THE JOURNAL OF BIOLOGICAL CHEMISTRY c) 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

VOl. 266, No . 34, Issue of ‘December 5, PP ,23027-23032,1991 Printed in 11. S. A.

Molecular Cloning and Characterization of Prolactin-like Protein C Complementary Deoxyribonucleic Acid*

(Received for publication, May 20, 1991)

Santanu Debs, Katherine F. Roby@, Teresa N. Fariatll, Claude SzpirerU**, Goran Levan$$, Simon C. M. Kwokss, and Michael J. SoaresSlill From the Departments of $Physiology and $§Biochemistry, University of Kansas Medical Center, Kansas City, Kansas 66103, the ((Department de Biologie Moleculaire, Uniuersite Libre de Brurelles, B-1640 Rhode-St-Genese, Belgium, and the $$Department of Genetics, University of Gothenburg, S-400 33 Gothenburg, Sweden

In this report, we describe the isolation and charac- terization of a full length cDNA clone for rat prolactin- like protein C (PLP-C) and describe the expression of PLP-C mRNA in the developing rat placenta. Nucleo- tide sequence analysis of the PLP-C cDNA clone pre- dicted a mature protein of 238 amino acids, including a 30-amino acid signal sequence. The predicted PLP- C amino acid sequence contains seven cysteine resi- dues, three tryptophan residues, and two putative N- linked glycosylation sites. Six of the cysteine residues in PLP-C are located in positions homologous to the cysteines of pituitary prolactin (PRL). Additional se- quence similarities with pituitary PRL and other mem- bers of the rat placental PRL family are evident. The PLP-C gene was localized to rat chromosome 17. Northern blot analysis showed that the PLP-C cDNA clone specifically hybridized to a 1.0-kilobase mRNA. PLP-C mRNA was first detectable between days 13 and 14 of gestation, peaked by day 18 of gestation, and remained elevated until term. In situ hybridization analysis indicated that PLP-C mRNA was specifically expressed by spongiotrophoblast cells and some troph- oblast giant cells in the junctional zone region of rat chorioallantoic placenta.

The rat placenta is a rich source of proteins structurally related to pituitary prolactin (PRL).’ Six different rat placen- tal PRL-like proteins have been identified and characterized, including placental lactogen-I (PL-I), PL-11, prolactin-like protein A (PLP-A), PLP-B, PLP-C, and PL-I variant (PL- Iv). PL-I is produced during the first half of pregnancy (Faria et aL, 1990; Robertson et al., 1990) while each of the other

* This work was supported by Grant HD-20676 from the National Institute of Child Health and Human Development (to M. J. S.) and by the Belgian Program on Interuniversity Attraction Poles initiated by the Belgian State-Prime Minister’s Office-Science Policy Pro- gramming (Brussels), the Swedish Cancer Society, the Erik Philip- Sorensen Foundation, the Trygger Foundation, Cancirco, and Bio- Vast (Gothenburg). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “acluertisernent” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted

M76537. to the GenBankTM/EMBL Data Bank with accession number(s)

§ Recipient of a Wesley Foundation postdoctoral fellowship. ll Recipient of a Fulbright predoctoral fellowship. ** Senior Research Associate of the National Fund for Scientific

llll To whom all correspondence should be addressed. ’ The abbreviations used are: PRL, prolactin; PL, placental lacto-

gen; PLP, prolactin-like protein; GH, growth hormone.

Research (FNRS, Belgium).

members of the placental PRL family are produced during the second half of pregnancy (Duckworth et al., 1986a, 1986b, 1988a; Campbell et al., 1989; Faria et al., 1990; Deb et al., 1991a, 1991b). PLP-C has only recently been identified, and thus our knowledge of PLP-C is far more limited relative to the other members of the rat placental PRL family (Deb et al., 1991b). Presently PLP-C is known to be one of the major secretory proteins of the mature rat chorioallantoic placenta; it has two distinct secretory forms and can be giycosylated (Deb et al., 1991b). In this report, we describe the isolation and characterization of a PLP-C cDNA clone and describe the pattern of expression of PLP-C mRNA in the developing rat chorioallantoic placenta.

