Embed Size (px)
Citation preview
THE ROLE OF INTERCELLULAR CONTACTS IN EPITHELIAL-MESENCHYMAL/-MYOFIBROBLAST
TRANSITION
by
Emmanuel Charbonney
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Institute of Medical Science University of Toronto
© Copyright by Emmanuel Charbonney, 2013
ii
THE ROLE OF INTERCELLULAR CONTACTS IN EPITHELIAL-
MESENCHYMAL/-MYOFIBROBLAST TRANSITION
Emmanuel Charbonney
Doctor of Philosophy
Institute of Medical Science University of Toronto
2013
Abstract
Epithelial mesenchymal/-myofibroblast transition (EMT/EMyT) has emerged as one of the
central mechanisms in wound healing and tissue fibrosis. The main feature of EMyT is the
activation of a myogenic program, leading to the induction of the α-smooth-muscle actin (SMA)
gene in the transitioning epithelium. Recent research suggests that intercellular contacts are not
merely passive targets, but are active contributors to EMT/EMyT. Indeed, our group showed
previously that contact uncoupling or injury is necessary for TGFβ to induce EMyT (two-hit
paradigm). Further, our previous work also revealed that Smad3, the main TGFβ-regulated
transcription factor, binds to the Myocardin Related Transcription Factor (MRTF), the prime
driver of SMA promoter, and inhibits MRTF’s transcriptional activity. During EMyT, Smad3
eventually degrades, which liberates the MRTF-driven myogenic program. However the
mechanisms whereby cell contacts regulate the fate of Smad3 and MRTF during EMyT are
poorly understood. Accordingly, the central aim of my studies was to explore the role of
intercellular contacts, in particular that of Adherens Junction (AJs) in the induction of the
myogenic reprogramming of the injured epithelium. This thesis describes two novel molecular
mechanisms through which AJs impact EMyT. In the first part, we show β-catenin, an AJs
iii
component and transcriptional co-activator counteracts the inhibitory action of Smad3 on MRTF.
Moreover we reveal that β-catenin is necessary to maintain MRTF stability via protecting MRTF
from proteasomal degradation. Thus, β-catenin is an indispensable permissive factor for SMA
expression. In the second part, we demonstrate that contact injury and TGFβ suppress the
expression of the phosphatase PTEN. EMyT-related reduction or absence of PTEN potentiates
Smad3 degradation. EMyT is associated with enhanced phosphorylation of the T179 residue in
Smad3 linker region, and this event is necessary for Smad3 degradation. PTEN silencing
increases the stimulatory effect of contact uncoupling and TGFβ on SMA promoter activity and
SMA protein expression. Thus, the integrity of intercellular contacts regulates the level of PTEN,
which in turn controls Smad3 stability through impacting on T179 phosphorylation.
This new knowledge holds promises for targeted therapies and more effective prevention of the
currently incurable fibroproliferative and fibrocontractile diseases.
iv
Acknowledgments
This Thesis is the end of a long journey, tainted of life and personal experience during four years.
It was more than just science, since the dedicated time to accomplish this work went hand in
hand with the urban multicultural piece of life spent in the city of Toronto.
First and foremost, my thoughts go to my wife, Anne, for her unlimited patience and love. She
has been supportive and very…..very tolerant, on top of being an amazing mother. She used to
say “we had the student life for a few years, but without the good side of it…..”.
I would like particularly to thank my supervisor, Dr. Andras Kapus, for his infinite support and
faithfulness. His guidance has always been gentle and purposeful. He is a source of inspiration,
not only in science, but also for his shared enthusiasm to get answers about life mysteries.
The accomplishment of this degree would not have been possible without the guidance and the
help of several individuals:
My committee members, Boris Hinz, Christopher Mcculloch and Ori Rotstein, for their
meaningful and encouraging input as well as continuous support.
Kati Szaszi for her energy and her scientific support.
John Marshall, for his mentorship and guidance through the experience of becoming a
researcher.
My dear friends and colleagues: Monika, Jen, Faiza, Yasaman, Matthew, Caterina and
particularly Andras Masszi for their contribution to my training, their valuable assistance,
their moral support and the shared laughs.
A very special thank you to Pam Speight, for her assistance in many experiments of this
work, her patient help, her magic touch for “the perfect blot” and her shared expertise.
Without her very meaningful contribution, I would never have reached the end of this
journey.
v
Attribution statement
I would like to report the details of my contribution and work to the content of this thesis, as well
as the contribution of others.
I’m the principle author of the text and the content of the results reported in the present thesis,
done under the supervision and leadership of Dr Andras Kapus.
My detailed contribution by order of appearance in the thesis:
A) The data and concept derived from the published work described in the prelude to results of
the introduction chapter (part 1.7). I participated as a co-author to this work realized
predominantly by Andras Masszi, in term of several experiments, discussions of the research
project, as well as in the elaboration of the final published paper in the Journal of Cell Biology
(Masszi A et al. Journal of Cell Biology 2010).
B) The first paper, titled “β-catenin and Smad3 regulate the activity and stability of Myocardin-
related Transcription Factor during epithelial-myofibroblast transition” is the core project of this
Thesis (part 4). I realized the majority of the experimental work, with the meaningful help of
Pam Speight, the research associate in our lab. I actively participated to the design, concept,
drafting and completion of its publication. The work was published in the Molecular Biology of
the Cell (Charbonney E et al. Molecular Biology of the Cell 2011).
C) The second part of the results (part 5), titled “The destabilization of PTEN by contact injury
promotes Smad3 degradation” is the second main project of my PhD work. I participated in the
formulation of the early ideas, concepts and experimental design. I realized the majority of the
experiments, some with the precious help of Pam Speight. I conducted the drafting and the
elaboration of the figures included in the chapter. This work is underway for completion and will
be submitted for publication in the near future.
vi
Table of Contents
Pages:
List of Tables ............................................................................................................................... viii
List of Figures ................................................................................................................................. ix
List of Appendices .......................................................................................................................... xi
List of Abbreviations ..................................................................................................................... xii
Chapter 1: Introduction and Background ........................................................................................ 1
1.1 General overview ..................................................................................................................... 1
1.2 Epithelial healing and fibrosis ................................................................................................. 4
1.3 Epithelial-Mesenchymal Transition (EMT) .......................................................................... 11
1.3.1 Brief history of the EMT concept .......................................................................... 11
1.3.2 Contexts in which EMT occurs ............................................................................. 12
1.3.3 Cellular and molecular features of EMT ............................................................... 14
1.4 Intercellular contacts .............................................................................................................. 24
1.4.1 E-cadherin .............................................................................................................. 27
1.4.2 β-catenin ................................................................................................................ 37
1.4.3 PTEN ..................................................................................................................... 37
1.5 MRTF and Cytoskeleton ........................................................................................................ 40
1.6 The TGFβ pathway and EMT ................................................................................................ 45
1.6.1 TGFβ pathways ...................................................................................................... 46
1.6.2 TGFβ in EMT ........................................................................................................ 49
1.6.3 Crosstalk with TGFβ pathways ............................................................................. 52
1.6.4 TGFβ is not sufficient for epithelial–mesenchymal-myofibroblast transition ...... 53
1.7 Prelude to results .................................................................................................................... 54
vii
Pages:
Chapter 2: Rationale, Aims and hypotheses .................................................................................. 66
2.1 Rationale ................................................................................................................................. 66
2.2 Aims and hypothesis .............................................................................................................. 68
Chapter 3: Materials and Methods ................................................................................................. 70
RESULTS
Chapter 4: β-catenin and Smad3 regulate the activity and stability of Myocardin-related
Transcription Factor during epithelial-myofibroblast transition ................................ 76
4.1 Summary ................................................................................................................................ 76
4.2 Introduction ............................................................................................................................ 77
4.3 Results .................................................................................................................................... 78
4.4 Discussion ............................................................................................................................ 110
Chapter 5: The destabilization of PTEN by contact injury promotes Smad3 degradation .......... 116
5.1 Summary .............................................................................................................................. 116
5.2 Introduction .......................................................................................................................... 117
5.3 Results .................................................................................................................................. 119
5.4 Discussion ............................................................................................................................ 143
Chapter 6: Overall discussion and future directions .................................................................... 147
References ................................................................................................................................... 155
Appendices: Supplementary Figures ........................................................................................... 180
viii
List of Tables
Pages:
Table 1: EMT inducing factors 15
Table 2: Molecular characteristics of epithelial vs mesenchymal cells 16
Table 3: Intercellular contact structures in the epithelium 25
ix
List of Figures
Pages:
Figure 1: Epithelium 6
Figure 2: Epithelial-Mesenchymal-Transition (EMT) 9
Figure 3: The Myofibroblast (MF) 21
Figure 4: The Adherens Junctions 26
Figure 5: E-cadherin 28
Figure 6: Low calcium medium (LCM) –induced uncoupling of contacts 32
Figure 7: β-catenin 35
Figure 8: Phosphatase and Tensin Homolog Deleted on chromosome 10 (PTEN) 39
Figure 9: Myocardin Related Transcription Factor (MRTF) 42
Figure 10: SMA promoter cis-elements and transcription factors 44
Figure 11: Canonical TGFb- Smad pathway; Smad3 structure and modifications 47
Figure 12: MRTF is a key transcription factor for CArG-dependent genes in EMyT 56
Figure 13: Smad3 strongly inhibits the MRTF- induced stimulation of the SMA promoter, and this effect requires the CArG box and the Smad3 C terminus 59
Figure 14: Myogenic (two-hit) conditions in- duce dramatic loss of Smad3 and mitigate the MRTF–Smad3 interaction 60
Figure 15: Reduced Smad3 expression robustly facilitates the interaction between MRTF and the endogenous SMA promoter, as well as SMA mRNA expression and the promoter activity. Smad3 silencing renders injury sufficient to induce MRTF- dependent SMA expression 62
Figure 16: Smad3 silencing has opposite effects on the expression of mesenchymal marker PAI-1 and on the myogenic program 64
Figure 17: E-Cadherin down-regulation facilitates TGFβ-induced SMA expression 80
Figure 18: β-Catenin is a crucial permissive regulator of SMA expression 84
Figure 19: TGFβ and LCM facilitate the association of Smad3 and β-catenin 89
x
Figure 20: β-Catenin counteracts the inhibitory action of Smad3 on the SMA promoter through SBE-independent, CArG-dependent mechanism
90
Figure 21: β-Catenin protects the SRF/MRTF myogenic complex 93
Figure 22: β-Catenin inhibits the association of Smad3 with MRTF 97
Figure 23: β-Catenin regulates MRTF stability and ubiquitination in a GSK-3β–dependent manner 101
Figure 24: Smad3 recruits GSK-3β to MRTF and is necessary for MRTF degradation 106
Figure 25: β-Catenin maintains expression of CArG-dependent proteins 108
Figure 26: Proposed model of the β-catenin– and Smad3-dependent regulation of MRTF 109
Figure 27: Uncoupling or absence of AJs destabilize Smad3 120
Figure 28: Smad3 induced degradation by the two-hit is independent of RhoA 121
Figure 29: Contact uncoupling induces Smad3 linker region phosphorylation, which is enhanced by the two-hit conditions 123
Figure 30: The two-hit Smad3-induced degradation is dependent of T179 phophorylation 127
Figure 31: PTEN expression is suppressed under EMyT-inducing conditions 129
Figure 32: Inhibition or silencing of PTEN enhances the two-hit-induced Smad3 degradation 132
Figure 33: PTEN silencing enhances the two-hit-induced Smad3 phosphorylation at T179 and promotes Smad3 degradation 136
Figure 34: PTEN silencing enhances SMA promoter activity and protein expression in the two-hit model 141
Figure 35: Summary of interplays between TGFβ and cell contact injury 151
Figure 36: Phases of EMyT and their relationship to Smad3 154
xi
List of Appendices
Supplementary Figures:
Pages:
Chapter 4:
Suppl. Figure 1: Verification of the efficiency of β-catenin downregulation and overexpression 180 Suppl. Figure 2: β-catenin is essential for EMyT in NRK-52E rat kidney tubular cells as well 181 Suppl. Figure 3: Smad3 downregulation restores MRTF stability in β-catenin- depleted cells 183
Chapter 5:
Suppl. Figure 4: pT179 Smad3, Smad3 and Smad2 location on gel 184
Suppl. Figure 5: Lung fibroblasts blot 184
xii
List of Abbreviations
APC: Adenomatosis Polyposis Coli
AJ: Adherens Junction
CArG: CC(A/T)richTT
CBD: Catenin Binding Domain
DM: Desmosome
EAD: Extracellular anchor domain
ECM: Extracellular Matrix
EGF: Epidermal Growth Factor
EMT: Epithelial-Mesenchymal Transition
EMyT: Epithelial-Myofibroblast Transition
ERK: Extracellular Signal-Regulated Kinase
FSP1: Fibroblast specific protein 1
GJ: Gap Junctions
IL-1β: Iterleukin-1β
ILK: Interleukin Linked Kinase
IPF: Idiopathic Pulmonary Fibrosis
JMD: Juxtamembrane Domain
LLC-PK1: Pig Kidney Proximal Tubule Cells
MAPK: Mitogen-Activated Protein Kinases
MF: Myofibroblast
MMP: Matrix Metalloproteinases
MRTF: Myocardin Related Transcription Factor
Myc: Myelocytomatosis oncogene cellular homolog
PAI-1: Plasminogen Activator Inhibitor-1
PTEN: Phosphatase and Tensin Homolog protein
Rac: Ras-related protein
Ras: Small GTPase
Rho: Ras homolog family member D (Small GTPase)
SMA: Smooth-Muscle Actin
Smad: Mother against decapentaplegic homolog
Src: Rous sarcoma oncogene cellular homolog
TCF/LEF: Lymphoid Enhancer Factor-T cell Factor
TGF: Transforming Growth Factor
TJ: Tight Junction
Snail, Slug: zinc-finger transcription factors
Twist: basic helix-loop-helix transcription factors
ZEB: zinc finger E-box binding homeobox
1
Chapter 1 Introduction and Background
Introduction 1
1.1 General overview
The primary focus of the present work is to investigate the role of intercellular contacts in
Epithelial-Mesenchymal (EMT) /-Myofibroblast Transition (EMyT), a phenomenon involved in
tissue healing and the pathogenesis of fibrosis.
Contacts between cells are fundamental for organ integrity, and they also contribute as regulators
of many biological phenomena, such as differentiation, proliferation and specific organ functions
(Adams, 2002; Baum and Georgiou, 2011). The interactions with other cells and the extracellular
matrix (ECM) result not only in adhesion, but also in specific sensing of the environment, which
are vital for a variety of cellular functions (Schwartz and Ginsberg, 2002).
From the contacts, signals can be transduced by modulating signaling pathways or by shuttling
components from contact to the nucleus where they can act as transcription factors or co-
transcriptional modulators. Contact-initiated events allow the regulation of multiple genes, which
will determine cellular fate, including differentiation (Koch and Nusrat, 2009), as well as the
assembly, renewal, maintenance and function of organs. In the context of epithelial healing after
various injuries, a dysregulated regeneration program can lead to excessive scar formation and to
the development of organ fibrosis. During the last decade, a phenomenon called Epithelial-
mesenchymal/myofibroblast transition (EMT/EMyT) has emerged as one of the central
mechanisms in development, wound healing, and tissue fibrosis. Its main inducing factor is the
profibrotic cytokine Transforming Growth Factor beta1 (TGFβ), which contributes to the cellular
reprograming, including the down-regulation of the contact elements.
However, recent research suggests that – in contrast to the previous paradigm – intercellular
contacts are not merely passive targets, but are active contributors to EMT/EMyT (Masszi et al.,
2004; Onder et al., 2008). In fact, our group and others have shown that the injury or absence of
2
the intercellular contacts is a major co-inducer of the EMT/EMyT (Busche et al., 2008; Kim et
al., 2009; Inumaru et al., 2009; Tamiya et al., 2010; Chen et al., 2012). It is therefore of
paramount importance to investigate how the contacts themselves modulate the genetic program
leading to the cellular transformation or dedifferentiation.
The purpose of these studies was to explore the role of intercellular contacts, in particular the
Adherens Junction (AJs), in EMT/EMyT.
The central aim is to define how and to what extent AJ injury contributes to the activation of
the myogenic program, which results in the Myofibroblast (MF) phenotype (see detailed aims
and hypothesis in part 2.2).
One of the key features of fibrosis is the excessive production of extracellular matrix by
mesenchymal cells. The regulation of this complex process (documented in a vast literature) is
not the focus of this thesis. Instead, our work concentrates on the other key element of fibrotic
and fibrocontratile diseases, the emergence of muscle-like features in mesenchymal cells, which
leads to the accumulation of MFs. Our work addresses this topic in the context of epithelial-
myofibroblast transition (EMyT).
The main feature of EMyT is the activation of a myogenic program, leading to the induction of
the α-smooth-muscle actin (SMA) gene in the transitioning epithelium. Since the hallmark of the
MF phenotype is the expression of SMA, and the abundance of this contractile protein shows
strong correlation with the severity of tissue fibrosis, the regulation of the SMA gene has become
a central question in fibrosis research (Kuhn and McDonald, 1991; Zhang et al., 1994; Brewster
et al., 1990). It is important to note that SMA expression and the ensuing enhanced tissue
contractility is not simply a marker of fibrosis. This phenomenon not only underlies increased
tissues constriction, but it also contributes to the direct activation and liberation of local TGFβ
(Wipff and Hinz, 2008; Hinz, 2009).
During EMT/EMYT, many cellular programs are triggered and have a strong impact on the
development of fibrosis. Smad3, as the direct effector of TGFβ receptor is central to this process.
However, as it will be documented and discussed in this thesis, previous and current work from
our lab points to the fact that the role of Smad3 is much more complex than previously thought.
While Smad3 is a definitive inducer of mesenchymal gene expression, it can actually delay or
3
mitigate the activation of the myogenic program, in a context-dependent manner. This thesis will
address this integrated role of Smad3. Specifically, this work will show how the modulation of
Smad3 (by its interaction with the AJ component β-catenin, and through the regulation of its
phosphorylation by the Phosphatase and Tensin Homolog protein (PTEN) links cell contacts to
SMA expression.
While our studies investigated these questions in the context of the transformation of kidney
tubular epithelial cells (LLC-PK1) into myofibroblasts, it is likely (as will be documented) that
the basic principles and major molecular or mechanisms can be generalized and validated in
variety of cell types, and thus it increases our understanding of the process.
In light of these considerations, the structure of this thesis is the following: After a general
introduction on epithelial healing and fibrosis, I will describe the implication of EMT/EMyT in
these two processes, particularly focusing on the cellular reprogramming, which leads to the
formation of the myofibroblasts. I will then address the different elements of the cell contacts
(particularly that of the adherens junctions) and their involvement in various signaling pathways
of EMT.
This will be followed by a prelude chapter to the Results, in which I will present the foundation
of the present work by recalling some central data from a previous publication, in which I
actively participated as a co-author (Masszi et al., 2010).
The subsequent Results section will address molecular mechanisms linking AJ-dependent
regulation of the SMA gene to (TGFβ) signaling. Specifically, the first part of the result section
will depict how β-catenin (a major AJ component) and its interaction with Smad3 (a TGFβ
dependent transcription factor) regulate the activity and stability of Myocardin-related
Transcription Factor (MRTF), a central transcription factor of the myogenic program.
The second part of results will describe how the destabilization of Phosphatase and Tensin
Homolog, PTEN (a well-known tumor suppressor) by contact injury promotes Smad3
degradation, which facilitates the myogenic program of the epithelium.
4
1.2 Epithelial healing and fibrosis
Organ fibrosis is the cause of nearly 45% of the deaths in the developed world (Wynn, 2008). In
the US alone the number of patients with some type of chronic fibroproliferative disease exceeds
20 million. The most frequent clinical manifestations of fibrosis include: interstitial lung disease
in particular idiopathic pulmonary fibrosis (IPF), liver cirrhosis, ischemic heart disease,
glomeruloscelerosis, tubulointerstitial fibrosis, and scleroderma. The two main examples that
illustrate the consequences of diseases with end-stage fibrosis on public health, involve chronic
kidney decease and IPF. The former represents more than 2 million people in Canada and 20
million people older than 20 years in the USA (Centers for Disease Control and Prevention
(CDC) 2010). More than half a million people are treated for end-stage renal disease in the USA.
In Canada, this represent more than 600/million persons in dialysis (Canadian institute of Health
Information). The IPF prevalence is reported to be 1.5–1.8/ 10 000 person-years in the UK
(Hansell et al., 1999) and represents 1/7th of idiopathic interstitial pneumonias. The mean
survival is 2-5 years, with 64.3 deaths/million men and 58.4/women (Olson et al., 2007).
Currently, there are no specific and effective anti-fibrotic therapies (Khalil and O'Connor, 2004).
Although the mechanisms underlying the fibrosis of various organs are not fully understood, it is
clear that many of the pathobiological processes and mechanisms are common, and stem from
dysregulated repair of the epithelium after injury. Novel targets might unveil strategies that can
be utilized toward anti-fibrotic therapies.
Long-term organ dysfunction, due to tissue injury, can be caused by infectious agents (bacterial,
viral), inflammation (allergy, auto-immunity), toxins (nicotine, asbestos, side effects associated
with therapeutic agents), physical trauma (hydronephrosis, mechanical ventilation), cancer or
pathology of unknown etiology. The recovery of the epithelium following such injury is critical
for restoration of the structural and functional integrity of the organ. However, the desired repair
outcome is not always achieved. Organ dysfunction can often be attributed to abnormal tissue
repair and remodeling, due to persistent inflammatory response and repeated attempts at wound
healing, especially in the case where epithelial cells are replaced by Myo/-fibroblasts.
Fibrosis is a form of pathological wound healing and is characterized by mesenchymal cell
infiltration and proliferation in the interstitial space, associated with excessive extra-cellular
5
matrix (ECM) production (collagens, hyaluronic acid, fibronectin, proteoglycans) and
consequent progressive replacement of the epithelial cellular component via extensive scarring
(Romagnani and Kalluri, 2009). This process disrupts the normal organ architecture and prevents
its restoration (Wynn, 2007).
Before describing the pathological process of fibrosis, I would like to first focus on the
characteristics of epithelial cells and provide a brief overview of the process of tissue repair that
follows tissue injury. The epithelium, one of the basic types of animal tissues, lines external or
internal interfaces at the boundary with the environment (e.g. skin, lung, gut) while modified
epithelia (e.g. hepatocytes, kidney tubular cells) build up parenchymal organs. Its main functions
include the protection of surfaces (skin, mucosa), absorption (lung, intestine) and secretion
(kidney, endocrine glands). All of these functions require proper integrity and the ability for
restoration following injury.
One of the main features of the epithelium is its apical-basal polarity, with the apex exposed to
lumen of the cavity (e.g. as in the intestine, bladder and peritoneum). The lateral side is anchored
to the adjacent cells, where as the basal part is attached to the basal membrane (BM) (Figure 1).
To assure that the cells preserve their contact and maintain the structural and functional integrity
of the organ, contact structures are required. Cell-cell contacts are composed of specialized
protein complexes that form the paracellular barrier of epithelia and control the paracellular
transport. I will further describe the different types of cell junctions, especially Adherens
Junction (AJ), later in this chapter (part 1.4).
Since the specific functions of various organs (kidney, lung, liver and intestine) are primarily
determined by the particular epithelia that constitute them, it is not surprising that the organism’s
ability to restore epithelial integrity after tissue damage is vitally important. Epithelial
reconstitution following injury involves the co-ordination of four different cellular processes:
migration, proliferation (division), differentiation and matrix deposition. The classical sequence
of events that follows tissue injury are: i) inflammation, ii) the re-epithelialization of the denuded
surface, and finally iii) tissue remodeling and termination of regeneration (Martin, 1997)). The
prerequisite for successful completion of these phases is that they must be tightly regulated,
transient and have a well-defined end-point.
6
i) Inflammation
Following injury of the epithelium a clot is often formed, consisting of fibrin with embedded
platelets, fibronectin, vitronectin, and thrombospondin. Neutrophils are then recruited and access
the wound rapidly. They are responsible for clearing the cellular debris and bacteria (in the
presence of infection). Following this first line of inflammatory cells, macrophages are recruited
in order to further eliminate the remaining neutrophils, cellular and matrix debris through
phagocytosis. The presence of these immune cells and platelets is essential for proper healing, as
they secrete multiple regulatory mediators, such as growth factors (PDGF, FGF, EGF, CCL2,
ATII) and profibrotic cytokines (TGFβ, IL-13, CTGF) (Li et al., 2006a; Wynn, 2003).
Neutrophils and Macrophages can also stimulate the local proliferation of fibroblast and
epithelial cells through the secretion of cytokines (Leibovich and Ross, 1975; Murphy et al.,
1993). In addition, many growth factors and inflammatory mediators are released directly from
7
the fibroblasts and epithelium themselves that further enhance the healing process (Skibinski et
al., 2007; Zhang et al., 1999). The release of these mediators is essential for recellularization of
the denuded area as they send appropriate cellular signals that assist in the recruitment and
enhancement of fibroblast proliferation. They also contribute to the release of matrix
metalloproteinases (MMPs) which disrupt the basal membrane, participate to wound remodeling,
providing a novel surface upon which the cells will adhere (Aresu et al., 2011).
ii) Re-epthelialization (or restitution) of the denuded surface
The stimulation of re-epithelialization is the next important step towards the restoration of the
epithelial coverage of the wound. The process of re-epithelialization involves cell-cell contact
downregulation (AJs), cellular cytoskeleton rearrangement, modification of the cell surface
expression of contact proteins and receptors (i.e cadherin, integrins), increase in motility and
enhanced survival signaling (mesenchymal features), along with the increased production of an
ECM. First, active contraction of the peripheral actin belt of epithelium takes place, through the
“purse string” mechanism. Purse string mechanism involves the formation of an actin filament
cable and its myosin-mediated contraction, which occurs early after injury. The acto-myosin
cables run from cell to cell at the leading edge, and their formation and contraction is important
for the coordination of wound closure (Danjo and Gipson, 1998). Next, crawling and migration
of epithelial cells (“lamellipodial crawling”) will take place form the wound edge.
Hemidesmosome are dissolved and new integrins, like the α5β1/αvβ6 (fibronectin/ tenascin
receptors) and α2β1 (collagen receptors) have to be expressed, in order migrate onto the wound
matrix. The characterization of epithelium spreading, proliferation and migration has been
explored in cornea, gut, kidney and lung cell cultures (Fenteany et al., 2000; Lotz et al., 2000;
Kheradmand et al., 1994).
The above-mentioned changes reflect the plasticity of the epithelium, and these transformations
can be partial or lead to a fully developed fibroblast phenotype, namely a phenomenon called
epithelial-mesenchymal transition (EMT). EMT occurs when epithelial cells are exposed to
fibrogenic cytokines and physical injury, lose their strong intercellular contacts and become
motile (Figure 2), matrix- producing cells, a strategy aimed at recellularizing the wound. I will
describe the features of this phenomenon in more details in the next chapter.
8
The local and newly formed fibroblasts (through recruitment or EMT) produce paracrine
mediators, which contribute to the recruitment or activation of other fibroblasts, allowing for the
temporary extension of the ECM, which provides a scaffold for the re-epithelialization process.
Fibroblasts and the epithelium are not the only cellular components involved in ECM production
and wound constriction. Another major participant in the repair process is the Myofibroblast
(MF), a motile and contractile mesenchymal cell hallmarked by the expression of α-smooth
muscle actin (SMA) (Hinz et al., 2007). MFs are essential for tissue remodeling during wound
healing and pathological scarring (Tomasek et al., 2002) as they participate in the production of
the ECM scaffold, and – importantly- induce strong tissue contraction at the site of the organ
injury (Gabbiani, 1972; Grinnell, 1994). ECM deposition is a key process because, as several
studies have shown, the ECM critically influences epithelial proliferation and motility. For
instance, hyaluronan-CD44 binding can act as a co-activator of cell proliferation and motility,
through the Epidermal Growth Factor (EGF) receptor, TGFβ receptor 1 or non receptor kinases
(Src family) (Toole, 2009).
The differentiation of MF, along the increased expression of SMA, will be responsible, in part, of
the increased contraction and stiffness, thereby leading to positive feedback on MF production of
SMA. The main factors necessary to generate SMA-positive MFs are TGFβ, ECM proteins
(fibronectin) or polysaccharide (hyaluronan) and increased mechanical stress (Tomasek et al.,
2002). In addition, many distinct mechanisms of the innate and the adaptive immune system are
implicated in the regulation of the MFs through various paracrine effects (Wynn, 2008). For
instance in IPF, characterized by the formation of large MF foci, the inflammation component is
responsible for the initiation of the fibrotic process, but becomes dispensable during the
excessive fibroproliferative phase; the persistent activation of the repair program is not due to
inflammation, which might have resolved (Thannickal et al., 2004).
9
10
iii) Tissue reconstitution and termination of the healing process
Finally tissue remodeling where the reconstitution of the epithelial is achieved through the
spreading and the migration of neighboring epithelium to cover the injured area is the ultimate
goal of the healing process. The physiologic conditions that signal for the termination of the
repair process allow ECM degradation and MFs apoptosis in a controlled manner (Darby et al.,
1990; Moodley et al., 2004).
However, if the original damaging or irritant factors remain present and/or if (for a variety of
reasons) inflammation persists, excessive activation of fibroblasts and MFs may occur, which
results in exuberant ECM (fibronectin, collagens, proteoglycans) deposition, shifting the balance
toward synthesis rather than degradation (Jelaska and Korn, 2000; Wallach-Dayan et al., 2007).
This will lead to pathologic scarring, which not only prevents the restoration of the normal
epithelial structure, but also destroys the neighboring (originally intact) tissue architecture. The
epithelium can be the target of the pathological process, but itself can also become the driver of
this process, through multiple attempts of healing and thereby the formation of active scarring
foci (Selman and Pardo, 2006).
The healing of the injured epithelium is an intensive field of research (Mutsaers et al., 1997;
King and Newmark, 2012), and the mechanisms leading to fibrosis after injury are becoming
progressively unveiled. Organ fibrosis has been extensively studied and research over the last
decade has lead to the discovery of numerous molecules and pathways that regulate the
development of fibrosis in vitro or in vivo. It is important to note that the extent of MFs presence
is strongly correlated with the severity of the fibrosis ((Kuhn and McDonald, 1991; Zhang et al.,
1994; Brewster et al., 1990). Indeed, MFs have 3 major roles: 1) They produce excessive ECM
2) Their contractility not only induces the contraction of the scar (fibrocontractile diseases e.g.
Dupuytren) but also activates TGFβ through the mechanochemical pathway (Hinz, 2009); 3)
They themselves produce fibrogenic cytokines.
Given the central importance of MFs, their origin is a critical issue and a major question in
fibrosis research. In addition, this question is particularly relevant to this work as we propose that
EMyT is in part responsible for their production. I will address that issue more specifically in the
next chapter.
11
In summary, the development of fibrosis represents a deregulated healing process. The
persistence of an inflammatory response and/or the multiple attempts at healing can lead to the
excessive deposition of ECM, thereby changing the extracellular milieu of cells. In response to
their changing environment the cells adapt by reprogramming the activation of various genetic
components gaining an increasingly motile and contractile phenotype. Such a
prolonged/deregulated repair process can lead to the loss of normal organ architecture and
function.
In order to clarify the potential role of the epithelium in the process, in the next chapter I will
describe the phenomenon of EMT in more detail. I will then discuss the implications of EMT in
fibrosis by describing the central role of the MFs. Finally I will summarize the recent
controversies surrounding the existence of EMT in vivo and its role in the pathogenesis of
fibrosis.
1.3 Epithelial-Mesenchymal Transition (EMT): a phenomenon
occurring during development, carcinogenesis and fibrosis
As discussed in the previous section, injury to cells and tissues sets in motion a series of events
that attempt to minimize the damage and initiate the healing process. This process can be broken
down into two main components, namely repair and regeneration. Regeneration represents the
replacement of the injured tissue, meaning the restoration of a whole epithelial structure.
However, depending on the extent of injury and the ability of the tissue to regenerate, scarring
will be part of the repair process. EMT, which I introduced in the previous chapter, plays a
central role in the process of attempt healing. The following paragraphs are describing the
history, context and cellular features of EMT.
1.3.1 Brief history of the EMT concept
Under the old paradigm it was believed that tissues are derived from a single cell, which, after
many divisions, produces a terminally differentiated cell type, like the epithelium. However more
12
recent research has radically challenged this view by providing new concepts. Under changing
environmental conditions/pressures, cells have the potential to undergo phenotypic (complete
transcriptional) reprogramming, which can lead to their dedifferentiation and acquisition of novel
features, such as mobility or invasiveness (Jopling et al., 2011). The process of cell morphing of
an epithelial cell to a mesenchymal cell has been termed Epithelial-Mesenchymal Transition
(EMT).
The discovery of EMT completely revolutionized this field of research as it uncovered that an
epithelial cell can exist in different phenotypic states, for example during the embryonic
development or during tissue healing. Betty Hay was the first to describe this new concept in the
context of the chick embryonic development when she observed that EMT was of crucial
importance during gastrulation (Trelstad et al., 1967) (Fleischmajer, R. and Billingham, R. E.
Eds. Epithelial-mesenchymal interactions. Williams and Wilkins. p31). In fact, during
gastrulation, the nascent mesoderm is formed through EMT and tissue migration. Later, during
tissue differentiation, this process can be repeated several times. The phenomenon was further
demonstrated, in vitro, with differentiated epithelial cells, grown in three-dimensional collagen
gels (Greenburg and Hay, 1982). This model promoted dissociation, migration, and acquisition
of secretory organelles by differentiated epithelial cells, and appeared to abolish the apical-basal
cell polarity characteristic of the original epithelium.
1.3.2 Contexts in which EMT occurs
While first described in embryogenesis, these cellular modifications were later uncovered also
during two pathological processes: cancer or fibrosis. The first description of the phenomenon in
cancer can be attributed to the description of breast carcinoma by Ramon y Cajal in a manual of
anatomopathology in 1890 (Ramón y Cajal, Santiago 1890, first edition. Manual de Anatomia
Pathologica General).
Despite differences in the final phenotype and invasiveness, the common feature between cancer-
and fibrosis-related EMT is the contribution of inflammation. Indeed, chronic inflammation
contributes to tumorigenesis (Cordon-Cardo and Prives, 1999) and fibrosis through various
cytokines and oxidative stress (Toyokuni et al., 1995; Moriyama et al., 2001).
13
In 2008 scientists at an EMT meeting in Cold Spring Harbor Laboratory suggested that EMT can
be classified in three subtypes; this classification system is based on the biological context in
which EMT take place (Kalluri, 2009):
- Type 1: embryogenesis and organ development
- Type 2: tissue regeneration and organ fibrosis
- Type 3: cancer and metastasis
Although these types of EMT have distinctive context-related characteristics and differ in well-
defined aspects, they share common genetic and biochemichal features. However, specific
signals or gene reprogramming that leads to the specific EMT type are not fully understood yet.
Briefly, Type 1 EMT involves primitive epithelial cells transitioning to motile mesenchymal
cells and occurs during implantation and embryonic gastrulation. It paves the path for the
formation of the mesoderm, endoderm, neural crest and primary mesenchyme. The primary
mesenchyme is then involved in the process of generation of secondary epithelia or endothelia
through a process called MET (Mesenhymal-Epithelial Transition), which will further generate
connective tissue and muscle cells through EMT. Despite their motility, these cells are not
invasive (in the sense that they do not penetrate vessels) and are not responsible for excessive
ECM production. The specific molecular mechanisms of these phenomena are beyond the scope
of this thesis and are described elsewhere (Acloque et al., 2009).
Type 2 EMT, which I will depict in the following paragraphs, involves secondary epithelial or
endothelial cells transitioning into fibroblasts and MFs. In mature adult tissues these
fibroblasts/myofibroblasts are induced in response to persistent inflammation, tissue injury and
repair attempts. The Type 3 EMT involves epithelial carcinoma cells in primary nodules; this
program shares some similarity with Type 2 (for example E-cadherin downregulation occurs in
both), but is essentially characterized by the acquisition of an invasive phenotype and systemic
spreading of the cancer cells leading to metastasis (while less ECM deposition) (Thiery, 2002).
The Type 2 EMT, which is the focus of my thesis, is involved in tissue repair and possibly
regeneration. As evoked in the previous chapter, the EMT will generate mesenchymal cells,
fibroblasts and ultimately could generate MFs through epithelial-myofibroblast transition
(EMyT).
14
1.3.3 Cellular and molecular features of EMT
The biological process of EMT/EMyT is a gradual departure from a polarized epithelial cell that
is interacting with the basal membrane toward a mesenchymal phenotype (Figure 2).
The modification of various protein expression involved in the intercellular junctions,
cytoskeletal components, cell–ECM interactions, as well as corresponding transcriptional
regulators, lead to a series of functional changes:
1. Loss of cellular contacts (adhesion), thereby the loss of polarity
2. Remodeling and reorganization of the cytoskeleton
3. Acquisition of spindle shape (elongation)
4. Enhanced motility
5. Enhanced contractility
6. Altered responsiveness to extracellular signals
Importantly, these modifications can take place even after the organogenesis is complete. One of
the central triggers of cellular differentiation is injury often involving the loss of cell-cell
contacts, which can facilitate EMT.
