45
1 The Role of Cyclin-dependent Kinase Inhibitor p27 Kip1 in Anti-HER2 Antibody-induced G1 Cell Cycle Arrest and Tumor Growth Inhibition * Xiao-Feng Le § , Francois-Xavier Claret , Amy Lammayot § , Ling Tian , Deepa Deshpande § , Ruth LaPushin , Ana M. Tari , and Robert C. Bast, Jr §¶ From the Departments of Experimental Therapeutics § , Molecular Therapeutics , and Bioimmunnotherapy , The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030, U.S.A. * This work was supported in part by Grant CA39930 from the National Cancer Institute (to R.C.B.), by Grant IRG3721206 from the University of Texas M. D. Anderson Cancer Center (to X.F.L.), Grant CA90853 from the National Cancer Institute (to F.X.C.), and by by DAMD 17-02-1-0459 from the U.S. Department of the Army (to A.M.T.) ¶ To whom correspondence should be addressed: The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Box 355, Houston, TX 77030-4009. Phone: 713-792-77743; Fax: 713-792-7864; E-mail: [email protected] Running Title: Role of p27 Kip1 in anti-HER2 antibody’s anti-tumor effects Key Words: p27 Kip1 , HER2, Herceptin , trastuzumab, phosphorylation, G 1 arrest. Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc. JBC Papers in Press. Published on April 16, 2003 as Manuscript M300848200 by guest on September 5, 2020 http://www.jbc.org/ Downloaded from

The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

  • Upload
    others

  • View
    3

  • Download
    0

Embed Size (px)

Citation preview

Page 1: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

1

The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in Anti-HER2

Antibody-induced G1 Cell Cycle Arrest and Tumor Growth Inhibition*

Xiao-Feng Le§, Francois-Xavier Claret†, Amy Lammayot§, Ling Tian†, Deepa

Deshpande§, Ruth LaPushin†, Ana M. Tari‡, and Robert C. Bast, Jr§¶

From the Departments of Experimental Therapeutics§, Molecular Therapeutics†, and

Bioimmunnotherapy‡, The University of Texas M. D. Anderson Cancer Center, Houston,

Texas 77030, U.S.A.

* This work was supported in part by Grant CA39930 from the National Cancer Institute

(to R.C.B.), by Grant IRG3721206 from the University of Texas M. D. Anderson Cancer

Center (to X.F.L.), Grant CA90853 from the National Cancer Institute (to F.X.C.), and by

by DAMD 17-02-1-0459 from the U.S. Department of the Army (to A.M.T.)

¶ To whom correspondence should be addressed: The University of Texas M. D.

Anderson Cancer Center, 1515 Holcombe Blvd., Box 355, Houston, TX 77030-4009.

Phone: 713-792-77743; Fax: 713-792-7864; E-mail: [email protected]

Running Title: Role of p27Kip1 in anti-HER2 antibody’s anti-tumor effects

Key Words: p27Kip1, HER2, Herceptin, trastuzumab, phosphorylation, G1 arrest.

Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on April 16, 2003 as Manuscript M300848200 by guest on Septem

ber 5, 2020http://w

ww

.jbc.org/D

ownloaded from

Page 2: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

2

ABSTRACT

Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2

complex and plays a major role in controlling cell cycle and cell growth. Our group and

others have reported that anti-HER2 monoclonal antibodies exert inhibitory effects on

HER2-overexpressing breast cancers through G1 cell cycle arrest associated with

induction of p27Kip1 and reduction of CDK2. The role of p27Kip1 in anti-HER2 antibody-

induced cell cycle arrest and growth inhibition is, however, still uncertain. Here we have

provided several lines of evidence supporting a critical role for p27Kip1 in the anti-HER2

antibody-induced G1 cell cycle arrest and tumor growth inhibition. Induction of p27Kip1

and G1 growth arrest by anti-HER2 antibody, murine 4D5 or humanized trastuzumab

(Herceptin) are concentration-dependent, time-dependent, irreversible, and long lasting.

The magnitude of G1 cell cycle arrest induced by trastuzumab or 4D5 is well correlated

with the level of p27Kip1 protein induced. Upregulation of p27Kip1 and G1 growth arrest

could no longer be removed with as little as 14-hrs treatment with trastuzumab. Anti-

HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth inhibition persist at least

five days after a single treatment. The magnitude of growth inhibition of breast cancer

cells induced by anti-HER2 antibody closely parallels the level of p27Kip1 induced.

Induced expression of exogenous p27Kip1 results in a p27Kip1 level-dependent G1 cell

cycle arrest and growth inhibition similar to that obtained with anti-HER2 antibodies.

Reducing p27Kip1 expression using p27Kip1 small interfering RNA (SiRNA) blocks anti-

HER2 antibody-induced p27Kip1 upregulation and G1 arrest. Treatment with anti-HER2

antibody significantly increases the half-life of p27Kip1 protein. Inhibition of ubiquitin-

proteasome pathway, but not inhibition of calpain and caspase activities, upregulates

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 3: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

3

p27Kip1 protein to a degree comparable to that obtained with anti-HER2 antibodies. We

have further demonstrated that anti-HER2 antibody significantly decreases threonine

phosphorylation of p27Kip1 protein at position 187 (T187) and increases serine

phosphorylation of p27Kip1 protein at position 10 (S10). Expression of S10A and T187A

mutant p27Kip1 protein increases the fraction of cells in G1 and reduces a further

antibody-induced G1 arrest. Consequently, p27Kip1 plays an important role in the anti-

HER2 antibody-induced G1 cell cycle arrest and tumor growth inhibition through post-

translational regulation. Regulation of the phosphorylation of p27Kip1 protein is one of the

post-translational mechanisms by which anti-HER2 antibody upregulates the protein.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 4: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

4

INTRODUCTION

The human epidermal growth factor receptor 2 (HER2, also known as c-neu or

ErbB-2) is a key member in the epidermal growth factor receptor (EGFR) family (1-4).

HER2, as a preferred heterodimer partner for other members in EGFR family, plays a

critical role in EGFR family signaling that is linked to a variety of cellular responses to

growth factors in both normal and abnormal conditions (1-4). When HER2 is over-

expresses in cells, normal signaling pathways are altered and growth control is

deregulated. HER2 is overexpressed in a number of cancers, including breast, ovarian,

gastric, colon, and non-small cell lung carcinomas (4, 5). A humanized monoclonal

antibody trastuzumab or Herceptin has been developed from the murine anti-HER2

monoclonal antibody 4D5. Trastuzumab has been successfully used in clinics to treat

patients with metastatic breast cancers that overexpress HER2 (4, 5). Trastuzumab

treatment can produce a response rate of 10% ~ 15% as a single agent in heavily pre-

treated patients with metastatic breast cancers that overexpress HER2 (6). Trastuzumab

treatment produces a response rate of 25% as a single agent in first-line management of

patients with HER2 positive metastatic breast cancer (7). Trastuzumab has further been

shown to enhance significantly the effectiveness of chemotherapy in patients whose

tumors over-express HER2 (4, 5). The combination of chemotherapy plus trastuzumab

has a much higher rate of response than chemotherapy alone (50% vs 32%) (8). The

combination of trastuzumab and chemotherapy also improve the time to disease

progression (7.4 vs 4.6 months) and the median response duration (9.1 vs 6.1 months)

when compared to chemotherapy alone (8). The mechanisms by which trastuzumab

affects growth of cancer cells and response to chemotherapy are not well understood.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 5: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

5

One of the intracellular growth regulators that are affected by trastuzumab is

cyclin-dependent kinase (CDK) inhibitor p27Kip1. p27Kip1, as one of the most important

CDK inhibitors during cell cycle G1 phase, binds to the cyclin E-CDK2 complex and

plays a major role in controlling cell cycle (9). An increase in p27Kip1 protein causes

proliferating cells to exit from the cell cycle, whereas a decrease in p27Kip1 protein

promotes quiescent cells to resume cell proliferation. p27Kip1 protein is primarily

regulated post-transcriptionally at the level of both protein translation and protein

stability, although transcriptional regulation and non-covalent sequestration may also

occur (9-11). Among the post-transcriptional mechanisms, ubiquitin-proteasome

proteolysis is a major pathway for regulation of p27Kip1 protein (12). Phosphorylation of

p27Kip1 protein on threonine 187 (Thr187) by CDK2 prepares p27Kip1 protein for binding

to ubiquitin ligase SCFSkp2 that leads to 26S proteasome degradation (13-15). In contrast

to the phosphorylation of Thr187, the phosphorylation of p27Kip1 protein on serine 10

(Ser10) by human kinase interacting stathmin (hKIS) stabilizes p27Kip1 protein in G1 (16,

17). p27Kip1 protein has been reported to interact with c-Jun co-activator Jab1 (also known

as CSN5) and this interaction causes nuclear export of the p27Kip1 protein (18) and

modulates c-Jun-dependent trascription (19).

