44
The PAQ4 Data Compressor Matt Mahoney Florida Tech.

The PAQ4 Data Compressor Matt Mahoney Florida Tech

Embed Size (px)

Citation preview

Page 1: The PAQ4 Data Compressor Matt Mahoney Florida Tech

The PAQ4 Data Compressor

Matt Mahoney

Florida Tech.

Page 2: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Outline

• Data compression background

• The PAQ4 compressor

• Modeling NASA valve data

• History of PAQ4 development

Page 3: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Data Compression Background

• Lossy vs. lossless

• Theoretical limits on lossless compression

• Difficulty of modeling data

• Current compression algorithms

Page 4: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Lossy vs. Lossless

• Lossy compression discards unimportant information– NTSC (color TV), JPEG, MPEG discard

imperceptible image details– MP3 discards inaudible details

• Losslessly compressed data can be restored exactly

Page 5: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Theoretical Limits on Lossless Compression

• Cannot compress random data

• Cannot compress recursively

• Cannot compress every possible message– Every compression algorithm must expand

some messages by at least 1 bit

• Cannot compress x better than log2 1/P(x) bits on average (Shannon, 1949)

Page 6: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Difficulty of Modeling

• In general, the probability distribution P of a source is unknown

• Estimating P is called modeling

• Modeling is hard– Text: as hard as AI– Encrypted data: as hard as cryptanalysis

Page 7: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Text compression is as hard as passing the Turing test for AI

• P(x) = probability of a human dialogue x (known implicitly by humans)

• A machine knowing P(A|Q) = P(QA)/P(Q) would be indistinguishable from human

• Entropy of English ≈ 1 bit per character (Shannon, 1950)– Best compression: 1.2 to 2 bpc (depending on input size)

Computer

Q: Are you human?

A: Yes

Page 8: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Compressing encrypted data is equivalent to breaking the

encryption

• Example: x = 1,000,000 0 bytes encrypted with AES in CBC mode and key “foobar”

• The encrypted data passes all tests for statistical randomness (not compressible)

• C(x) = 65 bytes using English

• Finding C(x) requires guessing the key

Page 9: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Nevertheless, some common data is compressible

Page 10: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Redundancy in English text

• Letter frequency: P(e) > P(q)– so “e” is assigned a shorter code

• Word frequency: P(the) > P(eth)

• Semantic constraints: P(drink tea) > P(drink air)

• Syntactic constraints: P(of the) > P(the of)

Page 11: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Redundancy in images (pic from Calgary corpus)

Adjacent pixels are often the same color, P(000111) > P(011010)

Page 12: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Redundancy in the Calgary corpusDistance back to last match of length 1, 2, 4, or 8

Page 13: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Redundancy in DNA

tcgggtcaataaaattattaaagccgcgttttaacaccaccgggcgtttctgccagtgacgttcaagaaaatcgggccattaagagtgagttggtattccatgttaagcatccacaggctggtatctgcaaccgattataacggatgcttaacgtaatcgtgaagtatgggcatatttattcatctttcggcgcagaatgctggcgaccaaaaatcacctccatccgcgcaccgcccgcatgctctctccggcgacgattttaccctcatattgctcggtgatttcgcgggctacc

P(a)=P(t)=P(c)=P(g)=1/4 (2 bpc) e.coli (1.92 bpc?)

Page 14: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Some data compression methods

• LZ77 (gzip) – Repeated strings replaced with pointers back to previous occurrence

• LZW (compress, gif) – Repeated strings replaced with index into dictionary– LZ decompression is very fast

• PPM (prediction by partial match) – characters are arithmetic encoded based on statistics of longest matching context– Slower, but better compression

Page 15: The PAQ4 Data Compressor Matt Mahoney Florida Tech

LZ77 Example

the cat in the hat

...a...a...a...or?

Sub-optimal compression due to redundancy in LZ77 coding

Page 16: The PAQ4 Data Compressor Matt Mahoney Florida Tech

LZW Example

the cat in the hat

atthein

Sub-optimal compression due to parsing ambiguity

...ab...bc...abc...

aabbbcc ab+c or a+bc?

