-CD3e antibody (145-2C11) in 400 ml phosphate-bufferedsaline by intraperitoneal injection. Animals were monitored daily afterinjection and euthanized at 48 h post injection. At end point, sectionsof the distal ileum were fixed in 10% buffered formalin, embedded inparaffin, and stained with haematoxylin and eosin. Histologicalinflammations were blindly scored on a scale of 0 to 4, where 0represented a normal ileum and 4 represented severe inflammation.Specific aspects such as infiltrating immune cells, crypt length,epithelial erosion, and muscle thickness were taken into account.

T-cell transfer colitis. CD4þ cells were enriched from spleens andperipheral LNs of Hic1fl/fl or Hic1DT mice with an EasySep MouseCD4þ T cell isolation kit (StemCell Technologies) and stained withanti-CD4, anti-CD25, and anti-CD45RB. Naive CD4þCD25–

CD45RBhi cells were purified by cell sorting. CD4þCD25–CD45RBhi

naive T cells (4� 105) were injected intraperitoneally into age-andsex-matched Rag1–/– mice, which were monitored for weight loss andkilled 6 weeks after initiation of the experiment. At end point, proximal

colon was fixed, embedded, and stained with haematoxylin and eosin.Histological inflammation was scored as above.

DSS-inducedcolitis. Mice were exposed to 3.5% DSS in their drinkingwater for 7 days before returning to regular drinking water for 1 finalday. Mice were monitored for weight loss and killed on day 8. At endpoint, proximal colon was fixed, embedded, and stained with hae-matoxylin and eosin. Histological inflammation was scored as above.

Isolation of intraepithelial and LPLs. Peyer’s patches were removedfrom the small intestine, which was cut open longitudinally, briefly washedwith ice-cold phosphate-buffered saline and cut into 1.5 cm pieces. Tissuewas incubated in 2 mM ethylenediaminetetraacetic acid phosphate-buf-fered saline for 15 min at 37 1C and extensively vortexed. Supernatantswere collected and pelleted then re-suspended in 30% Percoll solution andcentrifuged for 10 min at 1200 rpm. The pellet was collected and used asintraepithelial leukocytes. Remaining tissue was digested with Col-lagenase/Dispase (Roche) (0.5 mg ml-1) on a shaker at 250 rpm, 37 1C, for60 min, extensively vortexed and filtered through a 70mm cell strainer.The flow-through cell suspension was centrifuged at 1500 rpm for 5 min.The cell pellet was re-suspend in 30% Percoll solution and centrifuged for10 min at 1200 rpm. The pellet was collected and used as LPLs.

Cell lysis, immunoprecipitation, and immunoblotting. Cells werelysed and immunoprecipitation carried out using antibodies againstSTAT3 (C-20; Santa Cruz, Dallas, TX) and FLAG (M2; Sigma).Immunoblotting was carried out using antibodies against STAT3,HIC1 (H-123; Santa Cruz) and GAPDH (GA1R; in house).

Chromatin immunoprecipitiation. Naive CD4þ T cells were activatedand TH17 polarized for 3 days, followed by cross-linking for 8 min with1% (vol/vol) formaldehyde. Cells were collected, lysed, and sonicated.After being precleared with protein A agarose beads (EMD Millipore,Billerica, MA), cell lysates were immunoprecipitated overnight at 4 1Cwith anti-STAT3 (C-20, Santa Cruz) or normal rabbit IgG (CellSignaling, Danvers, MA). After washing and elution, cross-links werereversed for 4 h at 65 1C. Eluted DNA was purified and samples wereanalyzed by quantitative real time PCR on a 7900 Real-Time PCRsystem. Primer sets used for analysis are: Il17a promoter forward50- CACCTCACACGAGGCACAAG -30 and reverse 50-ATGTTTGCGCGTCCTGATC -30; Il5 promoter forward 50-AAGTCTAGCTACCGCCAATA-30 and reverse 50- AGCAAAGGTGAGTTCAATCT-30. Each Ct value was normalized to the corresponding input value.