Because of the major impact of p27Kip1 in controlling cell cycle, the role of

p27Kip1 protein in human carcinogenesis has been indicated in a number of studies. Low

expression of p27Kip1 protein is associated with excessive cell proliferation and has been

linked to many types of human tumors including breast cancer (10). Low expression of

p27Kip1 protein is found to correlate reversibly with HER2 overexpression via HER2-

facilitated p27Kip1 degradation (20). Low levels of p27Kip1 protein correlates well with

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 6: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

6

higher-grade neoplasms and poor survival rates (10). A striking correlation between the

expression of tumor suppressor PTEN and the level of p27Kip1 protein is observed in

thyroid carcinoma (21). By down-regulating p27Kip1 protein via proteasomal degradation,

oncogenic fusion protein Bcr-Abl forces fibroblasts and hematopoietic cells to divide

under inappropriate conditions (22). Furthermore, targeted disruption of the p27Kip1 gene

increases body size of mice, leads to striking enlargement of multiple organs and the

development of pituitary tumors (23, 24).

In the pre-clinical setting, our group and others have demonstrated that anti-HER2

monoclonal antibodies exert inhibitory effects on HER2-overexpressing breast cancer

through induction of G1 cell cycle arrest associated with induction of p27Kip1 and

reduction of CDK2 (25-31). However, the role of p27Kip1 in anti-HER2 antibody-induced

G1 cell cycle arrest and growth inhibition is still uncertain. Here we have provided

several lines of evidence to support a critical role for p27Kip1 in the anti-HER2 antibody-

induced G1 cell cycle arrest and tumor growth. We have further shown that regulation of

the phosphorylation of p27Kip1 protein is one of the post-translational mechanisms by

which anti-HER2 antibody upregulates the protein.

EXPERIMENTAL PROCEDURES

Cell CultureTwo human breast cancer cell lines, SKBr3 and BT474, were

obtained from the American Type Culture Collection (ATCC, Manassas, VA). SKBr3 cells

were grown in complete medium containing RPMI 1640 medium (Invitrogen, Carlsbad,

CA) supplemented with 10% fetal bovine serum (FBS) (Sigma, St. Louis, MO), 2 mM L-

glutamine, 100 units/ml of penicillin, and 100 µg/ml streptomycin in humidified air with 5%

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 7: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

7

CO2 at 37oC. BT474 cells were grown in complete medium containing DEME (GIBCO,

Grand Island, NY) supplemented with 10% FBS, 2 mM L-glutamine, 100 units/ml of

penicillin, and 100 µg/ml streptomycin. For all experiments, cells were detached with 0.25%

trypsin-0.02% EDTA. For cell culture, 2-6 X 105 exponentially growing cells were plated

into 100-mm tissue culture dishes or 3 X 103 into 96-well plates in complete medium. After

culture overnight in complete medium, cells were treated with antibodies at different

concentrations as indicated in each Figure Legend in complete medium at 37oC for the

indicated time intervals.

ReagentsAntibodies reactive with phospho-Thr187 p27Kip1, phospho-Ser10

p27Kip1, and Jab1 were purchased from Zymed Laboratories Inc. (South San Francisco, CA).

An antibody to p27Kip1 was purchased from BD Transduction Laboratories (San Diego,

CA). An antibody to c-Myc was obtained from Upstate Biotechnology Incorporated (Lake

Placid, NY). A monoclonal antibody to β-actin was purchased from Sigma (St Louis, MO).

Anti-HER2 murine monoclonal antibody 4D5 and humanized monoclonal antibody

trastuzumab (Herceptin or HCT) were kindly provided by Genentech (South San

Francisco, CA). Human IgG1 (hIgG) purified from plasma of patients with myelomas was

obtained from Calbiochem (San Diego, CA) and dialyzed against sterile cold PBS in order

to eliminate sodium azide. Hybridoma cells specific for MOPC21, which was obtained from

the American Type Culture Collection (ATCC, Manassas, VA) was used to produce ascites

fluid and the immunoglobin was purified as previously reported (25). A Tet-Off gene

expression system was purchased from BD Biosciences Clontech (Palo Alto, CA).

Cycloheximide was purchased from Sigma (St. Louis, MO). Wild-type p27Kip1 and its

mutants (S10A and T187A) in pcDNA3.0 vector were kindly provided by Dr. Nakayama

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 8: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

8

KI (Departments of Molecular and Cellular Biology and Molecular Genetics, Medical

Institute of Bioregulation, Kyushu University, Fukuoka, Japan). A membrane-bound GFP

expression vector pEGFP-F was purchased from BD Biosciences Clontech (Palo Alto,

CA). A calpain inhibitor PD151746, a broad-caspase inhibitor II, and MG132 were

obtained from Calbiochem (San Diego, CA).

Anchorage-Dependent GrowthTwo different methods have been used to

assess the anchorage-dependent growth in this study. The first one was a 96-well

microplate crystal violet mitogenic assay that was modified from previous reports (25, 32).

Briefly, 3 x 103 of SKBr3 cells were plated into 96-well tissue culture plates in triplicate.

The cells were treated with anti-HER2 antibody (trastuzumab or 4D5), or control reagent

(hIgG for trastuzumab; MOPC21 for 4D5). After incubation for 3 days, the cells were

washed with PBS, fixed in 1% glutaraldehyde in PBS, and stained with 0.5% crystal violet

(Sigma, St Louis, MO) in methanol. The dye was eluted with Sorenson’ buffer (0.9%

sodium citrate, 0.02 N HCl, and 45% ethanol) and the eluted dye was measured by a

microplater reader Vmax (Molecular Devices, Sunnyvalle, CA) at lengthwave 540 nm. A

second method, a low-density long-term assay, was performed in 100-mm cell culture

dishes. Low cell density (BT474 cells at 1 x 105; SKBr3 cells at 1.5 x 104) was used when

plating the cells. After overnight incubation, the cells were treated with single dose of

anti-HER2 antibody (trastuzumab or 4D5), or control reagent (hIgG for trastuzumab;

MOPC21 for 4D5) in complete media for up to one week. No medium was changed

during the assay. Cells on day 3 ~ 7 after treatment were then harvested for enumeration

of cells with a Coulter counter (Coulter Electronics LTD, Miami, FL), p27Kip1 protein

detection by Western blotting, and cell cycle analysis by flow cytometry.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 9: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

9

Anchorage-Independent GrowthTo determine the anchorage-independent cell

growth of SKBr3 cells, a colony-forming assay in soft agar was used as reported in our

previous studies (25).

Cell Cycle AnalysisCell cycle distribution was analyzed by flow cytometry.

Cells were trypsinized, washed once with PBS, and fixed overnight in 70% ethanol. Fixed

cells were centrifuged at 300 x g for 10 min and washed with PBS. Cell pellets were

resuspended in PBS containing 50 µg/ml of RNase A and 50 µg/ml propidium iodide and

incubated for 20 min at 37oC with gentle shaking. Stained cells were filtered through nylon

mesh (41 µM) and analyzed on a Coulter flow cytometer XL-MCL (Coulter Corporation,

Miami, FL) for relative DNA content based on red fluorescence levels. Doublets and cell

debris were excluded from the DNA histograms. The percentages of sub-G1 cell population

were determined based on relative DNA content. The percentages of cells in different cell

cycle compartments were determined using the MULTICYCLE software program (Phoenix

Flow Systems, San Diego, CA).