However, the EMT phenomenon can be triggered by the exposure to a variety of inducing factors
(Table 1), emanating from surrounding cells like fibroblasts, epithelial or inflammatory cells, in
response to pathological condition or to the attempt of healing. One of the central, and best
studied, mediators of EMT is transforming growth factor-β1 (TGFβ). This multifunctional
cytokine is a potent inducer of EMT in several tissues (Moustakas and Heldin, 2012). TGFβ
induced signaling pathways leading to cell reprogramming and EMT will be described in Section
1.6.
15
Table 1: EMT inducing factors
The loss of the differentiated epithelial state and mesenchymal transformation can lead to
different levels of transition, i.e different manifestations of tissue plasticity, including the
differentiation into a fibroblast or ultimately a MF.
There are several features that distinguish epithelial vs. mesenchymal cells. If compared in terms
of their morphological (Figures 1 and 2) and molecular characteristics (Table 2), the epithelium
is characterized by its cell junction structures (tight junction, adherens junctions and
desmosomes), an apico-basal polarity, and the expression of specific cytokeratins, cortical actin
ring and minimal cell mobility. In contrast, the mesenchymal cells have different cell junctions
(i.e: N-cadherin, focal tight junctions), acquire antero-posterior polarity, enhanced migratory
capacity, resistance to apoptosis and have the ability to produce ECM components.
Factors TGFβ superfamily Activin, Bone morphogen protein 4 and 7, TGFβ 1 and 3 Sonic Hedgehog (Shh) Wnt ligands Connective tissue growth factor (CTGF) Oncostatin M Interleukin 1 (Il-1) Advanced glycation end products Plasminogen activator inhitor-1 Fibroblast growth factors (FGFs) Epithelial growth factor (EGF) Platelet derived growth factor (PDGF) Vascular endothelial growth factor (VEGF) Notch family of paracrine signaling partners Angiotensin II Angiotensin II proteases
Integrins (αvβ6, α3β1)
16
Table 2: Molecular characteristics of epithelial vs mesenchymal cells
Interestingly during embryologic development the EMT process is reversible (in a regulated
manner) allowing for the return of cells to an epithelial phenotype, a process called
Mesenchymal-Epithelial Transition (MET) (Davies, 1996; Li et al., 2011). The switch from EMT
to MET, as reported in embryogenesis, is also described during distant colonies metastasis
formation (Zeisberg et al., 2005; Bukholm et al., 2000). While cancer cells do revert to the
normal epithelial phenotype, the metastasizing cells leaving the circulation develop colonies,
which possess a significantly higher level of epithelial features than the “transport form” of the
tumor. Although such reversibility has never been demonstrated in epithelial cells undergoing
repair (Ishibe and Cantley, 2008), the existence of progenitors, able to repopulate injured area
(for example in the liver), has been described (Yovchev et al., 2008). In fact, oval cells in that
particular case, not expressing hematopoietic stem cell markers but mesenchymal marker, have a
strong repopulating capacity in vivo, suggesting that the same phenomenon could happen during
epithelium injury.
Epithelial phenotype Mesenchymal phenotype E-cadherin Occludin Claudins ZO-1 (Tight junction protein) Cytokeratin Desmoplakin Laminin-1 MUC1 (Mucin1) Entactin Syndecan miR200 (microRNA) α1collagen (IV)
N-cadherin, OB-cadherin Vimentin Fibronectin Laminin 5 β-catenin FSP-1 (fibroblast-specific protein 1) α-SMA (α Smooth muscle actin) Snail, Slug, Twist HSP47 (Heat Shock Protein) DDR2 α5β1 integrin LEF-1 (Lymphoid enhancer-binding factor-1) SIP1 (survival interacting protein 1) FOXC2 (forkhead box C2) miR21 and 10b (micro RNA) Goosecoid ETS (E-twenty six) Syndecan-1
17
Another way to terminate the fibro/MF accumulation and limit their extension, i.e during
epithelium healing, is to induce apoptosis (Tomasek et al., 2002; Carlson et al., 2003). Although
TGFβ, the main driver of EMT, is known to induce apoptosis (Yanagisawa et al., 1998),
similarly to IL-1β, in the context of EMT it is able to prevent apoptosis (Conery et al., 2004).
However, a very recent work on hepatic fibrosis showed that the loss of MFs during regression
of fibrosis was only partially due to apoptosis. Some of the MFs escape apoptosis to return to a
similar phenotype as hepatic stellate cells, after downregulating their fibrogenic genes (Kisseleva
et al., 2012). In the context of persistent inflammation or sustained abnormal signaling, the
process is not reversible or self-ending and leads to cancer development or participates to the
fibro-proliferative process.
The first feature of EMT is the loss and downregulation of cell contact element, including
essentially the Adherens junctions (E-cadherin), (Onder et al., 2008; Busche et al., 2008) and
tight junction (ZO-1, claudins and occludin) (Medici et al., 2006). In parallel, new junctional
proteins are upregulated such as OB-cadherin (first describe in osteoblasts) and N-cadherin
(Neural cadherin) (Hinz et al., 2004). These usually mediate less stable (more dynamic) cell-cell
interactions. The downregulation of the contact elements is primarily due to their active
suppression by a variety of transcription regulators. The latter are part of the classic “EMT
signature” and play a key role in mediating EMT-related gene changes. Among them, Snail,
Slug, ZEB and Twist are induced in many EMT models (Nieto, 2002; Thuault et al., 2006;
Ansieau et al., 2008) and known to repress epithelial genes (E-cadherin) (Cano et al., 2000;
Olmeda et al., 2007) and tight junction (Blanco et al., 2007).
Beside the downregulation of AJs element, the liberation of junction-related proteins can further
contribute to the process of EMT. Especially, AJs component such as β-catenin, which is
reported to participate to EMT (Masszi et al., 2004; Liebner et al., 2004).
The spindle shape observed in mesenchymal cells is the consequence of anteroposterior-acquired
polarity, increased microfilament/ intermediate filament expression and loss of the peripheral
actin ring. This implies cytoskeleton remodeling, which is characterized by changes in
intermediate filaments (downregulation of cytokeratin and upregulation of vimentin), increase in
the production of cytoskeleton-related proteins such as the Fibroblast specific protein 1 (FSP1,
from the S100 class) and α-smooth-muscle Actin (SMA).
18
The expression of SMA in cells undergoing EMT is the signature of the full-blown myogenic
form of EMT and has been designed epithelial-myofibroblast transition (EMyT) from the
beginning of the introductory chapter. The EMyT, in the case of ultimate differentiation toward
MFs, is characterized by the acquisition of contractility and the de novo synthesis of α-SMA.
With the cytoskeleton changes, enhanced contractility (especially through SMA production) and
the generation of filopodia, motility will be enhanced (De Wever, 2004; Gabbiani, 1972;
Grinnell, 1994). Many stimuli are described to activate MF like: TGFβ, increased ECM stiffness
or the presence of EDA (extra type III domain A)-splice fibronectin (Serini et al., 1998).
Among transcription factors implicated in the myogenic program, myocardin-related
transcription factor (MRTF), a central regulator of SMA production (Fan et al., 2007; Busche et
al., 2008), and an activator of many cytoskeleton gene (Olson and Nordheim, 2010) will be
presented in detail in chapter 1.5 and in the “prelude to results” section (part 1.7).
Finally, two crucial signal transducing pathways, the TGFβ pathway (Moustakas and Heldin,
2012) and Integrin-induced signaling (Kevin K Kim, 2009; Kim et al., 2009)have been reported
to play key roles in activating a variety of EMT-inducing transcription factors (including those
mentioned above). Interestingly, Integrin Linked Kinase (ILK) has been incriminated in many
pathways of EMT (Li et al., 2003; Lee et al., 2004) or fibrosis (Hattori et al., 2008) and is the
subject of preclinical testing of anti-fibrotic pharmacologic therapy, among others (Deelman and
Sharma, 2009; Datta et al., 2011). ILK is responsible of β-catenin stabilization through inhibition
of GSK3 β (Oloumi et al., 2006). In addition, the development of a contractile ECM can activate
integrins and ILK, thereby inducing intracellular signaling of EMT (Li et al., 2009b).
The TGFβ pathway, involved in EMT, will be described later in this introduction, as well as the
interaction with the pathways induced by the disruption of intercellular contacts
1.3.4 EMT in fibrosis
The local production of MFs is central to the fibrotic process and its abundance correlates with
the severity of the fibrosis (Zhang et al., 1994; Brewster et al., 1990). The MF, a contractile and
invasive cell type, plays a central role in promoting the fibrotic conditions, through ECM
19
production and contraction of the injured tissue area (Hinz, 2007). Initially, the MF was
discovered through the description of fibroblasts transformed into contractile cells in granulation
tissue (Gabbiani, 1972; Grinnell, 1994). These cells had a smooth muscle cells characteristies,
were contractile and strongly attached to stromal tissue.
During granulation tissue contraction, a high proportion of these α-smooth muscle actin (α-SMA)
expressing MFs were found (Darby et al., 1990). The new expression of α-SMA by MFs confers
the generation of mechanical force, which regulates cytokine synthesis and ECM production
(Tomasek et al., 2002). Compared to fibroblasts, MFs built more contractile actin cytoplasmic
stress fibers and mature focal adhesion to the ECM (Hinz, 2006) and OB-cadherins (Hinz et al.,
2004) (Figure 3).
An active and partially resolved question in the fibrosis research field is the cellular source of the
fibroblasts/MFs and their proportion. It is central to understand the development of fibrosis in
wound healing, as each of the cellular components, might have a different role, regulation and
functional consequence. In fact it is also conceivable that different precursors (see below) give
rise to different MF subsets. The main subsets are derived from the locally residing fibroblasts or
mesenchymal cells, smooth muscle cells, bone marrow (BM)-derived circulating cells
(fibrocytes), pericytes, epithelial and endothelial cells. Each population might have a different
fate and role (Hinz et al., 2007). For example, in the lung, fibrocytes progenitors were shown to
differentiate into lung fibroblasts (Phillips et al., 2004) and alternatively, endothelium was able
to generate MFs (Frid et al., 2002). The contribution of the various cells may vary in different
fibrotic pathologies or disease models and remains to be determined. For example, the persistent
activation of genes encoding for extracellular matrix proteins in fibroblast is an important
contributor to matrix deposition, but while genes involved in the dysregulated healing of the
epithelium (or podocytes in the kidney) transformed in MFs is certainly another.
20
In summary, the major proposed sources of the myofibroblasts are:
1) The local mesenchymal cells: fibroblasts (Strutz et al., 2000; Strutz and Zeisberg, 2006),
hepatic stellate cells, pericytes, (Lin et al., 2008) and possibly mesenchymal stem cells
(Yang et al., 2012)
2) Bone marrow derived circulating fibrocytes (CD45 and CD34 positive)
(Broekema et al., 2007; Keeley et al., 2010).
3) Endothelium (Zeisberg et al., 2008)
4) Epithelial cells (Strutz et al., 1995; Iwano, 2002) through EMT
However, the present thesis will only focus on the epithelial source, through EMT/EMyT.
21
22
EMT has been recognized as a significant contributor to organ fibrosis in lung (Tanjore et al.,
2009; Kim et al., 2006), intestine, eye, liver (Kalluri and Neilson, 2003; Kalluri, 2009; Liu, 2010)
and kidney. The contribution to the process might depend on the underlying pathology and the
organ incriminated.
The first group to provide some link between the epithelium and the generation of fibroblasts
was Sturtz el al in 1995(Strutz et al., 1995). They identified fibroblast-specific protein 1 (FSP1 or
S1004A), as marker of mesenchymal cells, and fibroblasts. Using FSP-1 specific antibodies they
observed that during fibrosis some tubular cells acquire FSP-1 expression. This key finding
launched a long series of investigation to establish the role of EMT in the pathogenesis of
fibrosis. Initially, genetically tagged animals studies were conducted with FSP1 as a
“mesenchymal marker”, using the principle of “expressional snapshots”. A landmark study from
Iwano et al., using a unilateral ureteral obstruction (UUO) model of kidney fibrosis, reported that
36% of the FSP1 positive cells originated from the tubular epithelium (Iwano, 2002). This
phenomenon has been replicated in other organ systems, in vivo, using various epithelial fate
markers and fibrosis markers (SMA, vimentin, procollagen I, HSP47, FSP1) (Rygiel et al., 2008;
Omenetti et al., 2008; Kim et al., 2006; Zeisberg et al., 2007b; Tanjore et al., 2009; Flier et al.,
2010). In addition a high number of studies reported EMT in vitro, in many different cell lines
(Thiery, 2002; Liu, 2010; Tamiya et al., 2010; Willis and Borok, 2007; Firrincieli et al., 2010).
Moreover, treatment with EMT triggering factors enhanced Fibrosis (Boutet et al., 2006), and
alternatively anti-EMT treatments could lessen fibrosis (Sato et al., 2003; Terada et al., 2002;
Moon et al., 2006; Kinoshita et al., 2007).
While a plethora of observations supports the idea of EMT as one of the process in fibrogenesis,
this concept has recently been challenged in kidney (Humphreys et al., 2010; Koesters et al.,
2010), liver (Taura et al., 2010) and lung (Scholten et al., 2010; Rock et al., 2011) models. These
new studies are putting on the spot former lineage-tracing studies, which reported the presence of
mesenchymal markers in the genetically tagged epithelium (Omenetti et al., 2008; Tanjore et al.,
2009) and papers reporting that in histological samples obtained from patients with fibrotic
diseases (especially in the kidney and the liver) epithelial cells show double labeling for
epithelial and mesenchymal markers (Rastaldi et al., 2002; Cassiman et al., 2002; Vongwiwatana
et al., 2005). Recent fate-mapping studies did not find the expression of (myo)fibroblast markers
23
in the epithelium during fibrogenesis. The ongoing debate essentially centers on the source of
pro-fibrotic cells in kidney (Zeisberg and Duffield, 2010; Quaggin and Kapus, 2011; Humphreys
et al., 2010). Some groups claim that the major or exclusive source of kidney MF is the pericyte.
It is however not debated that in vitro both pericyte and epithelial cells can undergo
reprogramming to become MF (Lin et al., 2008). Moreover, recent work reports observation of
endothelial-to-mesenchymal transition in cardiac fibrosis (Zeisberg et al., 2007a) and diabetic
renal interstitial fibrosis as well (Li et al., 2009a). Nonetheless, the role and relative contribution
of EMT/EMyT in vivo to various forms of organ fibrosis is a subject to intensive ongoing debate,
and further research is needed to clarify this issue.
I would like to underline that our focus of research is the transformation of epithelial cells to a
myofibroblasts and the activation of a myogenic program involved in this process. We realize
that the epithelium is not the only source of fibroblasts/myofibroblasts, but it provides an
excellent model to describe the molecular mechanisms underlying MF generation. Irrespective of
the results of the current debate and the relative contribution of the various potential sources,
these molecular mechanisms appear to be similar and generalizable.
Since the hallmark of the MF phenotype is the expression SMA, and the abundance of this
contractile protein shows strong correlation with the severity of tissue fibrosis (Kuhn and
McDonald, 1991; Zhang et al., 1994; Brewster et al., 1990), the regulation of the SMA gene has
become a central question in fibrosis research (Hinz, 2007). Moreover, SMA represents a major
feature of contractile disease (Hinz et al., 2001) and is important for the mechanical activation of
TGFβ (Wipff et al., 2007). Since our lab has demonstrated the importance of injury to, or
absence of the intercellular contacts in the induction of EMT/EMyT, we sought to further
investigate how the contact themselves modulate this genetic program, particularly in terms of
SMA expression.
24
1.4 Intercellular contacts
The cell contact structures are specialized protein complexes, responsible of the cell-cell or cell-
ECM binding. The former are particularly abundant in the epithelium, where juxtaposed
polarized cells form sheets and solid tissues. The chief role of these coupling elements is to
maintain tissue integrity and regulate the paracellular barriers. In addition, cell contacts are
important signaling devices, acting as relay systems, which link mechanical and chemical signals
of the environment to the regulation of the cytoskeleton, tissue plasticity and the cell cycle
(Yeaman et al., 1999; Gumbiner, 1996; Baum and Georgiou, 2011). The large and heterogenous
sets of cell adhesion molecules include many different molecular families, such as cadherins,
selectins, mucin-like cell adhesion molecules, various members of immunoglobulin superfamily
and integrins.
The main groups of intercellular contact structures in the epithelium (from a morphological
standpoint) are Adherens Junction (AJ), Desmosomes (DM) and Tight Junctions (TJ) and Gap
Junctions (GJ), (Table 3). AJs and DMs are primarily anchoring structures, TJs both couple cells
and regulate paracellular permeability, while GJs form regulated gates between the cytosolic
spaces of neighboring cells.
The general structure of the cell-cell coupling proteins of AJs, TJs and DMs contain an
extracellular domain, a transmembrane domain, and an intracellular domain. The intracellular
domains, through a set of so-called plaque proteins, interact with the cytoskeleton, while the
extracellular regions interact either with the same complexes on another cell (homophilic
binding) or with other complexes or the extracellular matrix (heterophilic binding).
25
Table 3: Intercellular contact structures in the epithelium
Adherens Junctions Tight Junctions Desmosomes
Location Baso-lateral Close to apical surface Baso-lateral
Structure Belt-like Belt-like Plaque like
Function
Contact (ectodermic Calcium-dependent /homotypic)
Sealing and protection against paracellular diffusion
Strength to adhesion with other cells and basal membrane
Transmembranous or EC component
Cadherin (type I Glycoprotein) Claudin, Occludin Desmoglein,
Desmocollin
Cytoplasmic components
Beta-catenin, Alpha-catenin, p120, plakoglobin
Zonula Occludens (ZO) 1,2,3/ p120
Plakophilin, Plakoglobin
Anchoring structures Actin filament Actin filament Intermediate
filament
EC: extracellular
Here I will focus on the structure, regulation and functional role of AJs, as these structures relate
to the central topic of my thesis.
AJs, also termed as Zonula adherens, are well-defined electron microscopic structures that
encircle the cell just below the apical surface (sealed off by TJs) in the polarized epithelium
(Farquhar and Palade, 1963). They are composed of clustered external adhesion molecules
(classical cadherins or nectin), intercalated in the intercellular space of parallel-apposed cell
membranes, and intracellular plaques assembled from diverse proteins (catenins and afadin),
which confer an anchoring structure of the adhesive component to the cytoskeleton (F-actin)
(Figure 4) (Hartsock and Nelson, 2008; McNutt and Weinstein, 1973).
26
During morphogenesis AJs play a key role in the assembly of tissues as they govern the
formation of intercellular connections and participate in the definition of the apico-basal axis
(Takeichi, 1988). In the mature organism, AJs are critical for the maintenance of normal tissue
architecture (Gumbiner, 1996), by regulating cell polarity and shape; both by acting as physical
bridges between cells and through the organization of the actin cytoskeleton (Hartsock and
Nelson, 2008). AJs also ensure functional integrity by contributing to the formation of barriers
(which confine absorption and secretion in the proper luminal compartments) and by regulating a
plethora of cell-cell communication or signaling pathways (Drees et al., 2005; Brembeck et al.,
2006).
27
In the following I will restrict the discussion of the molecular details of AJs to their two main
constituents, E-cadherin and β-catenin, for four reasons: 1) E-cadherin downregulation is one of
the hallmarks of EMT (Aigner et al., 2007); 2) The transcriptional consequences of E-cadherin
loss or downregulation and gene reprograming are well studied in EMT (Onder et al., 2008); 3)
β-catenin is implicated in the signal transduction in EMT, wound healing and fibrosis (Liebner et
al., 2004; Bowley et al., 2007; Kevin K Kim, 2009); 4) our own research has implicated these
elements as key regulators of EMyT (Masszi et al., 2004; Fan et al., 2007; Masszi et al., 2010).
1.4.1 E-cadherin
E-cadherin, (the major Epithelial cadherin), is a representative of the cadherin (calcium-
dependent adhesion) superfamily which includes 100 members, divided in 6 subfamilies (Nollet
et al., 2000). Type I cadherin are the “classical” members, including E-cadherin (epithelium), N-
cadherin (neural) and P-cadherin (placenta). Atypical type II cadherins include VE-cadherin
(vascular). The others groups are desmosomal cadherins, proto-cadherins, flamingo cadherins
and ungrouped cadherins (Nollet et al., 2000).
E-cadherin is the core of the epithelial AJs (Nagafuchi et al., 1987; Gumbiner, 2005), which
interacts homotypically in the extracellular space and is linked to the actin skeleton through
plaque proteins (β-catenin, α-catenin, p120, plakoglobin), associated with the cytosolic regions.
1.4.1.1 Structure and function of E-cadherin
E-cadherin is an 882 amino-acids (in human) single-pass transmembraneα-helix (type I)
glycoprotein. The N-terminal extracellular end is composed of five extracellular cadherin repeats
(around 110 amino acids), containing four extracellular typical cadherin repeats (EC1-4) and one
extracellular anchor domain (EAD). The transmembrane domain (TMD) is followed by a highly
conserved cytoplasmic (the C-terminus), which contains a Juxtamembrane Domain (JMD) and a
Catenin Binding Domain (CBD) (Figure 5).
28
As mentioned, the main role of E-cadherin is to establish and maintain cell adhesion, and
polarity. The most important characteristics of the extracellular domain are its ability to engage
other cadherins to form bonds in a calcium-dependent manner (homophilic junctions). The
calcium dependency of cell adhesion was first described in the eary 70s (Steinberg et al., 1973;
Deman et al., 1974). This property led the identification of the molecule as well. In a set of very
elegant studies Takeichi et al found that Ca2+ removal, which disassembled cell contacts, made
specific proteins susceptible for trypsin-mediated proteolysis. E-cadherin was then identified as a
major protein band to which Ca2+ conferred resistance against trypsin-catalyzed cleavage
(Takeichi et al., 1981). The four sites on the extracellular N-terminal region of E-cadherin hold
the calcium-binding pockets (Koch et al., 1997). Each domain contains two putative calcium-
binding sites, which share similarity with the calcium-binding site of α-lactalbumin (Ringwald et
al., 1987). The three-dimensional calcium-domain structure was first described in mouse
epithelium (Overduin et al., 1995).
29
Clustering of E-cadherin is an important early event during the formation of contacts (Yap et al.,
1997). The first step is a trans (cell to another cell) dimerization of E-cadherin, followed by cis
(laterally on the same cell) clustering (Hong et al., 2010). These conformational changes lead to
a increase the strength and the stability of the intercellular adhesions (Harrison et al., 2011). In
addition, the strength of E-cadherin interaction also depends on the cortical actin cytoskeleton, to
which E-cadherin is linked by plaque proteins including β-catenin, α-catenin, plakoglobin, as
well as the activation of the adaptor protein p120 and regulatory inputs from engagement of
integrins (Avizienyte et al., 2002; de Rooij et al., 2005; Balzac, 2005). Interestingly, calcium
triggers the actin polymerization and the formation of several filopodia, which will lead to a
zipper mechanism of junction formation (Vasioukhin et al., 2000).
Linkage to the actin skeleton not only stabilizes E-cadherin clusters but also allows myosin
recruitment and the formation of an actomyosin contractile ring. In fact contractility appears to
play a dual role in AJ regulation, since some actomyosin activity is indispensible for contact
stability, whereas excessive contractility is associated with AJ dissolution (Ramachandran and
Srinivas, 2010; Liu et al., 2010). Accordingly, a variety of cytoskeleton-affecting inputs such as
the activity of Rho-GTPases regulate AJ dynamics by affecting E-cadherin clustering and
recycling (Vasioukhin et al., 2000; Cavey et al., 2008; Izumi et al., 2004). Conversely, the state
of AJs and specifically E-cadherin engagement and uncoupling regulate various Rho GTPases
and thereby cytoskeletal organization (Chu et al., 2004). Besides modifying Rho GTPase-
mediated signaling, E-cadherin complexes were also reported to directly affect the actin skeleton.
Specifically, α-catenin was proposed to exist in two pools, either bound to the E-cadherin/β-
catenin complex, or as a dimer. When not bound to β-catenin, α-catenin was shown to suppress
actin polymerization presumably by antagonizing the Arp2/3 complex. The assembly of the AJs
can redistribute α-catenin, which stimulates local actin polymerization (Drees et al., 2005).
Furthermore, E-cadherin can impact a variety of signaling processes: it may act through the
regulation of β-catenin (see results part) and has been shown to activate the Mitogen-Activated
Protein Kinases (MAPK) pathway through the recruitment of the EGF Receptors (Pece and
Gutkind, 2000). The loss of E-cadherin plays an important role in carcionegenesis, an aspect that
will be discussed in the section on its role in EMT.
30
1.4.1.2 Regulation of E-cadherin
E-cadherin is regulated both at the transcriptional and posttranslational level, and its distribution
and amount within the cells is dictated by endo- and exocytsosis as well as by proteasomal and
lysosomal degradation (Bryant and Stow, 2004; Troyanovsky et al., 2006).
The gene of E-cadherin, named CDH1, is located in 16q22.1 on Chromosome 16. The promoter
can be regulated by the epigenetic hypermethylation, or transcription factors – mostly
suppressors, including Snail (Batlle et al., 2000), Slug (Bolos et al., 2003), ZEB1 and SIP1
(ZEB2) (Carver et al., 2001), and Twist (Yang et al., 2004). Constant remodeling of epithelial
contacts is necessary to maintain tissue stability and plasticity. Accordingly, E-cadherin density
in the membrane is tightly regulated. Endocytosis, exocytosis and trafficking of E-cadherin to the
membrane have been shown to contribute, in a controlled manner, to the regulation of the surface
expression of E-cadherin (Troyanovsky et al., 2006). Indeed, a large portion of E-cadherin
undergoes constant cycling between the recycling endosome and the membrane (Bryant and
Stow, 2004). The rate of trafficking in influenced by many factors including multiple interactions
of E-cadherin with catenins, p120 and the actin skeleton, processes which are themselves
regulated by small GTPases and a variety of protein kinases (Gumbiner, 2005; Ishiyama et al.,
2010; D'Souza-Schorey, 2005).
It is noteworthy that after disruption of cell contact by removing calcium (the method used in the
experimental section of this thesis), E-cadherin is rapidly internalized through clathrin-mediated
and clathrin-independent endocytosis (Chitaev and Troyanovsky, 1998; Delva and Kowalczyk,
2009). Our laboratory has shown that in proximal tubular cells this endocytosis is accompanied
by Rho and Rac activation and followed by E-cadherin degradation (Masszi et al., 2004; Fan et
al., 2007). Furthermore, Src kinases were reported to tyrosine phosphorylate E-cadherin/catenin
complex, thereby decreasing adhesion (Behrens et al., 1993) and lead to the ubiquitination of the
E-cadherin complex (Fujita et al., 2002).
1.4.1.3 Role of E-cadherin in EMT/EMyT
During EMT, epithelial cells lose their strong intercellular contacts, which is a prime feature of
this phenomenon. In fact the downregulation of E-cadherin, has been extensively used as one of
31
the hallmarks of EMT. In cancer, E- cadherin is considered as an invasion-suppressor. Re-
expression of E-cadherin in cancer cells inhibits growth and tumor invasiveness (Birchmeier and
Behrens, 1994) while its loss is associated with a poor clinical prognosis.
Importantly, the loss of E-cadherin appears to be a trigger for EMT, but the responsible
molecular mechanisms are not well defined. Explorative work in the cancer field reported that E-
cadherin disappearance is associated with poor prognosis, tumor invasiveness and metastasis
through the phenomenon of EMT. A recent work aimed at distinguishing, which consequences of
E-cadherin dowregulation during carcinogenesis are due to its role in cell adhesion and which are
related to its signaling function. This study has elegantly shown that in addition to its role in cell-
cell adhesion, E-cadherin is involved as a pleiotropic regulator in multiple transcriptional
pathways (Onder et al., 2008). The obvious one is β-catenin, which was found to be mainly in its
unphosphorylated (active) form in E-cadherin-depleted cells, and which is required for EMT
(Onder et al., 2008). However, β-catenin was shown not to be sufficient to induce complete EMT
phenotypes, pointing to other roles of E-cadherin than immobilizing β-catenin. Using Microarray
hybridization, these authors revealed that 84% of the gene expression changes upon E-cadherin
silencing were not dependent on β-catenin. Some of these genes were up-regulated (Twist, ZEB-
1, N-cadherin, vimentin, fibronectin, and collagens) while others were down-regulated (mainly
cytokeratins), in accordance with the general patterns seen during EMT.
TGFβ, the major EMT-inducing pleiotropic cytokine, has been shown to down-regulate
epithelial cell contact molecules and especially E-cadherin in various cells (Cano et al., 2000;
Olmeda et al., 2007). However, the central observation that led our lab to develop the two-hit
paradigm was that TGFβ, when added to an intact, fully confluent epithelial monolayer, was
neither able to transform the epithelial cells, nor to induce SMA expression i.e it was insufficient
to induce EMyT (Masszi et al., 2004).
Intriguingly, injury or loss of intercellular contacts fully restored the EMyT-provoking capacity
of TGFβ. This was achieved either by subconfluence, or scratch wounding or disruption of Ca2+-
dependent contacts using low-Ca2+ medium (LCM) (Figure 6). The uncoupling of E-cadherin by
LCM has been shown by our lab to be a strong activator of RhoA and MRTF (an important
transcription factor introduced in part 1.3 and described in detail in part 1.5) translocation,
leading to enhanced EMT (Fan et al., 2007; Masszi et al., 2010). Another group confirmed the
32
role of contacts, showing that indeed the integrity of AJs as opposed to TJs is the critical factor
(Busche et al., 2008), The simplicity and the capacity to induce fast and synchronized contact
disruption made LCM our primary means to model contact injury.
From these studies the concept has emerged that the intercellular contacts are not merely passive
targets, but are important active elements in the process of EMT (Masszi et al., 2004; Fan et al.,
2007). The direct involvement of contact injury in the initiation of EMT has been substantiated
by the finding that MMP (rMMP-3)-induced shedding of E-cadherin is a key input for EMT in
tubular cells (Zheng et al., 2009). Indeed, our view that contact disruption is a major
predisposing factor for EMT has been recently reinforced by several other investigators (Busche
et al., 2008; Kim et al., 2009; Chen et al., 2012). Nonetheless, the underlying mechanism
remained largely unknown. The first part of the result chapter (part 4) will depict a mechanism
involving the E-cadherin binding partner, β- catenin. The β- catenin structure and function is
described in the following section.
33
1.4.2 β-catenin
β-catenin is a scaffold protein and an important component of the AJs. It is bound to the CBD of
the cytoplasmic end of E-cadherin, as part of the plaque complex at the cytoplasmic side (Figure
4). β-catenin is a member of the catenin family (including α-catenin and γ-catenin= plakoglobin)
and an important target of the Wnt signaling pathway (Gavard and Mege, 2005; MacDonald et
al., 2009). β-catenin is central to this work due to its dual function: first it is an important
component of AJs and second it is a mediator of intracellular signaling both as an interactive
partner for various proteins and as a transcriptional co-activator (after its translocation into the
nucleus). Accordingly, through the release of β-catenin, E-cadherin loss can result in the
activation of specific downstream signal transduction pathways reprogramming the cell.
1.4.2.1 Structure and function of β-catenin
β-catenin is a 781 amino-acids (in human) protein, which was found to be a member of the
armadillo family of proteins. This family has multiple copies of the so-called armadillo repeat
domain, first identified in the Drosophila, a segment polarity gene armadillo. Later, these repeats
were also found in the mammalian armadillo homolog β-catenin.
β-catenin is composed of a 130 amino acid N-terminal domain, a central region composed of 12
armadillo repeats of 42 amino acids, and a C-terminal domain of 100 amino acids (Figure 8). The
N-terminus contains multiple phosphorylation and ubiquitination sites, important for the
stabilization of β-catenin, as well as its α-catenin binding site. The C-terminus contains the
transactivation domain as well, which is responsible for the transcriptional activity of β-catenin.
The armadillo region, which is organized in three helices, forms a positively charged groove,
involved in many protein-protein interactions, including those with E-cadherin, APC
(Adenomatosis Polyposis Coli) and TCF/LEF (T cell factor/lymphoid enhancing factor)
(Figure 7).
In the epithelium, one major pool of β-catenin is bound to the juxtamembrane domain of E-
cadherin, while the other pools exist as “free” β-catenin that can be associated with the
34
cytoskeleton, may be in complex with other cytosolic proteins or may be in the nucleus, where β-
catenin acts as transcription factor (Tian and Phillips, 2002).
From a functional standpoint, β-catenin, as a component of the AJs, is important for the
stabilization of the adhesion complex. Indeed, it protects E-cadherin from proteolysis (Huber et
al., 2001) and by binding to components of the cytoskeleton, it also regulates local actin
polymerization, as described above (Drees et al., 2005; Vasioukhin et al., 2000) (Figure 4). The
binding between cadherin-catenins is regulated by a variety of kinases and small GTPases, which
affect junction maturation, strength and turnover (Ishiyama et al., 2010; Gumbiner, 2005; Smith
et al., 2012). Moreover, the association between β-catenin and E-cadherin is crucial for
translocation of the adhesion molecule from the endoplasmic reticulum to the cell membrane
(Chen et al., 1999).
As a transcription factor, β-catenin is a central mediator of the wingless (Wnt Canonical)
signaling pathway. This pathway was initially described in the context of normal wing
development of Drosophila (Babu, 1977). In presence of Wnt ligand (Wnts glycoprotein: 19
members in human), β-catenin is stabilized in the cytoplasm. It then can translocate to the
nucleus, binds to the transcription factors of the lymphoid enhancer factor-T cell factor
(LEF/TCF) family (Riese et al., 1997) and target the transcription of genes such as cyclin D1 and
c-myc (Myelocytomatosis oncogene cellular homolog) (Cadigan and Nusse, 1997). Importantly a
large number of β-catenin target genes has been identified, many of which are involved in the
regulation of cell cycle, proliferation and growth, (e.g. Cyclin D1, C-Myc, C-Jun, VEGF),
extracellular matrix remodeling (fibronectin, MMP-2. MMP-7, MMP-9, uPAR) transcriptional
control and differentiation (brachyury, Sox2, Sox9, basic-helix lop helix factors) and cell-cell
adhesion (E-cadherin, claudin-1) just to mention a few (Nelson and Nusse, 2004; Klaus and
Birchmeier, 2008). Importantly many of these gens are affected during EMT (see section 1.3, 1.5
and 1.6).
35
1.4.2.2 The regulation of β-catenin
β-catenin is regulated by various sites phosphorylation (i.e Y489, Y654) (Tian and Phillips,
2002; Hartsock and Nelson, 2008). Tyrosoine phosphorykation of β-catenin by proto-oncogenes
or oncogenic kinases of the Src and Fer/Fps families have been shown to promote its uncoupling
from E-cadherin (Behrens et al., 1993; Piedra et al., 2003), which contributes to the ensuing
malignant transformation. The most important control of β-catenin occurs through its tightly
regulated degradation, a process primarily governed by the Wnt pathway. In absence of Wnt
ligands, the amino terminal region of β-catenin, is phosphorylated by Casein Kinase Iα (CKIα)
and Glycogen synthase kinase-3 (GSK-3e) at Ser/Thr residues (Ser45, Ser33, Ser 37, Thr41),
36
resulting in its ubiquitination and subsequent proteasomal degradation (Aberle et al., 1997). For
efficient phosphorylation by GSK-3 cytosolic β-catenin should form a complex with two adaptor
proteins, APC and Axin. Mutations that prevent formation of this complex (in either protein)
lead to excessive β-catenin accumulation and malignant transformation (Morin et al., 1997;
Korinek et al., 1997). In presence of Wnt ligand(s) the GSK-3β activity is inhibited, preventing
β-catenin ubiquitination and elimination, thereby increasing its cytoplasmic level, which is a
temporally controlled signal during development and regeneration (Muller et al., 1999;
MacDonald et al., 2009). Importantly, other pathways, including the non-canonical TGFβ
signaling have also been shown to inhibit GSK-3β through Akt kinase-mediated
phosphorylation, thereby rescuing the β-catenin kinase-mediate degradation (Delcommenne et
al., 1998; Naito et al., 2005; Chang et al., 2012).
1.4.2.3 Role of β-catenin in EMT
Altered β-catenin signaling has been known for a long time as a key oncogenic factor in
colorectal cancer, medulloblastoma, melanoma, ovarian cancer and other malignancies (Behrens,
2000; Giangreco et al., 2012). The discovery of the disease-causing mutation of the APC, as a
main partner of β-catenin, had placed β-catenin in the focus of cancer research (Morin et al.,
1997). Later, β-catenin signaling has indeed been identified as a contributing factor to cancer
EMT, which represent a frequent phenomenon during carcinogenesis and metastasis formation
(Morin et al., 1997; Behrens, 2000; Giangreco et al., 2012). However, evidence is accumulating
that β-catenin plays an important role in regulating tissue plasticity or EMT-like processes in the
context of normal development, regeneration (wound healing) (Cheon et al., 2005) and non-
malignat pathologies (fibrosis) as well (Bowley et al., 2007; Kevin K Kim, 2009). While the
developmental roles of β-catenin will not be discussed here, it is worth mentioning that this
molecule is indispensible for the formation of the endocardial cushion, which occurs through
developmental EMT (Liebner et al., 2004). In addition, during dermal would healing β-catenin
levels showed time-dependent changes and correlated with the proliferative phase of the process
(Cheon et al., 2005).