Retroviral transduction. Platinum E cells were transiently transfectedusing the calcium phosphate method with MigR1 expression plasmidsencoding GFP alone or FLAG-HIC1. Viral supernatants were collectedafter 48 h, supplemented with 8 mg ml-1 polybrene (EMD Millipore)and added to T cells that had been activated under TH17 cell-polarizingconditions for 48 h. T cells (2� 106) were incubated in 24-well plateswith 1 ml viral supernatants. After 24 h, viral supernatant was replacedwith conditioned culture medium and cells were cultured under TH17cell-polarizing conditions for an additional 3 days.

Statistics. Data are presented as mean±s.e.m. Statistical significancewas determined by a two-tailed Student’s t-test using GraphPad Prism5 software. Results were considered statistically significant withPo0.05.

SUPPLEMENTARY MATERIAL is linked to the online version of the paper

at http://www.nature.com/mi

ACKNOWLEDGMENTS

We thank C. Hunter, K. Jacobson, and S. Gerondakis for advice on the

manuscript. We thank R.Dhesi, L.Rollins (BRC core),A. Johnson (UBCFlow),

M. Williams (UBC AbLab), T. Murakami (BRC Genotyping), I. Barta (BRC

Histology), and all members of BRC mouse facility for excellent technical

assistance. This work was supported by the Canadian Institutes of Health

Research’s (CIHR) Canadian Epigenetics, Environment and Health Research

ARTICLES

MucosalImmunology 9

Consortium (grant 128090 to C. Zaph) and operating grants (MOP-89773

and MOP-106623 to C. Zaph) and Australian National Health and Medical

Research Council (NHMRC) project grants (APP1104433 and APP1104466

to C. Zaph). F. Antignano is the recipient of a CIHR/Canadian Association of

Gastroenterology/Crohn’s and Colitis Foundation of Canada postdoctoral

fellowship. C. Zaph is a Michael Smith Foundation for Health Research

Career Investigator and a veski innovation fellow.

AUTHOR CONTRIBUTIONS

K.B., F.A., A.C., M.B., S.S. and C.Z. designed and performed the

experiments. T.M.U. and V.K. provided assistance and contributed

reagents and materials. K.B. and C.Z. wrote the manuscript.

DISCLOSURE

The authors declared no conflict of interest.

Official journal of the Society for Mucosal Immunology

REFERENCES1. Scott, C.L., Aumeunier, A.M. & Mowat, A.M. Intestinal CD103þ dendritic

cells: master regulators of tolerance?. Trends Immunol. 32, 412–419

(2011).

2. Smith, P., Smythies, L., Shen, R., Greenwell-Wild, T., Gliozzi, M. & Wahl, S.

Intestinal macrophages and response to microbial encroachment.

Mucosal immunol. 4, 31–42 (2011).

3. Bain, C.C. & Mowat, A.M. Macrophages in intestinal homeostasis and

inflammation. Immunological Reviews 260, 102–117 (2014).

4. Littman, D.R. & Rudensky, A.Y. Th17 and regulatory Tcells in mediating and

restraining inflammation. Cell 140, 845–858 (2010).

5. Cheroutre, H., Lambolez, F. & Mucida, D. The light and dark sides of

intestinal intraepithelial lymphocytes. Nat. Rev. Immunol. 11, 445–456

(2011).

6. Suzuki, K., Ha, S., Tsuji, M. & Fagarasan, S. Intestinal IgA synthesis: a

primitive form of adaptive immunity that regulates microbial communities in

the gut. Semin. Immunol. 19, 127–135 (2007).

7. Kelly, K.F. & Daniel, J.M. POZ for effect–POZ-ZF transcription factors in

cancer and development. Trends Cell Biol. 16, 578–587 (2006).