Preparation of Total Cell Lysate and Western Immunoblot AnalysisThe

procedures for preparation of total protein and Western immunoblot analysis were

performed as described previously (25).

Construction and Preparation of Inducible Adenovirus-p27Kip1 (Adp27)A

recombinant adenovirus vector expressing a doxycycline-regulated (Tet-Off) form of

p27Kip1 has been constructed according to the manufacturer’s recommendations

(Clontech, Palo Alto, CA). Briefly, the human full-length p27Kip1 cDNA [obtained

originally from polymerase chain reaction (PCR) and verified by DNA sequencing] was

cloned into pTRE-Shuutle2 vector. Recombinant adenoviral DNA containing myc-

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 10: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

10

p27Kip1 (Ad-myc-p27Kip1) was created through ligating pTRE-Shuutle2-myc--p27Kip1 to

Adeno-X viral DNA (Clontech). Large-scale production of high-titer Ad-myc-p27Kip1

was performed by growing HEK 293 cells on improved Eagle’s MEM supplemented with

10% Tet-free fetal bovine serum (Clontech), 4 mM L-glutamine, 100 units/ml penicillin

G sodium, 100 µg/ml streptomycin. The virus was purified twice using cesium-chloride

density gradient centrifugation. The viral vector was then dialyzed for 8 h at 4°C against

a buffer containing 10 mM Tris-HCl (pH 7.5), 1 mM MgCl2, and 10% glycerol and was

stored at -80°C.

Infection with Adp272 x 105 of SKBr3 cells were seeded in 100-mm cell

culture dishes and incubated at 37°C overnight. Cells were then coinfected with a 1:1

ratio of an adeno-X Tet-Off regulatory virus (Clontech) and Ad-myc-p27Kip1 virus

(created as described above) at different multiplicities of infection (MOI) or at an MOI of

20. The cells were cultured with 10% Tet-free fetal bovine serum in presence (+) of

absence (-) of doxycycline (1µg/ml). When applicable, doxycycline was re-added every

48 hrs. After 48 ~ 72 hrs, cells were harvested for enumeration with a Coulter counter,

Western blot analysis, and cell cycle analysis.

Small Interfering RNA (SiRNA) In order to silence p27Kip1 gene expression,

a single transfection of SiRNA duplex was performed using Oligofectamine reagent

(Invitrogen, Carlsbad, California) according to the manufacturer’s protocol. Two dsRNAs

with 21mers and d(TT) overhang were selected for the ability to silence p27Kip1

expression. p27Kip1 SiRNA #1 corresponds to nucleotides 217 to 238 of the human

p27Kip1 coding region (AAGTACGAGTGGCAAGAGGTG). p27Kip1 SiRNA #2

corresponds to nucleotides 139 to 160 of the human p27Kip1 coding region

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 11: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

11

(AAGCACTGCAGAGACATGGAA). The SiRNAs were synthesized at HPP grade

purity by Qiagen-Xeragon (Germantown, MD). A non-related control SiRNA, which

targeted DNA sequence AATTCTCCGAACGTGTCACGT with no significant match in

the complete human genome, was purchased from Qiagen-Xeragon that had been purified

under similar condition (Cat. #80-11310).

p27Kip1 Mutants and GFP Co-transfectionSKBr3 cells grown in 60mm

dishes were transfected with the 3.2 µg of appropriate expression plasmids (wildtype

p27Kip1, S10A p27Kip1, or T187A p27Kip1) plus 0.8 µg of pEGFP-F vector using 7 µl of

LipofectAMINE-2000 (Invitrogen) according to manufacturer’s instructions. Cells were

trypsinized and reseeded in two identical dishes after 24 hr transfection. One dish was

treated with anti-HER2 antibody 4D5 and the other was treated with diluent. After

incubation for another 24 hr, cells were collected and subjected to cell cycle analysis or

used to prepare protein. For cell cycle analysis, cells were first fixed in 0.25%

paraformaldehyde for 1.5 hr on ice and then stained with PI solution as described above.

Only the GFP positive population was gated and its cell cycle distribution was assessed.

The GFP positive rate in empty vector pcDNA3.0 was used to normalize other plasmids’

different transfection efficiency.

Statistical AnalysisThe two-tailed Student's t-test was used to compare two

different groups. Values with P<0.05 were considered significant.

RESULTS

Anti-HER2 Antibody Induces a Concentration-dependent Accumulation of

p27Kip1 Protein and a Corresponding Concentration-dependent G1 Cell Cycle

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 12: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

12

ArrestIn previous studies, we have shown that the anti-HER2 antibody ID5 induced

G1 cell cycle arrest through inhibition of CDK2 and induction of p27Kip1 (25). In this

study, we have employed the clinically approved anti-HER2 antibody trastuzumab and its

mouse precursor 4D5. Two breast cancer cell lines that overexpress HER2 protein,

SKBr3 and BT474 were used in our experiments. SKBr3 cells were treated for 24 hrs

with anti-HER2 antibody 4D5 at different concentrations or control mouse antibody

MOPC21 at 10 µg/ml. Cells were then divided into two portions: one for cell cycle

analysis and the other for total protein extraction and Western immunoblot analysis. As

shown in Figure 1A, 4D5 induced a dramatic and concentration-dependent increase in the

fraction of cells in G1 phase of the cell cycle. This G1 arrest was associated with a

dramatic and concentration-dependent decrease of cells in S phase. The decrease of cells

in G2/M phase was also concentration-dependent, but less impressive. The control

antibody MOPC21, as expected, did not cause G1 arrest (Fig. 1A). Importantly, G1 arrest

induced by 4D5 correlated closely with the induction of p27Kip1 in the same dose-

dependent manner (Fig. 1B). No p27Kip1 induction was observed in cells treated with

control antibody MOPC21 (Fig. 1B), which correlated well with no G1 arrest observed in

Figure 1A. These results were further confirmed in another HER2-overexpressing breast

cell line BT474. As shown in Figure 1C & 1D, 4D5 treatment resulted in a concentration-

dependent increase in the fraction of cells in G1 and a concentration-dependent induction

of p27Kip1 protein. The control antibody MOPC21 elicited no p27Kip1 protein and did not

cause any G1 arrest (Fig. 1C & 1D). These data demonstrate that anti-HER2 antibody

induces a concentration-dependent p27Kip1 accumulation and a corresponding G1 cell

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 13: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

13

cycle arrest, suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced G1

arrest.

Anti-HER2 Antibody Induces a Time-dependent Accumulation of p27Kip1

Protein and a Corresponding Time-dependent G1 Cell Cycle ArrestWe next test

whether the induction of p27Kip1 protein and G1 arrest by anti-HER2 antibody also

behave in a similarly time-dependent manner. BT474 cells were treated with the anti-

HER2 antibody trastuzumab at 10 µg/ml or control human IgG protein (hIgG) for

different time intervals. Cells were then divided into two portions: one for cell cycle

analysis and the other for total protein extraction and Western immunoblot analysis. As

shown in Figure 2A, in BT474 cells trastuzumab induced a dramatic and time-dependent

increase of cells in G1 phase within 48 hrs. This G1 arrest accompanied a dramatic and

concentration-dependent decrease of S phase cells. In BT474 cells, the G1 arrest induced

by trastuzumab peaked around 48 hrs. The control hIgG, as expected, did not cause any

G1 arrest (Fig. 2A). Similar to the results in Figure 1, the trastuzumab-induced G1 arrest

correlated closely with the induction of p27Kip1 in the same time-dependent manner (Fig.

2B). Trastuzumab-induced p27Kip1 protein peaked at 48 hrs in BT474 cells (Fig. 2B),

which was in agreement with the G1 cell cycle arrest observed in Figure 2A. No p27Kip1

induction was observed in cells treated with control hIgG (Fig. 2B), which correlated

well with the level of G1 arrest observed in Figure 2A. These results were further

confirmed in the 4D5-treated SKBr3 cells. As shown in Figure 2C & 2D, 4D5 treatment

resulted in a time-dependent increase in the G1 fraction of cells and a time-dependent

induction of p27Kip1 protein. In SKBr3 cells, both p27Kip1 level and G1 arrest induced by

4D5 peaked around 24 hrs. The control antibody MOPC21 elicited no p27Kip1 protein nor

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 14: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

14

did it cause any G1 arrest (Fig. 2C & 2D). These data demonstrate that anti-HER2

antibody induces a time-dependent p27Kip1 accumulation and a corresponding G1 cell

cycle arrest, further suggesting a role of p27Kip1 protein in anti-HER2 antibody-induced

G1 arrest.