Substantial literature supports the notion that β-catenin is an important mediator of fibrogenesis
as well. β-catenin stabilization, using transgenic mice was shown to be sufficient to cause
37
aggressive fibromatosis (Cheon et al., 2002) and hypertrophy (Deng et al., 2008). More
specifically, increased Wnt signaling has been observed during experimental kidney fibrosis
(Surendran et al., 2005; He et al., 2009).
Regarding the development of MFs through EMyT, previous work from our lab has
demonstrated that a chelation of cytosolic β-catenin by a truncated N-cadherin molecule inhibits
SMA expression (Masszi et al., 2004), placing it as an important player in the myogenic
program. Other groups also implicated β-catenin in smooth muscle differentiation and SMA
expression (Gosens et al., 2008), i.e during the development of aortic valve disease (Chen et al.,
2011). However, the mechanism by which β-catenin promotes SMA expression was not
unveiled, prompting us to investigate this problem.
Recent studies, conducted in parallel with our own investigations, have shown that crosstalk
between β-catenin and Smad signaling contributes to EMT during lung fibrosis and will be
described in part 1.6 (Kevin K Kim, 2009; Tian and Phillips, 2002; Zhang et al., 2010; 2007).
The recent discovery from our lab about the inhibitory effect of Smad3 on the myogenic program
provided us with a new point of entry to investigate the action of β-catenin in EMyT (see part
1.7).
1.4.3 PTEN
Looking at a potential effect of E-cadherin absence or uncoupling on Smad3 stability, we were
searching for a potential intermediate factor. As during our investigations PTEN (Phosphatase
and Tensin Homolog Deleted on chromosome 10) emerged as an important factor linking cell
contacts to the regulation to SMA expression (Chapter 5) a brief description of this important
molecule is warranted. PTEN is a potent protein and lipid phosphatase and a tumor suppressor
(LI et al., 1997; Steck et al., 1997). It contains 403 amino acids in human, with an N-terminal
phosphatase domain, a PDZ domain (membrane anchoring) and a C2 lipid-binding domain
(Figure 8). It also contains a PIP-bidning domain (H-C-K-A-G-K-G-R) contributing to binding
and the conversion of phosphatidylinositol-3,4,5- trisphosphate (PIP3) to phosphatidylinositol-
4,5-bisphosphate (PIP2) through dephosphorylation (Maehama and Dixon, 1998).
38
As PIP3 is the major activator of the PI3K/Akt pathway, which in turn plays a central role in cell
proliferation and cancer EMT (Thiery JP, Nat Rev cancer 2002) (Larue, L Nature 2005; Bakin,
A.V, JBC 2000; Grille, S.J, caner Res 2003), the loss of PTEN is associated with carcinogenesis
and tumor EMT (Wang, H, Cancer Res 2007; Leslie, N.R, Current Biol 2007). Much less is
known about the contribution of PTEN in fibrotic EMT. Nonetheless, increasing evidence
supports the involvement of impaired PTEN function in fibrogenesis. Thus, decreased PTEN
expression was found in lung fibrotic foci of IPF patients (White, AJRCCM 2006), and in
cirrhosis models (Li Sen Hao, APMIS 2009). Loss of PTEN in fibroblasts was also associated
with skin fibrosis. (Parapuram et al., 2011) or systemic sclerosis (Bu et al., 2010). Further, two
recent reports propose that enhanced or preserved PTEN function may have some therapeutic
effect in fibrosis. Specifically, overexpression of PTEN, through recombinant adenovirus led to a
curative effect in rat liver fibrosis induced by CCl4 (Xiaolan Zhang, ABSTRACT AASLD
2011). Correlation was also found between tissue expression of PTEN and decreased collagen (I
and III) and SMA expression (Xiaolan Zhang, ABSTRACT AASLD 2011). Another study
demonstrated that transduction of human subconjunctival fibroblasts with a fusion protein,
containing PTEN and a cell permeability sequence, prevented the TGFβ-induced expression of
SMA and fibronectin (Chung et al., 2012). However, the underlying molecular mechanisms
remain to be elucidated.
While these observations clearly implicate PTEN as a potential regulator of EMyT-related SMA
expression, a more focused rationale for studying this particular phosphatase and its relation with
AJs components is described in chapter 2 and in the introduction of the result section (part 5).
39
40
1.5 MRTF and Cytoskeleton
The cytoskeleton remodeling, especially actin, is an important element of the EMT/EMyT
process and the mesenchymal or muscle-type structural reorganization of the cell (Masszi et al.,
2003). The small GTPase Rho, is a central player in the activation of cytoskeleton remodeling
and the induction of a contractile phenotype (Takai et al., 1995; Fan et al., 2007).
Among transcription factors, which participate to the cytoskeleton reprogramming, TGFβ driven
factors (see next chapter) include Snail1, Twist and ZEB are implicated (De Craene et al., 2005;
Yang et al., 2004).
Recently, a group of cytoskeleton-specific transcription factors named myocardin family
(myocardin, MRTF-A, and –B) (Miano et al., 2007; Miralles et al., 2003) has been described.
Two of them, the myocardin-related transcription factors (MRTF A and B, also known as MALs,
MKLs), are the activators of many genes regulating the cytoskeleton, including Actin, Integrin
β1, Myosin heavy and light chain and Vinculin (Olson and Nordheim, 2010).
Interestingly MRTF itself is regulated by the cytoskeleton, as shown in fibroblasts. Namely,
MRTF is bound to monomeric G-actin, through its RPEL motif (Arg-Pro-X-X-X-Glu-Leu) at the
N-terminus, in the cytosol of quiescent cells. Upon F-actin polymerization, G-actin dissociates
from MRTF RPEL regions, thereby unmasking the nuclear localization sequence and allowing
translocation of MRTF to the nucleus (Guettler et al., 2008) where it acts as transcriptional co-
activator (Miralles et al., 2003; Posern and Treisman, 2006). Moreover, the association of G-
actin with MRTF not only inhibits MRTF uptake but also facilitates MRTF efflux from the
nucleus (Vartiainen et al., 2007; Mouilleron et al., 2011).
As said, MRTF act as a specific co-activator through its association with the serum response
factor (SRF), forming a transcriptional complex (Wang et al., 2002; Miralles et al., 2003). SRF
binds to MRTF through the basic domain (B) and glutamine-rich region (Q), at the level of the
LKYHQYI sequence (Zaromytidou et al., 2006).
This complex then binds to promoters through the CC(A/T)richTT motif, or so called CArG box
mentioned just above (Tomasek et al., 2005; Sun et al., 2006). The structure/interaction of MRTF
and SRF are described in Figure 9.
41
The fibroblast-specific protein 1 (FSP-1), the initial marker of fibroblast transformation used in
EMT (Strutz et al., 1995), is a central element of cytoskeletal remodeling and is regulated by a
proximal promoter element called fibroblast transcription site–1 (FTS-1) (Okada et al., 1997).
This promoter is regulated by CArG box–binding factor–A (CBF-A) and KRAB-associated
protein 1 (KAP-1), a complex of 2 proteins that bind to it (Venkov et al., 2007). The classical
EMT targets, E-cadherin, β-catenin, ZO 1, vimentin, α1- collagen I, Twist, Snail and α–smooth
muscle actin, are also inducible by the CArG box–binding factor–A (Venkov et al., 2007).
42
43
The SMA gene, contains a promoter with several cis-elements, including an E-box, Smad
Binding Element (SBE), CC(A/T)richTT motif (CArG-box) and TGFβ control element (TCE)
(Figure 10). The various transcription factors implicated (E-protein, MyoD, MRTF, Myocardin,
SRF, Kruppel-like factors and Smad3) target the different cis-elements and interact with each
other, thereby modulating the transcriptional activity. However the most important cis-element,
which proved to be the key determinant of SMA expression in various tissues, is the CArG box
(Tomasek et al., 2005). This element is targeted the MRTF/SRF complex.
SRF is a dual-function transcription factor, which supports two main disparate roles: either a
growth promoting one during embryonic development (Barron et al., 2005) and regeneration, or
a muscle-differentiation one through the activation of the myogenic program (Hautmann et al.,
1999; Miano et al., 2007). The SRF binding with MRTF, one of its co-activators, forms the
myogenic complex, and confers muscle specificity to SRF (Wang et al., 2002).
One of the strong stimuli leading to MRTF nuclear translocation is the disassembly or injury of
cell contacts in the epithelium (Fan et al., 2007). Our lab observed that uncoupling of cell
contacts in an epithelial monolayer with LCM, regulates epithelial-myofibroblast transition via a
Rho-ROK and phospho-MLC (Myosin light Chain)–dependent nuclear accumulation of MRTF
(Fan et al., 2007). Further LCM-induced contact uncoupling also activates Rac, (Sebe et al.,
2008; Busche et al., 2008), which in turn stimulates p21-activated kinase (PAK) and p38 MAPK,
a pathway that also contributes to MRTF uptake. Importantly, MRTF is a necessary step for
SMA expression during EMyT (Tomasek et al., 2005; Fan et al., 2007; Elberg et al., 2008) as its
downregulation prevents or mitigates this response, and it is an important connecting element
between the contact injury and the induction of the cytoskeleton genes (See prelude to results)
(Masszi et al., 2010). Nevertheless, MRTF translocation alone induced by contact disassembly is
insufficient for SMA expression, and the activation of the TGFβ pathways is also necessary for
EMyT. One of the mechanisms that underlie the collaboration of the contact injury-provoked and
TGFβ-induced signaling is described in the “prelude to result” chapter (part 1.7) and in the result
section (part 4 and 5).
In summary, the main signals linking contact uncoupling or injury with EMT - and particularly
the expression of SMA through the myogenic program- are the Rho pathway (Fan et al., 2007)
44
and the β-catenin pathway (Masszi et al., 2004). In addition, since TGFβ is a central element, the
connection or synergy of action between cell-contact disruption and TGFβ needs to be addressed.
45
1.6 The TGFβ pathway and EMT
The TGFβ family is a member of the of the transforming growth factor beta superfamily, which
includes bone morphogenetic protein (BMP), decapentaplegic, activin, anti-müllerian hormone,
inhibins and Vg-1. A variety of different cells can produce TGFβ, including macrophages and
oher immune cells, fibroblasts and the epithelium.
The cloning of TGFβ revealed a precursor protein of 391 amino acids (aa), with the C-terminal
(112 amino acids) constituting the mature protein (Derynck et al., 1985). It contains a signal
peptide of 29 aa and a pro-protein of 361 aa. The pro-TGFβ protein is transformed by a
convertase and secreted mostly in its latent form, as a complex: the C-terminal active TGFβ (112
aa) and the N-terminal latency associated protein (LAP; 249 aa). It remains quiescent in the
tissues. It has to be activated by proteolysis (catalyzed by MMPs, thrombin, tryptase, elastase), or
by radiation, a change in pH, temperature or by mechanical stress (Hinz, 2006; Tomasek et al.,
2002). These factors induce the liberation of free TGFβ, which then exerts its biological effects.
In the field of EMT, the best studied member of the family is TGFβ1, despite some similar effect
of other members (TGFβ2 or 3). From now on, I will only discuss TGFβ1, designated the as
TGFβ.
TGFβ is a pleiotropic cytokine that affects a large variety of functions including including cell
growth, survival, differentiation, migration proliferation, adhesion, apoptosis, angiogenesis, and
immunity (Gordon and Blobe, 2008). However, considering it overall biological effects, TGFβ is
known to be a key modulator of three complex functions: 1) it has an immune-modulatory
(mainly immunosuppressive) role, as indicated by the fact that its absence (e.g. in TGFβ KO
animals) leads to robust auto-immunity (Yaswen et al., 1996); 2) it has a dual and biphasic role
during carcinogenesis, namely early on it exerts tumor-suppressive effects (growth arrest), while
at later stages it has pro-invasive and survival (anti-apoptotic) effects. 3) Numerous lines of
evidence have placed TGFβ as a crucial inducer of EMT in vitro (Miettinen et al., 1994) and in
vivo (Pelton et al., 1990).
46
1.6.1 TGFβ pathways
TGFβ acts though well characterized ubiquitous, serine-threonine kinase receptors (Lin and
Moustakas, 1994). It binds to the type II receptor, which is a constitutively active kinase, leading
to the recruitment and the phosphorylation of the type I receptor. The receptor I kinase will then
phosphorylate the receptor-activated (R-)Smads, Smad3 and Samd2 at their C-terminal SSXS
motif. The R-Smads then form a complex with Smad4 (the so called co-Smad), which
translocates to the nucleus, thereby leading to target gene transcription through Smad binding
elements (SBEs) (Figure 11). As Smad3 is a central molecule for the present work, its structure
and the description of the different phosphorylation site are described in Figure 11. The Smad3
gene, named MADH3 is localized on the chromosome 15 (q21-q22). The Smad3 protein is
composed of 425 amino acids (in human), with two conserved domains at N-terminal (MH1)
and c-terminal (MH2) ends that are separated by a proline-rich linker region. The MH1 domain
contains the DNA binding activity, which is vital for the transcriptional activation of specific
target genes. The MH2 domain mediates differential association with a wide variety of proteins.
The regulation of Smad3 metabolism or degradation are brought about through various
posttranslational modifications, including phosphorylation (Feng and Derynck, 2005; Matsuura
et al., 2004), ubiquitination (Fukuchi et al., 2001; Izzi and Attisano, 2004), acetylation (Oussaief
et al., 2009) and SUMOylation (Imoto et al., 2008). These events impact on the fate of the
molecule by changing its nuclear shuttling, affinity for protein partners, transcriptional activity,
and stability/degradation (Wrighton et al., 2008; Liu and Feng, 2010; AlarcOn et al., 2009; Gao
et al., 2009; Aragon et al., 2011). The binding partner will influence Smad3’s transcriptional
capacity, shuttling or fate, as described in the present chapter and the result chapter (part 5).
While nuclear uptake (and thus transcriptional activity) of Smad3 is primarily dictated by
receptor-mediated C-terminal phosphorylation, the modification of Smad3 activity and stability
is brought about by phosphorylation at other sites, primarily at various sites in the linker region.
This can be catalyzed by various kinases (Kretzschmar et al., 1999; Matsuura et al., 2004; Mori
et al., 2004) including c-Jun N-terminal kinase (JNK), extracellular signal-regulated kinase
(ERK), p38 MAPK and ROCK, cyclin-dependent kinase (CDK) (AlarcOn et al., 2009; Gao et
al., 2009) and GSK-3β (Fuentealba et al., 2007; Sapkota et al., 2007).
47
48
The activation of the Raf/Ras pathway is also reported to lead to the down-regulation of Smad3
in EMT, however the underlying mechanisms are unknown (Nicolas et al., 2003).
These modifications may enhance (or decrease) R-Smads’ transcriptional activity (Sapkota et al.,
2007; Mori et al., 2004; Kamaraju and Roberts, 2005), but at the same time they may also prime
for subsequent degradation (Mavrakis et al., 2007).
Various Thr and Ser phosphorylations in the linker region of Smad3 have been proposed to be
responsible for the nuclear Smad3 uptake, for controlling Smad3 degradation via promoting
ubiquitination (Gao et al., 2009; Aragon et al., 2011).
Two examples are the phosphorylation of T66 in the MH1 region, which has been reported to
facilitate the basal (constitutive) degradation of Smad3 (Guo, X et al.,2008), while residues in the
linker region, particularly T179, were shown to facilitate stimulus (TGFβ)-induced degradation
(Gao et al., 2009; Aragon et al., 2011).
In fact, the phosphorylation of these residues has been recently suggested to promote
proteasomal degradation of Smad3. There is accumulating evidence supporting the fascinating
notion that enhanced nuclear translocation and transcriptional activity may be a prerequisite for
subsequent robust degradation (Aragon et al., 2011). This concept, termed the “Smad action
turnover switch” was based on finding that phosphorylation at various sites in the linker region
(e.g catalyzed by CDK8/9) creates binding sites for transcriptional co-activators (such a Pin or
perhaps TAZ), but also primes for a second phosphorylation (e.g. by GSK3β) in the linker
region, which facilitates the association of Smads with ubiquitin ligases like Nedd4L (Gao et al.,
2009) or ROC1. The former induces the formation of ubiquitin of complex and the ubiquitination
of Smad3 (Fukuchi et al., 2001). Cyclin- dependent kinases, CDK8 and CDK9, enhances Smad
transcriptional action before triggering Smad turnover (AlarcOn et al., 2009). Thus, enhanced
activity is followed by rapid degradation.
Various phosphatases have been reported to dephosphorylate Smad3 in the nucleus. One of them,
the nuclear protein phosphatase 1A (PPM1A), was found to be stabilized by PTEN (Bu et al.,
2008). Currently it is unknown if PTEN or other phosphatases could act directly, in a similar
manner, with regards to linker phosphorylation sites.
49
Beside the canonical TGFβ induced pathways, non-Smad pathways can be activated. The
activation is driven through signaling mediator or adaptor proteins, interacting directly with the
TGFβ receptor I or II (Moustakas and Heldin, 2005). The main pathways are Ras/MAPK, the
small GTPase Rho/Rho kinase, the PI3-kinase and the tyrosine kinase Src. The MAP kinases
JNK (c-Jun N-terminal kinase) and p38 mitogen-activated protein kinase (p38 MAP-Kinase)
can be activated through the recruitment of the ubiquitin ligase TRAF6 (Sorrentino et al., 2008;
Zhang, 2009). Other regulatory process can participate to the modulation of TGFβ signaling, like
internalization (Hautmann et al., 1999; Hayes et al., 2002) or intracellular receptor (TGRI)
cleavage by the metalloprotease TACE (Mu et al., 2011).
1.6.2 TGFβ in EMT
TGFβ is the most potent inducer of fibrosis and EMT (Thiery et al., 2009).
In vitro or in vivo interference with the TGFβ receptor, through chemical inhibitors, dominant
negative constructs or antibodies (Valcourt et al., 2005; Lamouille and Derynck, 2007) are
indeed able to reverse the EMT process. Moreover, the excessive production of TGFβ is
associated with renal, pulmonary, liver and cardiac fibrosis (Schnaper et al., 2003; Willis and
Borok, 2007; Gressner et al., 2002; Zeisberg et al., 2007a), a finding that underlies the potential
relationship between EMT and fibrogenesis.
The R-Smads, particularly Samd3, play an important role as an inducer(s) of EMT and fibrosis
(Xu et al., 2009; Lamouille and Derynck, 2011; Wendt et al., 2009). Earlier studies, using Smad3
knockout animals (Ashcroft et al., 1999), showed reduced EMT and fibrogenesis in models of
kidney (Sato et al., 2003), lung (Bonniaud et al., 2004), lens (Saika et al., 2004) and skin fibrosis
(Lakos et al., 2004). Conversely, KO animals showed accelerated wound healing (Falanga et al.,
2004). However, the use of pharmacological or selected alteration of Smad signaling indicated
that Smad signaling is not sufficient to induce EMT (Yu et al., 2002).
TGFβ regulates the expression of a large number of proteins and modulate transcription factors
in a Smad-dependent manner. Smad3 acts as a direct transcription factor or as a co-factor. Since
Smads, and particularly Smad3, is key to the TGFβ-induced EMT (Roberts et al., 2006), and is
50
central to our lab’s research, I will present first the EMT signaling related to this particular
protein.
The transcription factors implicated in EMT and regulated in a Smad-dependent manner, are
Snail, ZEB, Twist and bHLH (=Helix-loop-helix) (see table). Snail 1 and/or Snail 2 (=Slug) are
Zinc finger transcription factors, and their induction is reported in many EMT models (Nieto,
2002; Barrallo-Gimeno and Nieto, 2005; Thuault et al., 2006). They activate the expression of
mesenchymal proteins (collagen III and V, Fibronectin, N-cadherin), repress epithelial genes (E-
cadherin) (Cano et al., 2000; Olmeda et al., 2007), and in the case of Snail 1 provoke actin
remodeling (De Craene et al., 2005).
Smads strongly suppress E-cadherin genes through their interaction with zinc finger factors
ZEB1 and ZEB2 (Postigo et al., 2003) and through the upregulation of MMPs (Zheng et al.,
2009). The Slug induction is driven through the complex formed by Smad3 and MRTF, which
bind to and drive the Slug promoter through non-classical SBEs (Morita et al., 2007). The ZEB
family transcription factors induced by TGFβ, can interact with Smad3, which indirectly repress
the expression of epithelial genes (Postigo et al., 2003) and directly inhibit E-cadherin (Comijn et
al., 2001) or tight junction (Vandewalle et al., 2005) expression, at their promoter level.
Moreover, the upregulation of MMPs by Smad3 will indirectly lead to the injury of cell contacts
(Zheng et al., 2009). ZEB can also interact with Smad3 and SRF, and these interactions have
synergistic effect on the transactivation of SMA and smooth-muscle myosin heavy chain in
vessels (Nishimura et al., 2006). In addition ZEB is able to upregulate mesenchymal proteins
(Vimentin, N-cadhern, MMP2).
Another group of transcription factor, controlled by the TGFβR-Smad pathway, is the Helix-
loop-helix family, including Twist and class I proteins E12/E47. E12 and E47 directly suppress
E-cadherin through E-box element (Perez-Moreno et al., 2001). Twists 1 and 2 are upregulated in
many tumors (Yang et al., 2006), and can synergize with Ras, a small GTPase, to induce EMT
(Ansieau et al., 2008). They are also able to repress the expression of contact proteins, like E-
cadherin, claudin-7 or occludin, and increase mesenchymal proteins, like Vimentin or N-
cadherin (Yang et al., 2004).
51
In addition, Smad3 can induce a large number of genes through the SBEs many of which encode
constituents or regulators of the ECM. Indeed, the expression of several collagen isoforms
(Collagen I, A2), fibronectin, (Zhang et al., 2000; Isono et al., 2002), various matrix
metalloproteinases and their inhibitors, as well as ECM-cell interaction receptors (like β1-
integrin) (Verrecchia et al., 2001) are all regulated by Smad3. (Yeh et al., 2010). Furthermore,
Smad3 is a direct inducer of plasminogen activator inhibitor-1 (PAI-1) (Dennler et al., 1998;
Eddy and Fogo, 2006) and connective tissue growth factor (CTGF) (Arnott et al., 2008),
mesenchymal markers and strong inducers of fibrosis (Dennler et al., 1998; Eddy and Fogo,
2006). Clearly, Smad3 is a major factor responsible for excessive ECM deposition and scarring
during fibrosis (Roberts et al., 2006).
Interestingly, in opposition to the widely spread positive effect of Smad3, our group has shown a
partially negative role through its inhibitory effect on the MRTF-dependent SMA expression (see
part 1.7). Other groups reported that the absence of Smad2 was able to enhance skin tumor
formation and EMT by increasing Snail expression (Hoot et al., 2008). In addition, silencing of
Smad2 or its endocytic adaptor protein SARA (Smad Anchor for Receptor Activation) enhances
EMT. However, the association of phospho-Smad2 with phosphorylated β-catenin after contact
injury and integrin activation is reported in EMT and pulmonary fibrosis (Kevin K Kim, 2009;
Kim et al., 2009). Finally, knockdown of Smad4 decreases metastases or suppresses collagen 1
synthesis in vivo (Deckers et al., 2006; Kaimori et al., 2007).
Beside the canonical TGFβ-induced pathway, non-Smad pathways are also activated and were
found to be necessary for EMT (Derynck and Zhang, 2003; Valcourt et al., 2005) in various
models. Thus, the participation of ERK, c-JNK, p38 MAPK, PI3 kinase/Akt and Rho/Rho kinase
pathways have all been documented in TGFβ-induced EMT (Bhowmick et al., 2001). The
relative contribution of these signal transducers varies in a cell- or tissue-specific manner.
52
1.6.3 Crosstalk with TGFβ pathways
Modulation and crosstalk between canonical and non-non canonical TGFβ pathways are
involved in EMT. As a first example, ERK can phosphorylate Smad2 and increase its
transcriptional activity (Funaba et al., 2002). Another example of cooperation between TGFβ and
the Ras-ERK MAPK pathway was reported, showing the necessary concomitant activation of
Mitogen-activated protein kinase kinase (MEK or MAPKK), for TGFβ1 induced EMT in thyroid
epithelial cells (Grande et al., 2002). In addition, many of these kinases (Rho/ROCK, p38) are
able to modify Smad3 linker region phosphorylation, thereby modulating Smad3’s
transcriptional activity (Kamaraju and Roberts, 2005; Wang et al., 2009).
Finally, a crosstalk between the Wnt and the TGFβ-Smad signaling pathway, involving β-catenin
has been reported by different groups including our own (Tian and Phillips, 2002; Attisano and
Labbe, 2004; Kevin K Kim, 2009; Charbonney et al., 2011). Their interaction can occur at
different levels; for example, the disassembly of AJs leads to the physical interaction of Smad3
and β-catenin (Tian et al., 2003; Tian and Phillips, 2002) or the formation of a complex between
β-catenin and pSmad2 (Kim Y, JCB 2009). β-catenin itself can inhibit Smad3 signaling (Zhang
et al., 2007). In contrast, TGFβ is responsible for β-catenin accumulation via its stabilization and
can activate its signaling through Smad3. Indeed Smad3 interacts with β-catenin prevents its
degradation, increases its nuclear translocation and signaling, at least in chondrocytes (Li et al.,
2006b; Zhang et al., 2010). Interestingly, LEF-1 can also be activated by binding to either β-
catenin or Smad proteins (Labbe et al., 2000). As a last an example, Snail is positively regulated
by β-catenin (Kim et al., 2002) and conversely it can stimulate the Wnt pathway (Stemmer et al.,
2008). These findings point to a complex regulatory interplay between TGFβ signaling and β-
catenin.
53
1.6.4 TGFβ is not sufficient for epithelial–mesenchymal-myofibroblast
transition: the involvement of other inputs
Although TGFβ is one of the main inducers of EMT, a substantial body of work indicates that in
many systems it is not sufficient for EMT. Our group has shown that an injury to (or absence) of
the intercellular contacts (Masszi et al., 2004; Fan et al., 2007) is also required for the process;
remarkably, an intact, confluent epithelium is resistant to the EMT-inducing effect of TGFβ. A
second input increases susceptibility to TGFβ and facilitates EMT.
This second input or second hit can manifest in different forms: it may originate from enhanced
contractility (Wipff et al., 2007), higher matrix stiffness (Hinz, 2009), activation of integrins
(Kim et al., 2009; 2008) and finally loss or injury of the intercellular contacts (Masszi et al.,
2004; Fan et al., 2007; Zheng et al., 2009). These secondary inputs can themselves be affected by
TGFβ ; e.g. TGFβ downregulates further intercellular contacts, (Cano et al., 2000; Olmeda et al.,
2007) enhances contraction through SMA expression, thereby providing a positive feedback for
EMT.
Our group then proposed a two-hit paradigm and showed that TGFβ and contact injury synergize
at the level of the SMA promoter (Masszi et al., 2004; Fan et al., 2007).
In the next chapter I will describe relevant results by our group, which form the foundation of the
core findings (result section) of the present thesis. These findings concern the surprising
discovery that Smad3 plays a dual role in EMT: while it supports mesenchymal transition, it
delays the activation of the myogenic program via MRTF.
54
1.7 Prelude to results: The inhibitory role for Smad3 in epithelial-myofibroblast transition: contact disruption is sufficient for transformation when Smad3 is absent
The material presented in this chapter has been published previously in J Cell Biol. 2010 Feb 8;188(3):383-399 (Masszi A et al., 2010)
Web link: http://jcb.rupress.org/content/188/3/383.full.pdf+html?sid=cc0499bf-1ef6- 4239-ba13-ebc33b970f39
The following section represents the foundation on which the core results of this PhD work were
developed. Namely, our lab recently found that Smad3 is a strong inhibitor of the SMA-inducing
effect of MRTF and a delayer of the myogenic program. Accordingly, Smad3 degrades during
EMyT, which releases the action of MRTF (Masszi et al., 2010). These findings prompted us to
investigate the EMyT-promoting action of β-catenin from a new angle and led to the elucidation
of new mechanism described hereafter. In addition, it gave us the opportunity to investigate how
Smad3 degradation, known to be associated with phosphorylation of various Ser or Thr residues
in the Smad3 linker region (Wang et al., 2009), can be impacted by the injury or loss of AJ.
I participated actively as a co-author in this work. It is therefore logical to present these data, and
my involvement in this work as a continuum, before depicting the main results of my thesis.
I will only describe the key findings and highlight a few experiments of this already published
work, to the extent that is necessary to provide the context of the main focus of my thesis
(Masszi et al., 2010). The Figures will be displayed as formatted in the original publication, but
with a different numbering.
Smad proteins (Smad2 and Smad3 essentially) are main transcription factors downstream of the
TGFβ receptor. They have been extensively studied in the context of EMT and fibrosis (Kalluri
and Neilson, 2003; Phanish et al., 2006; Meng et al., 2010). Their effect on many modulators of
EMT (i.e : CTGF, integrins, Snail, PAI-1, etc…) are well described, however the mechanism
through which they impact SMA expression is not well understood.
As stated in the introduction, our lab showed that both an injury of intercellular contacts ([LCM]
or wounding) and TGFβ are required to induce SMA expression in kidney epithelial cells
(Masszi et al., 2004). Moreover MRTF translocation (signaling) alone, as induced by contact
55
disassembly, is insufficient for SMA expression. It was then important to investigate how TGFβ
signaling could synergize with contact injury to induce the myogenic program Receptor Smads
(R-Smads), the direct targets of the activated TGFβ receptor kinase were the obvious candidates,
for the following reasons:
1) R-Smads mediate a variety of the fibrogenic effects of TGFβ (Xu et al., 2009)
2) The SMA promoter contains Smad- binding elements (SBEs), which specifically bind Smad3 (Hu et al., 2003)
3) Smad3 can bind (with its C-terminal end) directly to MRTF (Morita et al., 2007)
Based on this rationale, our central hypothesis was that Smad3 and MRTF act on their own cis-
elements on the SMA promoter and have an additive effect, thereby synergizing to promote
SMA expression. Alternatively, we considered that they might act in a complex on one or the
other, or both cis-elements.
First, it was important to demonstrate that MRTF is a key transcription factor for CArG-
dependent genes (Sun et al., 2006) especially SMA (Tomasek et al., 2005), in the two-hit model
of EMyT. In the presence of non-related siRNA (NR), the combined treatment (LCM + TGFβ)
induced SMA expression, as previously described (Masszi et al., 2004). MRTF siRNAs
completely abolished the response to the combined treatment for SMA expression. Moreover,
MRTF silencing also abolished the increased expression of filamin, myosin heavy chain, SRF,
CapZ or α1-integrin and completely abolished the expression of cofilin, even at baseline (Figure
12A).
As the SMA promoter harbors different cis elements including SBEs, TGF control element
(TCE) and CArG boxes we set out to analyze the contribution of these in the response to the
different conditions of the two-hit model using various SMA promoter luciferase constructs, in
which these elements were inactivated by specific mutations, either individually or in
combination (Fig. 12 B). Mutation of the SBEs or the TCE, i.e. the TGFβ-responsive elements
failed to inhibit the effects of the various treatments; in fact the latter rather enhanced it
compared to WT, upon LCM or combined treatment. Inactivating mutations in the CArG-A site
showed partial inhibition, whereas in the CArG-B box completely eliminated the effect (Figure
12 C).
56
57
58
Since the Smad3 C-terminus can directly bind to MRTF (Morita et al., 2007), we put forward the
hypothesis that Smad3 and MRTF might synergize on the CArG cis-elements. Using the same
SMA promoter luciferase reporter system, MRTF or Smad3 or both were co-expressed
exogenously. As expected, MRTF stimulated the WT as well as the SBE mutant, but not the
CArG-B mutant promoters. The mutation of all the SBE cis-element (Triple mutant) or TCE cis-
elements enhanced the response. Surprisingly the co-expression of Smad3 strongly inhibited the
MRTF-induced activation of the SMA promoter (Figure 13A). Smad3 expression alone was not
able to stimulate the promoter (Figure13A). Using N- and C-terminal Smad3 constructs, we
found that only the C-terminal one was inhibitory (Figure 13 B). From these observations we
concluded that Smad3 is able to inhibit the MRTF-triggered, CArG-mediated stimulation of the
SMA promoter. In addition we noticed that the use of an MRTF mutant, (unable to bind Smad3)
to drive the SMA promoter, could not be suppressed by Smad3, indicating that the interaction of
these molecules is a key factor. It is noteworthy that Smad2 overexpression was not inhibitory
(Data not shown).
To reconcile the fact that TGFβ is necessary for SMA expression while Smad3 is a negative
regulator of the promoter, the fate of Smad3 under the two-hit conditions was explored. LCM
induced a modest decrease of Smad3 expression over time, while the combined treatment
induced 90% reduction at 48h (Figure 14A). The steady state expression of Smad2 and Smad4
were not affected (data not shown). The decrease in Smad3 expression was attributed to both
suppressed transcription and elevated protein degradation (data not shown and further elaborated
in the Results section of this thesis). In conclusion, during myogenic stimuli, namely the
combined treatment, Smad3 degradation precedes the expression of SMA. Next, we tested the
association of Smad3 and MRTF upon short-term (1 h) vs long term (24h) LCM or combined
short-term treatment by immunopreciptiation. Upon short-term stimulus, the more effective ones
for the association of Smad3 and MRTF was LCM or the combination, but not TGFβ-alone. On
long-term treatment (24h), this association decreased upon combined but not upon LCM
treatment, probably secondary to the degradation of Smad3 and affinity changes (Figure 14B).
Thus, so far we have shown that 1) Smad3 interferes with MRTF by inhibiting its effect on the
SMA promoter, and 2) it is degraded in the two-hit model, thereby decreasing its association
with MRTF.
59
60
61
The next step was to show that the decrease of Smad3 plays a role in the reprogramming toward
SMA expression. Using Smad3 siRNA, we demonstrated that the reduction of Smad3 expression
enhances the association of MRTF and the CArG box of the endogenous SMA promoter (Figure
15 A), and increases SMA mRNA (data not shown). In addition, the measure of Smad3 level, at
different time-point of the combined treatment (0-48h) was inversely related to the SMA
promoter activity at the same time-points (Figure 15 B). At the protein level, the LCM treatment
alone was able to elicit SMA expression, in absence of Smad3 (Figure 15 C). Nevertheless, this
phenomenon was still dependent on MRTF, as the SMA expression disappeared when MRTF
siRNA was co-transfected with Smad3 siRNA (Figure 15 C).
At this point, the results indicated that Smad3 is a delayer of the myogenic program, and that its
elimination is coincident with, and appears to be necessary to stimulate EMyT.
Finally, in order to reconcile the newly recognized inhibitory role of Smad3 and its known pro-
EMT/fibrotic contribution, the expression of mesenchymal markers of EMT (as opposed to
SMA) were investigated. Indeed, as expected, silencing of Smad3 impaired CTGF and PAI-
protein expression as well as (PAI-1) mRNA (Figure 16 A and B). In contrast SMA mRNA was
enhanced upon TGFβ, when Smad3 was silenced (Figure 16 A).
In summary, the essential findings of this work are:
1) Contact injury (LCM) and TGFβ pathways target the CArG box cis-element of the SMA
promoter
2) Smad3 is an inhibitor of the myogenic program; TGFβ in conjunction with contact
uncoupling/injury facilitates the myogenic program by reducing Smad3 protein expression.
3) The formation of the myogenic complex (MRTF/SRF), the direct driver of the SMA promoter,
is facilitated by Smad3 downregulation.
Please refer to the original publication (Masszi et al., 2010) for the detailed experiments and
discussion.
62
63
64
65
In light of these observations, the functional interpretation of the two-hit model is the following:
a) Contact disruption via the ensuing Rho, Rac activation is necessary for the nuclear
translocation of the main myogenic co-activator, MRTF.
b) The addition of TGFβ will provoke the degradation of the inhibitory Smad3, thereby
liberating MRTF, allowing it to exert its transcriptional activity.
c) In addition, TGFβ also contributes to Rho/Rac activations (albeit in our cellular models this is
a relatively weak effect) and it prolongs the nuclear accumulation of MRTF (data not shown).
These findings have to be put in the context of the complex and often controversial role of
Smad3 in EMT and fibrogenesis. Indeed, a large literature suggests that R-Smads are key
transcription factors in the TGFβ induced EMT and fibrosis (Roberts et al., 2006). I will address
this potential discrepancy (or complexity) in the overall Discussion.
In conclusion, in the light of the above work Smad3 (suppresses) postpones the MRTF driven
myogenic program and seems to electively modulate the different phases of EMT/EMyT. This
discovery gave our lab a hint about the mechanism whereby β-catenin might promote the
transformation of epithelium into SMA producing MFs.
66
Chapter 2
Rationale, Aims and hypotheses
Rationale, Aims and hypothesis 2
2.1 Rationale
As an introduction, I would like to recapitulate the main concepts and previous findings form our
lab. Previous studies have identified two inputs (or triggers), the combined presence of which is
essential for the induction of EMT/EMyT in kidney epithelial cells. These are: the presence of
TGFβ and a concomitant injury to the intercellular contacts (Masszi et al., 2004). To indicate this
double requirement, we apply the term “two-hit” scenario. We have also shown that at least three
molecules that can act also as transcription factors, are key mediators or regulators of EMT and
EMyT.