8. Lee, S.-U. & Maeda, T. POK/ZBTB proteins: an emerging family of proteins

that regulate lymphoid development and function. Immunol. Rev. 247,

107–119 (2012).

9. Allman, D. et al. BCL-6 expression during B-cell activation. Blood 87,

5257–5268 (1996).

10. Nurieva, R.I. et al. Bcl6 mediates the development of T follicular helper cells.

Science 325, 1001–1005 (2009).

11. Savage, A.K. et al. The transcription factor PLZF directs the effector

program of the NKT cell lineage. Immunity 29, 391–403 (2008).

12. Constantinides, M.G., McDonald, B.D., Verhoef, P.A. & Bendelac, A. A

committed precursor to innate lymphoid cells. Nature 508, 397–401

(2014).

13. Muroi, S. et al. Cascading suppression of transcriptional silencers by

ThPOK seals helper T cell fate. Nat. Immunol. 9, 1113–1121 (2008).

14. Wang, L. et al. Distinct functions for the transcription factors GATA-3 and

ThPOK during intrathymic differentiation of CD4(þ ) Tcells. Nat. Immunol.

9, 1122–1130 (2008).

15. Chen, W.Y. et al. Heterozygous disruption of Hic1 predisposes mice to

a gender-dependent spectrum of malignant tumors. Nat. Genet. 33,

197–202 (2003).

16. Wales, M.M. et al. p53 activates expression of HIC-1, a new

candidate tumour suppressor gene on 17p13.3. Nat. Med. 1,

570–577 (1995).

17. Chen, W.Y., Wang, D.H., Yen, R.C., Luo, J., Gu, W. & Baylin, S.B. Tumor

suppressor HIC1 directly regulates SIRT1 to modulate p53-dependent

DNA-damage responses. Cell 123, 437–448 (2005).

18. Pospichalova, V. et al. Generation of two modified mouse alleles of the Hic1

tumor suppressor gene. Genesis 49, 142–151 (2011).

19. Matloubian, M. et al. Lymphocyte egress from thymus and peripheral

lymphoid organs is dependent on S1P receptor 1. Nature 427, 355–360

(2004).

20. Skon, C.N., Lee, J.-Y., Anderson, K.G., Masopust, D., Hogquist, K.A. &

Jameson, S.C. Transcriptional downregulation of S1pr1 is required for the

establishment of resident memory CD8þ T cells. Nat. Immunol. 14,

1285–1293 (2013).

21. Schon, M.P. et al. Mucosal T lymphocyte numbers are selectively reduced

in integrin alpha E (CD103)-deficient mice. J. Immunol. 162, 6641–6649

(1999).

22. Brown, C.C. et al. Retinoic acid is essential for Th1 cell lineage stability and

prevents transition to a Th17 cell program. Immunity 42, 499–511 (2015).

23. Hall, J.A. et al. Essential role for retinoic acid in the promotion of CD4(þ )

T cell effector responses via retinoic acid receptor alpha. Immunity 34,

435–447 (2011).

24. Iwata, M., Hirakiyama, A., Eshima, Y., Kagechika, H., Kato, C. &

Song, S.-Y. Retinoic acid imprints gut-homing specificity on T cells.

Immunity 21, 527–538 (2004).

25. Johansson-Lindbom, B. et al. Functional specialization of gut CD103þdendritic cells in the regulation of tissue-selective T cell homing. J. Exp.

Med. 202, 1063–1073 (2005).

26. Hill, J.A. et al. Retinoic acid enhances Foxp3 induction indirectly by relieving

inhibition from CD4þCD44hi Cells. Immunity 29, 758–770 (2008).

27. Mucida, D. et al. Reciprocal TH17 and regulatory T cell differentiation

mediated by retinoic acid. Science 317, 256–260 (2007).