Anti-HER2 Antibody Induces an Irreversible Increase in p27Kip1 Protein and a

Corresponding G1 Cell Cycle ArrestTo determine whether anti-HER2 antibody-

induced p27Kip1 protein and G1 cell cycle arrest are reversible or irreversible, BT474 cells

were treated for different intervals with or without 10 µg/ml trastuzumab. At the different

intervals, cells were washed with media that lacked anti-HER2 antibody and were then

replenished with normal media that contained no antibody as illustrated in Figure 3A.

After 48 hrs, cells were harvested for measurement of p27Kip1 protein by Western

immunoblot and of cell cycle distribution by flow cytometry. Our preliminary data and

published data (25) have revealed that: 1) anti-HER2 antibody does not induce significant

p27Kip1 protein and G1 arrest within 8 hours upon antibody treatment; 2) The earliest time

interval for the anti-HER2 antibody to induce significant p27Kip1 protein and G1 arrest is

around 16 hours after treatment. Therefore, we have focused the time intervals between 8

and 16 hours after antibody treatment. As shown in Figure 3B, trastuzumab, as expected,

induced a dramatic expression of p27Kip1 protein and G1 arrest (84.9%) after 48 hrs

treatment compared to the untreated control. Treatment with trastuzumab for 8 hrs

induced little p27Kip1 protein and G1 arrest. Treatment with trastuzumab for 10 hrs and 12

hrs induced greater p27Kip1 protein and G1 arrest, which, however, did not differ

statistically from untreated control. At 14 hrs trastuzumab induced significant p27Kip1

protein and statistically significant G1 arrest (80.4%) when compared to the untreated

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 15: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

15

control (67.1%). These data indicate that statistically significant G1 cell cycle arrest and

elevation of p27Kip1 protein level induced by trastuzumab could no longer be removed

after 14-hrs treatment with antibody. Data in Figure 3B have also illustrated the close

correlation of the degree of G1 arrest with the level of p27Kip1 protein induced by anti-

HER2 antibody.

Growth Inhibition Induced by Anti-HER2 Antibody Correlates with the

Induced Level of p27Kip1 ProteinTo investigate whether the level of p27Kip1 protein

induced by anti-HER2 antibody correlates the magnitude of growth inhibition, we have

carried out two experiments. First, a microplate growth assay has been used to test the

correlation between p27Kip1 protein and anchorage-dependent growth as reported

previously (Ref. 32 and see Experimental Procedures for detail). For p27Kip1 protein

detection, BT474 cells at similar cell density to the microplate growth assay were plated

into 100-mm culture dishes and treated for 48 hrs with 4D5 and control antibody at

different concentrations. As shown in Figure 4, 4D5 induced a concentration-dependent

and anchorage-dependent growth inhibition (Fig. 4A) and a concentration-dependent

p27Kip1 accumulation in BT474 cells (Fig. 4B). Under the same conditions, control

antibody MOPC21 did not induce p27Kip1 protein at the highest concentration (Fig. 4B)

and any growth inhibition (Fig. 4A). Second, an anchorage-independent assay has been

employed to test the correlation between p27Kip1 protein and growth in soft agar as

previously reported (25). Again, for p27Kip1 protein determination, BT474 cells were

plated into 100-mm culture dishes under similar conditions to the growth assay and

treated for 48 hrs with 4D5 and control antibody at different concentrations. Anti-HER2

antibody 4D5 was found to induce concentration-dependent and anchorage-independent

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 16: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

16

growth inhibition of BT474 cells (Fig. 4C), whereas 4D5 induced a concentration-

dependent increase in p27Kip1 protein (Fig. 4D). Control antibody MOPC21 did not

induce p27Kip1 protein at the highest concentration (Fig. 4D) nor did it increase growth

inhibition (Fig. 4C). Taken together, these results suggest that growth inhibition induced

by anti-HER2 antibody correlates closely with the induced level of p27Kip1 protein in a

concentration-dependent manner.

Anti-HER2 Antibody Induces a Long-lasting Upregulation of p27Kip1 Protein,

G1 Cell Cycle Arrest, and Growth InhibitionAs described above and shown in

Figure 2, anti-HER2 antibodies, trastuzumab and 4D5, induced time-dependent p27Kip1

accumulaiton and a corresponding G1 cell cycle arrest up to 72 hrs in BT474 cells and 48

hrs in SKBr3 cells. To determine how long these anti-HER2 antibody’s effects would

last, we have investigated the effect of anti-HER2 antibody on p27Kip1 protein, G1 cell

cycle arrest, and cell growth over a prolonged period of time. In order to limit cell growth

to less than 75% confluency, low cell densities of cells were plated (BT474 cells at 1 x

105; SKBr3 cells at 1.5 x 104 in a 100-mm culture dish). After incubation overnight, the

cells were treated with single dose of anti-HER2 antibody (trastuzumab or 4D5), or

control reagent (hIgG for trastuzumab; MOPC21 for 4D5) up to one week. Cells on day 3

~ 7 after treatment were then harvested for enumeration of cells with a Coulter counter,

p27Kip1 protein detection by Western immunoblot, and cell cycle analysis by flow

cytometry. As shown in Figure 5A, trastuzumab induced an increase in p27Kip1 protein,

which was above control level on day 3 and day 5 in BT474 cells. Beyond 5 days, the

levels of p27Kip1 protein of trastuzumab- and control hIgG-treated cells were similar (data

not shown). Accordingly, treatment with trastuzumab produced an average of 84.8% of

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 17: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

17

BT474 cells in cell cycle G1 fraction on day 3 and 81.3% on day 5, whereas treatment

with control hIgG produced an average of 67.4% of cells in the G1 fraction on day 3 and

68.9% on day 5 (Fig. 5B). Beyond 5 days, the percentage of G1 fraction from

trastuzumab- and control hIgG-treated cells was not significantly different (data not

shown). As the result of the p27Kip1 upregulation and G1 arrest, trastuzumab produced

50% anchorage-dependent growth inhibition on day 3 and day 5 compared with a hIgG

control (Fig. 5C). Significant growth inhibition by trastuzumab was seen on day 6 and

day 7 (data not shown).

Similarly, 4D5 induced an increase in p27Kip1 protein, which was above the

control level on day 3 and day 5 in SKBr3 cells (Fig. 5D). Beyond 5 days, the levels of

p27Kip1 protein in 4D5- and control MOPC21-treated cells were not distinguishable (data

not shown). Accordingly, 4D5 treatment resulted in an average of 71.2% of SKBr3 cells

in the G1 phase of cell cycle on day 3 and 68.3% on day 5, whereas control MOPC21

generated an average of 56.2% of cells in G1 fraction on day 3 and 58.1% on day 5 (Fig.

5E). Beyond 5 days, the percentage of cells in G1 after treatment with 4D5 and with

control MOPC21 was not significantly different (data not shown). As the result of the

p27Kip1 upregulation and G1 arrest, 4D5 generated about 34% anchorage-dependent

growth inhibition on day3 and 50% on day 5 compared to MOPC21 control (Fig. 5F).

Compared to control, significant growth inhibition by 4D5 lasted on day 6 and day 7

(data not shown). Taken together, these data demonstrate that a single dose treatment of

anti-HER2 antibody induces a long-lasting p27Kip1 upregulation, G1 cell cycle arrest, and

growth inhibition in HER2-overexpressing breast cancer cells. These data reiterate the

correlation of G1 arrest induced by anti-HER2 antibody with the level of p27Kip1 protein.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 18: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

18

Above data also indicate, however, that there is no time-dependent correlation of growth

inhibition induced by anti-HER2 antibody with the level of p27Kip1 protein.