These are: Smad3, MRTF and β-catenin.
Smad3 is activated by TGFβ, and the SMA promoter contains SBEs. However, quite
surprisingly, as described in the latter chapter, our recent results revealed that Smad3 does not act
via this “expected”, straightforward mechanism. We have shown that the two-hit condition
induces a dramatic drop in Smad3 levels during EMyT. Moreover, we discovered that Smad3 is a
strong inhibitor of the myogenic program and the subsequent SMA expression, as it interferes
with the action of MRTF (Masszi et al., 2010). Thus Smad3 is timekeeper or switch for the
myogenic program, and it may have to “disappear” somehow before EMyT can proceed. Smad3
degradation has been associated with phosphorylation of various Ser or Thr residues, primarily in
the middle (linker region) of the Smad3 protein (Wang et al., 2009).
MRTF is a transcriptional activator that regulates the expression of many muscle-related and
cytoskeletal proteins through CArGs (Miano et al., 2007; Morita et al., 2007). MRTF is primarily
regulated by Rho GTPases (Miralles et al., 2003; Parmacek, 2007). Specifically, Rho/Rac
activation-mediated F-actin polymerization facilitates nuclear accumulation of MRTF. Of
relevance to the current project, we have shown that cell contact disassembly induces the
67
translocation of MRTF into the nucleus by a Rho/Rho kinase dependent mechanism (Fan et al.,
2007; Sebe et al., 2008; Busche et al., 2008). This step is necessary but not sufficient for SMA
expression during EMyT: the other prerequisite is TGFβ.
β-catenin, an armadillo family scaffold protein of the AJ is the central molecule of the first part
of results presented in this thesis. β-catenin has been described to contribute to EMT (Liebner et
al., 2004; Eger et al., 2004) and fibrosis (He et al., 2009). It can be released from contacts upon
injury (Masszi et al., 2004; Kevin K Kim, 2009), and acts as a transcriptional co-factor.
In addition, previous work from our lab has shown that a truncated N-cadherin molecule, which
can chelate cytosolic β-catenin, inhibits SMA expression (Masszi et al., 2004). However, the
SMA promoter does NOT contain β-catenin-responsive TCF/LEF motifs, so the molecular
mechanism of action remained unresolved.
Given that β-catenin is able to interact with the Smad pathway (A) (Tian and Phillips, 2002;
Zhang et al., 2007) and our recent results showing that the SMA promoter is regulated by an
interaction between MRTF and Smad3 (B), it provided us with a new point of entry to address
the mechanism whereby contact components can influence SMA expression.
We asked whether β-catenin could be integrated into this emerging picture. Specifically, we
sought to establish whether a cross-talk between β-catenin and Smad3 might account for
enhanced SMA expression by altering the effect of Smad3 on the major promyogenic factor
MRTF.
(A) Present work, in the result chapter (Part 4)
(B) Masszi A et al. JCB 2010(Masszi et al., 2010)
68
2.2 Aims and hypothesis
The purpose of my research project was to establish a link between the loss of cell-cell contacts
and the enhancement of the myogenic program, leading to MF generation, the ultimate form
of EMT.
First, we hypothesized that β-catenin (uncoupled from E-cadherin upon contact disruption)
could be a key mediator between injury and SMA expression.
We then formulated the following hypotheses:
(1) Cell contact injury-induced release of β-catenin facilitates the interaction between
Smad3 and β-catenin
(2) The interaction of β-catenin with Smad3 prevents Smad3 from inhibiting the MRTF-
driven SMA activation.
(3) β-catenin has an impact on the promyogenic function of MRTF
Secondly, following on the central finding that Smad3 degradation is necessary to liberate the
myogenic program, we wanted to investigate the impact of AJ injury, and in particular the loss or
uncoupling of E-cadherin on Smad3 expression.
Interestingly, E-cadherin loss has been associated with a decrease in the expression of PTEN
(Phosphatase and Tensin Homolog Deleted on chromosome 10), a potent protein and lipid
phosphatase (LI et al., 1997; Steck et al., 1997). Furthermore, a decrease in PTEN has also been
associated with the accumulation MFs of IPF patients, while pharmacological inhibition of
PTEN’s phosphatase activity facilitated MF generation (White ES, AJRCCM 2006; Fournier
MV, Can Re 2009). Another example is the enhanced skin fibrosis associated with the loss of
PTEN expression by dermal fibroblasts (Parapuram et al., 2011).
69
Recently, a group reported how E-cadherin positively influence PTEN expression, through β-
catenin-mediated regulation of early growth response gene 1 (Egr1) (Lau et al., 2011). In
addition, PTEN was shown to associate with Smad3 (Hjelmeland, 2005). Taken together, the loss
of E-cadherin may lead to reduced PTEN expression, which in turn may result in increased
Smad3 phosphorylation at sites, particularly on the residue T179, which were shown to promote
Smad3 ubiquitination (Gao et al., 2009).
We hypothesized that:
(1) The two-hit model or absence of E-cadherin destabilizes PTEN
(2) Decreased PTEN expression contribute to Smad3 degradation
(3) The two-hit model enhances Smad3 phosphorylation (in its liker region), particularly at
the T179, through the decrease of the phosphatase PTEN.
The aims of the following experiments are twofold: First, to depict a mechanism whereby cell
contact injury, through β-catenin, affects the myogenic program and facilitates EMyT. Secondly,
to provide evidence whether manipulation of AJ integrity indeed affects Smad3 stability, and to
address one of the underlying mechanisms.
70
Chapter 3
Materials and Methods
Materials and Methods 3
3.1 General
The major part of the methodology has already been published elsewhere (Charbonney et al.,
2011). Regarding the methods for the data presented in the prelude chapter above, please refer to
the original publication (Masszi et al., 2010).
Adjunctions have been made to cover the material used in the result chapter: “The destabilization
of PTEN by contact injury promotes Smad3 degradation”.
For the sake of clarity, I’m going to describe all the methodology of the subsequent results
sections in this chapter.
3.2 Reagents
The GSK-3β inhibitor SB-216763 was purchased from Sigma-Aldrich (St. Louis, MO) and
TGFβ from R&D Systems (Minneapolis, MN). Commercially available antibodies were obtained
from various sources as follows: MRTF-B (C-19), SRF (G-20), HA (Y-11), c-Myc (9E10), β-
catenin (C-18), GSK-3α/β (0011-A), and GAPDH (0411), Santa Cruz Biotechnology (Santa
Cruz, CA); FLAG (M2) and SMA (1A4), Sigma-Aldrich; E-cadherin, CapZ α , and filamin A
(clone 5/ ABP-280), BD Transduction Laboratories (Lexington, KY); SMAD3, Abcam
(Cambridge, MA); HA.11 clone 16B12, Covance (Berkeley, CA); histones (clone
F152.C25.WJJ) and ubiquitin (P4D1), Millipore (Billerica, MA); phospho-Smad3 (Ser 423/45;
C25A9), PTEN and, cofilin, Cell Signaling Technology (Beverley, MA). Rabbit polyclonal anti-
MRTF (BSAC) was described previously (Sasazuki et al., 2002). Smad3 phospho-linker
antibodies were generously provided by Dr. Fang Liu (Rutgers University). All secondary
antibodies were from Jackson ImmunoResearch Laboratories (West Grove, PA). The
flavopiridol hydrochloride hydrate (F3055), a PTEN phosphatase inhibitor (bpVic) was
purchased from Sigma.
71
3.3 Cell culture and treatment
LLC-PK1 (Cl 4) cells, a porcine proximal tubular epithelial cell line (a kind gift from R. C.
Harris, Vanderbilt University School of Medicine, Nashville, TN) were cultured in low-glucose
DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum and 1%
streptomycin/penicillin solution (Invitrogen) as in our previous studies (Masszi et al., 2004;
2010). Rat proximal tubular cells (NRK-52E) were purchased from American Type Culture
Collection (Manassas, VA) and cultured in high-glucose DMEM containing the same
supplements as mentioned. Cells were incubated under serum- free conditions for at least 3 h
before various treatments. Subconfluent monolayers were treated at that point. To induce cell
contact disassembly,in confluent monolayer, cells were thoroughly washed with phosphate-
buffered saline (PBS; Invitrogen) and cultured in nominally calcium chloride–free DMEM
(LCM; Invitrogen). Where indicated, cells were treated with TGFβ (10 ng/ml for luciferase
reporter assays and 4–10 ng/ml for other experiments).
3.4 Plasmids and transfection
The p765-SMA-Luc reporter construct containing the proximal 765– base pair portion of the rat
SMA promoter in a pGL3-basic vector (WT), the constructs harboring an inactivating mutation
at the SBE1 or SBE2 sites (SBE1mut and SBE2mut) (Hu et al., 2003), and the p152-SMA-Luc
reporter (provided by S. H. Phan, University of Michigan Medical School, Ann Arbor, MI) were
described in our previous studies (Masszi et al., 2010). Using SBE1mut as a template, we
performed PCR-based mutagenesis to create subsequent mutations in SBE2 and the TCE
resulting in the triple-mutant Luc construct, as described (Masszi et al., 2010). Briefly, the
mutations (in parentheses) and the corresponding primer pairs were as follows:
SBE2 (C+15/T, A+16/G, and G+17/C), 5′-CCACCCACCTGCAGTG- GAGAAGCCCAGC-3′
and 5′- CTGGGCTTCTCCACTGCAGGT- GGGTGGT-3′ TCE (T−53/C, G−52/T, and
G−50/C), 5′-TGGGAAGCGAGCTGCAG- GGGATCAGACCA-3′ and
5′-TGGTCTGATCCCCTGCAGCTCG- CTTCCCA-3′
The thymidine kinase minimal promoter-driven Renilla luciferase internal control plasmid, pRL-
TK, was purchased from Promega (Madison, WI). The LEF/TCF reporter plasmid, TOPFlash,
was ob- tained from Upstate (Millipore). The N-terminally Myc- or FLAG- tagged Smad3
expression constructs (in pCMV5B) were a kind gift from L. Attisano (University of Toronto).
72
FLAG-Smad3 T66A and T179A point mutations were generated using a standard PCR based
mutagenesis protocol, using primer pairs
5’-CGTCAACACCAAGTGCATCGCCATCCCCAGGTCCCTGGATGG-3’ ;
5’-CCATCCAGGGACCTGGGGATGGCGATGCACTTGGTGTTGACG-3’ and
5’- CAGAGCAATATTCCAGAGGCACCACCCCCTGGCTACCTG-3’ ;
5’-CAGGTAGCCAGGGGGTGGTGCCTCTGGAATATTGCTCTG-3’ respectively.
The FLAG-tagged β-catenin was provided by E. R. Fearon (University of Michigan, Ann Arbor,
MI) (Kolligs et al., 1999). The FLAG-tagged MRTF-B plasmid was pro- vided by E. N. Olson
(University of Texas Southwestern Medical Center, Dallas, TX). The coding region of MRTF-B
was amplified by PCR and cloned into pcDNA3.1/Myc–His A to obtain the myc-MRTF-B
expression vector. pcDNA3.1/HA-MRTF-B was generated by engineering a 2xHA tag at the N-
terminus of MRTF-B using standard PCR methodology. The B1 region–deletion mutant of HA-
tagged MRTF-B (ΔB1p) was then constructed using primer pairs complementary to regions
upstream and downstream of the specific deletion, as described previously (Masszi et al., 2010).
The final construct contained a seven–amino acid (S279–P285 inclusive) deletion. PCR reactions
were performed using PfuTurbo (Agilent Technologies, Santa Clara, CA). All constructs were
verified by sequencing. The pCGN-SRF plasmid encoding HA-tagged human SRF generated by
the Prywes lab (Johansen and Prywes, 1993) was obtained through Addgene (Cambridge, MA).
Depending on the experiment, cells were transfected using FuGENE 6 (Roche Applied Science,
Indianapolis, IN), Lipofectamine 2000 (Invitrogen), or jetPRIME (Polyplus-transfection SA,
Illkirch, France) reagents as in our previous studies (Masszi et al., 2004; 2010; Fan et al., 2007)
and (for jetPRIME) according to the manufacturer’s recommendation.
3.5 Luciferase reporter assays
Luciferase reporter assays for SMA and TOP-Flash were performed as described in our previous
studies (Masszi et al., 2003; 2004; 2010) using 0.5–µg/well luciferase construct, 0.05–µg/well
pRL-TK, and varying amounts of empty carrier or expression vector. Sixteen hours later, cells
were serum starved for 3 h, treated for the indicated duration, and lysed and the luciferase
activity was determined using the Dual Luciferase Reporter Assay System Kit (Promega). For
each condition, treatments were performed in duplicate, and experiments were repeated at least
three times. From each sample, the firefly luciferase activity corresponding to a specific
73
promoter construct was normalized to the Renilla luciferase activity of the same sample. Results
are expressed as fold changes compared with the mean firefly/Renilla ratio of the untreated
controls taken as a unit.
3.6 RNA interference
Optimal target sequences were determined using the siRNA Target Finder program (Applied
Biosystems, Foster City, CA). The siRNA sequences used in the present experiments were as
follows: pig β-catenin siRNA, 5′-GUACAUACACCAUACUACG-3′; pig SMAD3 siRNA, 5′-
GAGUUCACUCCACAUUCUC-3′; pig E-cadherin siRNA, 5′-CUCUGCUGGUGUUUGAU-
UAUU-3′; and pig PTEN siRNA, 5’-AGCUAAAGGUGAAGAUAUAUU-3’, The validated
siRNA against rat β-catenin was obtained from Dharmacon (Lafayette, CO). Alternative siRNAs
were also designed and used for the down-regulation of each of the aforementioned proteins. The
siRNAs directed against different sequences of the corresponding mRNA gave identical
experimental results. Silencer Negative Control #2 siRNA was purchased from Applied Biosys-
tems. LLC-PK1 cells were cultured in antibiotic-free growth medium and transfected with
siRNA using Lipofectamine RNAiMAX (Invitrogen). DNA/siRNA cotransfectionsor PTEN
siRNA transfection were performed using jetPRIME.
3.7 Western blotting and coimmunoprecipitation
Following treatments, cells were lysed with Triton lysis buffer (30 mM 4-(2-hydroxyethyl)-1-
piperazineethanesulfonic acid, pH 7.4, 100 mM NaCl, 1 mM ethylene glycol tetraacetic acid, 20
mM NaF, and 1% Triton X-100) supplemented with 1 mM Na3VO4, 1 mM
phenylmethylsulfonyl fluoride, and Complete Mini Protease Inhibitor Cocktail (Roche). SDS–
PAGE and Western blotting were performed on equivalent protein loads, as determined using
BCA Protein Assay Reagents (Thermo Scientific, Waltham, MA). Prior to coimmuno-
precipitation studies, cell lysates were spun at 12,000 rpm for 5 min to remove cell debris.
Precleared supernatants were incubated with appropriate antibodies, and immuno-complexes
were captured on protein G–agarose beads (Thermo Scientific). Bound proteins were eluted from
the washed beads and analyzed by Western blotting. Antibody-free and lysate-free controls were
routinely included to confirm specificity of the immunoprecipitated proteins. Aliquots of each
input were run in parallel to monitor expression levels. Densitometry was performed with a
GS800 densitometer using Quantity One software (Bio-Rad Laboratories, Hercules, CA).
74
3.8 Nuclear extraction
Nuclear extracts were prepared from confluent layers of LLC-PK1 cells grown on 6-cm dishes
using the NE-PER Nuclear Extraction Kit (Thermo Scientific). Equivalent amounts of protein
from each extract were analyzed by Western blotting. Equal loading of nuclear protein was
monitored by probing with an anti-histone antibody.
3.9 Immunofluorescence microscopy
Cells plated on glass coverslips were fixed with 4% paraformaldehyde (Canemco & Marivac,
Gore, Canada) for 30 min, washed with PBS, and quenched with 100 mM glycine/PBS for 10
min. Cells were permeabilized for 20 min in PBS containing 0.1%Triton X-100 and 1% bovine
serum albumin (BSA), blocked in 3% BSA for 1 h, and incubated with primary antibody for an
additional 1 h. Washed coverslips were incubated with the corresponding fluorescently labeled
secondary antibody, which included the addition of 4′,6-diamidino- 2-phenylindole (Lonza,
Basel, Switzerland) for nuclear labeling. When staining for E-cadherin, cells were fixed with
cooled methanol for 5 min, washed with PBS, and blocked with 3% BSA prior to
immunostaining. Coverslips were mounted on slides using fluorescent mounting medium (Dako,
Glostrup, Denmark). Samples were analyzed using a microscope (IX81; Olympus, Center
Valley, PA) with a UPlan S-Apo 60× 1.42 numerical aperture oil objective (Olympus) coupled to
a camera (Evolution QEi Monochrome; Media Cybernetics, Bethesda, MD) controlled by
imaging software (QED InVivo; Media Cybernetics). Images were processed using ImagePro
Plus software (3DS 5.1; Media Cybernetics). Modifications were restricted exclusively to minor
adjustments of brightness/contrast. Cytoplasmic β-catenin staining was quantified using the
MetaMorph image analysis software (Molecular Devices, Sunnyvale, CA). Briefly, the mean
fluorescence intensity was determined in circular regions (6.5 µm diameter) randomly placed in
the cytosplasmic (extranuclear) area in 50 cells. Data were normalized to the background
fluorescence determined in a cell-free area on the same coverslip. The average ratio of all
measurements in untreated controls was taken as 1 and compared with the ratio obtained in cells
exposed to the combined treatment (LCM plus TGFβ) for 6 h.
3.10 mRNA analysis
LLC-PK1 cells were transfected with pig specific β-catenin, alternatively with pig specific PTEN
75
siRNA or NR siRNA, using Lipofectamine RNAiMAX or jetPRIME. After 48 h, cells were
serum deprived for 3 h and treated with TGFβ and LCM for an additional 48 h for SMA
experiments and 6 h for Smad3 experiments. RNA was extracted using an RNeasy Kit (Qiagen,
Valencia, CA), and cDNA was synthesized from 1 µg of total RNA using iScript reverse
transcriptase (Bio-Rad Laboratories). SYBR green–based real-time PCR was used to evaluate
gene expression of SMA, using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the
reference standard.
Primer pairs designed against known pig sequences for SMA were as follows:
SMA, 5′-TGTGACAATGGTTCTGGGCTCTGT-3′ and 5′-TTCGT-
CACCCACGTAGCTGTCTTT-3′ GAPDH, 5′-GCAAAGTGGACATGGTCGCCATCA-3′ and
5′-AG- CTTCCCATTCTCAGCCTTGACT-3′
Primer pairs designed against known pig sequences for Smad3 were as follows:
5’- AATGTCAACAGGAATGCGGCTGTG - 3’ and
5’- ATAGCGCTGGTTACAGTTGGGTGA-3’
3.11 Statistical analysis
Data are presented as representative blots or images from at least three similar experiments or as
the means ± SEM for the number of experiments indicated. Statistical significance was
determined by one-way analysis of variance (Tukey or Dunn post hoc testing for parametric and
nonparametric analysis of variance, as appropriate), using Prism and the InStat software
GraphPad, La Jolla, CA). p< 0.05 was accepted as significant; *p < 0.05 and **p < 0.01
76
Chapter 4
β-catenin and Smad3
β-catenin and Smad3 regulate the activity and stability of 4Myocardin-related Transcription Factor during epithelial-myofibroblast transition
The material presented in this chapter has been published previously in Molecular Biology of the Cell, 22(23), 4472–4485 (Charbonney et al., 2011)
Web link: http://www.molbiolcell.org/content/22/23/4472.full.pdf
4.1 Summary
Injury to the adherens junctions (AJs) synergizes with transforming growth factor-β1 (TGFβ) to
activate a myogenic program (α-smooth muscle actin [SMA] expression) in the epithelium
during epithelial–myofibroblast transition (EMyT). Although this synergy plays a key role in
organ fibrosis, the underlying mechanisms have not been fully defined. Because we recently
showed that Smad3 inhibits myocardin-related transcription factor (MRTF), the driver of the
SMA promoter and many other CC(A/T)-rich GG element (CArG) box–dependent cytoskeletal
genes, we asked whether AJ components might affect SMA expression through interfering with
Smad3. We demonstrate that E-cadherin down-regulation potentiates, whereas β-catenin
knockdown inhibits, SMA expression. Contact injury and TGFβ enhance the binding of β-
catenin to Smad3, and this interaction facilitates MRTF signaling by two novel mechanisms.
First, it inhibits the Smad3/MRTF association and thereby allows the binding of MRTF to its
myogenic partner, serum response factor (SRF). Accordingly, β-catenin down-regulation disrupts
the SRF/MRTF complex. Second, β-catenin maintains the stability of MRTF by suppressing the
Smad3-mediated recruitment of glycogen synthase kinase-3β to MRTF, an event that otherwise
leads to MRTF ubiquitination and degradation and the consequent loss of SRF/MRTF–dependent
proteins. Thus β-catenin controls MRTF-dependent transcription and emerges as a critical
regulator of an array of cytoskeletal genes, the “CArGome.”
77
4.2 Introduction
Our previous results revealed that epithelial contacts are not simply targets but also key
regulators of EMT/EMyT and the myogenic program, but the molecular mechanisms remain
largely undefined. Nonetheless, previous studies aimed at linking contact injury with epithelial
SMA expression implicated two pathways: signaling through Rho and β-catenin.
The first mechanism involves myocardin-related transcription factor (MRTF), a recently
discovered activator of serum response factor (SRF) that links cytoskeleton remodeling and the
transcriptional control of cytoskeletal components (Wang et al., 2002; Olson and Nordheim,
2010). Under resting conditions, MRTF binds to monomeric (G) actin, which masks its nuclear
localization signal. On F- actin polymerization (induced by various stimuli and mediated pre-
dominantly by Rho family GTPases), G-actin dissociates from MRTF, which results in nuclear
translocation of MRTF (Miralles et al., 2003; Vartiainen et al., 2007). We, and others, showed
that acute disruption of AJs stimulates Rho (Fan et al., 2007; Samarin et al., 2007) and
redistributes MRTF to the nucleus (Fan et al., 2007; Busche et al., 2008). Once there, MRTF
associates with SRF (Zaromytidou et al., 2006), and the complex drives gene transcription
through the CC(A/T)6GG cis elements (CArG boxes) present in the promoters of a large array of
muscle-type and cytoskeletal genes (the “CArGome”) (Tomasek et al., 2005; Sun et al., 2006),
including SMA. Indeed, knockdown studies revealed that MRTF is indispensable for the TGFβ-
induced (Morita et al., 2007; Elberg et al., 2008) and contact injury–facilitated EMyT (Fan et al.,
2007; Masszi et al., 2010).
However, we found that Smad3, one of the main transducers of TGFβ signaling, binds to MRTF
and strongly inhibits its transcriptional activity on the SMA promoter (Masszi et al., 2010). This
surprising observation implies that Smad3 is a temporary brake on EMyT, putting the process on
hold. This brake is then relieved because under two-hit conditions (TGFβ plus contact disruption
by low-calcium medium [LCM]) Smad3 gradually degrades, which liberates MRTF and allows
for MF differentiation. The other contact-dependent input relates to β-catenin. Given the double
function of this molecule as a binding partner of E-cad- herin at the AJ and as transcriptional
coactivator of T cell factor/ lymphoid enhancer factor (TCF/LEF) in the nucleus, β-catenin is a
good candidate to link the state of AJs to transcriptional control. Indeed, β-catenin has been
implicated in developmental EMT (Liebner et al., 2004), fibrogenesis (Bowley et al., 2007; Kim
78
et al., 2009), smooth muscle differentiation, and SMA expression (Gosens et al., 2008).
However, the underlying mechanism, especially with respect to SMA expression, remains
enigmatic. It is important that the SMA promoter does not contain any β-catenin– responsive
(TCF/LEF) elements. On the other hand, β-catenin has been described as a binding partner of
Smad3 (Tian and Phillips, 2002; Zhang et al., 2007; 2010). This fact, together with our finding
that Smad3 is an inhibitor of the myogenic program, prompted us to investigate the EMyT-
promoting action of β-catenin from a new angle. We asked whether β-catenin could be integrated
into the recently described regulatory mechanism as a key modifier of the MRTF–Smad3
interaction. We hypothesized that β-catenin might interfere with the inhibitory action of Smad3
on MRTF.
Our results show that β-catenin is critical for the maintenance of MRTF/SRF interaction and
MRTF stability. Because the MRTF/SRF complex is a master regulator of muscle and
cytoskeletal genes, these results provide new insight into the mechanism by which β-catenin
affects the expression of many CArG-dependent proteins, crucial for MF formation and muscle
differentiation.
4.3 Results
4.3.1 E-Cadherin down-regulation facilitates TGFβ-induced SMA expression
Our previous studies showed that disruption or absence of intercellular contacts (as induced by
LCM, scratch wounding, or subconflence) enables TGFβ to provoke SMA expression in tubular
epithelial (LLC-PK1) cells (Masszi et al., 2004; Fan et al., 2007). To assess the role of AJs in this
EMyT-promoting effect, we specifically targeted their chief component, E-cadherin. TGFβ failed
to induce SMA expression in intact, confluent monolayers transfected with a control (nonrelated
[NR]) small interfering RNA (siRNA) but provoked robust SMA expression after siRNA-
mediated E-cadherin down-regulation (Figure 17, A and B). E-Cadherin silencing alone (without
TGFβ stimulation) did not induce (or did so only marginally) SMA expression (Figure 17, A and
B). In agreement with our previous data (Masszi et al., 2004), in subconfluent layers, TGFβ did
provoke SMA expression, concomitant with ∼60% decrease in E-cadherin level (Figure 17, C
and D). However, when E-cadherin was fully knocked down prior to TGFβ treatment, the
cytokine triggered a 3.5-fold-higher increase in SMA expression in the subconfluent cultures
79
compared with the NR-treated controls (Figure 17, C–E). Thus the absence of E-cadherin permits
TGFβ-induced SMA expression in confluent monolayers and strongly potentiates SMA
expression in subconfluent cultures, implying that E-cadherin is an important regulator of the
myogenic program in the epithelium.
80
81
82
4.3.2 β-Catenin is a crucial permissive regulator of SMA expression
E-Cadherin has been shown to mitigate Rho activation (Cho et al., 2010), which might contribute
to its suppressive effect on SMA expression. In addition, E-cadherin is the major intracellular
binding partner of β-catenin, and this molecule has been implicated in SMA expression (Masszi
et al., 2004; Onder et al., 2008). Therefore we set out to characterize the role of β-catenin in
SMA expression under myogenic (two-hit) conditions. Cells were transfected with NR or β-
catenin siRNA and, after reaching confluence, exposed to LCM plus TGFβ for 48 h. β-Catenin
knockdown (Figure 18A and Supplementary Figure S1) resulted in strong suppression of SMA
expression (Figure 18, A and B).
Similar observations were made on another tubular cell line, NRK-52E, as well, in which the
two-hit stimulation also caused marked increase in SMA expression, and β-catenin down-
regulation fully blocked this response (Supplementary Figure S2, A and B).
To test whether this effect manifested at the transcriptional level, we measured SMA mRNA in
control and β-catenin– silenced cells after 48 h of stimulation with the combined treatment. The
message for SMA was 50% less in β-catenin siRNA-transfected cells than in the NR siRNA-
transfected controls (Figure 18 C).
To determine whether the presence of β-catenin affects the activity of the SMA promoter, we
performed reporter assays using a 765–base pair SMA promoter coupled to firefly luciferase
(pSMA-Luc; Masszi et al., 2010). Cells were first transfected with NR or β-catenin siRNA,
followed 24 h later with cotransfection of pSMA-Luc and an internal control plasmid (pRL-TK).
The combined treatment triggered strong activation of the SMA promoter in control cells,
whereas β-catenin silencing suppressed the (already low) basal SMA promoter activity and-of
importance-prevented its stimulation-induced rise over the baseline obtained in nonstimulated
control cells (Figure 18 D).
Taken together, the results indicate that the absence of β-catenin dramatically reduces the
activation of the SMA promoter and consequently the level of SMA mRNA and protein
expression.
83
Having seen that β-catenin is essential for SMA expression induced by the conventional two-hit
scheme, we asked whether it could be involved in the E-cadherin down-regulation–promoted
SMA response as well. It is noteworthy that in our cells (similar to many other systems) E-
cadherin silencing did not reduce the total β-catenin level (Figures 17 C and 18 E), implying that
β-catenin might bind to other partners or its synthesis may keep up with its degradation.
Moreover, elimination of E-cadherin resulted in a greater-than- threefold rise in nuclear β-catenin
content, indicating an increase in the mobile pool of this molecule (Figure 18, F and G).
Similarly, stimulation of the cells by the two-hit regimen (TGFβ plus LCM) also caused a
threefold increase in cytosolic β-catenin, along with the dissipation of the peripheral β-catenin
signal (Figure 18 H).
Of importance, concomitant silencing of β-catenin and E-cadherin strongly reduced the TGFβ-
provoked SMA expression compared with the level observed in E-cadherin down-regulated cells
(Figure 18 E). This finding confirms the key role of β-catenin in the E-cadherin silencing–
promoted SMA expression.
Next we sought to determine whether β-catenin plays a permissive or/and inductive role in the
regulation of the SMA promoter. Overexpression of β-catenin induced a 10-fold increase in the
activity of the β-catenin–responsive reporter TOP- Flash, verifying the efficacy of our expression
vector (Supplementary Figure S1 B). Nonetheless, β-catenin overexpression did not stimulate the
SMA promoter, nor did it increase its activation provoked by TGFβ plus LCM (Figure 18 I).
Thus β-catenin is necessary but not sufficient for the optimal activation of the SMA promoter, in
full agreement with the fact that the SMA promoter does not harbor any obvious β-catenin–
responsive motifs.
Taken together these results suggest that β-catenin plays a crucial permissive role in the
regulation of the SMA promoter, and the cytosolic β-catenin levels obtained after contact injury
or E-cadherin down-regulation are sufficient for this permissive effect.
84
85
86
87
4.3.3 β-Catenin prevents the inhibitory effect of Smad3 on the MRTF-induced
activation of the SMA promoter
Next we sought to gain insight into mechanism by which β-catenin facilitates the myogenic
program. Because previous observations showed that β-catenin can associate with Smad3 and
that Smad3 is a strong inhibitor of MRTF-dependent transcription (Masszi et al., 2010), we
considered whether the Smad3/β-catenin interaction might regulate the myogenic program. We
initially tested their interaction under the various conditions of the two-hit regimen after short-
term stimulation, since the nuclear translocation of MRTF peaks around 30–60 min, and during
this time neither β-catenin nor Smad3 levels change (Masszi et al., 2010).
Coimmunoprecipitation studies revealed that in resting cells there was only a weak association
between Smad3 and β-catenin, whereas stimulation with either TGFβ or LCM induced a
substantial (5- to 10-fold) increase in their interaction. The combined treatment exerted an even
stronger effect (Figure 19, A and B). More- over, down-regulation of E-cadherin increased the
complex formation between β-catenin and Smad3 in the absence of any stimulus, suggesting that
the increased availability of β-catenin is sufficient to promote enhanced interaction between
these partners (Figure 19 C).
We then asked whether β-catenin could reverse the inhibitory action of Smad3 on MRTF-driven
transcription. In introductory experiments we titrated the effect of Smad3 on MRTF. In
agreement with our recent findings (Masszi et al., 2010), the MRTF expression– driven SMA
promoter response was gradually diminished as the amount of coexpressed Smad3 was increased
(Figure 20 A). Under our conditions ∼60% inhibition was attained with 1 µg of Smad3 DNA,
and this dose was applied in the subsequent studies. As shown in Figure 20 B, cotransfection
with an increasing amount of β-catenin gradually restored the MRTF-induced SMA promoter
activation. A detailed analysis of the β-catenin effect, using cotransfection with MRTF, Smad3,
or both (Figure 20 C, top) showed that over-expression of β-catenin entirely prevented the
Smad3-induced inhibition of the MRTF-triggered promoter activation, and produced only a
slight (nonsignificant) decrease in the basal or MRTF-induced promoter activity. In agreement
with our previous findings, overexpression of Smad3 without MRTF had no significant effect on
the SMA promoter.
88
To test whether the β-catenin–induced protection against the inhibitory effect of Smad3 required
the CArG-boxes or other cis elements in the SMA promoter, including Smad-binding element 1
(SBE1), SBE2, and the TGFβ control element (TCE), we transfected the cells with a triple
mutant promoter in which each of these was inactivated (Masszi et al., 2010). Of importance, the
inhibition by Smad3 and the protective effect of β-catenin remained the same as observed with
the wild-type promoter (Figure 20 C, middle). Similar results were obtained with a short (152
base pair) promoter construct, which includes the two CArGs and the TCE but lacks both SBEs
and the E-box, the target site for basic helix-loop-helix transcription factors (Figure 20 C,
bottom). Together these data show that β-catenin reverses the inhibitory effect of Smad3 on
MRTF- driven transcription, and this effect is mediated via the CArG boxes.
89
90
91
92
4.3.4 β-Catenin maintains the SRF/MRTF (myogenic) complex
To investigate whether β-catenin can preserve the interaction between SRF and MRTF, cells
were cotransfected with hemagglutinin (HA)-SRF and Myc-MRTF along with FLAG–β-catenin,
FLAG-Smad3, or both (Figure 21 A). When only MRTF and SRF were coexpressed,
immunoprecipitation of MRTF (through the tag) pulled down a sizable amount of SRF (lane 4).
Overexpression of Smad3 nearly abolished the association between SRF and MRTF (lane 1). Of
importance, β-catenin overexpression fully restored the MRTF/SRF interaction (lanes 2 and 3).
To validate these observations with regard to the endogenous proteins, we investigated the
association of SRF with MRTF in control or β-catenin–down-regulated cells with or without
stimulation. Suppression of β-catenin had a dramatic effect on the myogenic complex: namely, it
disrupted the association between MRTF and SRF under basal conditions and prevented any
increase upon TGFβ plus LCM (30 min) stimulation (Figure 21 B).
Identical results were obtained using NRK-52E rat tubular cells, implying that the need for β-
catenin for the SRF/MRTF association is a general phenomenon (Supplementary Figure S2 C).
We then tested whether β-catenin down-regulation could interfere with the stimulus-induced
translocation of MRTF into the nucleus. β-Catenin silencing did not prevent the fast, LCM-
induced nuclear uptake of MRTF (Figure 21 C).
Thus β-catenin facilitates the integrity of the myogenic complex by a mechanism distal to MRTF
translocation, consistent with the prevention of the inhibitory effect of Smad3.
93
94
95
4.3.5 β-Catenin and Smad3 mutually inhibit each other’s association with
MRTF
We argued that if β-catenin, at least in part, acts through capturing Smad3, then overexpression
of β-catenin should result in reduced Smad3–MRTF interaction. To test this, cells were
transfected with HA-MRTF, Myc-Smad3, and either an empty vector or FLAG–β-catenin.
Immunoprecipitation of MRTF through the HA tag (Figure 22 A) brought down a substantial
amount of Smad3 in empty vector-transfected cells, whereas overexpression of β-catenin
strongly reduced the amount of MRTF-associated Smad3, concomitant with a dramatic increase
in the SRF/ MRTF interaction (Figure 22 A).
Intriguingly and unexpectedly, the MRTF immunoprecipitate also contained some β-catenin (see
later discussion). Next we investigated the converse situation by asking whether a reduction in
endogenous β-catenin could increase the MRTF–Smad3 interaction. Downregulation of β-
catenin caused a substantial rise in the amount of MRTF- associated Smad3 (Figure 22 B).
These experiments indicate that β-catenin is a negative regulator of the Smad3/MRTF
interaction.
Having observed that β-catenin itself can be in complex with MRTF, we first surmised that this
interaction might be mediated through Smad3. In other words, whereas β-catenin reduces the
overall Smad3 binding to MRTF, it was conceivable that the remaining Smad3–MRTF binding
was responsible for the presence of β-catenin through the formation of an MRTF–Smad3– β-
catenin complex. To assess this, we used an MRTF mutant, ΔB1p, that lacks a seven–amino acid
sequence in the B1 region critical for Smad3 binding (Masszi et al., 2010). Indeed,
coprecipitation studies revealed that ΔB1p almost entirely lost its capacity to bind Smad3 (Figure
22 C). Despite this, ΔB1p retained its capacity to pull down β-catenin; in fact there was more β-
catenin in complex with ΔB1p than with wild-type MRTF (Figure 22 C).
This implies that β-catenin does not bind to MRTF through Smad3, and that the MRTF sequence
critical for Smad3 binding is not essential for the complex formation between β-catenin and
MRTF.
96
To substantiate the reciprocal relationship between the binding of β-catenin versus Smad3 to
MRTF, we down-regulated Smad3 and found an increased association between endogenous β-
catenin and MRTF (Figure 22 D). As expected, this was coincident with enhanced interaction
between MRTF and SRF.
Taken together, the results indicate that β-catenin reduces the binding of Smad3 to MRTF,
whereas Smad3 mitigates the binding of β-catenin to MRTF, and these mutually inhibitory
effects do not require the same MRTF sequence. These findings imply that the Smad3–β-catenin
interaction prevents these partners from accessing MRTF.