MATERIALS AND METHODS

Reagents”A11 restriction enzymes, polymerases, and DNA ligase were purchased from New England Biolabs (Beverly, MA). The 7’7 DNA sequencing kit was obtained from Pharmacia LKB Biotechnol- ogy Inc. Oligonucleotide primers for T7 and Sp6 promoters were purchased from Promega (Madison, WI). Other nucleotide primers were custom-synthesized by Oligos Etc. (Guillford, CT). Oligonucle- otide random priming DNA labeling kits were obtained from Bethesda Research Laboratories. All radiolabeled nucleotides were purchased from Du Pont-New England Nuclear. Nitrocellulose was obtained from Schleicher and Schuell. Unless otherwise noted, all other chem- icals and reagents were purchased from Sigma.

Animals-Holtzman rats were obtained from Harlan Sprague- Dawley (Indianapolis, IN). Time pregnancies and tissue dissections were performed as previously described (Soares et al., 1985; Soares, 1987). Protocols for the care and use of animals were approved by the University of Kansas Institutional Animal Care and Use Com- mittee.

Screening of the Rat Placental cDNA Library-A cDNA library generated from term Sprague-Dawley rat placentas and packaged in AGEM-4 phage was kindly provided by Drs. Ok-Kyong Park and Kelly E. Mayo of Northwestern University (Park and Mayo, 1991). The placental cDNA library was screened with a 102-base pair oligonucleotide probe generated from two 60-mer oligonucleotides containing complementary regions. Sequences of the two oligonucle- otides (see 1 and 2 of Table I) were derived from the N-terminal amino acid sequence of PLP-C (spanning amino acids 4-37 of PLP- C; Deb et al., 1991b) according to the procedure of Lathe (1985). The oligonucleotides were synthesized by Genosys Biotechnologies, Inc. (The Woodlands, TX). The 102-base pair oligonucleotide probe was prepared by annealing the two complementary regions of the oligo- nucleotides and filling in the remaining regions with Klenow fragment and [”PIdGTP.

The rat placental cDNA library was screened for PLP-C positive clones according to the procedure described by Benton and Davis (1977). Prehybridization was carried out a t 65 “C for 4 h in 6 x SSC (1 X ssc = 0.15 M NaCI, 0.15 M sodium citrate), 0.5% sodium dodecyl sulfate, and 2 X Denhardt’s solution (1 X = 0.02% each of bovine serum albumin, Ficoll, and polyvinylpyrrolidone; Denhardt, 1966). Hybridizations were carried out overnight in prehybridization solu- tion containing 10 pg/ml heat-denatured Escherichia coli DNA and 1 X lo6 cpm of radiolabeled probe. The filters were washed four times

23027

23028 Prolactin-like Protein C

TABLE I Sequences of oligonucleotides used for screening the rat placental cDNA library

Together these sequences span amino acids 4-37 of the PLP-C protein and were determined according to the method of Lathe (1985). The complementary region is underlined.

5' 3' 1. TGCATGGTGGAGGATGGCGGCTGCTGGGACCCCCTGCGGGAGGCCTTC~CTCTGCCACC 2. ATACAGCTGGTCAGACAGCCGCCGCAGGGTCTCAGCCCGCT~TGGCAGAGTTG~GGC

100 200 300 400 5 0 0 600 700 800

0-l- -m - FIG. 1. Sequencingstrategy and restriction enzyme map for

the PLP-C cDNA. PLP-C clone C-308, containing the entire coding region, was sequenced with the dideoxy chain termination method. The direction and extent of sequencing are indicated by the horizontal arrows. The boxes positioned at the start of each horizontal arrow indicate the location of primers used in the sequencing of the PLP-C cDNA clone. Open boxes represent primers complementary to the T7 and Sp6 promoters, and the black boxes represent primers comple- mentary to the coding sequence of PLP-C. The cDNA is numbered in base pairs, and the restriction enzyme sites are shown as uertical arrows located above the linear cDNA representation. The XbaI, NcoI, and RsaI restriction sites were verified experimentally (data not shown).

for 10 min each a t 30 "C in 6 X SSC and two times for 5 min each in 1 X SSC a t 65 "C. Blots were exposed to Kodak XAR film (Eastman Kodak, Rochester, NY) a t -70 "C using an Optonix x-ray intensifying screen (MCI Optonix Inc., NJ).