Induced Expression of p27Kip1 Produces G1 Cell Cycle Arrest and Growth

Inhibition Similar to That Observed with Anti-HER2 AntibodyTo demonstrate the

important role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest and

growth inhibition, a recombinant adenovirus vector expressing a doxycycline-controlled

human p27Kip1 (Adp27, Tet-Off form) has been created. Based on our previous

experience (33), we have first tested the Adp27 in SKBr3 breast cancer cells that

overxpress HER2 protein. As expected, Adp27 did not express induced p27Kip1 protein

that was tagged with c-Myc in the presence of doxycycline (Fig. 6A), suggesting there

was no leakage of this inducible system at indicated MOIs. In the absence of

doxycycline, Adp27 was induced to express p27Kip1 protein in a MOI-dependent manner

(Fig. 6A), suggesting effective control of p27Kip1 in this adenovirus system. Accordingly,

induced Adp27 produced an average of 59.6% cells in G1 phase at a MOI of 2 and 79.8%

at a MOI of 20, whereas uninduced Adp27 produced an average of 47.0% in G1 phase at

2 MOI and 48.3% at 20 MOI (Fig. 6B). As shown in Figure 6C, induced Adp27 at 2 MOI

resulted in an average of 16% anchorage-dependent growth inhibition compared to

uninduced Adp27, whereas induced Adp27 at 20 MOI resulted in an average of 40%

anchorage-dependent growth inhibition compared to uninduced Adp27. In addition to

SKBr3 cells, we have also tested Adp27 in another HER2-overexpressing breast cancer

cell line, BT474, and obtained similar results (data not shown). These observations

clearly illustrated that expression of p27Kip1 protein resulted in p27Kip1 level-dependent

G1 cell cycle arrest and growth inhibition. Thus, these data strongly indicate the

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 19: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

19

importance of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest and

growth inhibition.

Silencing Expression of p27Kip1 Blocks Anti-HER2 Antibody Mediated

Induction of p27Kip1 Protein and G1 ArrestTo further demonstrate the important

role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle arrest, we have

employed p27Kip1 SiRNA approach to silence the expression of p27Kip1. If p27Kip1

expression is critical to anti-HER2 antibody-induced G1 cell cycle arrest, the effect of

anti-HER2 antibody on G1 arrest should be dramatically decreased when p27Kip1

expression is impaired. Two p27Kip1 SiRNAs (#1 and #2) that we have selected in this

study were capable of effectively silencing p27Kip1 expression in SKBr3 cells after 48 hr

transfection as shown in Figure 7A. 4D5-induced p27Kip1 protein was completely blocked

in cells treated with p27Kip1 SiRNA #1, whereas 4D5-induced p27Kip1 protein was not

significantly affected in cells treated with control SiRNA (Fig. 7B). A similar effect on

4D5-induced p27Kip1 protein was observed with p27Kip1 SiRNA #2 (Data not shown). In

agreement with the level of p27Kip1 protein, 4D5-induced G1 arrest was also completely

prevented in the cells treated with p27Kip1 SiRNA #1, whereas 4D5-induced p27Kip1

protein was not significantly affected in the cells treated with control SiRNA (Fig. 7C).

Thus, the important role of p27Kip1 protein in anti-HER2 antibody-induced G1 cell cycle

arrest is further confirmed.

Anti-HER2 Antibody Significantly Increases the Half-life of p27Kip1

ProteinOur preliminary data obtained from Northern blots and reverse transcription-

PCR suggested that anti-HER2 antibody did not increase the amount of p27Kip1 mRNA

(Data not shown). Thus, anti-HER2 antibody may upregulate p27Kip1 protein primarily

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 20: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

20

through post-translational mechanisms. To confirm that anti-HER2 antibody-induced

p27Kip1 protein is due to post-translational events, we have measured the half-life of

p27Kip1 protein. BT474 cells were treated with trastuzumab for 48 hrs and then treated

with an inhibitor of protein synthesis, cyclohexamide, at 5 µg/ml, for different time

intervals as indicated in Figure 8A. Cells were harvested for Western blot analysis to

check the level of p27Kip1 protein. As shown in Figure 8A, the level of p27Kip1 protein in

trastuzumab-treated cells declined gradually with time but at a much slower rate than in

hIgG-treated cells. After normalization of p27Kip1 expression with the loading control (β-

actin), the half-life of p27Kip1 protein in trastuzumab-treated cells was about 5.0 hrs,

whereas the half-life of p27Kip1 protein in hIgG-treated cells was about 1.8 hrs (Fig. 8B).

The prolonged half-life of p27Kip1 protein in anti-HER2 antibody-treated cells was also

confirmed by the 35S-labeled pulse-chase experiments (data not shown). Therefore, these

results illustrate that anti-HER2 antibody significantly increases the half-life of p27kip1

protein and suggest the accumulation of p27Kip1 protein induced by anti-HER2 antibody

results from post-translational mechanisms.

Anti-HER2 Antibody Significantly Decreases Threonine Phosphorylation of

p27Kip1 Protein at Position 187 and Increases Serine Phosphorylation of p27Kip1 Protein

at Position 10The results described above support the idea that anti-HER2 antibody

induces p27Kip1 expression through post-translational regulation. Ubiquitin-proteasome

proteolysis plays a major role in regulating p27Kip1 protein (12). We have tested the

importance of this mechanism in SKBr3 cells using an ubiquitin-proteasome inhibitor

MG132. As shown in Figure 9A, treatment with MG132 significantly increased the level

of p27Kip1 protein, whereas the inhibition of calpain or caspase activity did not alter

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 21: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

21

p27Kip1 expression. These data support the important role of ubiquitin-proteasome

proteolysis in regulation of p27Kip1 protein in SKBr3 cells. Phosphorylation of p27Kip1

protein has been widely recognized to be one of the major post-translational mechanisms

that regulate the abundance of this protein (10, 12-15). Phosphorylation of p27Kip1 protein

at Threonine 187 (T187) by CDK2 results in the recognition by E3 proteasome complex

for protein degradation (13-15). Phosphorylation of p27Kip1 protein at Serine 10 (S10) has

been shown to increase dramatically the expression of this protein (16,17). Consequently,

we have investigated the phosphorylation status at these two common sites of p27Kip1

protein using site- and phoshpho-specific antibodies against phosphorylated p27Kip1

protein. As shown in Figure 9B, anti-HER2 antibody 4D5 considerably decreased the

T187 phosphorylation of p27Kip1 protein in SKBr3 cells. At the same time, 4D5

considerably increased the S10 phosphorylation of p27Kip1 protein (Fig. 9B). The level of

Jab1, a regulator of p27Kip1 expression (18,19), decreased only slightly. Similarly, anti-

HER2 antibody trastuzumab decreased T187 phosphorylation and increased S10

phosphorylation of p27Kip1 protein in another breast cancer cell line BT474 (Fig. 9C). The

effect of S10 phosphorylation and T187 phosphorylation on anti-HER2 antibody-induced

G1 cell cycle arrest was further investigated using p27 mutants (12) and pGFP co-

transfection as described in Materials and Methods and Figure 10A. The GFP

transfection efficiency for vectors expressing wild-type p27, S10A p27 (Serine 10 was

converted to Alanine 10), and T187A p27 (Threonine 187 was converted to Alanine 187)

ranged from 34% to 50%. Since the ratio of individual gene expression vector to GFP

vector used in the transfection was 4:1, GFP-positive cells were considered to

simultaneously express the individual gene of interest. As shown in Figure 10B, S10A

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 22: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

22

p27 expression increased the fraction of cells in G1 and rendered the cells much less

sensitive to 4D5-induced G1 arrest than was observed after transfection of a control

vector or wild-type p27. These results confirm S10 phosphorylation is important to anti-

HER2 antibody-induced G1 arrest. Cells expressing T187A p27 also showed less

sensitivity to 4D5-induced G1 arrest (Fig. 10B). As anti-HER2 antibody decreases T187

phosphorylation, the T187A mutant p27Kip1 protein already lacks phosphorylation and

should not respond to antibody. Taken together, these results showed that regulation of

the phosphorylation of p27Kip1 protein might present one of the post-translational

mechanisms by which anti-HER2 antibody upregulates the protein. The data strongly

suggest the different role of T187 and S10 phosphorylation in regulation of p27Kip1

protein, in which phosphorylation of p27Kip1 protein at T187 promotes protein

degradation, whereas phosphorylation of p27Kip1 protein at S10 stabilizes the protein.