The association between β-catenin and MRTF is a novel finding that could also contribute to
MRTF regulation. Although the detailed characterization of this interaction will require a
separate study, as an initial step we established that this is a stimulus-regulated process, as the
two-hit challenge induced a transient increase in MRTF–β-catenin association (Figure 22 E).
97
98
99
4.3.6 β-Catenin maintains MRTF stability in stimulated cells by counteracting
glycogen synthase kinase-3β–dependent MRTF degradation
During the course of our experiments we noticed that in β-catenin– down-regulated cells the two-
hit stimulation appeared to reduce the size of the MRTF immunoreactive band. To investigate
this phenomenon, we performed a detailed time course (0–120 min) in NR and β-catenin siRNA-
transfected cells. Figure 23 A shows that there was no obvious difference in the expression of
MRTF in resting control versus β-catenin–silenced cells; in contrast, after stimulation there was a
dramatic reduction in the MRTF band obtained from β-catenin– down-regulated cells.
The same phenomenon was observed in NRK-52E cells as well (Supplementary Figure S2 D).
This decrease was apparent at times ≥60 min and became pronounced or near complete by ∼120
min. It is noteworthy that in β-catenin–expressing cells stimulation induces an upward shift in
the MRTF band, corresponding to the re- ported (multiple) phosphorylation of this protein. This
often manifests as a widening of the band or the appearance of multiple bands with slightly
higher molecular mass. The total density of these usually exceeds the density of the
nonstimulated band, which may be due to more efficient or preferential antibody binding to the
less condensed epitopes and/or the phosphorylated form(s) of MRTF. Indeed, densitometry
showed an early increase in the MRTF-immunoreactive band(s) upon two-hit stimulation (Figure
23A). Because this response was readily apparent after 15 min, it likely reflects posttranslational
modification (e.g., phosphorylation) and not a net rise in the MRTF protein. On stimulation, the
intensity of the MRTF bands started to increase in the β-catenin–depleted cells as well, but after
∼30–60 min a reversal occurred and the signal eventually dropped well below the non-
stimulated level (Figure 23 A).
The same pattern was observed when probing with a different MRTF antibody (Figure 23 A,
inset). The decrease of the signal below the basal level might be due to an additional
modification that masks the epitope seen by the antibody (e.g., ubiquitination) and/or the
degradation of MRTF protein. To determine whether protein degradation might play a role, we
followed the fate of heterologously expressed, HA-tagged MRTF using an anti- HA antibody. In
NR siRNA-transfected cells the intensity of the HA signal remained constant during stimulation,
indicating that the increase seen by the MRTF antibody was indeed due to some posttranslational
100
modification. In contrast, in β-catenin–silenced cells the HA signal still dropped below the level
observed in the NR siRNA-transfected cells. However this decrease started later and became
substantial (usually ∼80%) only after ≥2 h of stimulation (Figure 23 B).
From these results we conclude that the early phase of the signal reduction is likely due to
epitope masking by modification, whereas the later phase reflects (at least in part) reduction in
MRTF protein expression. Glycogen synthase kinase-3β (GSK-3β) has been reported to
phosphorylate and inhibit myocardin (Badorff et al., 2005) and to promote its ubiquitination (Xie
et al., 2009). We therefore examined whether GSK-3β might be involved in the degradation of
MRTF, an effect that might become apparent in β-catenin–depleted cells. The decrease in MRTF
observed upon stimulation in β-catenin–depleted cells was efficiently mitigated by LiCl or SB-
216763, two inhibitors of GSK-3β (Figure 23 C). Moreover, the elimination of β-catenin strongly
facilitated MRTF ubiquitination, and this phenomenon was prevented by LiCl (Figure 23 D).
101
102
103
104
4.3.7 GSK-3β interacts with MRTF through a Smad3-dependent, β-catenin–
inhibited mechanism
We then investigated whether GSK-3β might interact with MRTF and whether this process
might be modulated by β-catenin and Smad3. Of importance, a recent publication reported that
Smad3 and GSK-3β can directly associate (Hua et al., 2010). This raised the intriguing
possibility that Smad3 might act as an adaptor recruiting GSK-3β to MRTF and this process
might be regulated by β-catenin. Probing MRTF immunoprecipitates with anti–GSK-3β revealed
a weak binding of GSK-3β to MRTF that was slightly elevated by the two-hit stimulation (Figure
24 A). Downregulation of β-catenin robustly potentiated the stimulus-induced association of
GSK-3β with MRTF as early as 30 min after stimulation. In contrast, elimination of Smad3
prevented the basal and stimulus-induced interaction be- tween MRTF and GSK-3β (Figure 24
A). Moreover, double silencing of β-catenin and Smad3 revealed that the MRTF–GSK-3β
interaction, potentiated by the absence β-catenin, was preempted in the absence of Smad3
(Figure 24 B). To substantiate the role of Smad3 as a potential recruiter of GSK-3β to MRTF, we
compared the association of GSK-3β with wild-type (WT) and ΔB1p MRTF, the mutant with
diminished Smad3-binding capacity. In β-catenin–depleted cells, the stimulus-induced
association of ΔB1p MRTF with GSK-3β was strongly reduced compared with the WT (Figure
24 C). Finally, knock-down of Smad3 significantly reduced MRTF degradation in β-catenin–
depleted and stimulated cells (Supplementary Figure S3). Taken together, these results implicate
β-catenin as a key factor in the maintenance of MRTF stability and suggest that the absence of β-
catenin facilitates the Smad3-dependent association of GSK-3β to MRTF, which primes the
latter for ubiquitination and degradation (see the scheme in Figure 26).
4.3.8 β-Catenin is a key permissive factor for the CArGome
Having seen the importance of β-catenin in MRTF stability, we considered that β-catenin might
be necessary to ensure the expression of a variety of MRTF-dependent genes in addition to
SMA. We showed previously (Masszi et al., 2010) that MRTF is required for the basal and/or
stimulus-induced expression of several CArG-regulated proteins, including filamin, CapZ,
cofilin, and SRF itself. Accordingly, we found that β-catenin depletion prevented the two-hit–
105
induced increase in filamin, CapZ, and cofilin and decreased the level of SRF both under resting
conditions and after stimulation (Figure 25, A and B). These results suggest that β-catenin might
be an essential regulator of the CArGome and might explain how β-catenin, independent of its
transcriptional effect, can affect the expression of an array of cytoskeletal proteins.
106
107
108
109
110
4.4 Discussion
Injury to the intercellular contacts has emerged as an important contributor to EMT/EMyT
(Masszi et al., 2004; Fan et al., 2007; Kim et al., 2009; Zheng et al., 2009; Tamiya et al., 2010),
and the AJ component β-catenin has been shown to promote the myogenic program in the
epithelium (Masszi et al., 2004) and other cell types during wound healing (Cheon et al., 2005),
organ fibrosis (Surendran et al., 2005; Kim et al., 2008), tissue specification (Liebner et al.,
2004), carcinogenesis (Onder et al., 2008), and hypertrophy (Deng et al., 2008; Gosens et al.,
2008). Nonetheless the underlying mechanisms remained undefined. Our studies provide
evidence that β-catenin is a strong positive regulator of MRTF, which in turn is a master
regulator of cytoskeletal genes. We show that β-catenin exerts this effect via (at least) two
mechanisms. First, it antagonizes the inhibitory action of Smad3 on MRTF, thereby increasing
the interaction between MRTF and SRF. Second, it maintains the stability of MRTF under
conditions that are able to enhance MRTF degradation. Our observations can also explain the
need for the double hit for SMA expression: contact disassembly induces nuclear translocation of
MRTF (Fan et al., 2007; Busche et al., 2008; Sebe et al., 2008) and elevates the level of cytosolic
β-catenin (present study; (Masszi et al., 2004), whereas TGFβ is required to rescue β-catenin
from degradation (via multiple mechanisms) after contact injury (Masszi et al., 2004) and it is
also indispensable for the efficient down-regulation of Smad3 (Masszi et al., 2010). The
increasing β-catenin/ Smad3 ratio then allows nuclear MRTF to exert its transcriptional effects.
On the basis of these findings, we propose that β-catenin, as a key modulator of MRTF/SRF
signaling, is one of the central links connecting epithelial injury to the expression of cytoskeletal
and muscle-specific genes during the phenotypic reprogramming of EMyT.
Studies including our own showed that cell contact disruption induces Rho- and/or Rac-
dependent nuclear translocation of MRTF (Fan et al., 2007; Busche et al., 2008; Sebe et al.,
2008), but the specific contact type(s) involved were not identified. We found that down-
regulation of E-cadherin rendered TGFβ able to induce SMA expression in confluent epithelia
and augmented it in subconfluent layers, implicating the AJs. In line with this, recent work
(AlarcOn et al., 2009; Busche et al., 2010; Gao et al., 2009) showed that uncoupling of E-
cadherin is the key trigger for MRTF translocation upon calcium switch, whereas the changes in
TJ integrity do not play a role. These authors also noted that serum failed to stimulate the SRF
111
reporter in tumor cells that had been forced to express E-cadherin, whereas the
absence/dissociation of E-cadherin reestablished serum-responsiveness. Together these data
suggest that E-cadherin plays two distinct roles in MRTF regulation. Acute dissociation of the
AJs induces Rho/Rac activation, causing MRTF translocation. This is followed by degradation of
E-cadherin (Fuentealba et al., 2007; Masszi et al., 2004; Sapkota et al., 2007; Gao et al., 2009),
which terminates this MRTF response. However, the absence of E-cadherin seems to sensitize
cells for MRTF translocation or activation by other stimuli (e.g., TGFβ or serum). This could be
due to the fact that E-cadherin counteracts TGFβ-induced Rho activation (Sapkota et al., 2007;
Cho et al., 2010; Wrighton et al., 2006). In addition, we propose that the loss of E-cadherin
contributes to MRTF activation through the liberation of β-catenin, which neutralizes Smad3, a
strong inhibitor of MRTF.
The central role of β-catenin in the myogenic program is substantiated by our findings that β-
catenin knockdown suppresses the SMA promoter and protein expression induced by AJ
disruption or E-cadherin silencing combined with TGFβ treatment. These observations are
congruent with data obtained during tumor EMT, showing that elimination of E-cadherin
stabilizes free β-catenin and in- creases the SMA message (Sapkota et al., 2007; Onder et al.,
2008; Gao et al., 2009; Aragon et al., 2011). The critical question has been the mechanism by
which β-catenin acts. Because extensive cross-talk exists between the β-catenin/TCF-LEF and
TGFβ/ Smad3 pathways (Guo et al., 2008; Attisano and Labbe, 2004) and β-catenin can bind to
Smad3, an interaction with Smad3 was a plausible possibility. Indeed, a variety of promoters
(Twist, vascular endothelial growth factor, gastrin) contain TCF sites and SBEs in close
proximity, and at these loci β-catenin and Smad3 act synergistically. In addition to targeting their
own sites, they form active transcriptional complexes (Bu et al., 2008; Lei et al., 2004; Clifford
et al., 2008; Fuxe et al., 2010). Synergy can also occur when a single cis-element (e.g., SBE) is
occupied by the Smad3/β-catenin complex, as was reported for the SM22α promoter (White,
2006; Shafer and Towler, 2009). However, none of these mechanisms accounts for the
stimulation of the SMA promoter in epithelial cells because 1) it does not harbor a TCF site and
2) although it contains SBEs, overexpression of Smad3, β-catenin, or both of these failed to
activate the promoter.
An alternative possibility emerged from our previous studies, showing that Smad3 is a potent
inhibitor of MRTF and SMA expression (Hsing et al., 1996; Masszi et al., 2010; Lin and Chou,
112
1992). Initially this finding looks counterintuitive since R-Smads are considered chief mediators
of fibrogenesis and EMT (Yanagisawa et al., 1998; Roberts et al., 2006; Wildey et al., 2003).
However, this simplified view is controversial since the progression of EMT, fibrosis, and MF
accumulation is often accompanied by a reduction in Smad3 (or Smad2) levels (Hjelmeland,
2005; Zhao and Geverd, 2002; Poncelet et al., 2007; Meng et al., 2010), and suppression of
Smad3 can actually facilitate SMA expression (Masszi et al., 2010). These facts and the
demonstration that Smad3 can bind to (Masszi et al., 2004; Morita et al., 2007) and inhibit
(Onder et al., 2008; Masszi et al., 2010; Busche et al., 2008) MRTF led to the new view that
Smad3 is an inducer of the fibrogenic phase but an inhibitor/delayer of the myogenic phase of
EMyT. Accordingly, our present work shows that β-catenin acts by preventing the Smad3-
mediated inhibition of MRTF. β-Catenin and Smad3 bind together and mutually inhibit each
other’s interactions with MRTF. Conversely, the absence of β-catenin enhances the MRTF–
Smad3 binding and destroys the myogenic complex (SRF–MRTF). It was recently reported
(Masszi et al., 2004; Zhang et al., 2010; Kim et al., 2009) that the N-terminal and armadillo
domain of β-catenin associates with the C-terminal region of Smad3. It is intriguing that the
same C-terminal region is critical for MRTF binding (Fan et al., 2007; Morita et al., 2007).
Although both TGFβ and LCM enhanced β-catenin–Smad3 association, the underlying
mechanisms remain to be elucidated. Beside the possibility of increased β-catenin availability, C-
terminal or linker-region phosphorylation of Smad3 (Masszi et al., 2010; Kamaraju and Roberts,
2005) and/or serine dephosphorylation or tyrosine phosphorylation of β-catenin (Charbonney et
al., 2011; Doble and Woodgett, 2003) might also contribute. Because total E-cadherin levels do
not change within the first hour after the combined treatment, at this early time post- translational
modification of β-catenin and/ or Smad3 may be the predominant signal. Later the absence of E-
cadherin likely contributes to the increase in the available β-catenin pool. Of interest, tyrosine
phosphorylated β-catenin has been shown to associate with phospho-Smad2 during con- tact
injury and integrin-dependent EMT, and these proteins colocalized in epithelium-derived MFs in
the lungs of patients with pulmonary fibrosis (Badorff et al., 2005; Kevin K Kim, 2009; Kim et
al., 2009). However, the mechanism by which this complex would promote MF generation was
not defined. Our findings raise the possibility that under the same conditions Smad3 or the
Smad3/Smad2 complex can also associate with β-catenin, which leads to the disinhibition of
MRTF.
113
Consistent with these views, MRTF translocation is necessary but not sufficient for the induction
of MRTF/SRF target genes, as in certain cells MRTF is constitutively nuclear yet
transcriptionally inactive (Kapoor et al., 2008; Elberg et al., 2008). This inactive state is likely
maintained by the interaction of MRTF with its negative regulators such as intranuclear G-actin
(LI et al., 1997; Vartiainen et al., 2007; Steck et al., 1997) or Smad3 (White, 2006; Masszi et al.,
2010). Although crucially important, only a few mechanisms have been identified that modulate
these negative influences. Thus G-actin affinity of intranuclear MRTF is regulated by MAP
kinase–dependent phosphorylation (Muehlich et al., 2008), whereas the present studies
demonstrate that the MRTF–Smad3 interaction depends on the availability of β-catenin.
Furthermore, although MRTF is indispensable for the induction of the CArGome during EMyT
(Parapuram et al., 2011; Fan et al., 2007; Elberg et al., 2008), its net nuclear accumulation is
transient and terminates long before SMA expression (Bu et al., 2010; Masszi et al., 2010).
These observations suggest that contact disruption leads to an MRTF-dependent priming event,
and the interactions of MRTF with its partners (e.g., Smad3) during this early, postinjury phase
might be critically important for cell fate determination.
The β-catenin–Smad3 complex can exert additional effects that modify EMT and fibrogenesis.
Association of β-catenin with Smad3 suppressed SBE-dependent transcription in epithelial cells
(Lau et al., 2011; Zhang et al., 2007) and promoted TCF/LEF-dependent transcription in
chondrocytes (Palacios et al., 2005; Zhang et al., 2010). Thus the association might mitigate
Smad3-dependent but enhance β-catenin–dependent gene transcription, resulting in a more
proliferative and myogenic (motile, contractile) phenotype.
Perhaps our most intriguing finding is that β-catenin not only regulates the interactions of
MRTF, but it also controls MRTF stability. We propose the following scenario: MRTF
degradation is regulated by GSK-3β–mediated phosphorylation followed by ubiquitination. This
process is very slow in the presence of normal β-catenin levels but is dramatically enhanced
when β-catenin is decreased. This view is supported by our findings that 1) two-hit stimulation
drastically reduces MRTF in β-catenin–down-regulated cells; 2) the same conditions provoke
ubiquitination of MRTF; and 3) GSK-3β inhibitors prevent both the reduction in the MRTF band
and the enhanced ubiquitination. Consistent with our proposal that GSK-3β is a key determinant
of MRTF stability, deletion of GSK-3β facilitates SMA expression in fibroblasts (Fan et al.,
2007; Kapoor et al., 2008); GSK-3β has been shown to phosphorylate myocardin, thereby
114
reducing its transcriptional activity (Charbonney et al., 2011; Badorff et al., 2005); and the E3
ligase CHIP was reported to promote myocardin ubiquitination in a GSK-3β– dependent manner
(Muehlich et al., 2008; Xie et al., 2009). Some of the implicated myocardin phosphorylation sites
are conserved in MRTF, and MRTF-B contains other potential GSK-3β consensus motives as
well. Verification of these and the relevant E3 ligase(s) warrants further studies.
How does a reduction in β-catenin promote MRTF degradation? We propose that Smad3 recruits
GSK-3β to MRTF, and this process is counteracted by β-catenin. Indeed, Smad3 has been
reported to bind to GSK-3β through its MH2 domain (Sacco et al., 2012; Hua et al., 2010), and
we found that the absence of Smad3 suppresses GSK-3β/MRTF association and subsequent
MRTF degradation in β-catenin– depleted cells. Recently Smad3 was shown to suppress the
myocardin gene (Xie et al., 2011), adding yet another mechanism (be- sides direct inhibition and
enhanced degradation) by which Smad3 can antagonize myocardin signaling.
Finally we consider the pathophysiological implications of these findings. β-Catenin levels show
characteristic changes in fibroblasts during wound healing or fibrosis (Cheon et al., 2002; 2005;
Surendran et al., 2005), with a postinjury rise followed by a gradual decrease if tissue restoration
occurs. These changes might be accentuated in the epithelium, where AJ injury can also increase
free β-catenin. The fate of free β-catenin depends on its stability, which is promoted by
fibrogenic and myogenic stimuli, such as Wnt proteins and TGFβ. We propose that an initial rise
in β-catenin keeps fibrogenic Smad3 signaling in check and maintains MRTF activity. This could
contribute to normal healing by facilitating wound closure (contractility; (Tomasek et al., 2006))
and reepithelialization. Later the decrease in β-catenin allows the termination of MRTF
signaling. However, during dysregulated healing, β-catenin–stabilizing inputs become persistent,
sustaining MRTF. Indeed, we found that the expression of several CAr- Gome proteins depends
on β-catenin. Because β-catenin– and MRTF-dependent promoters drive many genes involved in
matrix production and MF differentiation, the final outcome (healing vs. fibrosis) might depend
on the delicate interplay among β-catenin, Smad3, and MRTF/SRF signaling.
In summary, we have defined novel mechanisms by which the integrity of intercellular contacts,
through a network of β-catenin–controlled interactions, regulates MRTF-dependent transcription
and thus the expression of a multitude of key cytoskeletal proteins. These mechanisms likely
play key roles in normal healing, EMT/EMyT, and tissue fibrosis.
115
116
Chapter 5
PTEN and Smad3
The destabilization of PTEN by contact injury promotes 5Smad3 degradation
5.1 Summary
The activation of the myogenic program (α-smooth muscle actin [SMA] expression) in the
epithelium during epithelial–myofibroblast transition (EMyT) is the consequence of the
combined effect of TGFβ and the contact disruption (two-hit model). We have previously shown
that Smad3, a key downstream effector of TGFβ, plays a dual role in EMyT: while it is critically
important for the activation of mesenchymal genes, it inhibits myocardin-related transcription
factor (MRTF), the main driver of the SMA promoter, and thereby delays SMA expression.
During EMyT, Smad3 eventually degrades, which liberates the MRTF-driven myogenic
program. However, the mechanisms that lead to Smad3 downregulation during EMyT have not
been defined. We demonstrate here that the loss or disassembly of cell contacts, in conjunction
with exposure to TGFβ, suppresses the expression of the phosphatase PTEN. EMyT-related
reduction or siRNA-mediated downregulation of PTEN in turn potentiates Smad3 degradation.
Using phospho-specific antibodies, as well as WT and mutant Smad3 constructs, we show that
EMyT is associated with enhanced phosphorylation of the T179 residue in Smad3 linker region,
and this event is necessary for Smad3 degradation. Knockdown of PTEN prolongs Smad3 linker
region phosphorylation (pT179) and concomitantly facilitates Smad3 degradation. PTEN
silencing increases the stimulatory effect of contact uncoupling and TGFβ on SMA promoter
activity and SMA protein expression. Thus, the integrity of intercellular contacts regulates the
level of PTEN, which in turn controls Smad3 stability through impacting on T179
phosphorylation. Our studies reveal a mechanistic link between contact integrity, Smad3 stability
and SMA expression during epithelial-myofibroblast transition.
117
5.2 Introduction
The canonical TGFβ signaling plays a central role in the mediation of EMT (Moustakas and
Heldin, 2012). While Smad3 is a major inducer of several genes involved in mesenchymal
transition, our previous studies have demonstrated that it has an inhibitory role in the myogenic
phase of the process. Specifically, Smad3 mitigates the transcriptional activity of MRTF on the
SMA promoter (Masszi et al., 2010). This temporary brake on EMyT is then relieved because
under two-hit conditions (TGFβ plus contact disruption by low-calcium medium [LCM]) Smad3
gradually degrades, which liberates MRTF and allows for MF differentiation. Clearly, in addition
to TGFβ, the alteration of the AJs also plays an indispensible role in EMyT, providing a second
critical input, which synergistically activates the myogenic program. Searching for molecular
mechanisms underlying the regulation of EMyT by AJs, we showed that β-catenin, liberated
from AJs upon contact injury (Masszi et al., 2004) or LCM (Masszi et al., 2010; Charbonney et
al., 2011) exerts a positive (permissive) effect on the myogenic program.
As mentioned above, the loss of Smad3 protein is a key element in unleashing the myogenic
phase of EMyT, and this phenomenon also requires both “hits” i.e. TGFβ and AJ uncoupling.
Indeed, Smad3 protein showed a modest decrease after contact uncoupling (by LCM), TGFβ
alone had only a marginal effect, while in the presence of both stimuli it dropped by≈ 90% in the
first 48h of EMyT (Masszi et al., 2010). However, it remained to be elucidated how the integrity
of the contacts affects the steady state level of Smad3 protein expression. First we asked whether
specifically targeting the AJ (through E-cadherin downregulation) also interferes with Smad3
stability/expression. We also wished to understand how Smad3 per se is modified by contact
disassembly, and how the two-hit synergize to downregulate Smad3 protein. Although TGFβ has
been shown to suppress Smad3 mRNA expression in certain cells (Yanagisawa et al., 1998), we
sought to concentrate primarily on mechanisms that might affect Smad3 protein degradation, as
our earlier studies indicated that heterologously expressed Smad3 is also reduced or lost during
EMyT (Masszi et al., 2010).
The stability of Smad3 has been reported to be regulated by phosphorylation: various Thr and
Ser residues, distinct from the C-terminal phosphorylation sites, which are responsible for the
nuclear Smad3 uptake, have been proposed to control Smad3 degradation via promoting
ubiquitination. Specifcally the phosphorylation in the linker region, particularly T179, was
118
shown to facilitate stimulus (TGFβ)-induced degradation (Gao et al., 2009; Aragon et al., 2011)
while phosphorylation of T66 in the MH1 region was implicated in basal turnover (Guo et al.,
2008). Interestingly, the phosphorylation of T179 has been recently suggested to promote
proteasomal degradation of Smad3 as well (Gao et al., 2009; Aragon et al., 2011). We therefore
wished to know whether these sites are synergistically targeted and/or necessary for degradation
under two-hit conditions.
Even if these sites prove to be involved in Smad3 downregulation during EMyT, how could the
phosphorylation status of Smad3 be linked to contact disruption? The literature has provided an
interesting hint for us to address this issue. The loss of E-cadherin (which is a frequent
phenomenon in cancer and also a key feature of contact injury) has been shown to reduce the
level of the protein and lipid phosphatase PTEN (Phosphatase and Tensin Homolog Deleted on
chromosome 10) (LI et al., 1997; Li et al., 2007; Fournier et al., 2009). E-cadherin was also
shown to bind PTEN (Fournier et al., 2009). Conversely, E-cadherin was shown to antagonize
the repression of PTEN expression, through a mechanism implicating β-catenin (Lau et al.,
2011). Furthermore, PTEN can associate with Smad3 upon TGFβ treatment (Hjelmeland, 2005)
and PTEN silencing enhances short-term Smad3 signaling (Hjelmeland, 2005). In addition, in
various cells TGFβ has been shown to reduce PTEN message, and decreased PTEN expression
was also observed during EMT, presumably due to the upregulation of key transcriptional
repressors (e.g. Snail). Finally, decreased PTEN levels were associated with MFs transformation
(White, 2006) and were linked the development of fibrosis in experimental models and clinical
cases (Parapuram et al., 2011; Bu et al., 2010).
Based on these findings, we hypothesized that PTEN might be one of the potential links between
contact integrity and Smad3 degradation. We surmised that PTEN might be lost during EMyT
and this might contribute to prolonged Smad3 linker phosphorylation, which in turn might
facilitate its degradation and the activation of SMA expression.
In this work, we show that contact uncoupling or absence (E-cadherin downregulation)
destabilizes PTEN, and that loss of PTEN enhances the two-hit-induced Smad3 degradation. We
also show that phosphorylation of Smad3 on its T179 is critical for the two-hit induced
degradation, and the loss of PTEN facilitates the phosporylation at this site.
119
5.3 Results
5.3.1 Uncoupling or absence of AJs destabilize Smad3
Our previous work (Masszi et al., 2010) showed that uncoupling of AJs by LCM decreases
Smad3 expression, a phenomenon strongly potentiated by TGFβ. We recapitulated these finding,
showing that the combined treatment (LCM and TGFβ) caused a robust decrease in E-cadherin,
which appeared to precede the loss of Smad3 (Figure 27 A). To assess whether the drop in E-
cadherin could play a causal role in Smad3 suppression, we specifically downregulated this chief
AJ component using small interfering RNA (siRNA) in confluent layers, and followed the fate of
Smad3 in the absence or presence TGFβ.
TGFβ treatment of confluent LLCPK monolayers transfected with a control (nonrelated [NR])
siRNA did not cause any Smad3 decrease (Figure 27, B and C), in accordance with our previous
results (Masszi et al., 2010) E-cadherin silencing alone (without TGFβ stimulation) did provoke
a decrease of ≈ 30%,while the E-cadherin silencing followed by TGFβ treatment resulted in a
≈70% reduction in Smad3 protein. Thus contact uncoupling or the absence of E-cadherin leads to
reduced Smad3 expression and this effect is strongly potentiated by TGFβ.
5.3.2 Smad3 induced degradation by the two-hit is independent of RhoA
We have shown earlier that RhoA is a strongly activated by LCM-triggered contact uncoupling
and is a key mediator of the myogenic program as it stimulates MRTF translocation into the
nucleus(Fan et al., 2007; Sebe et al., 2008; Masszi et al., 2010). In addition, a recent work on
hepatic stellate cells suggested that E-cadherin inhibits Smad3 signaling by interfering with Rho
activation (Cho et al., 2010). Therefore we sought to determine if RhoA is involved in the loss of
Smad3 under two-hit conditions. Cells were transfected with NR or RhoA siRNA and, once
confluent, were exposed to the combined treatment for 24 h. RhoA silencing did not prevent the
decrease of Smad3 induced by the two-hit (Figure 28), suggesting that while Rho is necessary for
the myogenic program it is dispensable for Smad3 downregulation.
120
121
122
5.3.3 Contact uncoupling induces Smad3 linker region phosphorylation, which is enhanced by the two-hit conditions
The posttranslational modification of Smad3 is important for its transcriptional activity. While C-
terminal phosphorylation by the TGFβ type I receptor (Zhang et al., 1996) is critical for Smad3
translocation and thus activity, phosphorylation of various sites in the linker region, (i.e. Thr 179
(T179), Ser 204 (S204), Ser 208 (S208), induced by the non-canonical TGFβ pathways, has been
associated with both positive or negative modulatory effects (Wang et al., 2009; Gao et al.,
2009).
To assess whether contact uncoupling affects the phosphorylation of these linker sites, we treated
confluent monolayers with LCM and performed Western blot analysis using phospho-specific
Smad2/3 antibodies. We found that LCM was as effective as TGFβ (the well-documented
agonist) to induce phosphorylation of these residues upon short-term stimulation (Figure 29, A
and B). This finding is consistent with the fact, that various kinases, known to be involved in
linker phosphorylation (including ROK and p38), are also stimulated by LCM (Fan et al., 2007;
Sebe et al., 2008). We then tested the individual and combined effects of these stimuli of the
two-hit scheme at both early and late time points, concentrating on the T179 phosphorylation, as
this event was reported to be a prerequisite for the subsequent modification and degradation of
Smad3 (Gao et al., 2009; Aragon et al., 2011). The various conditions were applied for 1h and
18h. Major differences were observed at the later time point (18h), where the combined
treatment resulted in much higher p179 phosphorylation than either LCM or TGFβ alone, despite
the fact that by then the Smad3 level was already substantially reduced (Figure 29, C and D).
The anti-p179 antibody visualized a doublet where the lower and higher bands correspond to
Smad3 and Smad2, respectively (Supplementary Figure S4). The similar experiment was run in
parallel in order to blot for Smad3 or Smad2.
Taken together, these results show that contact injury leads to Smad3 linker region
phosphorylation (pT179), which is strongly enhanced and prolonged after the application of the
combined stimuli, i.e. under the conditions, which are associated with Smad3 degradation. Of
note, that Smad2 does not degrade under the same conditions (Masszi et al., 2010).
123
124
125
126
5.3.4 The two-hit condition-induced Smad3 degradation is dependent on T179 phophorylation
So far our results can be interpreted in two different ways: since T179 phosphorylation is much
higher in the remaining Smad3 molecules, there is either a preferential preservation of T179-
phosphorylated Smad3, or the enhanced/prolonged phosphorylation of this residue is a key
priming signal that marks Smad3 for subsequent degradation. To assess whether the
phosphorylation of T179 is a positive/permissive signal for the two-hit-induced Smad3
degradation, we generated FLAG-tagged WT and T179A mutant Smad3 constructs. Cells were
transfected with either of these and, after reaching confluence, were exposed to the combined
treatment for 24h. While the stimulation induced ≈ 55% decrease in the steady state level of WT
Smad3, the level of the non-phosphorylatable mutant remained essentially unchanged (Figure 30,
A and B). These data suggest that T179 phosphorylation is critical for the Smad3 degradation in
the setting of the two-hit conditions.
127
128
5.3.5 PTEN expression is suppressed under EMyT-inducing conditions
To gain insight into the link between contact disruption and Smad3 degradation, we considered
that PTEN might play a role in this relationship, an idea that stemmed from several previous
findings as described in the Introduction.
To assess this possibility, first we investigated whether EMyT induction (by interfering with the
contacts and TGFβ addition) affects the expression of PTEN. Contacts were manipulated by
different means as in our earlier studies, using subconfluence, siRNA-mediated E-cadherin
downregulation or LCM. Exposure of subconfluent monolayers to TGFβ for 24h induced a
substantial drop in PTEN expression (Figure 31 A). Similarly, the application of the two-hit
treatment decreased PTEN expression by≈ 50% at 24 h and ≈ 70% at 48 h (Figure 31, B and C).
E-cadherin silencing with siRNA, or TGFβ alone added to monolayers pretreated with control
(NR siRNA) had only a modest effect on PTEN expression. However, E-cadherin knockdown
combined with TGFβ treatment (24h) led to a 60% drop in PTEN expression (Figure 31, D and
E).
Thus these data show that PTEN expression is significantly suppressed in the early phase of
EMyT, and this effect requires a disassembly or loss of AJs and the presence of TGFβ. Our
findings are consistent with earlier data suggesting that E-cadherin expression regulates PTEN
level (Li et al., 2007; Fournier et al., 2009).
129
130
131
5.3.6 Inhibition or silencing of PTEN enhances the two-hit-induced Smad3 degradation.
Having shown that our two-hit model, which drives the myogenic program partly through Smad3
degradation, destabilizes the phosphatase PTEN, we asked whether the loss of PTEN might
contribute to Smad3 degradation. To assess this, we first applied a pharmacological inhibitor of
PTEN (bpVic), before treating subconfluent cells with TGFβ for 24h. The inhibitor decreased
Smad3 expression, which was only marginally enhanced further by TGFβ, in the investigated
time frame (Figure 32, A and B). We then silenced PTEN with a specific siRNA and, upon
reaching confluence we exposed the monolayer to the different stimuli of the two-hit model
(Figure 32 C). Remarkably, while in the control (NR siRNA) samples there was no change in
Smad3 expression after 6 h treatment in any group, the Smad3 level dropped by≈ 80% (Figure
32, C and D) at this early time in PTEN-depleted cells exposed to the combined treatment.
It is worth noting that after 6 hours the PTEN level per se is not yet significantly altered after
LCM+TGFβ treatment in the control group, in agreement with the unchanged Smad3 expression
at this time.
Taken together, these data unambiguously show that the presence of PTEN counteracts the
decrease of Smad3 suppression, or conversely, the loss of PTEN facilitates the loss of Smad3.
132
133
134
5.3.7 PTEN silencing enhances the two-hit-induced Smad3 phosphorylation at T179 and promotes Smad3 degradation
Having demonstrated that T179 phosphorylation is critical for the Smad3 degradation, (Figure
30, A and B) that the two-hit condition enhances Smad3 linker region phosphorylation on T179
(Figure 29, C and D), and that PTEN silencing facilitates the two-hit-induced Smad3 degradation
(Figure 32, C and D), we sought to determine if PTEN silencing could act by affecting the
phosphorylation status of T179 in Smad3. To this end we compared the combined treatment-
induced T179 phosphorylation at different time points in control and PTEN-downregulated cells.
PTEN silencing increased the basal T179 phosphorylation (in non-stimulated cells), and
prolonged phosphorylation after the combined treatment (Figure 33, A and B).
To substantiate the notion that PTEN indeed plays a role in Smad3 degradation by altering T179
phosphorylation, we performed experiments using the WT and non-phosphorylatable Smad3
constructs. We reasoned that if PTEN-mediated T179 dephosphorylation is indeed significantly
contributing to the preservation of Smad3, then the WT molecule should be affected by PTEN
silencing while the T179A should not. To test this we co-transfected cells with FLAG-tagged
WT or 179A Smad3 in conjunction with PTEN silencing (siRNA), and then exposed the
confluent monolayers to the two-hit for 6h. As expected, the stimulus-induced degradation of
WT Smad3 was facilitated by PTEN silencing (Figure 33, C and D), similar to our observation
made with the endogenous molecule (Figure 32, C and D). In contrast T179A Smad3 failed to
degrade upon stimulation and its stability was not affected by concomitant PTEN
downregulation either (Figure 33, C and D).
The phosphorylation of T66 has been reported to facilitate the basal (constitutive) degradation of
Smad3 (Guo et al., 2008). In the absence of available phospho-specific antibody we could not
directly test whether our two-hit condition promotes T66 phosphorylation as well; instead we
checked the impact of the 66A mutation on Smad3 stability. The two-hit stimulation for 6h,in
conjunction with PTEN silencing, induced a robust decrease in the level of the 66A constructs,
which was similar to the behavior of the WT (Figure 33, C and D).
The level of the Smad3 179A mutant was unaffected, even after 24 stimulation in PTEN-
depleted cells, i.e. under conditions when the WT Smad3 completely disappeared from the cells
135
(Figure 33 E). In contrast to the 179A mutant, the 66A Smad3 remained fully sensitive to the
two-hit stimulation, showing substantial drop upon EMyT (Figure 33 F).
The results obtained using the heterologously expressed Smad3 constructs clearly imply that
enhanced Smad3 degradation is a major contributor to decreased Smad3 expression, and this
process is impacted by PTEN. To further elaborate this point, we attempted to compare the effect
of PTEN silencing on the kinetics of the stimulation-induced drop in Smad3 level under
conditions when protein synthesis was blocked by cycloheximide. However, these experiments
were not conclusive due to the very short half-life of PTEN itself in cycloheximide-treated cells
(data not shown).
While the above experiments clearly imply that PTEN regulates Smad3 degradation, it was
conceivable that PTEN might affect Smad3 at the transcriptional level as well. To address this
possibility, we measured the changes in Smad3 mRNA in NR- and PTEN siRNA-transfected
cells in the absence and presence of stimulation. The two-hit condition provoked only a modest
decrease in Smad3 mRNA. PTEN silencing appeared to slightly increase Smad3 mRNA under
basal conditions. However, after stimulation Smad3 significantly decreased in PTEN-depleted
cells compared to the corresponding controls (Figure 33 G).