Nucleotide Sequence Analysis-Two PLP-C cDNA clones ((2-303 and C-308) were digested with SpeI to isolate the pGEM recombinant plasmids from the XGEM-4 phage vectors. Plasmids containing the PLP-C inserts were religated and propagated in E. coli J M 105. Plasmid DNA purified by centrifugation through CsCl gradient meth- ods (Sambrook et al., 1989) was used for nucleotide sequence analysis. DNA sequencing was performed by the dideoxy chain termination method (Sanger et al., 1977) using oligonucleotide primers comple- mentary to the Sp6 promoter, the 2'7 promoter, and to two internal segments of the PLP-C cDNA (nucleotides 187-207 and 701-719). Sequencing reactions utilized ["SIdATP and were performed with 2'7 sequencing kits. Reaction products were resolved in 6% polyacryl- amide urea gels, fixed in 10% acetic acid, dried, and exposed to Kodak XAR film (Eastman Kodak).

Chromosomal Assignment-The cell hybrids used in this study were derived from the fusion of mouse hepatoma cells (BWTG3) with adult rat hepatocytes and have been described previously (Szpirer et al., 1984). They have lost rat chromosomes and have been used to map several rat genes (for reviews see Levan et al. (1990, 1991)). Chromosome preparations were made as described previously (Szpirer et aL, 1984; Islam and Levan, 1987). DNA was extracted and analyzed by the Southern blot method (Southern, 1975) after blotting to nylon membranes.

Northern Blot Analysis-PLP-C mRNA concentrations in the rat placenta were assessed by Northern blot analysis as previously de- scribed (Soares et al., 1987; Campbell et al., 1989; Faria et al., 1990). Total RNA was isolated by extraction with guanidine isothiocyanate (Puissant and Houdebine, 1990). RNA samples were fractionated by electrophoresis in 1% agarose gels and blotted to nitrocellulose. PLP- C cDNA clone C-308 was used as a template for T7 polymerase- directed synthesis of 32P-labeled cRNA probes. Prehybridization, hybridization, and posthybridization of the filters were carried out as previously described (Soares et al., 1987). After hybridization, filters were washed, dried, and autoradiographed with Kodak XAR film (Eastman Kodak) at -70 "C. Relative changes in the autoradiographs were estimated by transmission densitometry (model 620 video den- sitometer, Bio-Rad).

- 30 - 2 0

AGCGCTCCCCAGTG ATC GAA CTG CCA TTC ACT C M CCT TCC TTC TTT GGC ACA CTC CTG ATG 6 2 Met Glu Leu Ala Leu Ser Gln Pro Scr Phe Phe Gly Thr Leu Leu Met

-10 . 1 1 +1 t .

CTG GTG GTT TCA M C TTC CTC CTG TGC GAG AM GCT GCA TCA A T 1 CCT OCA TCT ATC GTG 1 2 2 Leu Val Val Ser ASn Leu Leu Leu Trp G l u Lys Ala Ala Ser I l e Pro Ala Cys Met Val

1 0 2 0

C A I GAC GGT GCC TGC TGC CAC CCC CTC CCC GAA C C A TTT M C ACT GCT ACC CAC AGA GCT 1 8 2 Glu A s p Gly Gly Cy6 Trp Asp Pro Leu A r g Glu Ala Phe Asn Ser Ala Thr Gln A r p ALII

30 4 0

Glu Thr Leu Arg Asn Leu Ser Asp Gln Leu Tyr Val Clu Phe Phe Gln Asn Gln Phe Ser C M ACC CTC CGT M T CTA TCT GAC CAG TTA TAT GTA GAG TTC TTC CAG M C C M TTC TCA 2 4 2

50 -

M)

TCT AGA CAG TTT GCA GAT CTT ACT TCA C M CTG ATT AGG M G GAC GAG ACT GTT CTC AM 3 0 2 Ser Arg Cln Phe Ale Asp Leu Ser Ser Gln Leu I l e Arg Lys Asp GLu Thr Val Leu Lys

70 80

GCT GGA ACT TAC TGC CAT T U M T CGT GCA AM CCC AM TCT AGC GGA GTA U T ATT GAT 3 4 2 A l a Gly Thr Tyr Cys H i s Ser Asn Arg Ala Lys Pro Lys ser Arg Gly Val Asn I l e Asp

90 1 0 0

ATC GAA GAG TAT TTA A M ATG TCG ATC M T TTT TCT GGG TTC ATC GAT CAG CCT CTA TTC 4 2 2 I l e Clu Clu Tyr Leu Lys Met Ser I l e Asn Phc Cys Gly Phe Met Asp Cln Pro Leu Phe