DISCUSSION

Our data demonstrate that p27Kip1 plays a critical role in the anti-HER2 antibody-

induced G1 cell cycle arrest and tumor growth inhibition. p27Kip1 upregulation and

corresponding G1 cell cycle arrest induced by anti-HER2 antibody are not only

concentration-dependent, but also time-dependent. The magnitude of G1 cell cycle arrest

induced by anti-HER2 antibody is correlated well with the level of p27Kip1 protein

induced. The magnitude of growth inhibition of breast cancer cells treated with anti-

HER2 antibody parallels closely the level of p27Kip1 induced. Induced expression of

exogenous p27Kip1 with an inducible system results in a similar G1 cell cycle arrest and

growth inhibition to that obtained with anti-HER2 antibody. Inhibition of

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 23: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

23

p27Kip1expression by p27Kip1 anti-sense cDNA significantly impairs, but does not

completely eliminate anti-HER2 antibody-induced p27Kip1 protein, G1 arrest, and growth

inhibition. Our data also illustrate that the majority of G1 arrest induced by anti-HER2

antibody can no longer be removed after 14 hrs of treatment. Anti-HER2 antibody-

induced p27Kip1 protein, G1 arrest, and growth inhibition last at least five days after a

single treatment. Our data further demonstrate that anti-HER2 antibody increases the

half-life of p27kip1 protein. Anti-HER2 antibody is able to decrease threonine

phosphorylation of p27kip1 protein at position 187 and increase serine phosphorylation of

p27kip1 protein at position 10. Therefore, upregulation of p27Kip1 by anti-HER2 antibody

occurs primarily through post-translational mechanisms. Regulation of the

phosphorylation of p27Kip1 protein is identified as one of the post-translational

mechanisms by which anti-HER2 antibody up-regulates the protein.

Definition of the role p27Kip1 in the anti-HER2 antibody-induced G1 cell cycle

arrest and tumor growth inhibition is important. p27Kip1 protein appears to be a critical

downstream target of signaling through HER2 molecule. Elucidation of the role p27Kip1

in the anti-HER2 antibody-induced tumor growth inhibition also indicates that any

factors that affect p27Kip1 level might also influence anti-HER2 antibody-induced tumor

growth inhibition. Modulation of p27Kip1 protein by multiple pathways might be exploited

in the treatment of cancer in animal models and ultimately in clinical trials that include

trastuzumab. At a minimum, levels of p27Kip1 protein observed after trastuzumab therapy

might be an intermediate biomarker for response to the antibody alone.

Expression of p27Kip1 protein is a short event as the protein generally has short

half-life as shown in Figure 8. However, growth inhibition of HER2-overexpressing

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 24: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

24

cancer cells induced by the antibody is a long-lasting event as the effect is cumulative.

Therefore, the time-dependent correlation between growth and the level of p27Kip1 protein

could not be established. Recently, Yakes et al reported that antisense ODN of p27Kip1

prevented trastuzumab-induced reduction of cells in S phase and induction of cells in G1

phase (31), confirming our observation in Figure 7.

In this study, we provide data to indicate that anti-HER2 antibody needs at least

14 hrs to exhibit its anti-tumor effects on G1 arrest and p27Kip1 upregulation. After 14 hrs,

90% of the anti-tumor effect of anti-HER2 antibody can no longer be removed. Our data

also indicate that a single dose of anti-HER2 antibody produces a long-lasting p27Kip1

upregulaiton and G1 cell cycle arrest for at least five days and inhibits cancer cell growth

for at least a week. These results are consistent with the administration of trastuzumab to

patients on a weekly basis in clinic. In a severe combined immunodeficient (SCID) mice

model, Tokuda et al also showed that a single dose of trastuzumab inhibited about 50%

tumor growth of HER2-overexpressing 4-1ST human gastric carcinoma (34).

Our data support the notion that p27Kip1 upregulaiton by anti-HER2 antibody is

through a post-translational mechanism. Regulation of p27Kip1 phoshorylation by anti-

HER2 antibody is one of the mechanisms leading to stabilization and accumulation of the

protein. Recent reports have shown that different phoshorylation patterns of p27Kip1

determine its binding to cyclin D1 or to cyclin E (35). Thr187 and Ser10 are two major

sites for p27Kip1 phoshorylation that regulate its abundance in the cell (13-17).

Degradation of p27Kip1 protein depends on: phosphorylation of Thr187 by cyclin E-

CDK2 complex, transportation form the nucleus to the cytoplasm; then ubiquitination

mediated by SCFSkp2, and finally proteolysis by the 26S proteasome (10-15). How

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 25: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

25

phosphorylation of Ser10 increases the stability of p27Kip1 protein is still unknown. Two

new phoshorylation sites on p27Kip1 have recently been identified. Three independent

groups have reported that Threonine 157 of p27Kip1 can be phosphorylated by PKB/AKT

(36-38). Fujita et al found that Threonine 198 of p27Kip1 could also be phosphorylated by

PKB/AKT (39). Threonine 157 and 198 phosphorylation have been linked to regulate the

cellular localization of p27Kip1, in that phosphorylation of these two sites blocks nuclear

import of p27Kip1 (16, 17, 36-39). Thus, different phosphorylation events can affect not

only the levels of p27Kip1 protein but also its subcellular localization. It will be worthy to

investigate the impact of trastuzumab treatment on Threonine 157 and 198

phosphorylation of p27Kip1 protein.

AcknowledgementsWe sincerely thank Genentech Corp (South San Francisco,

CA) for providing Trastuzumab (Herceptin) and 4D5 monoclonal antibodies against

HER2; Dr. Nakayama KI at Departments of Molecular and Cellular Biology and

Molecular Genetics, Medical Institute of Bioregulation, Kyushu University (Fukuoka,

Japan) for providing the p27Kip1 wildtype and mutants constructs; and Mrs. Karen

Ramirez at Flow Cytometry Core Laboratory (Smith Research Building) of M. D.

Anderson Cancer Center (Houston, TX) for her expert assistance with flow cytometry

analysis.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 26: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

26

REFERENCES

1. Harari, D., and Yarden, Y. (2000) Oncogene 19, 6102-6114

2. Stern, D. F. (2000) Breast Cancer Res. 2, 176-183

3. Yarden, Y., and Sliwkowski, M. X. (2001) Nat. Rev. Mol. Cell Biol. 2, 127-137

4. Mendelsohn, J., and Baselga, J. (2000) Oncogene 19, 6550-6565

5. Pegram, M. D., and Slamon, D. J. (2000) Cancer Treat. Res. 103, 57-75

6. Cobleigh, M., Vogel, C., Tripathy, D., et al. (1999) J. Clin. Oncol. 17, 2639-2648

7. Vogel, C., Cobleigh, M., Tripathy, D., et al. (2002) J. Clin. Oncol. 20, 719-726

8. Slamon, D., Leyland-Jon, B., Shak, S., et al. (2001) N. Engl. J. Med. 344, 783-792

9. Sherr, C. J., and Roberts, J. M. (1999) Genes & Dev. 13, 1501-1512

10. Philipp-Staheli, J., Payne, S. R., and Kemp, C. J. (2001) Exp. Cell. Res. 264, 148-

168

11. Hengst, L., and Reed, S. I. (1996) Science 271, 1861-1864

12. Pagano, M., Tam, S. W., Theodoras, A. M., Beer-Romero, P., Del Sal, G., Chau,

V., Yew, P. R., Draetta, G. F., and Rolfe, M. (1995) Science 269, 682-685

13. Vlach, J., Hennecke, S., and Amati, B. (2002) EMBO J. 21, 3390-3401

14. Harper, J. W. (2001) Curr. Biol. 11, R431-435

15. DeSalle, L. M., and Pagano, M. (2001) FEBS Lett. 490, 179-189

16. Ishida, N., Kitagawa, M., Hatakeyama, S., and Nakayama, K. (2000) J. Biol.

Chem. 275, 25146-25154

17. Boehm, M., Yoshimoto, T., Crook, M. F., Nallamshetty, S., True, A., Nabel, G.

J., and Nabel, E. G. (2002) EMBO J. 21, 3390-3401

18. Tomoda, K., Kubota, Y., and Kato, J. (1999) Nature 398, 160-165

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 27: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

27

19. Chopra, S., Fernandez, D., Mattos S, Lam, E. W., and Mann, D. J. (2002) J. Biol.

Chem. 277, 32413-32416

20. Yang, H. Y., Zhou, B. P., Hung, M. C., and Lee, M. H. 2000; J. Biol. Chem. 275,

24735-24739.