Page 17: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Predictive Arithmetic Compression (optimal)

Predict next symbol

ArithmeticCoder

input p

ArithmeticDecoder

Predict next symbol

p output

compresseddata

Compressor

Decompressor

Page 18: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Arithmetic Coding

• Maps string x into C(x) [0,1) represented as a high precision binary fraction

• P(y < x) < C(x) < P(y ≤ x)– < is a lexicographical ordering

• There exists a C(x) with at most a log2 1/P(x) + 1 bit representation– Optimal within 1 bit of Shannon limit

• Can be computed incrementally– As characters of x are read, the bounds tighten– As the bounds tighten, the high order bits of C(x) can

be output

Page 19: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Arithmetic coding example• P(a) = 2/3, P(b) = 1/3

– We can output “1” after the first “b”

a

b

aa

ab

ba

bb

aaa = “”

aba = 1

baa = 11

bbb = 11111

0.1

0.01

0.11

0aaa

aab

aba

abb

baababbbabbb

Page 20: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Prediction by Partial Match (PPM) Guess next letter by matching longest context

the cat in the ha?

Longest context match is “a”Next letter in context “a” is “t”

the cat in th?

Longest context match is “th”Next letter in context “th” is “e”

Page 21: The PAQ4 Data Compressor Matt Mahoney Florida Tech

How do you mix old and new evidence?

..abx...abx...abx...aby...ab?

P(x) = ?P(y) = ?

Page 22: The PAQ4 Data Compressor Matt Mahoney Florida Tech

How do you mix evidence from contexts of different lengths?

..abcx...bcy...cy...abc?

P(x) = ?P(y) = ?P(z) = ? (unseen but not impossible)

Page 23: The PAQ4 Data Compressor Matt Mahoney Florida Tech

PAQ4 Overview

• Predictive arithmetic coder

• Predicts 1 bit at a time

• 19 models make independent predictions– Most models favor newer data

• Weighted average of model predictions– Weights adapted by gradient descent

• SSE adjusts final probability (Osnach)

• Mixer and SSE are context sensitive

Page 24: The PAQ4 Data Compressor Matt Mahoney Florida Tech

PAQ4

Model

Model

Model

Model

Mixer SSEArithmetic

Coder

p

p p

Input Data

Compressed Data

context

Page 25: The PAQ4 Data Compressor Matt Mahoney Florida Tech

19 Models

• Fixed (P(1) = ½)• n-gram, n = 1 to 8 bytes• Match model for n > 8• 1-word context (white space boundary)• Sparse 2-byte contexts (skips a byte) (Osnach)• Table models (2 above, or 1 above and left)

• 8 predictions per byte– Context normally begins on a byte boundary

Page 26: The PAQ4 Data Compressor Matt Mahoney Florida Tech

n-gram and sparse contexts

.......x? .....x.x?

......xx? ....x..x?

.....xxx? ....x.x.?

....xxxx? x...x...?

...xxxxx? .....xx.?

..xxxxxx? ....xx..?

.xxxxxxx? ... word? (begins after space)

xxxxxxxx? xxxxxxxxxx? (variable length > 8)

Page 27: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Record (or Table) Model

• Find a byte repeated 4 times with same interval, e.g. ..x..x..x..x

• If interval is at least 3, assume a table

• 2 models:– first and second bytes above

– bytes above and left

...x...

...x...

...?

.......

...x...

..x?

Page 28: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Nonstationary counter model

• Count 0 and 1 bits observed in each context

• Discard from the opposite count:– If more than 2 then discard ½ of the excess

• Favors newer data and highly predictive contexts

Page 29: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Nonstationary counter exampleInput (in some context) n0 n1 p(1)----------------------- -- -- ----0000000000 10 0 0/1000000000001 6 1 1/7000000000011 4 2 2/60000000000111 3 3 3/600000000001111 2 4 4/6000000000011111 2 5 5/70000000000111111 2 6 6/8

Page 30: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Mixer

• p(1) = i win1i / i ni

– wi = weight of i’th model– n0i, n1i = 0 and 1 counts for i’th model– ni = n0i + n1i

• Cost to code a 0 bit = -log p(1)• Weight gradient to reduce cost = ∂cost/∂wi =

n1i/jwjnj – ni/jwjn1j

• Adjust wi by small amount (0.1-0.5%) in direction of negative gradient after coding each bit (to reduce the cost of coding that bit)