Taken together, these results suggest that PTEN promotes Smad3 stability, and this effect is, at
least in part, due to its inhibitory impact on T179 phosphorylation. In addition, PTEN might help
maintain Smad3 mRNA expression in cells challenged to undergo EMT.
136
137
138
139
140
5.3.8 PTEN silencing enhances SMA promoter activity and protein expression in the two-hit model
The absence of PTEN has been shown to promote the transformation of fibroblasts into MFs
(White, 2006), albeit the underlying mechanisms have not been characterized. Given that the
loss of PTEN facilitates the degradation of Smad3 (which is an inhibitor of the myogenic
MRTF), we surmised that the loss of PTEN might also facilitate SMA promoter activity and
protein expression.
To address this possibility, we transfected the cells with NR and PTEN siRNA along with the
SMA luciferase reporter system (Masszi et al., 2003; 2010) and then exposed them for 24 h to
TGFβ or the combined stimulation. As shown before, TGFβ exerted only a marginal effect
whereas the combined condition efficiently activated the promoter (Figure 34 A). Importantly,
silencing of PTEN prior to EMyT induction caused a further ≈2.5-fold rise under two-hit
conditions compared to the corresponding control (Figure 34 A). Accordingly, TGFβ+LCM-
induced SMA protein expression was strongly (≈ 5-fold) facilitated after 48 h stimulation in
PTEN-downregulated cells (Figure 34, B and C). Occasionally PTEN-silenced cells exhibited
detectable SMA expression even in resting state, which was slightly increased by the individual
stimuli too, indicating that the loss of PTEN primes for SMA expression (Figure 34 B). Indeed
when the pharmacological inhibitor of PTEN (bpVic) was applied on subconfluent cells, SMA
expression was observed (immunofluorescence) even in absence of TGFβ (Figure 34 D).
Taken together the loss of PTEN facilitates SMA protein expression, and this effect, at least in
part, is due to priming for increased SMA promoter activation during EMyT.
To corroborate our finding in EMyT with the previous results in fibroblasts (White, 2006), we
treated rat lung fibroblasts for 72h with TGFβ and looked at Smad3 and PTEN expression.
Indeed, while the myogenic program was strongly enhanced by TGFβ, Smad3 degraded
significantly, while PTEN dropped moderately (Supplementary Figure S5).
141
142
143
5.4 Discussion
TGFβ is recognized as a central inducer of EMT-EMyT, that activates many pathways critical for
phenotypic and functional transformation (See part 1.6 of this thesis) (Moustakas and Heldin,
2012). Its downstream signal transducer, Smad3, has been repeatedly shown to be necessary for
EMT (Sato et al., 2003; Roberts et al., 2006; Saika et al., 2004). However, our recent studies
have revealed that Smad3 plays a more complex role in the process: namely, Smad3 degrades
during the EMyT, and this event potentiates the myogenic program by disinhibiting the
transcription factor MRTF, a driver cytoskeletal/muscle genes (including SMA), (Masszi et al.,
2010). Smad3 degradation requires both hits (contact injury+TGFβ), in accordance with our
proposed paradigm that intercellular contact injury is a prerequisite for the induction of EMyT by
TGFβ (Masszi et al., 2004; Fan et al., 2007; Kim et al., 2009; Zheng et al., 2009). These findings
place Smad3 as a context-dependent modulator of EMT/EMyT.
While this pro-myogenic role of Smad3 degradation has been firmly established, the link
between the injury of intercellular contacts and Smad3 stability remained to be elucidated.
This study provides evidence that PTEN, a protein phosphatase, and major tumor suppressor,
represents a functional link between cell contact integrity and Smad3 stability. We found that the
disassembly or loss of AJs, in conjunction with TGFβ exposure, i.e. the very same conditions
that provoke EMyT, destabilize PTEN. EMyT-related reduction or siRNA-mediated
downregulation of PTEN in turn potentiates Smad3 degradation. Using phospho-specific
antibodies, as well as WT and mutant Smad3 constructs, we show that EMyT is associated with
enhanced phosphorylation of the T179 residue in the Smad3 linker region, and this event is
necessary for Smad3 degradation. Knockdown of PTEN prolongs Smad3 linker region
phosphorylation (pT179) and concomitantly facilitates Smad3 degradation. Finally, PTEN
silencing increases the stimulatory effect of contact uncoupling and TGFβ on SMA promoter
activity and SMA protein expression.
The destabilization of PTEN, as observed in the context of the two-hit model, is in accordance
with similar phenomena reported in the context of cancer. Indeed, the loss of E- cadherin, an
early mechanism in tumor initiation and progression (Guilford, 1999), was reported to lead to
PTEN destabilization (Li et al., 2007; Fournier et al., 2009). This, in turn, facilitates the
144
activation of the phosphoinositide 3-kinase (PI3 Kinase) pathway, and thereby cell proliferation
(Brugge et al., 2007; Chalhoub and Baker, 2009).
Although the underlying mechanisms have not been fully worked out, a group recently
implicated β-catenin, (the direct binding partner of E-cadherin), as a negative regulator of PTEN
expression. They showed that the loss of E-cadherin leads to β-catenin-mediated suppression of
the early growth response gene 1 (Egr1), which is a driver of the PTEN gene (Lau et al., 2011).
While the mechanism of PTEN downregulation was not the focus of our work, it is noteworthy
that, as demonstrated in our earlier studies and the previous chapter, E-cadherin downregulation
or two-hit-inducd EMyT increases cytoslolic and nuclear β-catenin levels, and β-catenin’s
trancriptional activity (Charbonney et al., 2011; Masszi et al., 2004). Nonetheless, repression of
the PTEN gene is certainly not the only mechanism leading to the loss of the PTEN: post-
transcriptional and post-translational, TGFβ-mediated downregulation have also been reported as
important contributing factors (Yang et al., 2009; Chow et al., 2007).
The central aim of our work was to elucidate the mechanism of Smad3 downregulation during
EMyT. We were interested in the potential priming of Smad3 for protein degradation, since our
earlier studies indicated that not only the endogenous but also the heterologously expressed
(CMV promoter-driven) Smad3 is eliminated during EMyT, clearly implying a
posttranscriptional mechanism (Masszi et al., 2010).
A variety of posttranslational modifications of Smad3 impact on its nuclear traffic, affinity for
partners, transcriptional activity and stability (Fukuchi et al., 2001; Matsuura et al., 2004;
Wrighton et al., 2008; Liu and Feng, 2010; AlarcOn et al., 2009; Gao et al., 2009; Aragon et al.,
2011). The C-terminal phosphorylation is leading the transcriptional activity of Smad3 through
its translocation into the nucleus. However, other modifications can also regulate Smad3, namely
phosphorylation at other sites (Feng and Derynck, 2005; Matsuura et al., 2004) acetylation
(Oussaief et al., 2009), SUMOylation (Imoto et al., 2008) and ubiquitination (Fukuchi et al.,
2001; Izzi and Attisano, 2004).
A number of kinases has been implicated in the regulation of Smad3 activity and stability, by
inducing the phosphorylation of various sites in the linker region (Kretzschmar et al., 1999;
Matsuura et al., 2004; Mori et al., 2004; AlarcOn et al., 2009; Gao et al., 2009; Fuentealba et al.,
2007; Sapkota et al., 2007) and prime it for subsequent degradation (Mavrakis et al., 2007). In
145
fact, the concept that enhanced transcriptional activity may be a prerequisite for subsequent
robust degradation (Aragon et al., 2011) is based on finding that phosphorylation at various sites
in the linker region (e.g catalyzed by CDK8/9) creates binding sites for transcriptional co-
activators (such a Pin or perhaps TAZ), but also primes for a second phosphorylation (e.g. by
GSK3β) in the linker region, which facilitates the association of Smads with ubiquitin ligases
(Gao et al., 2009).
Our findings in the context of the two-hit model (LCM+TGFβ), are in good agreement with this
view in several respects: These conditions initially trigger robust Smad3 accumulation in the
nucleus but this is followed by degradation (see overall discussion). A recent paper might shed
light on the mechanism whereby contact injury facilitates Smad3 translocation. Cell density is
sensed by the Hippo pathway and regulates the localization of transcriptional activators TAZ and
YAP (TAZ/YAP). Low density or contact uncoupling induces YAP/TAZ translocation to the
nucleus. Importantly, TAZ is a SMAD nuclear retention factor and is co-localized with Smad3 in
the nucleus,upon uncoupling of the cell contact by LCM, which can explain why the LCM
potentiates the TGFβ-driven Smad3 translocation (Varelas et al., 2010).
Once in the nucleus, the fate of Smad3 may be manifold: 1) the C-terminus may be
dephosphorylated by PPM1, which relocates Smad3 to the cytosol (Bu et al., 2008); 2) As
mentioned, Smad3 can be phosphorylated at various sites in the linker region by CDK (8/9)
(AlarcOn et al., 2009; Gao et al., 2009) and glycogen synthase kinase-3 (GSK3) (Fuentealba et
al., 2007; Sapkota et al., 2007; Gao et al., 2009). Conceivably linker phosphorylated Smads can
also be dephosphorylated on their C-terminus and reenter the cytosol where they are degraded 3)
Linker phosphorylated Smads can be dephosphorylated by small C-terminal domain
phosphatases (SCP) (Sapkota et al., 2007; Wrighton et al., 2006).
We propose that PTEN can act as linker region phosphatase for Smad3 and thereby it maintains
Smad3 stability. In favor of this idea we found that PTEN silencing enhances and prolongs T179
Smad3 linker region phosphorylation and Smad3 degradation. Consistent with the critical role of
T179 in EMyT-related Smad3 degradation, this residue was shown to facilitate TGFβ-induced
Smad3 degradation though ubiquitination (Sapkota et al., 2007; Gao et al., 2009; Aragon et al.,
2011). Another residue T66 in the MH1 region was related to baseline degradation and turnover
(Guo et al., 2008). However, our mutagenesis studies indicate that the phosphorylation of T66 is
146
not required for the two-hit-triggered Smad3 degradation. It remains to be tested whether Smad3
T179 is a direct or indirect target of PTEN. It is noteworthy that PTEN was reported to act as a
stabilizer of the nuclear protein phosphatase 1A (PPM1A) and required for Smad3
dephosphorylation in the nucleus (Bu et al., 2008). Thus it may act in a similar manner with
regards to linker phosphatses as well. In any case our studies defined a new role for PTEN as a
positive regulator of Smad3 stability.
Finally, we show that PTEN silencing enhances SMA protein expression in the epithelium, a
phenomenon that can contribute to EMyT and fibrosis. Indeed, past work had shown an
association btween the loss of PTEN and the transformation of fibroblasts into myofibroblasts
(White, 2006).
To the best of our knowledge, the present work is the first to associate the loss of PTEN and the
myogenic program in the epithelium. This discovery provides a link between contact uncoupling
(or absence of E-cadherin), TGFβ signaling and reduced Smad3 expression. The finding that the
loss of PTEN destabilizes Smad3 may be very important from a cancer standpoint as well: it may
help explain the well-known phenomenon that in advanced tumors TGFβ, which is originallly a
tumor suppressor by promoting apoptosis (Hsing et al., 1996; Lin and Chou, 1992) becomes a
tumor promoter. Since Smad3 mediates the apoptotic effect of TGFβ (Yanagisawa et al., 1998;
Wildey et al., 2003), its loss significantly contributes to the imbalance between apoptosis and cell
proliferation (Hjelmeland, 2005).
In summary, we have identified PTEN as central mediator of the cell contact-dependent
regulation of Smad3 stability. This mechanism likely plays key roles in normal healing, cancer
invasions and tissue fibrosis.
147
Chapter 6
Discussion
Overall discussion and future directions 6Injury to the intercellular contacts concomitant with exposure to TGFβ emerges as the double
requirement for the induction of EMT/EMyT in a confluent epithelium monolayer (Masszi et al.,
2004). This “two-hit” scenario was suggested by our group and confirmed by others to be a
major inducer of the process (Busche et al., 2008; Kim et al., 2009; Inumaru et al., 2009; Tamiya
et al., 2010; Chen et al., 2012). These studies led to the recognition that intercellular contacts are
not merely passive targets, but are active contributors to EMT/EMyT (Masszi et al., 2004). It is
especially true for the AJ contact protein E-cadherin (Onder et al., 2008; Busche et al., 2008) and
its binding partner β-catenin (Masszi et al., 2004; Kim et al., 2009).
The central aim of this work was to characterize some of the mechanisms whereby AJ injury or
loss contributes to the development of the myogenic reprogramming (SMA expression) in the
epithelium. The central target for transcriptional regulation leading to the expression of SMA is
represented by the CArG box cis-element, driven by the myogenic complex. The latter is formed
by serum response factor (SRF), and its essential co-activator myocardin-related transcription
factor (MRTF). Our group had shown that the Rho/Rac activation-mediated F-actin
polymerization facilitates nuclear accumulation of MRTF and specifically that cell contact
disassembly induces the translocation of MRTF into the nucleus by a Rho/Rho kinase dependent
mechanism (Fan et al., 2007).
However, MRTF translocation is not sufficient for SMA expression and thus for EMyT TGFβ
signaling is necessary. In addition, a recent publication from our lab revealed that the two-hit
condition induces a dramatic drop in Smad3 levels, the direct downstream effector of TGFβ.
Moreover, we discovered that Smad3 is a strong inhibitor of the myogenic program and the
subsequent SMA expression, as it interferes with the action of MRTF (Masszi et al., 2010).
148
The results of the present thesis provide novels insights into the mechanisms, which link contact
disassembly and the main regulators (MRTF, Smad3) of the myogenic program.
In the first part of the results chapter (part 4), we show that β-catenin not only regulates the
interactions of MRTF with SRF or Smad3, but also controls MRTF stability, and thereby the
expression of several CArGome proteins (Charbonney et al., 2011). We demonstrate that the
availability of β-catenin, after AJ uncoupling or in the absence of E-cadherin, is responsible for
counteracting the inhibitory action of Smad3 on MRTF. The association of β-catenin with Smad3
prevents the association of the latter with MRTF and alternatively, the association of β-catenin
with MRTF could prevent the inhibitory action of Smad3 on MRTF. Moreover, the association
of β-catenin and Smad3 might mitigate Smad3-dependent, but enhance β-catenin–dependent
gene transcription.
The other promyogenic activity of β-catenin is mediated through its positive effect on MRTF
stability. Indeed, during the two-hit stimulation MRTF is drastically reduced if β-catenin is
silenced. The same conditions provoke the increased ubiquitination of MRTF in a GSK-3β
dependent manner. These findings are in line with the literature reporting GSK-3β as an
important determinant of myocardin stability (Badorff et al., 2005). In agreement with this
possibility, the deletion of GSK-3β facilitates SMA expression in fibroblasts (Kapoor et al.,
2008).
The liberation of β-catenin and its delicate interplay with Smad3 and MRTF/SRF signaling,
place it as a central regulator of the MRTF-dependent transcription and thus the expression of a
multitude of key cytoskeletal proteins, including SMA.
In the second result chapter (part 5), we provide a link between contact uncoupling (or the
absence of E-cadherin) associated with TGFβ stimulation, and reduced Smad3 expression.
We incriminate PTEN, a lipid and protein phosphatase (LI et al., 1997; Steck et al., 1997).
Recent studies reported its association with fibroblast to myofibroblast transformation in IPF
patients (White, 2006) and other investigators found that the loss of PTEN in fibroblasts
enhances skin fibrosis (Parapuram et al., 2011) and systemic sclerosis (Bu et al., 2010). Thus,
increasing evidence suggests strong correlation between the loss of PTEN and fibrogenesis in in
vivo models. However, the role of PTEN in fibrosis-associated EMT per se has not been
149
addressed. Interestingly, using pten null mice, a group recently reported the modified expression
of different collagens isoforms and integrins in hepatic carcinogenesis (Keane K. Y. Lai, Plos
gen 2011). This finding is suggestive of the emergence of a fibrogenic and cancer-promoting
EMT upon the loss of PTEN. Nonetheless this possibility should be directly addressed in PTEN
knockout animals in models of experimental kidney or lung fibrosis.
Here we show that the integrity of intercellular contacts regulates the level of the phosphatase
PTEN, which in turn controls Smad3 stability through impacting on T179 phosphorylation in the
linker region. First, the loss or disassembly of cell contacts and the exposure to TGFβ (the very
same conditions that provoke EMyT), destabilize PTEN. Smad3 degradation is also potentiated
by the downregulation of PTEN. Looking at the post-translational modification of Smad3, we
show that EMyT is associated with enhanced phosphorylation of the T179 residue in Smad3
linker region, and this event is necessary for Smad3 degradation. Knockdown of PTEN prolongs
Smad3 linker region phosphorylation (pT179) and concomitantly facilitates Smad3 degradation.
Finally, PTEN silencing increases the two-hit induced SMA promoter activity and SMA protein
expression.
Interestingly, a group recently described β-catenin to be responsible for the negative regulation
of PTEN expression. They incriminate β-catenin as a suppressor of the early growth response
gene 1, one driver of PTEN gene (Egr1)(Lau et al., 2011). Another potential mechanism whereby
contact disruption may facilitate Smad3 degradation invokes the observation that E-cadherin
undergoes lysosomal degradation during oncogene-induced EMT. Importantly preliminary
experiments suggest that contact disruption by LCM facilitates association between E-cadherin
and Smad3 (Palacios et al., 2005). It is therefore conceivable that E-cadherin, mobilized from the
membrane by AJ injury, targets (“carries”) Smad3 to the lysosome, thereby contributing to its
degradation.
The two interesting mechanisms described in the present work, through which contact
uncoupling might favor the myogenic program, have to be put in perspective with the previous
mechanism described in the lab, involving MRTF (Fan et al., 2007; Sebe et al., 2008; Masszi et
al., 2010). Our lab has shown LCM-induced contact disruption stimulates the Rho-ROK
pathway, which induces F-actin polymerization and promotes MRTF translocation to the nucleus
(Fan et al., 2007). However, the action of MRTF is initially mitigated by Smad3 and
150
subsequently this molecule is degraded, liberating MRTF. As the central driver of the myogenic
program, MRTF could be potentially influenced by or interacting with the two molecules (β-
catenin and PTEN) incriminated in the mechanisms described above.
Specifically: We have shown that β-catenin is able to form a complex with MRTF, and this
association is not mediated by Smad3 per se (Charbonney et al., 2011). Currently the functional
significance and the exact structural basis and the regulation of the MRTF/β-catenin complex are
unknown. Nonetheless it is tempting to speculate that this interaction might have a positive effect
on the myogenic program, since both molecules have been shown to exert a positive action on
this process. This possibility is intriguing since it would directly link a major
proliferative/fibrogenic and a major cytoskeleton-regulating, myogenic transcription factor.
Clearly, future studies are required to address this point.
Further investigations are also warranted to define the specific kinases that regulate Smad3 linker
phosphorylation during EMyT(Sacco et al., 2012). Detecting the effect of specific kinase
inhibitors (p38, ROK, casein kinase) on T179 phosphorylation and Smad3 degradation is a useful
first step in this direction. In addition the role of PTEN in the dephosphorylation of other linker
region residues (S203, S207) should also be tested in the context of the two-hit model. This can
be assessed by pharmacological inhibition (BpVic) or silencing of PTEN (siRNA). Another
question that remains to be clarified is whether the action of PTEN on Smad3 requires its
phosphatase activity or it may act as an adaptor. This cannot be ruled out since PTEN interacts
with other phosphatases that were implicated in the direct dephosphorylation of Smad3.
Downregulation of endogenous PTEN followed the reexpression of the phosphatase-active or
phosphatase-dead enzyme is an adequate approach to address this issue.
151
152
An important further point regards the central regulatory role of Smad3. Our work emphasizes
the inhibitory action of Smad3 on the myogenic program. In this regard our research has changed
the overall view about the role of Smad3 in fibrosis and MF generation. While Smad3 was
previously seen as fully pro-EM(y)T molecule, our studies have contributed to the formation of
a more subtle view (Masszi et al., 2010; Masszi and Kapus, 2011). Nonetheless, Smad3 has been
reported to be necessary for EMT (Roberts et al., 2006; Kalluri and Neilson, 2003; Phanish et al.,
2006; Meng et al., 2010) and it is an undisputed inducer of ECM deposition and MMP
expression. To reconcile these apparently disparate findings and views, we have proposed that
Smad3 is a fine-tuner of EMyT, which can be divided into an early, mesenchymal, Smad3-
promoted phase and a late, myogenic, Smad3-inhibitable phase (Figure 36) (Masszi and Kapus,
2011). Moreover, while Smad3 clearly inhibits MRTF or the MRTF-mediated SMA induction, it
may also exert positive effects on SMA expression through other mechanisms in a cell-type and
context-specific manner. In this regard, recent publications (Davis-Dusenbery et al., 2011; Long
and Miano, 2011) revealed that Smad3 and MRTF both can stimulate (through their own cis
elements) the transcription of microRNA 143/145. This micro-RNA downregulates KLF4, a
major antimyogenic transcription factor that exerts its suppressive effect through the TCE cis
element, which is also present in the SMA promoter. It is therefore conceivable that Smad3 may
inhibit or facilitate SMA expression, depending on whether the process is primarily driven by an
MRTF- or by KLF4-dependent manner. The impact of the other regulators (β-catenin, PTEN) on
mirR 143/145 remains to be established.
Finally, yet another level of complexity arises from the analysis of spatiotemporal changes in
Smad3 concentration during the process of EMyT. Namely, we have made the interesting
observation, that despite the strong overall degradation of Smad3, under two-hit conditions, it
initially hugely accumulates in the nucleus. This locus appears to be a temporary “hiding place”
from degradation. In agreement with this observation, SBE- dependent transcription it
maintained despite a substantial overall decrease in Smad3 protein after 48 stimulation. This
observation is in agreement with a recent work, showing that the cell contact uncoupling strongly
facilitates Smad3 accumulation in the nucleus. The underlying mechanism is that contact
disruption inhibits the Hippo pathway (Zhao et al., 2007), leading to the nuclear translocation of
TAZ, a transcriptional co-activator that binds to and sequestrates Smad3 in the nucleus (Varelas
et al., 2008; 2010). Therefore it is possible that Smad3 remains present in a sufficiently high
153
concentration during (early) EMyT to drive SBEs (e.g. through the Smad3/TAZ complex), while
it loses its interaction with and thus inhibitory effect on MRTF. Indeed, our preliminary data
imply that active TAZ strongly potentiates the activation of the SMA promoter. This intriguing
finding warrants further study. Similarly it remains to be determined how post-translational
modifications of Smad3 in the nucleus (Wrighton et al., 2008; Liu and Feng, 2010; AlarcOn et
al., 2009; Gao et al., 2009; Aragon et al., 2011), might interfere with its MRTF-inhibiting
activity.
The extensive morbidity and mortality related to organ fibrosis together with the current
incurability of this disease entity are alarming facts that necessitate a much better understanding
of the fundamental mechanisms underlying this devastating condition.
Our work has identified novel players and fate-determining interactions in EMyT. It is our hope
that our studies contribute to such better understanding by providing important insight into the
mechanisms by which the injury of epithelial cell contacts triggers, maintains and worsens the
disease process. Further studies should aim at the verification of these molecular patho-
mechanisms in animal models of fibrosis and to develop molecular tools (e,g. specific cell-
permeable fusion peptides) that can interfere with the described interactions thereby lessening
fibrogenesis, and proving effective therapy.
154
155
References
Aberle, H., A. Bauer, J. Stappert, A. Kispert, and R. Kemler. 1997. beta-catenin is a target for the ubiquitin-proteasome pathway. EMBO J. 16:3797–3804.
Acloque, H., M.S. Adams, K. Fishwick, M. Bronner-Fraser, and M.A. Nieto. 2009. Epithelial-mesenchymal transitions: the importance of changing cell state in development and disease. J. Clin. Invest. 119:1438–1449.
Adams, J.C. 2002. Molecular organisation of cell-matrix contacts: essential multiprotein assemblies in cell and tissue function. ERM. 4:1–24.
Aigner, K., B. Dampier, L. Descovich, M. Mikula, A. Sultan, M. Schreiber, W. Mikulits, T. Brabletz, D. Strand, P. Obrist, W. Sommergruber, N. Schweifer, A. Wernitznig, H. Beug, R. Foisner, and A. Eger. 2007. The transcription factor ZEB1 (deltaEF1) promotes tumour cell dedifferentiation by repressing master regulators of epithelial polarity. Oncogene. 26:6979–6988.
AlarcOn, C., A.-I. Zaromytidou, Q. Xi, S. Gao, J. Yu, S. Fujisawa, A. Barlas, A.N. Miller, K. Manova-Todorova, M.J. Macias, G. Sapkota, D. Pan, and J. MassaguE. 2009. Nuclear CDKs drive Smad transcriptional activation and turnover in BMP and TGF-beta pathways. Cell. 139:757–769.
Ansieau, S., J. Bastid, A. Doreau, A.-P. Morel, B.P. Bouchet, C. Thomas, F. Fauvet, I. Puisieux, C. Doglioni, S. Piccinin, R. Maestro, T. Voeltzel, A. Selmi, S. Valsesia-Wittmann, C. Caron de Fromentel, and A. Puisieux. 2008. Induction of EMT by twist proteins as a collateral effect of tumor-promoting inactivation of premature senescence. Cancer Cell. 14:79–89.
Aragon, E., N. Goerner, A.I. Zaromytidou, Q. Xi, A. Escobedo, J. Massague, and M.J. Macias. 2011. A Smad action turnover switch operated by WW domain readers of a phosphoserine code. Genes & Development. 25:1275–1288.
Aresu, L., S. Benali, S. Garbisa, E. Gallo, and M. Castagnaro. 2011. Matrix metalloproteinases and their role in the renal epithelial mesenchymal transition. Histol Histopathol. 26:307–313.
Arnott, J.A., X. Zhang, A. Sanjay, T.A. Owen, S.L. Smock, S. Rehman, W.G. DeLong, F.F. Safadi, and S.N. Popoff. 2008. Molecular requirements for induction of CTGF expression by TGF-β1 in primary osteoblasts. Bone. 42:871–885.
Ashcroft, G.S., X. Yang, A.B. Glick, M. Weinstein, J.L. Letterio, D.E. Mizel, M. Anzano, T. Greenwell-Wild, S.M. Wahl, C. Deng, and A.B. Roberts. 1999. Mice lacking Smad3 show accelerated wound healing and an impaired local inflammatory response. Nat Cell Biol. 1:260–266.
Attisano, L., and E. Labbe. 2004. TGFbeta and Wnt pathway cross-talk. Cancer Metastasis Rev. 23:53–61.
Avizienyte, E., A.W. Wyke, R.J. Jones, G.W. McLean, M.A. Westhoff, V.G. Brunton, and M.C. Frame. 2002. Src-induced de-regulation of E-cadherin in colon cancer cells requires integrin signalling. Nat Cell Biol. 4:632–638.
156
Babu, P. 1977. Early developmental subdivisions of the wing disk in Drosophila. Mol Gen Genet. 151:289–294.
Badorff, C., F.H. Seeger, A.M. Zeiher, and S. Dimmeler. 2005. Glycogen synthase kinase 3beta inhibits myocardin-dependent transcription and hypertrophy induction through site-specific phosphorylation. Circulation Research. 97:645–654.
Balzac, F. 2005. E-cadherin endocytosis regulates the activity of Rap1: a traffic light GTPase at the crossroads between cadherin and integrin function. Journal of Cell Science. 118:4765–4783.
Barrallo-Gimeno, A., and M.A. Nieto. 2005. The Snail genes as inducers of cell movement and survival: implications in development and cancer. Development. 132:3151–3161.
Barron, M.R., N.S. Belaguli, S.X. Zhang, M. Trinh, D. Iyer, X. Merlo, J.W. Lough, M.S. Parmacek, B.G. Bruneau, and R.J. Schwartz. 2005. Serum response factor, an enriched cardiac mesoderm obligatory factor, is a downstream gene target for Tbx genes. J Biol Chem. 280:11816–11828.
Batlle, E., E. Sancho, C. Franci, D. Dominguez, M. Monfar, J. Baulida, and A. Garcia de Herreros. 2000. The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumour cells. Nat Cell Biol. 2:84–89.
Baum, B., and M. Georgiou. 2011. Dynamics of adherens junctions in epithelial establishment, maintenance, and remodeling. The Journal of Cell Biology. 192:907–917.
Behrens, J. 2000. Control of beta-catenin signaling in tumor development. Ann N Y Acad Sci. 910:21–33– discussion 33–5.
Behrens, J., L. Vakaet, R. Friis, E. Winterhager, F. van Roy, M.M. Mareel, and W. Birchmeier. 1993. Loss of epithelial differentiation and gain of invasiveness correlates with tyrosine phosphorylation of the E-cadherin/beta-catenin complex in cells transformed with a temperature-sensitive v-SRC gene. The Journal of Cell Biology. 120:757–766.
Bhowmick, N.A., R. Zent, M. Ghiassi, M. McDonnell, and H.L. Moses. 2001. Integrin beta 1 signaling is necessary for transforming growth factor-beta activation of p38MAPK and epithelial plasticity. J Biol Chem. 276:46707–46713.
Birchmeier, W., and J. Behrens. 1994. Cadherin expression in carcinomas: role in the formation of cell junctions and the prevention of invasiveness. Biochim. Biophys. Acta. 1198:11–26.
Blanco, M.J., A. Barrallo-Gimeno, H. Acloque, A.E. Reyes, M. Tada, M.L. Allende, R. Mayor, and M.A. Nieto. 2007. Snail1a and Snail1b cooperate in the anterior migration of the axial mesendoderm in the zebrafish embryo. Development. 134:4073–4081.
Bolos, V., H. Peinado, M.A. Perez-Moreno, M.F. Fraga, M. Esteller, and A. Cano. 2003. The transcription factor Slug represses E-cadherin expression and induces epithelial to mesenchymal transitions: a comparison with Snail and E47 repressors. Journal of Cell Science. 116:499–511.
Bonniaud, P., M. Kolb, T. Galt, J. Robertson, C. Robbins, M. Stampfli, C. Lavery, P.J. Margetts, A.B. Roberts, and J. Gauldie. 2004. Smad3 null mice develop airspace enlargement and are resistant to TGF-beta-mediated pulmonary fibrosis. J Immunol. 173:2099–2108.
Boutet, A., C.A. De Frutos, P.H. Maxwell, M.J. Mayol, J. Romero, and M.A. Nieto. 2006. Snail activation disrupts tissue homeostasis and induces fibrosis in the adult kidney. EMBO J. 25:5603–5613.
157
Bowley, E., D.B. O'Gorman, and B.S. Gan. 2007. Beta-catenin signaling in fibroproliferative disease. J Surg Res. 138:141–150.
Brembeck, F.H., M. Rosario, and W. Birchmeier. 2006. Balancing cell adhesion and Wnt signaling, the key role of beta-catenin. Curr Opin Genet Dev. 16:51–59.
Brewster, C.E., P.H. Howarth, R. Djukanovic, J. Wilson, S.T. Holgate, and W.R. Roche. 1990. Myofibroblasts and subepithelial fibrosis in bronchial asthma. American Journal of Respiratory Cell and Molecular Biology. 3:507–511.
Broekema, M., M.C. Harmsen, M.J.A. van Luyn, J.A. Koerts, A.H. Petersen, T.G. van Kooten, H. van Goor, G. Navis, and E.R. Popa. 2007. Bone marrow-derived myofibroblasts contribute to the renal interstitial myofibroblast population and produce procollagen I after ischemia/reperfusion in rats. J Am Soc Nephrol. 18:165–175.
Brugge, J., M.-C. Hung, and G.B. Mills. 2007. A new mutational AKTivation in the PI3K pathway. Cancer Cell. 12:104–107.
Bryant, D.M., and J.L. Stow. 2004. The ins and outs of E-cadherin trafficking. Trends in Cell Biology. 14:427–434.
Bu, S., B. Kapanadze, T. Hsu, and M. Trojanowska. 2008. Opposite effects of dihydrosphingosine 1-phosphate and sphingosine 1-phosphate on transforming growth factor-beta/Smad signaling are mediated through the PTEN/PPM1A-dependent pathway. J Biol Chem. 283:19593–19602.
Bu, S., Y. Asano, A. Bujor, K. Highland, F. Hant, and M. Trojanowska. 2010. Dihydrosphingosine 1-phosphate has a potent antifibrotic effect in scleroderma fibroblasts via normalization of phosphatase and tensin homolog levels. Arthritis Rheum. 62:2117–2126.
Bukholm, I.K., J.M. Nesland, and A.L. Borresen-Dale. 2000. Re-expression of E-cadherin, alpha-catenin and beta-catenin, but not of gamma-catenin, in metastatic tissue from breast cancer patients [seecomments]. J. Pathol. 190:15–19.
Busche, S., A. Descot, S. Julien, H. Genth, and G. Posern. 2008. Epithelial cell-cell contacts regulate SRF-mediated transcription via Rac-actin-MAL signalling. Journal of Cell Science. 121:1025–1035.
Busche, S., E. Kremmer, and G. Posern. 2010. E-cadherin regulates MAL-SRF-mediated transcription in epithelial cells. Journal of Cell Science. 123:2803–2809.
Cadigan, K.M., and R. Nusse. 1997. Wnt signaling: a common theme in animal development. Genes & Development. 11:3286–3305.
Cano, A., M.A. Perez-Moreno, I. Rodrigo, A. Locascio, M.J. Blanco, M.G. del Barrio, F. Portillo, and M.A. Nieto. 2000. The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat Cell Biol. 2:76–83.
Carlson, M.A., M.T. Longaker, and J.S. Thompson. 2003. Wound splinting regulates granulation tissue survival. J Surg Res. 110:304–309.
Carver, E.A., R. Jiang, Y. Lan, K.F. Oram, and T. Gridley. 2001. The mouse snail gene encodes a key regulator of the epithelial-mesenchymal transition. Molecular and Cellular Biology. 21:8184–8188.
158
Cassiman, D., L. Libbrecht, V. Desmet, C. Denef, and T. Roskams. 2002. Hepatic stellate cell/myofibroblast subpopulations in fibrotic human and rat livers. Journal of Hepatology. 36:200–209.
Cavey, M., M. Rauzi, P.-F. Lenne, and T. Lecuit. 2008. A two-tiered mechanism for stabilization and immobilization of E-cadherin. Nature. 453:751–756.
Chalhoub, N., and S.J. Baker. 2009. PTEN and the PI3-kinase pathway in cancer. Annu Rev Pathol. 4:127–150.
Chang, T.-C., C.-C. Liu, E.-W. Hsing, S.-M. Liang, Y.-H. Chi, L.-Y. Sung, S.-P. Lin, T.-L. Shen, B.-S. Ko, B.L. Yen, S.-F. Yet, K.K. Wu, and J.-Y. Liou. 2012. 14-3-3sigma Regulates beta-Catenin-Mediated Mouse Embryonic Stem Cell Proliferation by Sequestering GSK-3beta. PLoS ONE. 7:e40193.
Charbonney, E., P. Speight, A. Masszi, H. Nakano, and A. Kapus. 2011. β-catenin and Smad3 regulate the activity and stability of myocardin-related transcription factor during epithelial-myofibroblast transition. Mol. Biol. Cell. 22:4472–4485.
Chen, H.-C., Y.-T. Zhu, S.-Y. Chen, and S.C. Tseng. 2012. Wnt signaling induces epithelial–mesenchymal transition with proliferation in ARPE-19 cells upon loss of contact inhibition. 92:676–687.
Chen, J.-H., W.L.K. Chen, K.L. Sider, C.Y.Y. Yip, and C.A. Simmons. 2011. beta-catenin mediates mechanically regulated, transforming growth factor-beta1-induced myofibroblast differentiation of aortic valve interstitial cells. Arterioscler. Thromb. Vasc. Biol. 31:590–597.
Chen, Y.T., D.B. Stewart, and W.J. Nelson. 1999. Coupling assembly of the E-cadherin/beta-catenin complex to efficient endoplasmic reticulum exit and basal-lateral membrane targeting of E-cadherin in polarized MDCK cells. The Journal of Cell Biology. 144:687–699.
Cheon, S., R. Poon, C. Yu, M. Khoury, R. Shenker, J. Fish, and B.A. Alman. 2005. Prolonged β-catenin stabilization and tcf-dependent transcriptional activation in hyperplastic cutaneous wounds. Lab Invest. 85:416–425.
Cheon, S.S., A.Y.L. Cheah, S. Turley, P. Nadesan, R. Poon, H. Clevers, and B.A. Alman. 2002. beta-Catenin stabilization dysregulates mesenchymal cell proliferation, motility, and invasiveness and causes aggressive fibromatosis and hyperplastic cutaneous wounds. Proc. Natl. Acad. Sci. U.S.A. 99:6973–6978.
Chitaev, N.A., and S.M. Troyanovsky. 1998. Adhesive but not lateral E-cadherin complexes require calcium and catenins for their formation. The Journal of Cell Biology. 142:837–846.