21. Bruni, P., Boccia, A., Baldassarre, G., Trapasso, F., Santoro, M., Chiappetta, G.,

Fusco, A., and Viglietto, G. (2000) Oncogene 19, 3146-5315

22. Jonuleit, T., van der Kuip, H., Miething, C., Michels, H., Hallek, M., Duyster, J.,

and Aulitzky, W. E. (2000) Blood 96, 1933-1399

23. Nakayama, K., Ishida, N., Shirane, M., Inomata, A., Inoue, T., Shishido, N.,

Horii, I., Loh, D.Y., and Nakayama, K. (1996) Cell 85, 707-720

24. Fero, M. L., Rivkin, M., Tasch, M., Porter, P., Carow, C. E., Firpo, E., Polyak, K.,

Tsai, L. H., Broudy, V., Perlmutter, R. M., Kaushansky, K., and Roberts, J. M.

(1996) Cell 85, 733-744

25. Le, X. -F., McWatters, A., Wiener, J., Mills, G.B., and Bast, R.C., Jr. (2000) Clin.

Cancer Res. 6: 260-270

26. Neve, R. M., Sutterluty, H., Pullen, N., Lane, H. A., Daly, J. M., Krek, W., and

Hynes, N. E. (2000) Oncogene 19, 1647-5166

27. Pietras, R. J., Poen, J. C., Gallardo, D., Wongvipat, P. N., Lee, H. J., and Slamon,

D. J. (1999) Cancer Res. 59, 1347-1355

28. Ye, D. W., Fan, Z., and Mendelsohn, J. (1999) Oncogene 18, 731-738

29. Sliwkowski, M. X., Lofgren, J. A., Lewis, G. D., Hotaling, T. E., Fendly, B. M.,

and Fox, J. A. (1999) Semin. Oncol., 26 (4 Suppl 12), 60-70

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 28: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

28

30. Lane, H. A., Beuvink, I., Motoyama, A. B., Daly, J. M., Neve, R. M., and Hynes,

N. E. (2000) Mol. Cell. Biol. 20, 3210-3223

31. Yakes, F. M., Chinratanalab, W., Ritter, C. A., King, W., Seelig, S., and Arteaga,

C. L. (2002) Cancer Res. 62, 4132-4141

32. Pegram, M. D., Finn, R. S., Arzoo, K., Beryt, M., Pietras, R. J., and Slamon, D. J.

(1997) Oncogene 15, 537-547

33. Le, X. -F., Marcelli, M., McWatters, A., Nan, B., Mills, G. B., O’Brian, C. A.,

and Bast, R.C., Jr. (2001) Oncogene 20, 8258-8269

34. Tokuda, Y., Ohnishi, Y., Shimamura, K., Iwasawa, M., Yoshimura, M., Ueyama,

Y., Tamaoki, N., Tajima, T., and Mitomi, T. (1996) Br. J. Cancer 73, 1362-1365

35. Ciarallo, S., Subramaniam, V., Hung, W., Lee, J. H., Kotchetkov, R., Sandhu, C.,

Milic, A., and Slingerland, J. M. (2002) Mol. Cell. Biol. 22, 2993-3002

36. Liang, J., Zubovitz, J., Petrocelli, T., Kotchetkov, R., Connor, M. K., Han, K.,

Lee, J. H., Ciarallo, S., Catzavelos, C., Beniston, R., Franssen, E., and

Slingerland, J. M. (2002) Nat. Med. 8, 1153-1160

37. Shin, I., Yakes, F. M., Rojo, F., Shin, N. Y., Bakin, A.V., Baselga, J., and

Arteaga, C. L. (2002) Nat. Med. 8, 1145-1152

38. Viglietto, G., Motti, M. L., Bruni, P., Melillo, R. M., D'Alessio, A., Califano, D.,

Vinci, F., Chiappetta, G., Tsichlis, P., Bellacosa, A., Fusco, A., and Santoro, M.

(2002) Nat. Med. 8, 1136-1144

39. Fujita, N., Sato, S., Katayama, K., and Tsuruo, T. (2002) J. Biol. Chem. 277,

28706-28713

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 29: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

29

FIGURE LEGENDS

Fig. 1. Anti-HER2 antibody induces a concentration-dependent

accumulation of p27Kip1 protein and a corresponding concentration-dependent G1

cell cycle arrest. SKBr3 cells (panel A, B) were treated for 24 hrs with anti-HER2

antibody 4D5 at indicated concentrations or control mouse antibody MOPC21 at 10

µg/ml. Cells were then divided into two portions: one for measurement of cell cycle

distribution by flow cytometry (A) and the other for total protein extraction and

quantitation of p27Kip1 protein by Western blotting (B). Similarly, BT474 cells (panel C,

D) were treated for 48 hrs with anti-HER2 antibody 4D5 at indicated concentrations or

control antibody MOPC21 at 10 µg/ml. Cells were then divided into two portions: one for

measurement of cell cycle distribution by flow cytometry (C) and another for total

protein extraction and detection of p27Kip1 protein by Western blotting (D). Results in this

figure are representative of three replicate experiments. For the protein loading control,

the same blot was stripped and re-probed with an anti-ß-actin antibody.

Fig. 2. Anti-HER2 antibody induces a time-dependent accumulation of

p27Kip1 protein and a corresponding time-dependent G1 cell cycle arrest. BT474

cells (panel A, B) were treated for 72 hrs with anti-HER2 antibody trastuzumab at 10

µg/ml for the indicated time intervals or with human IgG protein (hIgG) as a control at 10

µg/ml. Cells were then divided into two portions: one for cell cycle analysis and the other

for total protein extraction and Western blot analysis. A, Measurement of cell cycle

distribution by flow cytometry. B, Quantitation of p27Kip1 protein by Western blotting.

SKBr3 cells (panel C, D) were treated for 48 hrs with anti-HER2 antibody 4D5 at 3µg/ml

for the indicated time intervals or control MOPC21 at 3µg/ml. C, Detection of cell cycle

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 30: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

30

distribution by flow cytometry. D, Detection of p27Kip1 protein by Western blotting.

Results in this figure are representative of three replicate experiments. For the protein

loading control, the same blot was stripped and re-probed with an anti-ß-actin antibody.

Fig. 3. Anti-HER2 antibody induces an irreversible increase in p27Kip1

protein and a corresponding G1 cell cycle arrest. A, Schematic illustration of the

experimental design. BT474 cells were treated with or without trastuzumab at 10 µg/ml.

B, Measurement of p27Kip1 protein by Western blotting and of cell cycle distribution by

flow cytometry. Results in this figure are representative of three replicate experiments.

For the protein loading control, the same blot was stripped and re-probed with an anti-ß-

actin antibody. * indicates a statistically significant difference compared to the untreated

control.

Fig. 4. Growth inhibition induced by anti-HER2 antibody correlates with the

induced level of p27Kip1 protein. BT474 cells were treated with 4D5 at the

concentrations indicated. A, Anchorage-dependent growth assay was performed in 96-

well microplates as described in Experimental Procedures. B, Measurement of p27Kip1

protein by Western blot analysis. BT474 cells at similar cell density to the microplate

growth assay were plated into 100-mm culture dishes and treated for 48 hrs with 4D5 or

control antibody at similar conditions. C, Anchorage-independent growth assay was

measured by clonogenic growth in soft agar as described in Experimental Procedures. D,

Measurement of p27Kip1 protein by Western blot analysis. BT474 cells at similar cell

density to the colony-formation assay were plated into 100-mm culture dishes and treated

with 4D5 or control antibody at similar concentrations for 48 hrs. Results in this figure

are representative of three replicate experiments.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 31: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

31

Fig. 5. Anti-HER2 antibody induces a long-lasting upregulation of p27Kip1

protein, G1 cell cycle arrest, and growth inhibition. BT474 cells (panel A, B, C) at cell

density of 1 x 105 per 100-mm cell culture dish were treated with single dose of

trastuzumab or control hIgG for different time intervals. Cells on day 3 and day 5 after

treatment were then harvested and enumerated with a Coulter counter, p27Kip1 protein

was measured, and cell cycle analyzed. A, Detection of p27Kip1 by Western blot analysis.