Page 31: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Secondary Symbol Estimation (SSE)

• Maps P(x) to P(x)

• Refines final probability by adapting to observed bits

• Piecewise linear approximation

• 32 segments (shorter near 0 or 1)

• Counts n0, n1 at segment intersections (stationary, no discounting opposite count)

• 8-bit counts are halved if over 255

Page 32: The PAQ4 Data Compressor Matt Mahoney Florida Tech

SSE example

0 Input p 1

Output p

0

1 Initial function

Trained function

Page 33: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Mixer and SSE are context sensitive

• 8 mixers selected by 3 high order bits of last whole byte

• 1024 SSE functions selected by current partial byte and 2 high order bits of last whole byte

Page 34: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Experimental Results on Popular Compressors, Calgary Corpus

Compressor Size (bytes) Compression Time, 750 MHz

Original data 3141622

compress 1272772 1.5 sec.

pkzip 2.04e 1032290 1.5

gzip -9 1017624 2

winrar 3.20 754270 7

paq4 672134 166

Page 35: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Results on Top Compressors

Compressor Size Time

ppmn 716297 23 sec.

rk 1.02 707160 44

ppmonstr I 696647 35

paq4 672134 166

epm r9 668115 54

rkc 661602 91

slim 18 659358 153

compressia 1.0b 650398 66

durilca 0.3a 647028 35

Page 36: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Compression for Anomaly Detection

• Anomaly detection: finding unlikely events

• Depends on ability to estimate probability

• So does compression

Page 37: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Prior work

• Compression detects anomalies in NASA TEK valve data– C(normal) = C(abnormal)– C(normal + normal) < C(normal + abnormal)– Verified with gzip, rk, and paq4

Page 38: The PAQ4 Data Compressor Matt Mahoney Florida Tech

NASA Valve Solenoid Traces

• Data set 3 solenoid current (Hall effect sensor)

• 218 normal traces

• 20,000 samples per trace

• Measurements quantized to 208 values

• Data converted to a 4,360,000 byte file with 1 sample per byte

Page 39: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Graph of 218 overlapped traces data (green)

Page 40: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Compression ResultsCompressor Size

Original 4360000

gzip -9 1836587

slim 18 1298189

epm r9 1290581

durilca 0.3a 1287610

rkc 1277363

rk4 –mx 1275324

ppmonstr Ipre 1272559

paq4 1263021

Page 41: The PAQ4 Data Compressor Matt Mahoney Florida Tech

PAQ4 Analysis

• Removing SSE had little effect

• Removing all models except n=1 to 5 had little effect

• Delta coding made compression worse for all compressors

• Model is still too large to code in SCL, but uncompressed data is probably noise which can be modeled statistically

Page 42: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Future Work

• Compress with noise filtered out

• Verify anomaly detection by temperature, voltage, and plunger impediment (voltage test 1)

• Investigate analog and other models

• Convert models to rules

Page 43: The PAQ4 Data Compressor Matt Mahoney Florida Tech

History of PAQ4Date Compressor Calgary Size

Nov. 1999 P12 (Neural net, FLAIRS paper in 5/2000)

831341

Jan. 2002 PAQ1 (Nonstationary counters)

716704

May 2003 PAQ2 (Serge Osnach adds SSE)

702382

Sept. 2003 PAQ3 (Improved SSE) 696616

Oct. 2003 PAQ3N (Osnach adds sparse models)

684580

Nov. 2003 PAQ4 (Adaptive mixing) 672135

Page 44: The PAQ4 Data Compressor Matt Mahoney Florida Tech

Acknowledgments

• Serge Osnach (author of EPM) for adding SSE and sparse models to PAQ2, PAQ3N

• Yoockin Vadim (YBS), Werner Bergmans, Berto Destasio for benchmarking PAQ4

• Jason Schmidt, Eugene Shelwien (ASH, PPMY) for compiling faster/smaller executables

• Eugene Shelwien, Dmitry Shkarin (DURILCA, PPMONSTR, BMF) for improvements to SSE contexts

• Alexander Ratushnyak (ERI) for finding a bug in an earlier version of PAQ4