Cho, I.J., Y.W. Kim, C.Y. Han, E.H. Kim, R.A. Anderson, Y.S. Lee, C.H. Lee, S.J. Hwang, and S.G. Kim. 2010. E-cadherin antagonizes transforming growth factor β1 gene induction in hepatic stellate cells by inhibiting RhoA-dependent Smad3 phosphorylation. Hepatology. 52:2053–2064.
Chow, J.Y.C., K.T. Quach, B.L. Cabrera, J.A. Cabral, S.E. Beck, and J.M. Carethers. 2007. RAS/ERK modulates TGFbeta-regulated PTEN expression in human pancreatic adenocarcinoma cells. Carcinogenesis. 28:2321–2327.
Chu, Y.-S., W.A. Thomas, O. Eder, F. Pincet, E. Perez, J.P. Thiery, and S. Dufour. 2004. Force measurements in E-cadherin-mediated cell doublets reveal rapid adhesion strengthened by actin cytoskeleton remodeling through Rac and Cdc42. The Journal of Cell Biology. 167:1183–1194.
159
Chung, E.J., H.K. Lee, S.-A. Jung, S.J. Lee, H.Y. Chee, Y.H. Sohn, and J.H. Lee. 2012. Transduction of PTEN proteins using the tat domain modulates TGF-beta1-mediated signaling pathways and transdifferentiation in subconjunctival fibroblasts. Invest. Ophthalmol. Vis. Sci. 53:379–386.
Clifford, R.L., K. Deacon, and A.J. Knox. 2008. Novel regulation of vascular endothelial growth factor-A (VEGF-A) by transforming growth factor (beta)1: requirement for Smads, (beta)-CATENIN, AND GSK3(beta). J Biol Chem. 283:35337–35353.
Comijn, J., G. Berx, P. Vermassen, K. Verschueren, L. van Grunsven, E. Bruyneel, M. Mareel, D. Huylebroeck, and F. van Roy. 2001. The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion. Molecular Cell. 7:1267–1278.
Conery, A.R., Y. Cao, E.A. Thompson, C.M.J. Townsend, T.C. Ko, and K. Luo. 2004. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat Cell Biol. 6:366–372.
Cordon-Cardo, C., and C. Prives. 1999. At the crossroads of inflammation and tumorigenesis. J Exp Med. 190:1367–1370.
D'Souza-Schorey, C. 2005. Disassembling adherens junctions: breaking up is hard to do. Trends in Cell Biology. 15:19–26.
Danjo, Y., and I.K. Gipson. 1998. Actin “purse string” filaments are anchored by E-cadherin-mediated adherens junctions at the leading edge of the epithelial wound, providing coordinated cell movement. Journal of Cell Science. 111 ( Pt 22):3323–3332.
Darby, I., O. Skalli, and G. Gabbiani. 1990. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest. 63:21–29.
Datta, A., C.J. Scotton, and R.C. Chambers. 2011. Novel therapeutic approaches for pulmonary fibrosis. British Journal of Pharmacology. 163:141–172.
Davies, J.A. 1996. Mesenchyme to epithelium transition during development of the mammalian kidney tubule. Acta Anat (Basel). 156:187–201.
Davis-Dusenbery, B.N., M.C. Chan, K.E. Reno, A.S. Weisman, M.D. Layne, G. Lagna, and A. Hata. 2011. down-regulation of Kruppel-like factor-4 (KLF4) by microRNA-143/145 is critical for modulation of vascular smooth muscle cell phenotype by transforming growth factor-beta and bone morphogenetic protein 4. J Biol Chem. 286:28097–28110.
De Craene, B., B. Gilbert, C. Stove, E. Bruyneel, F. van Roy, and G. Berx. 2005. The transcription factor snail induces tumor cell invasion through modulation of the epithelial cell differentiation program. Cancer Research. 65:6237–6244.
de Rooij, J., A. Kerstens, G. Danuser, M.A. Schwartz, and C.M. Waterman-Storer. 2005. Integrin-dependent actomyosin contraction regulates epithelial cell scattering. The Journal of Cell Biology. 171:153–164.
De Wever, O. 2004. Critical role of N-cadherin in myofibroblast invasion and migration in vitro stimulated by colon-cancer-cell-derived TGF- or wounding. Journal of Cell Science. 117:4691–4703.
Deckers, M., M. van Dinther, J. Buijs, I. Que, C. Lowik, G. van der Pluijm, and P. ten Dijke. 2006. The tumor suppressor Smad4 is required for transforming growth factor beta-induced epithelial to mesenchymal transition and bone metastasis of breast cancer cells. Cancer Research. 66:2202–2209.
160
Deelman, L., and K. Sharma. 2009. Mechanisms of kidney fibrosis and the role of antifibrotic therapies. Curr Opin Nephrol Hypertens. 18:85–90.
Delcommenne, M., C. Tan, V. Gray, L. Rue, J. Woodgett, and S. Dedhar. 1998. Phosphoinositide-3-OH kinase-dependent regulation of glycogen synthase kinase 3 and protein kinase B/AKT by the integrin-linked kinase. Proc. Natl. Acad. Sci. U.S.A. 95:11211–11216.
Delva, E., and A.P. Kowalczyk. 2009. Regulation of cadherin trafficking. Traffic. 10:259–267.
Deman, J.J., E.A. Bruyneel, and M.M. Mareel. 1974. A study on the mechanism of intercellular adhesion. Effects of neuraminidase, calcium, and trypsin on the aggregation of suspended HeLa cells. The Journal of Cell Biology. 60:641–652.
Deng, H., G.A. Dokshin, J. Lei, A.M. Goldsmith, K.N. Bitar, D.C. Fingar, M.B. Hershenson, and J.K. Bentley. 2008. Inhibition of glycogen synthase kinase-3beta is sufficient for airway smooth muscle hypertrophy. J Biol Chem. 283:10198–10207.
Dennler, S., S. Itoh, D. Vivien, P. ten Dijke, S. Huet, and J.M. Gauthier. 1998. Direct binding of Smad3 and Smad4 to critical TGF beta-inducible elements in the promoter of human plasminogen activator inhibitor-type 1 gene. EMBO J. 17:3091–3100.
Derynck, R., and Y.E. Zhang. 2003. Smad-dependent and Smad-independent pathways in TGF-beta family signalling. Nature. 425:577–584.
Derynck, R., J.A. Jarrett, E.Y. Chen, D.H. Eaton, J.R. Bell, R.K. Assoian, A.B. Roberts, M.B. Sporn, and D.V. Goeddel. 1985. Human transforming growth factor-beta complementary DNA sequence and expression in normal and transformed cells. Nature. 316:701–705.
Doble, B.W., and J.R. Woodgett. 2003. GSK-3: tricks of the trade for a multi-tasking kinase. Journal of Cell Science. 116:1175–1186.
Drees, F., S. Pokutta, S. Yamada, W.J. Nelson, and W.I. Weis. 2005. Alpha-catenin is a molecular switch that binds E-cadherin-beta-catenin and regulates actin-filament assembly. Cell. 123:903–915.
Eddy, A.A., and A.B. Fogo. 2006. Plasminogen activator inhibitor-1 in chronic kidney disease: evidence and mechanisms of action. J Am Soc Nephrol. 17:2999–3012.
Eger, A., A. Stockinger, J. Park, E. Langkopf, M. Mikula, J. Gotzmann, W. Mikulits, H. Beug, and R. Foisner. 2004. beta-Catenin and TGFbeta signalling cooperate to maintain a mesenchymal phenotype after FosER-induced epithelial to mesenchymal transition. Oncogene. 23:2672–2680.
Elberg, G., L. Chen, D. Elberg, M.D. Chan, C.J. Logan, and M.A. Turman. 2008. MKL1 mediates TGF-beta1-induced alpha-smooth muscle actin expression in human renal epithelial cells. AJP: Renal Physiology. 294:F1116–28.
Falanga, V., D. Schrayer, J. Cha, J. Butmarc, P. Carson, A.B. Roberts, and S.-J. Kim. 2004. Full-thickness wounding of the mouse tail as a model for delayed wound healing: accelerated wound closure in Smad3 knock-out mice. Wound Repair Regen. 12:320–326.
Fan, L., A. Sebe, Z. Péterfi, A. Masszi, A.C.P. Thirone, O.D. Rotstein, H. Nakano, C.A. McCulloch, K. Szászi, I. Mucsi, and A. Kapus. 2007. Cell contact-dependent regulation of epithelial-myofibroblast transition via the rho-rho kinase-phospho-myosin pathway. Mol. Biol. Cell. 18:1083–1097.
161
Farquhar, M.G., and G.E. Palade. 1963. Junctional complexes in various epithelia. The Journal of Cell Biology. 17:375–412.
Feng, X.-H., and R. Derynck. 2005. Specificity and versatility in tgf-beta signaling through Smads. Annu Rev Cell Dev Biol. 21:659–693.
Fenteany, G., P.A. Janmey, and T.P. Stossel. 2000. Signaling pathways and cell mechanics involved in wound closure by epithelial cell sheets. Curr Biol. 10:831–838.
Firrincieli, D., M. Boissan, and N. Chignard. 2010. Epithelial-mesenchymal transition in the liver. Gastroenterol Clin Biol. 34:523–528.
Flier, S.N., H. Tanjore, E.G. Kokkotou, H. Sugimoto, M. Zeisberg, and R. Kalluri. 2010. Identification of epithelial to mesenchymal transition as a novel source of fibroblasts in intestinal fibrosis. J Biol Chem. 285:20202–20212.
Fournier, M.V., J.E. Fata, K.J. Martin, P. Yaswen, and M.J. Bissell. 2009. Interaction of E-cadherin and PTEN Regulates Morphogenesis and Growth Arrest in Human Mammary Epithelial Cells. Cancer Research. 69:4545–4552.
Frid, M.G., V.A. Kale, and K.R. Stenmark. 2002. Mature vascular endothelium can give rise to smooth muscle cells via endothelial-mesenchymal transdifferentiation: in vitro analysis. Circulation Research. 90:1189–1196.
Fuentealba, L.C., E. Eivers, A. Ikeda, C. Hurtado, H. Kuroda, E.M. Pera, and E.M. De Robertis. 2007. Integrating patterning signals: Wnt/GSK3 regulates the duration of the BMP/Smad1 signal. Cell. 131:980–993.
Fujita, Y., G. Krause, M. Scheffner, D. Zechner, H.E.M. Leddy, J. Behrens, T. Sommer, and W. Birchmeier. 2002. Hakai, a c-Cbl-like protein, ubiquitinates and induces endocytosis of the E-cadherin complex. Nat Cell Biol. 4:222–231.
Fukuchi, M., T. Imamura, T. Chiba, T. Ebisawa, M. Kawabata, K. Tanaka, and K. Miyazono. 2001. Ligand-dependent degradation of Smad3 by a ubiquitin ligase complex of ROC1 and associated proteins. Mol. Biol. Cell. 12:1431–1443.
Funaba, M., C.M. Zimmerman, and L.S. Mathews. 2002. Modulation of Smad2-mediated signaling by extracellular signal-regulated kinase. J Biol Chem. 277:41361–41368.
Fuxe, J., T. Vincent, and A. Garcia de Herreros. 2010. Transcriptional crosstalk between TGF-beta and stem cell pathways in tumor cell invasion: role of EMT promoting Smad complexes. Cell Cycle. 9:2363–2374.
Gabbiani, G. 1972. GRANULATION TISSUE AS A CONTRACTILE ORGAN: A STUDY OF STRUCTURE AND FUNCTION. Journal of Experimental Medicine. 135:719–734.
Gao, S., C. AlarcOn, G. Sapkota, S. Rahman, P.-Y. Chen, N. Goerner, M.J. Macias, H. Erdjument-Bromage, P. Tempst, and J. MassaguE. 2009. Ubiquitin Ligase Nedd4L Targets Activated Smad2/3 to Limit TGF-β Signaling. Molecular Cell. 36:457–468.
Gavard, J., and R.-M. Mege. 2005. Once upon a time there was beta-catenin in cadherin-mediated signalling. Biol Cell. 97:921–926.
162
Giangreco, A., L. Lu, C. Vickers, V.H. Teixeira, K.R. Groot, C.R. Butler, E.V. Ilieva, P.J. George, A.G. Nicholson, E.K. Sage, F.M. Watt, and S.M. Janes. 2012. beta-Catenin determines upper airway progenitor cell fate and preinvasive squamous lung cancer progression by modulating epithelial-mesenchymal transition. J. Pathol. 226:575–587.
Gordon, K.J., and G.C. Blobe. 2008. Role of transforming growth factor-beta superfamily signaling pathways in human disease. Biochim. Biophys. Acta. 1782:197–228.
Gosens, R., H. Meurs, and M. Schmidt. 2008. The GSK-3/beta-catenin-signalling axis in smooth muscle and its relationship with remodelling. Naunyn Schmiedebergs Arch Pharmacol. 378:185–191.
Grande, M., A. Franzen, J.-O. Karlsson, L.E. Ericson, N.-E. Heldin, and M. Nilsson. 2002. Transforming growth factor-beta and epidermal growth factor synergistically stimulate epithelial to mesenchymal transition (EMT) through a MEK-dependent mechanism in primary cultured pig thyrocytes. Journal of Cell Science. 115:4227–4236.
Greenburg, G., and E.D. Hay. 1982. Epithelia suspended in collagen gels can lose polarity and express characteristics of migrating mesenchymal cells. The Journal of Cell Biology. 95:333–339.
Gressner, A.M., R. Weiskirchen, K. Breitkopf, and S. Dooley. 2002. Roles of TGF-beta in hepatic fibrosis. Front Biosci. 7:d793–807.
Grinnell, F. 1994. Fibroblasts, myofibroblasts, and wound contraction. The Journal of Cell Biology. 124:401–404.
Guettler, S., M.K. Vartiainen, F. Miralles, B. Larijani, and R. Treisman. 2008. RPEL Motifs Link the Serum Response Factor Cofactor MAL but Not Myocardin to Rho Signaling via Actin Binding. Molecular and Cellular Biology. 28:732–742.
Guilford, P. 1999. E-cadherin downregulation in cancer: fuel on the fire? Mol Med Today. 5:172–177.
Gumbiner, B.M. 1996. Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell. 84:345–357.
Gumbiner, B.M. 2005. Regulation of cadherin-mediated adhesion in morphogenesis. Nat Rev Mol Cell Biol. 6:622–634.
Guo, X., A. Ramirez, D.S. Waddell, Z. Li, X. Liu, and X.-F. Wang. 2008. Axin and GSK3- control Smad3 protein stability and modulate TGF- signaling. Genes & Development. 22:106–120.
Hansell, A., J. Hollowell, T. Nichols, R. McNiece, and D. Strachan. 1999. Use of the General Practice Research Database (GPRD) for respiratory epidemiology: a comparison with the 4th Morbidity Survey in General Practice (MSGP4). Thorax. 54:413–419.
Harrison, O.J., X. Jin, S. Hong, F. Bahna, G. Ahlsen, J. Brasch, Y. Wu, J. Vendome, K. Felsovalyi, C.M. Hampton, R.B. Troyanovsky, A. Ben-Shaul, J. Frank, S.M. Troyanovsky, L. Shapiro, and B. Honig. 2011. The extracellular architecture of adherens junctions revealed by crystal structures of type I cadherins. Structure. 19:244–256.
Hartsock, A., and W.J. Nelson. 2008. Adherens and tight junctions: Structure, function and connections to the actin cytoskeleton. Biochimica et Biophysica Acta (BBA) - Biomembranes. 1778:660–669.
163
Hattori, M., Y. Akioka, H. Chikamoto, N. Kobayashi, K. Tsuchiya, M. Shimizu, S. Kagami, and H. Tsukaguchi. 2008. Increase of integrin-linked kinase activity in cultured podocytes upon stimulation with plasma from patients with recurrent FSGS. Am J Transplant. 8:1550–1556.
Hautmann, M.B., P.J. Adam, and G.K. Owens. 1999. Similarities and differences in smooth muscle alpha-actin induction by TGF-beta in smooth muscle versus non-smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 19:2049–2058.
Hayes, S., A. Chawla, and S. Corvera. 2002. TGF beta receptor internalization into EEA1-enriched early endosomes: role in signaling to Smad2. The Journal of Cell Biology. 158:1239–1249.
He, W., C. Dai, Y. Li, G. Zeng, S.P. Monga, and Y. Liu. 2009. Wnt/beta-catenin signaling promotes renal interstitial fibrosis. J Am Soc Nephrol. 20:765–776.
Hinz, B. 2006. Masters and servants of the force: the role of matrix adhesions in myofibroblast force perception and transmission. European Journal of Cell Biology. 85:175–181.
Hinz, B. 2007. Formation and function of the myofibroblast during tissue repair. J Invest Dermatol. 127:526–537.
Hinz, B. 2009. Tissue stiffness, latent TGF-beta1 activation, and mechanical signal transduction: implications for the pathogenesis and treatment of fibrosis. Curr Rheumatol Rep. 11:120–126.
Hinz, B., G. Celetta, J.J. Tomasek, G. Gabbiani, and C. Chaponnier. 2001. Alpha-smooth muscle actin expression upregulates fibroblast contractile activity. Mol. Biol. Cell. 12:2730–2741.
Hinz, B., P. Pittet, J. Smith-Clerc, C. Chaponnier, and J.-J. Meister. 2004. Myofibroblast development is characterized by specific cell-cell adherens junctions. Mol. Biol. Cell. 15:4310–4320.
Hinz, B., S.H. Phan, V.J. Thannickal, A. Galli, M.-L. Bochaton-Piallat, and G. Gabbiani. 2007. The Myofibroblast. The American Journal of Pathology. 170:1807–1816.
Hjelmeland, A.B. 2005. Loss of Phosphatase and Tensin Homologue Increases Transforming Growth Factor -Mediated Invasion with Enhanced SMAD3 Transcriptional Activity. Cancer Research. 65:11276–11281.
Hong, S., R.B. Troyanovsky, and S.M. Troyanovsky. 2010. Spontaneous assembly and active disassembly balance adherens junction homeostasis. Proc. Natl. Acad. Sci. U.S.A. 107:3528–3533.
Hoot, K.E., J. Lighthall, G. Han, S.-L. Lu, A. Li, W. Ju, M. Kulesz-Martin, E. Bottinger, and X.-J. Wang. 2008. Keratinocyte-specific Smad2 ablation results in increased epithelial-mesenchymal transition during skin cancer formation and progression. J. Clin. Invest. 118:2722–2732.
Hsing, A.Y., K. Kadomatsu, M.J. Bonham, and D. Danielpour. 1996. Regulation of apoptosis induced by transforming growth factor-beta1 in nontumorigenic rat prostatic epithelial cell lines. Cancer Research. 56:5146–5149.
Hu, B., Z. Wu, and S.H. Phan. 2003. Smad3 mediates transforming growth factor-beta-induced alpha-smooth muscle actin expression. American Journal of Respiratory Cell and Molecular Biology. 29:397–404.
164
Hua, F., J. Zhou, J. Liu, C. Zhu, B. Cui, H. Lin, Y. Liu, W. Jin, H. Yang, and Z. Hu. 2010. Glycogen synthase kinase-3beta negatively regulates TGF-beta1 and Angiotensin II-mediated cellular activity through interaction with Smad3. Eur J Pharmacol. 644:17–23.
Huber, A.H., D.B. Stewart, D.V. Laurents, W.J. Nelson, and W.I. Weis. 2001. The cadherin cytoplasmic domain is unstructured in the absence of beta-catenin. A possible mechanism for regulating cadherin turnover. J Biol Chem. 276:12301–12309.
Humphreys, B.D., S.-L. Lin, A. Kobayashi, T.E. Hudson, B.T. Nowlin, J.V. Bonventre, M.T. Valerius, A.P. McMahon, and J.S. Duffield. 2010. Fate tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney fibrosis. The American Journal of Pathology. 176:85–97.
Imoto, S., N. Ohbayashi, O. Ikeda, S. Kamitani, R. Muromoto, Y. Sekine, and T. Matsuda. 2008. Sumoylation of Smad3 stimulates its nuclear export during PIASy-mediated suppression of TGF-beta signaling. Biochemical and Biophysical Research Communications. 370:359–365.
Inumaru, J., O. Nagano, E. Takahashi, T. Ishimoto, S. Nakamura, Y. Suzuki, S.-I. Niwa, K. Umezawa, H. Tanihara, and H. Saya. 2009. Molecular mechanisms regulating dissociation of cell-cell junction of epithelial cells by oxidative stress. Genes Cells. 14:703–716.
Ishibe, S., and L.G. Cantley. 2008. Epithelial-mesenchymal-epithelial cycling in kidney repair. Curr Opin Nephrol Hypertens. 17:379–385.
Ishiyama, N., S.-H. Lee, S. Liu, G.-Y. Li, M.J. Smith, L.F. Reichardt, and M. Ikura. 2010. Dynamic and static interactions between p120 catenin and E-cadherin regulate the stability of cell-cell adhesion. Cell. 141:117–128.
Isono, M., S. Chen, S.W. Hong, M.C. Iglesias-de la Cruz, and F.N. Ziyadeh. 2002. Smad pathway is activated in the diabetic mouse kidney and Smad3 mediates TGF-beta-induced fibronectin in mesangial cells. Biochemical and Biophysical Research Communications. 296:1356–1365.
Iwano, M. 2002. Evidence that fibroblasts derive from epithelium during tissue fibrosis. J. Clin. Invest. 110:341–350.
Izumi, G., T. Sakisaka, T. Baba, S. Tanaka, K. Morimoto, and Y. Takai. 2004. Endocytosis of E-cadherin regulated by Rac and Cdc42 small G proteins through IQGAP1 and actin filaments. The Journal of Cell Biology. 166:237–248.
Izzi, L., and L. Attisano. 2004. Regulation of the TGFbeta signalling pathway by ubiquitin-mediated degradation. Oncogene. 23:2071–2078.
Jelaska, A., and J.H. Korn. 2000. Role of apoptosis and transforming growth factor beta1 in fibroblast selection and activation in systemic sclerosis. Arthritis Rheum. 43:2230–2239.
Jopling, C., S. Boue, and J.C. Izpisua Belmonte. 2011. Dedifferentiation, transdifferentiation and reprogramming: three routes to regeneration. Nat Rev Mol Cell Biol. 12:79–89.
Kaimori, A., J. Potter, J.-Y. Kaimori, C. Wang, E. Mezey, and A. Koteish. 2007. Transforming growth factor-beta1 induces an epithelial-to-mesenchymal transition state in mouse hepatocytes in vitro. J Biol Chem. 282:22089–22101.
Kalluri, R. 2009. EMT: when epithelial cells decide to become mesenchymal-like cells. J. Clin. Invest. 119:1417–1419.
165
Kalluri, R., and E.G. Neilson. 2003. Epithelial-mesenchymal transition and its implications for fibrosis. J. Clin. Invest. 112:1776–1784.
Kamaraju, A.K., and A.B. Roberts. 2005. Role of Rho/ROCK and p38 MAP kinase pathways in transforming growth factor-beta-mediated Smad-dependent growth inhibition of human breast carcinoma cells in vivo. J Biol Chem. 280:1024–1036.
Kapoor, M., S. Liu, X. Shi-wen, K. Huh, M. McCann, C.P. Denton, J.R. Woodgett, D.J. Abraham, and A. Leask. 2008. GSK-3beta in mouse fibroblasts controls wound healing and fibrosis through an endothelin-1-dependent mechanism. J. Clin. Invest. 118:3279–3290.
Keeley, E.C., B. Mehrad, and R.M. Strieter. 2010. Fibrocytes: bringing new insights into mechanisms of inflammation and fibrosis. Int J Biochem Cell Biol. 42:535–542.
Kevin K Kim, Y.W.C.S.M.C.K.P.J.W.M.L.H.J.A.F.A.N.B.S.E.W.J.A.K.H.A.C. 2009. Epithelial cell α3β1 integrin links β-catenin and Smad signaling to promote myofibroblast formation and pulmonary fibrosis. The Journal of Clinical Investigation. 119:213.
Khalil, N., and R. O'Connor. 2004. Idiopathic pulmonary fibrosis: current understanding of the pathogenesis and the status of treatment. CMAJ. 171:153–160.
Kheradmand, F., H.G. Folkesson, L. Shum, R. Derynk, R. Pytela, and M.A. Matthay. 1994. Transforming growth factor-alpha enhances alveolar epithelial cell repair in a new in vitro model. Am J Physiol. 267:L728–38.
Kim, K., Z. Lu, and E.D. Hay. 2002. Direct evidence for a role of beta-catenin/LEF-1 signaling pathway in induction of EMT. Cell Biol. Int. 26:463–476.
Kim, K.K., M.C. Kugler, P.J. Wolters, L. Robillard, M.G. Galvez, A.N. Brumwell, D. Sheppard, and H.A. Chapman. 2006. Alveolar epithelial cell mesenchymal transition develops in vivo during pulmonary fibrosis and is regulated by the extracellular matrix. Proc. Natl. Acad. Sci. U.S.A. 103:13180–13185.
Kim, K.K., Y. Wei, C. Szekeres, M.C. Kugler, P.J. Wolters, M.L. Hill, J.A. Frank, A.N. Brumwell, S.E. Wheeler, J.A. Kreidberg, and H.A. Chapman. 2008. Epithelial cell α3β1 integrin links β-catenin and Smad signaling to promote myofibroblast formation and pulmonary fibrosis. J. Clin. Invest.
Kim, Y., M.C. Kugler, Y. Wei, K.K. Kim, X. Li, A.N. Brumwell, and H.A. Chapman. 2009. Integrin 3 1-dependent -catenin phosphorylation links epithelial Smad signaling to cell contacts. The Journal of Cell Biology. 184:309–322.
King, R.S., and P.A. Newmark. 2012. Beyond the cell: The cell biology of regeneration. The Journal of Cell Biology. 196:553–562.
Kinoshita, K., Y. Iimuro, K. Otogawa, S. Saika, Y. Inagaki, Y. Nakajima, N. Kawada, J. Fujimoto, S.L. Friedman, and K. Ikeda. 2007. Adenovirus-mediated expression of BMP-7 suppresses the development of liver fibrosis in rats. Gut. 56:706–714.
Kisseleva, T., M. Cong, Y. Paik, D. Scholten, C. Jiang, C. Benner, K. Iwaisako, T. Moore-Morris, B. Scott, H. Tsukamoto, S.M. Evans, W. Dillmann, C.K. Glass, and D.A. Brenner. 2012. Myofibroblasts revert to an inactive phenotype during regression of liver fibrosis. Proc. Natl. Acad. Sci. U.S.A. 109:9448–9453.
166
Klaus, A., and W. Birchmeier. 2008. Wnt signalling and its impact on development and cancer. Nat Rev Cancer. 8:387–398.
Koch, A.W., S. Pokutta, A. Lustig, and J. Engel. 1997. Calcium binding and homoassociation of E-cadherin domains. Biochemistry. 36:7697–7705.
Koch, S., and A. Nusrat. 2009. Dynamic regulation of epithelial cell fate and barrier function by intercellular junctions. Ann N Y Acad Sci. 1165:220–227.
Koesters, R., B. Kaissling, M. Lehir, N. Picard, F. Theilig, R. Gebhardt, A.B. Glick, B. Hahnel, H. Hosser, H.-J. Grone, and W. Kriz. 2010. Tubular overexpression of transforming growth factor-beta1 induces autophagy and fibrosis but not mesenchymal transition of renal epithelial cells. The American Journal of Pathology. 177:632–643.
Korinek, V., N. Barker, P.J. Morin, D. van Wichen, R. de Weger, K.W. Kinzler, B. Vogelstein, and H. Clevers. 1997. Constitutive transcriptional activation by a beta-catenin-Tcf complex in APC-/- colon carcinoma. Science. 275:1784–1787.
Kretzschmar, M., J. Doody, I. Timokhina, and J. Massague. 1999. A mechanism of repression of TGFbeta/ Smad signaling by oncogenic Ras. Genes & Development. 13:804–816.
Kuhn, C., and J.A. McDonald. 1991. The roles of the myofibroblast in idiopathic pulmonary fibrosis. Ultrastructural and immunohistochemical features of sites of active extracellular matrix synthesis. The American Journal of Pathology. 138:1257–1265.
Labbe, E., A. Letamendia, and L. Attisano. 2000. Association of Smads with lymphoid enhancer binding factor 1/T cell-specific factor mediates cooperative signaling by the transforming growth factor-beta and wnt pathways. Proc. Natl. Acad. Sci. U.S.A. 97:8358–8363.
Lakos, G., S. Takagawa, S.-J. Chen, A.M. Ferreira, G. Han, K. Masuda, X.-J. Wang, L.A. DiPietro, and J. Varga. 2004. Targeted disruption of TGF-beta/Smad3 signaling modulates skin fibrosis in a mouse model of scleroderma. The American Journal of Pathology. 165:203–217.
Lamouille, S., and R. Derynck. 2007. Cell size and invasion in TGF-beta-induced epithelial to mesenchymal transition is regulated by activation of the mTOR pathway. The Journal of Cell Biology. 178:437–451.
Lamouille, S., and R. Derynck. 2011. Emergence of the phosphoinositide 3-kinase-Akt-mammalian target of rapamycin axis in transforming growth factor-beta-induced epithelial-mesenchymal transition. Cells Tissues Organs. 193:8–22.
Lau, M.-T., C. Klausen, and P.C.K. Leung. 2011. E-cadherin inhibits tumor cell growth by suppressing PI3K/Akt signaling via β-catenin-Egr1-mediated PTEN expression. Oncogene. 30:2753–2766.
Lee, Y.-I., Y.-J. Kwon, and C.-K. Joo. 2004. Integrin-linked kinase function is required for transforming growth factor beta-mediated epithelial to mesenchymal transition. Biochemical and Biophysical Research Communications. 316:997–1001.
Lei, S., A. Dubeykovskiy, A. Chakladar, L. Wojtukiewicz, and T.C. Wang. 2004. The murine gastrin promoter is synergistically activated by transforming growth factor-beta/Smad and Wnt signaling pathways. J Biol Chem. 279:42492–42502.
167
Leibovich, S.J., and R. Ross. 1975. The role of the macrophage in wound repair. A study with hydrocortisone and antimacrophage serum. The American Journal of Pathology. 78:71–100.
Li, B., Y.-W. Zheng, Y. Sano, and H. Taniguchi. 2011. Evidence for mesenchymal-epithelial transition associated with mouse hepatic stem cell differentiation. PLoS ONE. 6:e17092.
LI, J., C. Yen, D. Liaw, K. Podsypanina, S. Bose, S.I. Wang, J. Puc, C. Miliaresis, L. Rodgers, R. McCombie, S.H. Bigner, B.C. Giovanella, M. Ittmann, B. Tycko, H. Hibshoosh, M.H. Wigler, and R. Parsons. 1997. PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science. 275:1943–1947.
Li, J., X. Qu, and J.F. Bertram. 2009a. Endothelial-myofibroblast transition contributes to the early development of diabetic renal interstitial fibrosis in streptozotocin-induced diabetic mice. The American Journal of Pathology. 175:1380–1388.
Li, M.O., Y.Y. Wan, S. Sanjabi, A.-K.L. Robertson, and R.A. Flavell. 2006a. Transforming growth factor-beta regulation of immune responses. Annu. Rev. Immunol. 24:99–146.
Li, T.F., D. Chen, Q. Wu, M. Chen, T. Sheu, E.M. Schwarz, H. Drissi, M. Zuscik, and R.J. O'Keefe. 2006b. Transforming growth factor-β stimulates cyclin D1 expression through activation of β-catenin signaling in chondrocytes. Journal of Biological Chemistry. 281:21296.
Li, Y., J. Yang, C. Dai, C. Wu, and Y. Liu. 2003. Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J. Clin. Invest. 112:503–516.
Li, Y., X. Tan, C. Dai, D.B. Stolz, D. Wang, and Y. Liu. 2009b. Inhibition of integrin-linked kinase attenuates renal interstitial fibrosis. J Am Soc Nephrol. 20:1907–1918.
Li, Z., L. Wang, W. Zhang, Y. Fu, H. Zhao, Y. Hu, B.P. Prins, and X. Zha. 2007. Restoring E-cadherin-mediated cell–cell adhesion increases PTEN protein level and stability in human breast carcinoma cells. Biochemical and Biophysical Research Communications. 363:165–170.
Liebner, S., A. Cattelino, R. Gallini, N. Rudini, M. Iurlaro, S. Piccolo, and E. Dejana. 2004. Beta-catenin is required for endothelial-mesenchymal transformation during heart cushion development in the mouse. The Journal of Cell Biology. 166:359–367.
Lin, H.Y., and A. Moustakas. 1994. TGF-beta receptors: structure and function. Cell Mol Biol (Noisy-le-grand). 40:337–349.
Lin, J.K., and C.K. Chou. 1992. In vitro apoptosis in the human hepatoma cell line induced by transforming growth factor beta 1. Cancer Research. 52:385–388.
Lin, S.-L., T. Kisseleva, D.A. Brenner, and J.S. Duffield. 2008. Pericytes and perivascular fibroblasts are the primary source of collagen-producing cells in obstructive fibrosis of the kidney. The American Journal of Pathology. 173:1617–1627.
Liu, T., and X.-H. Feng. 2010. Regulation of TGF-beta signalling by protein phosphatases. Biochem. J. 430:191–198.
Liu, Y. 2010. New insights into epithelial-mesenchymal transition in kidney fibrosis. J Am Soc Nephrol. 21:212–222.
168
Liu, Z., J.L. Tan, D.M. Cohen, M.T. Yang, N.J. Sniadecki, S.A. Ruiz, C.M. Nelson, and C.S. Chen. 2010. Mechanical tugging force regulates the size of cell-cell junctions. Proc. Natl. Acad. Sci. U.S.A. 107:9944–9949.
Long, X., and J.M. Miano. 2011. Transforming growth factor-beta1 (TGF-beta1) utilizes distinct pathways for the transcriptional activation of microRNA 143/145 in human coronary artery smooth muscle cells. J Biol Chem. 286:30119–30129.
Lotz, M.M., I. Rabinovitz, and A.M. Mercurio. 2000. Intestinal restitution: progression of actin cytoskeleton rearrangements and integrin function in a model of epithelial wound healing. The American Journal of Pathology. 156:985–996.
MacDonald, B.T., K. Tamai, and X. He. 2009. Wnt/beta-catenin signaling: components, mechanisms, and diseases. Dev Cell. 17:9–26.
Maehama, T., and J.E. Dixon. 1998. The tumor suppressor, PTEN/MMAC1, dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-trisphosphate. J Biol Chem. 273:13375–13378.
Martin, P. 1997. Wound Healing--Aiming for Perfect Skin Regeneration. Science. 276:75–81.
Masszi, A., and A. Kapus. 2011. Smaddening Complexity: The Role of Smad3 in Epithelial-Myofibroblast Transition. Cells Tissues Organs. 193:41–52.
Masszi, A., C. Di Ciano, G. Sirokmány, W.T. Arthur, O.D. Rotstein, J. Wang, C.A.G. McCulloch, L. Rosivall, I. Mucsi, and A. Kapus. 2003. Central role for Rho in TGF-beta1-induced alpha-smooth muscle actin expression during epithelial-mesenchymal transition. Am. J. Physiol. Renal Physiol. 284:F911–24.
Masszi, A., L. Fan, L. Rosivall, C.A. McCulloch, O.D. Rotstein, I. Mucsi, and A. Kapus. 2004. Integrity of cell-cell contacts is a critical regulator of TGF-β1-induced epithelial-to-myofibroblast transition: role for β-catenin. The American Journal of Pathology. 165:1955.
Masszi, A., P. Speight, E. Charbonney, M. Lodyga, H. Nakano, K. Szászi, and A. Kapus. 2010. Fate-determining mechanisms in epithelial-myofibroblast transition: major inhibitory role for Smad3. The Journal of Cell Biology. 188:383–399.
Matsuura, I., N.G. Denissova, G. Wang, D. He, J. Long, and F. Liu. 2004. Cyclin-dependent kinases regulate the antiproliferative function of Smads. Nature. 430:226–231.
Mavrakis, K.J., R.L. Andrew, K.L. Lee, C. Petropoulou, J.E. Dixon, N. Navaratnam, D.P. Norris, and V. Episkopou. 2007. Arkadia enhances Nodal/TGF-beta signaling by coupling phospho-Smad2/3 activity and turnover. PLoS Biol. 5:e67.
McNutt, N.S., and R.S. Weinstein. 1973. Membrane ultrastructure at mammalian intercellular junctions. Prog Biophys Mol Biol. 26:45–101.
Medici, D., E.D. Hay, and D.A. Goodenough. 2006. Cooperation between snail and LEF-1 transcription factors is essential for TGF-beta1-induced epithelial-mesenchymal transition. Mol. Biol. Cell. 17:1871–1879.
Meng, X.M., X.R. Huang, A.C.K. Chung, W. Qin, X. Shao, P. Igarashi, W. Ju, E.P. Bottinger, and H.Y. Lan. 2010. Smad2 protects against TGF-beta/Smad3-mediated renal fibrosis. J Am Soc Nephrol. 21:1477–1487.
169
Miano, J.M., X. Long, and K. Fujiwara. 2007. Serum response factor: master regulator of the actin cytoskeleton and contractile apparatus. Am J Physiol Cell Physiol. 292:C70–81.