For the protein loading control, the same blot was stripped and re-probed with an anti-ß-

actin antibody. B, Cell cycle distribution by flow cytometry. HCT represents Herceptin or

trastuzumab. C, Cell growth measured with a Coulter counter. *, P = 0.012 compared

with day3 hIgG control; **, P = 0.001 compared with day5 hIgG control. SKBr3 cells

(1.5 x 104 in a 100-mm culture dish) (panel D, E, F) were treated with single dose of 4D5

or control MOPC21 as described above. D, Detection of p27Kip1 by Western blot analysis.

For the protein loading control, the same blot was stripped and re-probed with an anti-ß-

actin antibody. E, Cell cycle distribution by flow cytometry. F Cell growth measured

with a Coulter counter. † indicates a statistically significant difference from day3

MOPC21 control (P = 0.04); ‡ denote a statistically significant difference from day5

MOPC21 control (P = 0.009). Results in this figure are representative of three replicate

experiments.

Fig. 6. Induced expression of p27Kip1 protein produces G1 cell cycle arrest

and growth inhibition similar to that observed with anti-HER2 antibody. SKBr3

cells (2 x 105) were seeded in 100-mm cell culture dishes and incubated overnight at

37oC. Cells were then coinfected with a regulatory virus (adeno-X Tet-Off) and Ad-Myc-

p27Kip1 virus at different multiplicities of infection (MOI) or at a MOI of 20 in presence

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 32: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

32

(+) of absence (-) of doxycycline. After 72 hrs, cells were harvested for enumeration with

a Coulter counter, Western blot analysis, and cell cycle analysis. A, Detection of Myc-

p27Kip1 by Western blot analysis with an anti-Myc antibody. For the protein loading

control, the same blot was stripped and re-probed with an anti-ß-actin antibody. B, Effect

of induced Myc-p27Kip1 on cell cycle distribution. † indicates a statistically significant

difference from 2 MOI uninduced group; ‡ denote a statistically significant difference 20

MOI uninduced group. C, Effect of induced Myc-p27Kip1 on growth inhibition. *

indicates a statistically significant difference from 20 MOI uninduced group. Results in

this figure are representative of three replicate experiments.

Fig. 7. Silencing expression of p27Kip1 blocks anti-HER2 antibody mediated

induction of p27Kip1 protein and G1 arrest. SKBr3 cells seeded on six-well plate were

transfected with p27 SiRNA duplex or with control SiRNA using Oligofectamine reagent

according to the manufacturer’s protocol. A, Both p27 SiRNA #1 and #2 diminished the

level of p27Kip1 protein after 48 hr transfection. A representative Western blot of p27Kip1

expression was shown. For the protein loading control, the same blot was stripped and re-

probed with an anti-ß-actin antibody. B, p27 SiRNA blocked 4D5-induced p27Kip1

expression. SKBr3 cells were transfected with SiRNA for 36 hr and then treated with

4D5 (3 µg/ml) for another 24 hr. Cells were collected for protein blotting and cell cycle

analysis. C, p27 SiRNA blocked 4D5-induced G1 arrest. SKBr3 cells were treated as

described in B. Cell cycle distribution was determined by flow cytometry. Results are

representative of two replicate analyses.

Fig. 8. Anti-HER2 antibody significantly increases the half-life of p27Kip1

protein. BT474 cells at a density of 6 x 105 per 100-mm cell culture dish were treated

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 33: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

33

with 10 µg/ml of trastuzumab or hIgG for 48 hrs. Cells were then washed and treated

with 5 µg/ml of cycloheximide (CHX) for the indicated time intervals. Cells were

harvested, subjected to total protein preparation and Western blot analysis with anti-

p27Kip1 and anti-ß-actin antibodies. A, A Western blot is shown that is representative of

three replicate analyses. B, Semi-quantitation of p27Kip1 expression shown in A. Results

were normalized according to the level of ß-actin control. The p27Kip1 expression of both

trastuzumab and hIgG group at 0 hr interval was set as 1 unit.

Fig. 9. Anti-HER2 antibody significantly decreases threonine

phosphorylation of p27Kip1 protein at position 187 and increases serine

phosphorylation of p27Kip1 protein at position 10. A, Only the inhibitor of proteasome

degradation pathway upregulated p27Kip1 expression. SKBr3 cells were treated with a

proteasome inhibitor MG132 (5 µM), or a broad inhibitor of caspases (60 µM), or a

calpain inhibitor PD151746 (5 µM) for 24 hr. Total protein was then prepared for

Western blot analysis. B, 4D5 decreased T187 phosphorylation and increased S10

phosphorylation of p27Kip1 protein in SKBr3 cells. SKBr3 cells were treated for 24 hrs

with 4D5 at different concentration or with diluent and total proteins were prepared as

described in Experimental Procedures. Western blot analysis was performed to detect

different proteins. Filters were first blotted with an anti-phospho-Thr187 p27Kip1

antibody, then stripped and re-probed with different antibodies in the following order:

phospho-Ser10 p27Kip1, Jab1, β-actin, and total p27Kip1. These results were representative

of two independent experiments. C, Trastuzumab decreased T187 phosphorylation and

increased S10 phosphorylation of p27Kip1 protein in BT474 cells. BT474 cells were

treated with or without trastuzumab (10 µg/ml) for 48 hr. Total protein was prepared for

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 34: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

34

Western blot analysis using different antibodies in the following order: phospho-Ser10

p27Kip1, phospho-Thr187 p27Kip1, and total p27Kip1.

Fig. 10. Expression of p27Kip1 mutants causes G1 arrest and decreases

sensitivity to anti-HER2 antibody-induced G1 arrest. A, Flow cytometric analysis of

GFP-positive cells. SKBr3 cells were transiently transfected with the appropriate

expression plasmids (p27Kip1 wildtype, p27Kip1 S10A, or p27Kip1 T187A) plus pEGFP-F

vector using LipofectAMINE-2000. Cells were collected after 48 hr transfection and

fixed in 0.25% paraformaldehyde for 1.5 hr and then stained with PI solution. The GFP-

positive population was gated. The numbers shown as an insert in the histogram were

percentage of GFP+ positive cells. B, p27Kip1 S10A and p27Kip1 T187A mutants caused

less sensitivity to anti-HER2 antibody-induced G1 arrest than p27Kip1 wildtype and

control vector. SKBr3 cells were treated as described in A. Cells on individual dish were

trypsinized and reseeded in two identical dishes after 24 hr transfection. One dish was

treated with anti-HER2 antibody 4D5 and the other was treated with diluent for another

24 hr. Cells were then subjected to cell cycle analysis. The cell cycle distribution of GFP-

positive population was determined. The GFP positive rate in empty vector pcDNA3.0

was used to normalize other plasmids’ different transfection efficiency. A representative

data was shown from two separate experiments.

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 35: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 36: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 37: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 38: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 39: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 40: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 41: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 42: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 43: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 44: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from

Page 45: The Role of Cyclin-dependent Kinase Inhibitor p27Kip1 in ... · 4/16/2003  · 2 ABSTRACT Cyclin-dependent kinase (CDK) inhibitor p27Kip1 binds to the cyclin E-CDK2 complex and plays

Ruth LaPushin, Ana M. Tari and Robert C. Bast ., JrXiao-Feng Le, Francois-Xavier Claret, Amy Lammayot, Ling Tian, Deepa Deshpande,

G1 cell cycle arrest and tumor growth inhibitionThe role of cyclin-dependent kinase inhibitor p27Kip1 in anti-HER2 antibody-induced

published online April 16, 2003J. Biol. Chem. 

  10.1074/jbc.M300848200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on September 5, 2020

http://ww

w.jbc.org/

Dow

nloaded from