28. Mucida, D. et al. Retinoic acid can directly promote TGF-beta-mediated

Foxp3(þ ) Treg cell conversion of naive T cells. Immunity 30, 471–472

(2009). author reply 472–3.29. Schambach, F., Schupp, M., Lazar, M.A. & Reiner, S.L. Activation of

retinoic acid receptor-alpha favours regulatory T cell induction at the

expense of IL-17-secreting T helper cell differentiation. Eur. J. Immunol. 37,

2396–2399 (2007).

30. Esplugues, E. et al. Control of TH17 cells occurs in the small intestine.

Nature 475, 514–518 (2011).

31. Merger, M. et al. Defining the roles of perforin, Fas/FasL, and tumour

necrosis factor in T cell induced mucosal damage in the mouse intestine.

Gut 51, 155–163 (2002).

32. Rutz, S. et al. Deubiquitinase DUBA is a post-translational brake on

interleukin-17 production in T cells. Nature 518, 417–421 (2015).

33. Powrie, F., Leach, M.W., Mauze, S., Caddle, L.B. & Coffman, R.L.

Phenotypically distinct subsets of CD4þ T cells induce or protect from

chronic intestinal inflammation in C. B-17 scid mice. Int. Immunol. 5,

1461–1471 (1993).34. Chassaing, B., Aitken, J.D., Malleshappa, M. & Vijay-Kumar, M. Dextran

sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104,

Unit 15.25 (2014).

35. Dieleman, L.A., Ridwan, B.U., Tennyson, G.S., Beagley, K.W., Bucy, R.P. &

Elson, C.O. Dextran sulfate sodium-induced colitis occurs in severe

combined immunodeficient mice. Gastroenterology 107, 1643–1652

(1994).36. Boulay, G. et al. Hypermethylated in cancer 1 (HIC1) recruits polycomb

repressive complex 2 (PRC2) to a subset of its target genes through

interaction with human polycomb-like (hPCL) proteins. J. Biol. Chem. 287,

10509–10524 (2012).

37. Van Rechem, C., Boulay, G., Pinte, S., Stankovic-Valentin, N.,

Guerardel, C. & Leprince, D. Differential regulation of HIC1 target genes

by CtBP and NuRD, via an acetylation/SUMOylation switch, in quiescent

versus proliferating cells. Mol. Cell Biol. 30, 4045–4059 (2010).

38. Hu, B. et al. HIC1 attenuates invasion and metastasis by inhibiting the IL-6/

STAT3 signalling pathway in human pancreatic cancer. Cancer Lett. 376,

387–398 (2016).

39. Lin, Y.-M., Wang, C.-M., Jeng, J.-C., Leprince, D. & Shih, H.-M. HIC1

interacts with and modulates the activity of STAT3. Cell Cycle 12,

2266–2276 (2013).

40. Valenta, T., Lukas, J., Doubravska, L., Fafilek, B. & Korinek, V. HIC1

attenuates Wnt signaling by recruitment of TCF-4 and beta-catenin to the

nuclear bodies. EMBO J. 25, 2326–2337 (2006).

41. Durant, L. et al. Diverse targets of the transcription factor STAT3

contribute to T cell pathogenicity and homeostasis. Immunity 32,

605–615 (2010).

42. Kang, S.G., Park, J., Cho, J.Y., Ulrich, B. & Kim, C.H. Complementary roles

of retinoic acid and TGF-b1 in coordinated expression of mucosal integrins

by T cells. Mucosal Immunol. 4, 66–82 (2011).

ARTICLES

10 www.nature.com/mi

43. Lalevee, S. et al. Genome-wide in silico identification of new conserved and

functional retinoic acid receptor response elements (direct repeats

separated by 5 bp). J. Biol. Chem. 286, 33322–33334 (2011).

44. Dehennaut, V., Loison, I., Pinte, S. & Leprince, D. Molecular dissection of

the interaction between HIC1 and SIRT1. Biochem. Biophys. Res.

Commun. 421, 384–388 (2012).