Miettinen, P.J., R. Ebner, A.R. Lopez, and R. Derynck. 1994. TGF-beta induced transdifferentiation of mammary epithelial cells to mesenchymal cells: involvement of type I receptors. The Journal of Cell Biology. 127:2021–2036.
Miralles, F., G. Posern, A.-I. Zaromytidou, and R. Treisman. 2003. Actin dynamics control SRF activity by regulation of its coactivator MAL. Cell. 113:329–342.
Moodley, Y.P., P. Caterina, A.K. Scaffidi, N.L. Misso, J.M. Papadimitriou, R.J. McAnulty, G.J. Laurent, P.J. Thompson, and D.A. Knight. 2004. Comparison of the morphological and biochemical changes in normal human lung fibroblasts and fibroblasts derived from lungs of patients with idiopathic pulmonary fibrosis during FasL-induced apoptosis. J. Pathol. 202:486–495.
Moon, J.-A., H.-T. Kim, I.-S. Cho, Y.Y. Sheen, and D.-K. Kim. 2006. IN-1130, a novel transforming growth factor-beta type I receptor kinase (ALK5) inhibitor, suppresses renal fibrosis in obstructive nephropathy. Kidney Int. 70:1234–1243.
Mori, S., K. Matsuzaki, K. Yoshida, F. Furukawa, Y. Tahashi, H. Yamagata, G. Sekimoto, T. Seki, H. Matsui, M. Nishizawa, J.-I. Fujisawa, and K. Okazaki. 2004. TGF-beta and HGF transmit the signals through JNK-dependent Smad2/3 phosphorylation at the linker regions. Oncogene. 23:7416–7429.
Morin, P.J., A.B. Sparks, V. Korinek, N. Barker, H. Clevers, B. Vogelstein, and K.W. Kinzler. 1997. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta-catenin or APC. Science. 275:1787–1790.
Morita, T., T. Mayanagi, and K. Sobue. 2007. Dual roles of myocardin-related transcription factors in epithelial mesenchymal transition via slug induction and actin remodeling. The Journal of Cell Biology. 179:1027–1042.
Moriyama, T., N. Kawada, K. Nagatoya, M. Takeji, M. Horio, A. Ando, E. Imai, and M. Hori. 2001. Fluvastatin suppresses oxidative stress and fibrosis in the interstitium of mouse kidneys with unilateral ureteral obstruction. Kidney Int. 59:2095–2103.
Mouilleron, S., C.A. Langer, S. Guettler, N.Q. McDonald, and R. Treisman. 2011. Structure of a pentavalent G-actin*MRTF-A complex reveals how G-actin controls nucleocytoplasmic shuttling of a transcriptional coactivator. Sci Signal. 4:ra40.
Moustakas, A., and C.-H. Heldin. 2005. Non-Smad TGF-beta signals. Journal of Cell Science. 118:3573–3584.
Moustakas, A., and C.-H. Heldin. 2012. Induction of epithelial-mesenchymal transition by transforming growth factor beta. Semin Cancer Biol.
Mu, Y., R. Sundar, N. Thakur, M. Ekman, S.K. Gudey, M. Yakymovych, A. Hermansson, H. Dimitriou, M.T. Bengoechea-Alonso, J. Ericsson, C.-H. Heldin, and M. Landstrom. 2011. TRAF6 ubiquitinates TGFbeta type I receptor to promote its cleavage and nuclear translocation in cancer. Nat Commun. 2:330.
Muehlich, S., R. Wang, S.-M. Lee, T.C. Lewis, C. Dai, and R. Prywes. 2008. Serum-induced phosphorylation of the serum response factor coactivator MKL1 by the extracellular signal-regulated kinase 1/2 pathway inhibits its nuclear localization. Molecular and Cellular Biology. 28:6302–6313.
170
Muller, T., A. Choidas, E. Reichmann, and A. Ullrich. 1999. Phosphorylation and free pool of beta-catenin are regulated by tyrosine kinases and tyrosine phosphatases during epithelial cell migration. J Biol Chem. 274:10173–10183.
Murphy, C.J., B.A. Foster, M.J. Mannis, M.E. Selsted, and T.W. Reid. 1993. Defensins are mitogenic for epithelial cells and fibroblasts. J Cell Physiol. 155:408–413.
Mutsaers, S.E., J.E. Bishop, G. McGrouther, and G.J. Laurent. 1997. Mechanisms of tissue repair: from wound healing to fibrosis. Int J Biochem Cell Biol. 29:5–17.
Nagafuchi, A., Y. Shirayoshi, K. Okazaki, K. Yasuda, and M. Takeichi. 1987. Transformation of cell adhesion properties by exogenously introduced E-cadherin cDNA. Nature. 329:341–343.
Naito, A.T., H. Akazawa, H. Takano, T. Minamino, T. Nagai, H. Aburatani, and I. Komuro. 2005. Phosphatidylinositol 3-kinase-Akt pathway plays a critical role in early cardiomyogenesis by regulating canonical Wnt signaling. Circulation Research. 97:144–151.
Nelson, W.J., and R. Nusse. 2004. Convergence of Wnt, beta-catenin, and cadherin pathways. Science. 303:1483–1487.
Nicolas, F.J., K. Lehmann, P.H. Warne, C.S. Hill, and J. Downward. 2003. Epithelial to mesenchymal transition in Madin-Darby canine kidney cells is accompanied by down-regulation of Smad3 expression, leading to resistance to transforming growth factor-beta-induced growth arrest. J Biol Chem. 278:3251–3256.
Nieto, M.A. 2002. The snail superfamily of zinc-finger transcription factors. Nat Rev Mol Cell Biol. 3:155–166.
Nishimura, G., I. Manabe, K. Tsushima, K. Fujiu, Y. Oishi, Y. Imai, K. Maemura, M. Miyagishi, Y. Higashi, H. Kondoh, and R. Nagai. 2006. DeltaEF1 mediates TGF-beta signaling in vascular smooth muscle cell differentiation. Dev Cell. 11:93–104.
Nollet, F., P. Kools, and F. van Roy. 2000. Phylogenetic analysis of the cadherin superfamily allows identification of six major subfamilies besides several solitary members. J Mol Biol. 299:551–572.
Okada, H., T.M. Danoff, R. Kalluri, and E.G. Neilson. 1997. Early role of Fsp1 in epithelial-mesenchymal transformation. Am J Physiol. 273:F563–74.
Olmeda, D., M. Jorda, H. Peinado, A. Fabra, and A. Cano. 2007. Snail silencing effectively suppresses tumour growth and invasiveness. Oncogene. 26:1862–1874.
Oloumi, A., S. Syam, and S. Dedhar. 2006. Modulation of Wnt3a-mediated nuclear beta-catenin accumulation and activation by integrin-linked kinase in mammalian cells. Oncogene. 25:7747–7757.
Olson, A.L., J.J. Swigris, D.C. Lezotte, J.M. Norris, C.G. Wilson, and K.K. Brown. 2007. Mortality from pulmonary fibrosis increased in the United States from 1992 to 2003. American Journal of Respiratory and Critical Care Medicine. 176:277–284.
Olson, E.N., and A. Nordheim. 2010. Linking actin dynamics and gene transcription to drive cellular motile functions. Nat Rev Mol Cell Biol. 11:353–365.
Omenetti, A., A. Porrello, Y. Jung, L. Yang, Y. Popov, S.S. Choi, R.P. Witek, G. Alpini, J. Venter, H.M. Vandongen, W.-K. Syn, G.S. Baroni, A. Benedetti, D. Schuppan, and A.M. Diehl. 2008. Hedgehog
171
signaling regulates epithelial-mesenchymal transition during biliary fibrosis in rodents and humans. J. Clin. Invest. 118:3331–3342.
Onder, T.T., P.B. Gupta, S.A. Mani, J. Yang, E.S. Lander, and R.A. Weinberg. 2008. Loss of E-Cadherin Promotes Metastasis via Multiple Downstream Transcriptional Pathways. Cancer Research. 68:3645–3654.
Oussaief, L., A. Hippocrate, V. Ramirez, A. Rampanou, W. Zhang, D. Meyers, P. Cole, R. Khelifa, and I. Joab. 2009. Phosphatidylinositol 3-kinase/Akt pathway targets acetylation of Smad3 through Smad3/CREB-binding protein interaction: contribution to transforming growth factor beta1-induced Epstein-Barr virus reactivation. J Biol Chem. 284:23912–23924.
Overduin, M., T.S. Harvey, S. Bagby, K.I. Tong, P. Yau, M. Takeichi, and M. Ikura. 1995. Solution structure of the epithelial cadherin domain responsible for selective cell adhesion. Science. 267:386–389.
Palacios, F., J.S. Tushir, Y. Fujita, and C. D'Souza-Schorey. 2005. Lysosomal targeting of E-cadherin: a unique mechanism for the down-regulation of cell-cell adhesion during epithelial to mesenchymal transitions. Molecular and Cellular Biology. 25:389–402.
Parapuram, S.K., X. Shi-wen, C. Elliott, I.D. Welch, H. Jones, M. Baron, C.P. Denton, D.J. Abraham, and A. Leask. 2011. Loss of PTEN Expression by Dermal Fibroblasts Causes Skin Fibrosis. Journal of Investigative Dermatology. 131:1996–2003.
Parmacek, M.S. 2007. Myocardin-Related Transcription Factors: Critical Coactivators Regulating Cardiovascular Development and Adaptation. Circulation Research. 100:633–644.
Pece, S., and J.S. Gutkind. 2000. Signaling from E-cadherins to the MAPK pathway by the recruitment and activation of epidermal growth factor receptors upon cell-cell contact formation. J Biol Chem. 275:41227–41233.
Pelton, R.W., B.L. Hogan, D.A. Miller, and H.L. Moses. 1990. Differential expression of genes encoding TGFs beta 1, beta 2, and beta 3 during murine palate formation. Dev Biol. 141:456–460.
Perez-Moreno, M.A., A. Locascio, I. Rodrigo, G. Dhondt, F. Portillo, M.A. Nieto, and A. Cano. 2001. A new role for E12/E47 in the repression of E-cadherin expression and epithelial-mesenchymal transitions. J Biol Chem. 276:27424–27431.
Phanish, M.K., N.A. Wahab, P. Colville-Nash, B.M. Hendry, and M.E.C. Dockrell. 2006. The differential role of Smad2 and Smad3 in the regulation of pro-fibrotic TGFbeta1 responses in human proximal-tubule epithelial cells. Biochem. J. 393:601–607.
Phillips, R.J., M.D. Burdick, K. Hong, M.A. Lutz, L.A. Murray, Y.Y. Xue, J.A. Belperio, M.P. Keane, and R.M. Strieter. 2004. Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis. J. Clin. Invest. 114:438–446.
Piedra, J., S. Miravet, J. Castano, H.G. Palmer, N. Heisterkamp, A. Garcia de Herreros, and M. Dunach. 2003. p120 Catenin-associated Fer and Fyn tyrosine kinases regulate beta-catenin Tyr-142 phosphorylation and beta-catenin-alpha-catenin Interaction. Molecular and Cellular Biology. 23:2287–2297.
Poncelet, A.-C., H.W. Schnaper, R. Tan, Y. Liu, and C.E. Runyan. 2007. Cell phenotype-specific down-regulation of Smad3 involves decreased gene activation as well as protein degradation. J Biol Chem. 282:15534–15540.
172
Posern, G., and R. Treisman. 2006. Actin' together: serum response factor, its cofactors and the link to signal transduction. Trends in Cell Biology. 16:588–596.
Postigo, A.A., J.L. Depp, J.J. Taylor, and K.L. Kroll. 2003. Regulation of Smad signaling through a differential recruitment of coactivators and corepressors by ZEB proteins. EMBO J. 22:2453–2462.
Quaggin, S.E., and A.A.S. Kapus. 2011. Scar wars: mapping the fate of epithelial–mesenchymal–myofibroblast transition. Kidney Int. 80:41–50.
Ramachandran, C., and S.P. Srinivas. 2010. Formation and disassembly of adherens and tight junctions in the corneal endothelium: regulation by actomyosin contraction. Invest. Ophthalmol. Vis. Sci. 51:2139–2148.
Rastaldi, M.P., F. Ferrario, L. Giardino, G. Dell'Antonio, C. Grillo, P. Grillo, F. Strutz, G.A. Muller, G. Colasanti, and G. D'Amico. 2002. Epithelial-mesenchymal transition of tubular epithelial cells in human renal biopsies. Kidney Int. 62:137–146.
Riese, J., X. Yu, A. Munnerlyn, S. Eresh, S.C. Hsu, R. Grosschedl, and M. Bienz. 1997. LEF-1, a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. Cell. 88:777–787.
Ringwald, M., R. Schuh, D. Vestweber, H. Eistetter, F. Lottspeich, J. Engel, R. Dolz, F. Jahnig, J. Epplen, and S. Mayer. 1987. The structure of cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+-dependent cell adhesion. EMBO J. 6:3647–3653.
Roberts, A.B., F. Tian, S.D. Byfield, C. Stuelten, A. Ooshima, S. Saika, and K.C. Flanders. 2006. Smad3 is key to TGF-beta-mediated epithelial-to-mesenchymal transition, fibrosis, tumor suppression and metastasis. Cytokine & Growth Factor Reviews. 17:19–27.
Rock, J.R., C.E. Barkauskas, M.J. Cronce, Y. Xue, J.R. Harris, J. Liang, P.W. Noble, and B.L.M. Hogan. 2011. Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition. Proc. Natl. Acad. Sci. U.S.A. 108:E1475–83.
Romagnani, P., and R. Kalluri. 2009. Possible mechanisms of kidney repair. Fibrogenesis & Tissue Repair. 2:3.
Rygiel, K.A., H. Robertson, H.L. Marshall, M. Pekalski, L. Zhao, T.A. Booth, D.E.J. Jones, A.D. Burt, and J.A. Kirby. 2008. Epithelial-mesenchymal transition contributes to portal tract fibrogenesis during human chronic liver disease. Lab Invest. 88:112–123.
Sacco, F., L. Perfetto, L. Castagnoli, and G. Cesareni. 2012. The human phosphatase interactome: An intricate family portrait. FEBS Letters. 586:2732–2739.
Saika, S., S. Kono-Saika, Y. Ohnishi, M. Sato, Y. Muragaki, A. Ooshima, K.C. Flanders, J. Yoo, M. Anzano, C.-Y. Liu, W.W.-Y. Kao, and A.B. Roberts. 2004. Smad3 signaling is required for epithelial-mesenchymal transition of lens epithelium after injury. The American Journal of Pathology. 164:651–663.
Samarin, S.N., A.I. Ivanov, G. Flatau, C.A. Parkos, and A. Nusrat. 2007. Rho/Rho-associated kinase-II signaling mediates disassembly of epithelial apical junctions. Mol. Biol. Cell. 18:3429–3439.
Sapkota, G., C. AlarcOn, F.M. Spagnoli, A.H. Brivanlou, and J. MassaguE. 2007. Balancing BMP signaling through integrated inputs into the Smad1 linker. Molecular Cell. 25:441–454.
173
Sato, M., Y. Muragaki, S. Saika, A.B. Roberts, and A. Ooshima. 2003. Targeted disruption of TGF-beta1/Smad3 signaling protects against renal tubulointerstitial fibrosis induced by unilateral ureteral obstruction. J. Clin. Invest. 112:1486–1494.
Schnaper, H.W., T. Hayashida, S.C. Hubchak, and A.-C. Poncelet. 2003. TGF-beta signal transduction and mesangial cell fibrogenesis. AJP: Renal Physiology. 284:F243–52.
Scholten, D., C.H. Osterreicher, A. Scholten, K. Iwaisako, G. Gu, D.A. Brenner, and T. Kisseleva. 2010. Genetic labeling does not detect epithelial-to-mesenchymal transition of cholangiocytes in liver fibrosis in mice. Gastroenterology. 139:987–998.
Schwartz, M.A., and M.H. Ginsberg. 2002. Networks and crosstalk: integrin signalling spreads. Nat Cell Biol. 4:E65–8.
Sebe, A., A. Masszi, M. Zulys, T. Yeung, P. Speight, O.D. Rotstein, H. Nakano, I. Mucsi, K. Szászi, and A. Kapus. 2008. Rac, PAK and p38 regulate cell contact-dependent nuclear translocation of myocardin-related transcription factor. FEBS Letters. 582:291–298.
Selman, M., and A. Pardo. 2006. Role of epithelial cells in idiopathic pulmonary fibrosis: from innocent targets to serial killers. Proceedings of the American Thoracic Society. 3:364–372.
Serini, G., M.L. Bochaton-Piallat, P. Ropraz, A. Geinoz, L. Borsi, L. Zardi, and G. Gabbiani. 1998. The fibronectin domain ED-A is crucial for myofibroblastic phenotype induction by transforming growth factor-beta1. The Journal of Cell Biology. 142:873–881.
Shafer, S.L., and D.A. Towler. 2009. Transcriptional regulation of SM22alpha by Wnt3a: convergence with TGFbeta(1)/Smad signaling at a novel regulatory element. J Mol Cell Cardiol. 46:621–635.
Skibinski, G., J.S. Elborn, and M. Ennis. 2007. Bronchial epithelial cell growth regulation in fibroblast cocultures: the role of hepatocyte growth factor. AJP: Lung Cellular and Molecular Physiology. 293:L69–L76.
Smith, A.L., M.R. Dohn, M.V. Brown, and A.B. Reynolds. 2012. Association of Rho-associated protein kinase 1 with E-cadherin complexes is mediated by p120-catenin. Mol. Biol. Cell. 23:99–110.
Sorrentino, A., N. Thakur, S. Grimsby, A. Marcusson, V. von Bulow, N. Schuster, S. Zhang, C.-H. Heldin, and M. Landstrom. 2008. The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nat Cell Biol. 10:1199–1207.
Steck, P.A., M.A. Pershouse, S.A. Jasser, W.K. Yung, H. LIN, A.H. Ligon, L.A. Langford, M.L. Baumgard, T. Hattier, T. Davis, C. Frye, R. Hu, B. Swedlund, D.H. Teng, and S.V. Tavtigian. 1997. Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet. 15:356–362.
Steinberg, M.S., P.B. Armstrong, and R.E. Granger. 1973. On the recovery of adhesiveness by trypsin-dissociated cells. J Membr Biol. 13:97–128.
Stemmer, V., B. de Craene, G. Berx, and J. Behrens. 2008. Snail promotes Wnt target gene expression and interacts with beta-catenin. Oncogene. 27:5075–5080.
Strutz, F., and M. Zeisberg. 2006. Renal fibroblasts and myofibroblasts in chronic kidney disease. J Am Soc Nephrol. 17:2992–2998.
174
Strutz, F., H. Okada, C.W. Lo, T. Danoff, R.L. Carone, J.E. Tomaszewski, and E.G. Neilson. 1995. Identification and characterization of a fibroblast marker: FSP1. The Journal of Cell Biology. 130:393–405.
Strutz, F., M. Zeisberg, B. Hemmerlein, B. Sattler, K. Hummel, V. Becker, and G.A. Muller. 2000. Basic fibroblast growth factor expression is increased in human renal fibrogenesis and may mediate autocrine fibroblast proliferation. Kidney Int. 57:1521–1538.
Sun, Q., G. Chen, J.W. Streb, X. Long, Y. Yang, C.J.J. Stoeckert, and J.M. Miano. 2006. Defining the mammalian CArGome. Genome Res. 16:197–207.
Surendran, K., S. Schiavi, and K.A. Hruska. 2005. Wnt-dependent beta-catenin signaling is activated after unilateral ureteral obstruction, and recombinant secreted frizzled-related protein 4 alters the progression of renal fibrosis. J Am Soc Nephrol. 16:2373–2384.
Takai, Y., T. Sasaki, K. Tanaka, and H. Nakanishi. 1995. Rho as a regulator of the cytoskeleton. Trends Biochem Sci. 20:227–231.
Takeichi, M. 1988. The cadherins: cell-cell adhesion molecules controlling animal morphogenesis. Development. 102:639–655.
Takeichi, M., T. Atsumi, C. Yoshida, K. Uno, and T.S. Okada. 1981. Selective adhesion of embryonal carcinoma cells and differentiated cells by Ca2+-dependent sites. Dev Biol. 87:340–350.
Tamiya, S., L. Liu, and H.J. Kaplan. 2010. Epithelial-mesenchymal transition and proliferation of retinal pigment epithelial cells initiated upon loss of cell-cell contact. Invest. Ophthalmol. Vis. Sci. 51:2755–2763.
Tanjore, H., X.C. Xu, V.V. Polosukhin, A.L. Degryse, B. Li, W. Han, T.P. Sherrill, D. Plieth, E.G. Neilson, T.S. Blackwell, and W.E. Lawson. 2009. Contribution of epithelial-derived fibroblasts to bleomycin-induced lung fibrosis. American Journal of Respiratory and Critical Care Medicine. 180:657–665.
Taura, K., K. Miura, K. Iwaisako, C.H. Osterreicher, Y. Kodama, M. Penz-Osterreicher, and D.A. Brenner. 2010. Hepatocytes do not undergo epithelial-mesenchymal transition in liver fibrosis in mice. Hepatology. 51:1027–1036.
Terada, Y., S. Hanada, A. Nakao, M. Kuwahara, S. Sasaki, and F. Marumo. 2002. Gene transfer of Smad7 using electroporation of adenovirus prevents renal fibrosis in post-obstructed kidney. Kidney Int. 61:S94–8.
Thannickal, V.J., G.B. Toews, E.S. White, J.P.3. Lynch, and F.J. Martinez. 2004. Mechanisms of pulmonary fibrosis. Annu Rev Med. 55:395–417.
Thiery, J.P. 2002. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2:442–454.
Thiery, J.P., H. Acloque, R.Y.J. Huang, and M.A. Nieto. 2009. Epithelial-mesenchymal transitions in development and disease. Cell. 139:871–890.
Thuault, S., U. Valcourt, M. Petersen, G. Manfioletti, C.-H. Heldin, and A. Moustakas. 2006. Transforming growth factor-beta employs HMGA2 to elicit epithelial-mesenchymal transition. The Journal of Cell Biology. 174:175–183.
175
Tian, Y.C., and A.O. Phillips. 2002. Interaction between the transforming growth factor-beta type II receptor/Smad pathway and beta-catenin during transforming growth factor-beta1-mediated adherens junction disassembly. The American Journal of Pathology. 160:1619–1628.
Tian, Y.C., D. Fraser, L. Attisano, and A.O. Phillips. 2003. TGF-beta1-mediated alterations of renal proximal tubular epithelial cell phenotype. Am. J. Physiol. Renal Physiol. 285:F130–42.
Tomasek, J.J., G. Gabbiani, B. Hinz, C. Chaponnier, and R.A. Brown. 2002. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol. 3:349–363.
Tomasek, J.J., J. McRae, G.K. Owens, and C.J. Haaksma. 2005. Regulation of alpha-smooth muscle actin expression in granulation tissue myofibroblasts is dependent on the intronic CArG element and the transforming growth factor-beta1 control element. The American Journal of Pathology. 166:1343–1351.
Tomasek, J.J., M.B. Vaughan, B.P. Kropp, G. Gabbiani, M.D. Martin, C.J. Haaksma, and B. Hinz. 2006. Contraction of myofibroblasts in granulation tissue is dependent on Rho/Rho kinase/myosin light chain phosphatase activity. Wound Repair Regen. 14:313–320.
Toole, B.P. 2009. Hyaluronan-CD44 Interactions in Cancer: Paradoxes and Possibilities. Clin Cancer Res. 15:7462–7468.
Toyokuni, S., K. Okamoto, J. Yodoi, and H. Hiai. 1995. Persistent oxidative stress in cancer. FEBS Letters. 358:1–3.
Trelstad, R.L., E.D. Hay, and J.D. Revel. 1967. Cell contact during early morphogenesis in the chick embryo. Dev Biol. 16:78–106.
Troyanovsky, R.B., E.P. Sokolov, and S.M. Troyanovsky. 2006. Endocytosis of cadherin from intracellular junctions is the driving force for cadherin adhesive dimer disassembly. Mol. Biol. Cell. 17:3484–3493.
Valcourt, U., M. Kowanetz, H. Niimi, C.-H. Heldin, and A. Moustakas. 2005. TGF-beta and the Smad signaling pathway support transcriptomic reprogramming during epithelial-mesenchymal cell transition. Mol. Biol. Cell. 16:1987–2002.
Vandewalle, C., J. Comijn, B. De Craene, P. Vermassen, E. Bruyneel, H. Andersen, E. Tulchinsky, F. van Roy, and G. Berx. 2005. SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res. 33:6566–6578.
Varelas, X., P. Samavarchi-Tehrani, M. Narimatsu, A. Weiss, K. Cockburn, B.G. Larsen, J. Rossant, and J.L. Wrana. 2010. The Crumbs complex couples cell density sensing to Hippo-dependent control of the TGF-beta-SMAD pathway. Dev Cell. 19:831–844.
Varelas, X., R. Sakuma, P. Samavarchi-Tehrani, R. Peerani, B.M. Rao, J. Dembowy, M.B. Yaffe, P.W. Zandstra, and J.L. Wrana. 2008. TAZ controls Smad nucleocytoplasmic shuttling and regulates human embryonic stem-cell self-renewal. Nat Cell Biol. 10:837–848.
Vartiainen, M.K., S. Guettler, B. Larijani, and R. Treisman. 2007. Nuclear actin regulates dynamic subcellular localization and activity of the SRF cofactor MAL. Science. 316:1749–1752.
Vasioukhin, V., C. Bauer, M. Yin, and E. Fuchs. 2000. Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Cell. 100:209–219.
176
Venkov, C.D., A.J. Link, J.L. Jennings, D. Plieth, T. Inoue, K. Nagai, C. Xu, Y.N. Dimitrova, F.J. Rauscher, and E.G. Neilson. 2007. A proximal activator of transcription in epithelial-mesenchymal transition. J. Clin. Invest. 117:482–491.
Verrecchia, F., M.L. Chu, and A. Mauviel. 2001. Identification of novel TGF-beta /Smad gene targets in dermal fibroblasts using a combined cDNA microarray/promoter transactivation approach. Journal of Biological Chemistry. 276:17058–17062.
Vongwiwatana, A., A. Tasanarong, D.C. Rayner, A. Melk, and P.F. Halloran. 2005. Epithelial to mesenchymal transition during late deterioration of human kidney transplants: the role of tubular cells in fibrogenesis. Am J Transplant. 5:1367–1374.
Wallach-Dayan, S.B., R. Golan-Gerstl, and R. Breuer. 2007. Evasion of myofibroblasts from immune surveillance: a mechanism for tissue fibrosis. Proc. Natl. Acad. Sci. U.S.A. 104:20460–20465.
Wang, D.-Z., S. Li, D. Hockemeyer, L. Sutherland, Z. Wang, G. Schratt, J.A. Richardson, A. Nordheim, and E.N. Olson. 2002. Potentiation of serum response factor activity by a family of myocardin-related transcription factors. Proc. Natl. Acad. Sci. U.S.A. 99:14855–14860.
Wang, G., I. Matsuura, D. He, and F. Liu. 2009. Transforming Growth Factor- -inducible Phosphorylation of Smad3. Journal of Biological Chemistry. 284:9663–9673.
Wendt, M.K., T.M. Allington, and W.P. Schiemann. 2009. Mechanisms of the epithelial-mesenchymal transition by TGF-beta. Future Oncol. 5:1145–1168.
White, E.S. 2006. Negative Regulation of Myofibroblast Differentiation by PTEN (Phosphatase and Tensin Homolog Deleted on Chromosome 10). American Journal of Respiratory and Critical Care Medicine. 173:112–121.
Wildey, G.M., S. Patil, and P.H. Howe. 2003. Smad3 potentiates transforming growth factor beta (TGFbeta )-induced apoptosis and expression of the BH3-only protein Bim in WEHI 231 B lymphocytes. J Biol Chem. 278:18069–18077.
Willis, B.C., and Z. Borok. 2007. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. AJP: Lung Cellular and Molecular Physiology. 293:L525–L534.
WIPFF, P., and B. HINZ. 2008. Integrins and the activation of latent transforming growth factor β1 – An intimate relationship. European Journal of Cell Biology. 87:601–615.
Wipff, P.-J., D.B. Rifkin, J.-J. Meister, and B. Hinz. 2007. Myofibroblast contraction activates latent TGF-beta1 from the extracellular matrix. The Journal of Cell Biology. 179:1311–1323.
Wrighton, K.H., D. Willis, J. Long, F. Liu, X. Lin, and X.-H. Feng. 2006. Small C-terminal domain phosphatases dephosphorylate the regulatory linker regions of Smad2 and Smad3 to enhance transforming growth factor-beta signaling. J Biol Chem. 281:38365–38375.
Wrighton, K.H., F. Dai, and X.-H. Feng. 2008. A new kid on the TGFbeta block: TAZ controls Smad nucleocytoplasmic shuttling. Dev Cell. 15:8–10.
Wynn, T.A. 2003. IL-13 effector functions. Annu. Rev. Immunol. 21:425–456.
Wynn, T.A. 2007. Common and unique mechanisms regulate fibrosis in various fibroproliferative diseases. J. Clin. Invest. 117:524–529.
177
Wynn, T.A. 2008. Cellular and molecular mechanisms of fibrosis. J. Pathol. 214:199–210.
Xie, P., Y. Fan, H. Zhang, Y. Zhang, M. She, D. Gu, C. Patterson, and H. Li. 2009. CHIP represses myocardin-induced smooth muscle cell differentiation via ubiquitin-mediated proteasomal degradation. Molecular and Cellular Biology. 29:2398–2408.
Xie, W.B., Z. Li, J.M. Miano, X. Long, and S.Y. Chen. 2011. Smad3-mediated Myocardin Silencing: A NOVEL MECHANISM GOVERNING THE INITIATION OF SMOOTH MUSCLE DIFFERENTIATION. Journal of Biological Chemistry. 286:15050–15057.
Xu, J., S. Lamouille, and R. Derynck. 2009. TGF-β-induced epithelial to mesenchymal transition. Cell Res. 19:156–172.
Yanagisawa, K., H. Osada, A. Masuda, M. Kondo, T. Saito, Y. Yatabe, K. Takagi, T. Takahashi, and T. Takahashi. 1998. Induction of apoptosis by Smad3 and down-regulation of Smad3 expression in response to TGF-beta in human normal lung epithelial cells. Oncogene. 17:1743–1747.
Yang, J., S.A. Mani, and R.A. Weinberg. 2006. Exploring a new twist on tumor metastasis. Cancer Research. 66:4549–4552.
Yang, J., S.A. Mani, J.L. Donaher, S. Ramaswamy, R.A. Itzykson, C. Come, P. Savagner, I. Gitelman, A. Richardson, and R.A. Weinberg. 2004. Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell. 117:927–939.
Yang, L., N. Chang, X. Liu, Z. Han, T. Zhu, C. Li, L. Yang, and L. Li. 2012. Bone Marrow-Derived Mesenchymal Stem Cells Differentiate to Hepatic Myofibroblasts by Transforming Growth Factor-beta1 via Sphingosine Kinase/Sphingosine 1-Phosphate (S1P)/S1P Receptor Axis. The American Journal of Pathology. 181:85–97.
Yang, Y., F. Zhou, Z. Fang, L. Wang, Z. Li, L. Sun, C. Wang, W. Yao, X. Cai, J. Jin, and X. Zha. 2009. Post-transcriptional and post-translational regulation of PTEN by transforming growth factor-beta1. J. Cell. Biochem. 106:1102–1112.
Yap, A.S., W.M. Brieher, M. Pruschy, and B.M. Gumbiner. 1997. Lateral clustering of the adhesive ectodomain: a fundamental determinant of cadherin function. Curr Biol. 7:308–315.
Yaswen, L., A.B. Kulkarni, T. Fredrickson, B. Mittleman, R. Schiffman, S. Payne, G. Longenecker, E. Mozes, and S. Karlsson. 1996. Autoimmune manifestations in the transforming growth factor-beta 1 knockout mouse. Blood. 87:1439–1445.
Yeaman, C., K.K. Grindstaff, M.D. Hansen, and W.J. Nelson. 1999. Cell polarity: Versatile scaffolds keep things in place. Curr Biol. 9:R515–7.
Yeh, Y.-C., W.-C. Wei, Y.-K. Wang, S.-C. Lin, J.-M. Sung, and M.-J. Tang. 2010. Transforming growth factor-{beta}1 induces Smad3-dependent {beta}1 integrin gene expression in epithelial-to-mesenchymal transition during chronic tubulointerstitial fibrosis. The American Journal of Pathology. 177:1743–1754.
Yovchev, M.I., P.N. Grozdanov, H. Zhou, H. Racherla, C. Guha, and M.D. Dabeva. 2008. Identification of adult hepatic progenitor cells capable of repopulating injured rat liver. Hepatology. 47:636–647.
Yu, L., M.C. Hébert, and Y.E. Zhang. 2002. TGF-beta receptor-activated p38 MAP kinase mediates Smad-independent TGF-beta responses. EMBO J. 21:3749–3759.
178
Zaromytidou, A.-I., F. Miralles, and R. Treisman. 2006. MAL and ternary complex factor use different mechanisms to contact a common surface on the serum response factor DNA-binding domain. Molecular and Cellular Biology. 26:4134–4148.
Zeisberg, E.M., O. Tarnavski, M. Zeisberg, A.L. Dorfman, J.R. McMullen, E. Gustafsson, A. Chandraker, X. Yuan, W.T. Pu, A.B. Roberts, E.G. Neilson, M.H. Sayegh, S. Izumo, and R. Kalluri. 2007a. Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat Med. 13:952–961.
Zeisberg, E.M., S.E. Potenta, H. Sugimoto, M. Zeisberg, and R. Kalluri. 2008. Fibroblasts in kidney fibrosis emerge via endothelial-to-mesenchymal transition. J Am Soc Nephrol. 19:2282–2287.
Zeisberg, M., A.A. Shah, and R. Kalluri. 2005. Bone morphogenic protein-7 induces mesenchymal to epithelial transition in adult renal fibroblasts and facilitates regeneration of injured kidney. J Biol Chem. 280:8094–8100.
Zeisberg, M., and J.S. Duffield. 2010. Resolved: EMT Produces Fibroblasts in the Kidney. Journal of the American Society of Nephrology. 21:1247–1253.
Zeisberg, M., C. Yang, M. Martino, M.B. Duncan, F. Rieder, H. Tanjore, and R. Kalluri. 2007b. Fibroblasts derive from hepatocytes in liver fibrosis via epithelial to mesenchymal transition. J Biol Chem. 282:23337–23347.
Zhang, K., M.D. Rekhter, D. Gordon, and S.H. Phan. 1994. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis. A combined immunohistochemical and in situ hybridization study. The American Journal of Pathology. 145:114–125.
Zhang, M., C.-H. Lee, D.D. Luo, A. Krupa, D. Fraser, and A. Phillips. 2007. Polarity of response to transforming growth factor-beta1 in proximal tubular epithelial cells is regulated by beta-catenin. J Biol Chem. 282:28639–28647.
Zhang, M., M. Wang, X. Tan, T.F. Li, Y.E. Zhang, and D. Chen. 2010. Smad3 Prevents -Catenin Degradation and Facilitates -Catenin Nuclear Translocation in Chondrocytes. Journal of Biological Chemistry. 285:8703–8710.
Zhang, S., H. Smartt, S.T. Holgate, and W.R. Roche. 1999. Growth factors secreted by bronchial epithelial cells control myofibroblast proliferation: an in vitro co-culture model of airway remodeling in asthma. Lab Invest. 79:395–405.
Zhang, W., J. Ou, Y. Inagaki, P. Greenwel, and F. Ramirez. 2000. Synergistic cooperation between Sp1 and Smad3/Smad4 mediates transforming growth factor beta1 stimulation of alpha 2(I)-collagen (COL1A2) transcription. J Biol Chem. 275:39237–39245.
Zhang, Y., X. Feng, R. We, and R. Derynck. 1996. Receptor-associated Mad homologues synergize as effectors of the TGF-beta response. Nature. 383:168–172.
Zhang, Y.E. 2009. Non-Smad pathways in TGF-β signaling. Cell Res. 19:128–139.
Zhao, B., X. Wei, W. Li, R.S. Udan, Q. Yang, J. Kim, J. Xie, T. Ikenoue, J. Yu, L. Li, P. Zheng, K. Ye, A. Chinnaiyan, G. Halder, Z.-C. Lai, and K.-L. Guan. 2007. Inactivation of YAP oncoprotein by the Hippo pathway is involved in cell contact inhibition and tissue growth control. Genes & Development. 21:2747–2761.
179
Zhao, Y., and D.A. Geverd. 2002. Regulation of Smad3 expression in bleomycin-induced pulmonary fibrosis: a negative feedback loop of TGF-beta signaling. Biochemical and Biophysical Research Communications. 294:319–323.
Zheng, G., J.G. Lyons, T.K. Tan, Y. Wang, T.-T. Hsu, D. Min, L. Succar, G.K. Rangan, M. Hu, B.R. Henderson, S.I. Alexander, and D.C.H. Harris. 2009. Disruption of E-cadherin by matrix metalloproteinase directly mediates epithelial-mesenchymal transition downstream of transforming growth factor-beta1 in renal tubular epithelial cells. The American Journal of Pathology. 175:580–591.
180
Appendices
181
182
183
184