45. Rood, B.R. & Leprince, D. Deciphering HIC1 control pathways to reveal

new avenues in cancer therapeutics. Expert Opin. Ther. Targets 17,

811–827 (2013).46. Li, P. et al. Interferon gamma (IFN-g) disrupts energy expenditure and

metabolic homeostasis by suppressing SIRT1 transcription. Nucleic Acids

Res. 40, 1609–1620 (2012).

47. Gerhart-Hines, Z. et al. Metabolic control of muscle mitochondrial function

and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J. 26,

1913–1923 (2007).

48. Pearce, E.L. et al. Enhancing CD8 T-cell memory by modulating fatty acid

metabolism. Nature 460, 103–107 (2009).

49. van der Windt, G.J.W. & Pearce, E.L. Metabolic switching and fuel choice

during T-cell differentiation and memory development. Immunol. Rev. 249,

27–42 (2012).

50. Annunziato, F., Romagnani, C. & Romagnani, S. The 3 major types of

innate and adaptive cell-mediated effector immunity. J. Allergy Clin.

Immunol. 135, 626–635 (2015).

51. Genovese, M.C. et al. LY2439821, a humanized anti-interleukin-17

monoclonal antibody, in the treatment of patients with rheumatoid arthritis:

a phase I randomized, double-blind, placebo-controlled, proof-of-concept

study. Arthritis Rheum. 62, 929–939 (2010).52. Leonardi, C. et al. Anti-interleukin-17 monoclonal antibody ixekizumab in

chronic plaque psoriasis. N. Engl. J. Med. 366, 1190–1199 (2012).

53. Papp, K.A. et al. Brodalumab, an anti-interleukin-17-receptor antibody for

psoriasis. N. Engl. J. Med. 366, 1181–1189 (2012).

54. Ahern, P.P. et al. Interleukin-23 drives intestinal inflammation through direct

activity on T cells. Immunity 33, 279–288 (2010).

55. Hueber, W. et al. Secukinumab, a human anti-IL-17A monoclonal antibody,

for moderate to severe Crohn’s disease: unexpected results of a

randomised, double-blind placebo-controlled trial. Gut 61, 1693–1700

(2012).

56. Targan, S.R. et al. Mo2083 a randomized, double-blind, placebo-

controlled study to evaluate the safety, tolerability, and efficacy of AMG

827 in subjects with moderate to severe Crohn’s disease. Gastroenter-

ology 143, e26 (2012).

57. Lee, J.S. et al. Interleukin-23-independent IL-17 production regulates

intestinal epithelial permeability. Immunity 43, 727–738 (2015).

58. Maxwell, J.R. et al. Differential roles for interleukin-23 and interleukin-17 inintestinal immunoregulation. Immunity 43, 739–750 (2015).

59. Lee, Y. et al. Induction and molecular signature of pathogenic TH17 cells.

Nat. Immunol. 13, 991–999 (2012).

60. McGeachy, M.J. et al. TGF-b and IL-6 drive the production of IL-17 and

IL-10 by Tcells and restrain TH-17 cell–mediated pathology. Nat. Immunol.

8, 1390–1397 (2007).

61. Hirota, K. et al. Fate mapping of IL-17-producing T cells in inflammatory

responses. Nat. Immunol. 12, 255–263 (2011).

62. Wan, C.-K. et al. Opposing roles of STAT1 and STAT3 in

IL-21 function in CD4þ T cells. Proc. Natl. Acad. Sci. 112, 9394–9399

(2015).

This work is licensed under a Creative CommonsAttribution4.0InternationalLicense.Theimagesor

otherthirdpartymaterialinthisarticleareincludedinthearticle’sCreative Commons license, unless indicated otherwise in thecredit line; if the material is not included under the CreativeCommons license, users will need to obtain permission from thelicense holder to reproduce the material. To view a copy of thislicense, visit http://creativecommons.org/licenses/by/4.0/

r The Author(s) 2017

ARTICLES

MucosalImmunology 11