1 1 0 1 2 0

CAT CTG GTA A T 1 GAA CTG ACT GCC ATG G M GGT GTC CCT GM ACT ATC CTC TCT M A GCT 4 8 2 H i s Leu Val I l e Glu Leu Ser Ala Met Clu Gly Val Pro Clu Thr I l e Leu ser Lys Ala

1 3 0 1 4 0

MAC GAT CTG G M GAG M C M C AGA CM CTT TTG GAT GAC CTT AGG TCG A T 1 CTC ACC M G 5 4 2 Lys Asp Leu Glu Glu Asn Asn Arg Gln Leu Leu Asp Asp Leu Arg Trp I l e Leu Thr Lys

1 5 0 1 6 0

GTC TTC CCT ACA GCA GAG ATA M G GM G M TTT CCC AGC TGG GAC TAT CTT TEA TTC TTA 6 0 2 Val Phe Pro Thr Ala Glu l l e Lys Glu Glu Phe Pro Ser Trp Asp Tyr Leu Ssr Phe Leu

170 180

AM TCA ACT M T AM M T CAT AM TTT TTC GCA I T A T T T M C CTT TCC AGC TGT CTA GAC 6 6 2 Lys Ser SeP Asn Lys Asn His Lys Phe Leu Ala I l e Phe Asn Leu Ser Ser C y s Leu Asp -

1 9 0 2 0 0

TAT GAC ACA CAA GTA CAC TAT ACA TTA TCT CM ATA TTG M C TCT CTC A T 1 ACT CGG AM 7 2 2 Tyr Asp Thr Gln Val H i s Tyr Thr Leu Ser CLn I l e Leu Asn Cys Leu I l e Thr Gly Lys

CAT TGC TAA GTGCACATTTACCGTGTCTCCTTGGGAGATGCTCTM~CAGTTCATTGTAGAGCATTTGCTTTTM 798 Asp Cys

A T T G T A T A T A T T T C M A T C C A T A T G T G G A T A T M T G T A T A G G C T T T A M ~ T ~ T A T T C A G C C G G C A M ~ 880 m

FIG. 2. Nucleotide and amino acid sequences of PLP-C. Translation is assumed to begin at the first ATG (nucleotides 15-17) and continue until the termination codon, TAA (nucleotides 729-

S e i ' and Ile+'. The identity of this site as the cleavage site has been 731). An arrow indicates the signal peptide cleavage site between

determined by N-terminal amino acid sequencing of the purified PLP-C protein (Deb et al., 1991b). Putative glycosylation and poly- adenylation sites are underlined withgray and black bars, respectively.

In Situ Hybridization-The distribution of PLP-C mRNAs was detected in placental tissue sections with techniques previously de- scribed for the detection of PL-I and PL-I1 mRNAs (Faria et al., 1990). The PLP-C cDNA was used as a template for the synthesis of 35S-labeled antisense and sense RNA probes. The RNA probes were derived from the PLP-C '2-308 clone which represents the entire coding sequence of PLP-C.

RESULTS

Isolation and Characterization of PLP-C cDNA Clones-In our initial screening of 100,000 clones of the rat placental

Prolactin-like Protein C 23029

TABLE I1 Correlation between the presence of rat PLP-C sequences and rat chromosomes in mouse-rat somatic cell hybrids

Rat

gene" X 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Hybrids PLP-C

Rat chromosomes*

LB150-I + + - - + + - - + - LB 161

+ (-) + (+) + - - (+) (+) + (+) - + + - + + + + + + - + + - ( - ) + + + + + + + ( + )

LB251 LB330

+ + + + - + - ( + ) + - - + - + + - - - + - + - + + -

LB330TG3 + + + - + - " + - + " " + - "

LB510-6 + + - + - - - - - - - + - - - - - - - -

LB600 + + + - - + " " + + + + + + + - -

LB630 + + + + + + ( + ) + - ( - ) + + + + + + + - + + -

- + ( - ) - + + ( + ) + + - + - + + + ( + ) + + - + + (-) LB780 LB810

+ + - + + + + - + - - + + - + - - - + + - + + + - + + + - + + + - + + + + + + + + - + (+I

LB860 + + - + + + - - + - + - + + + - + + + + - ( + ) LB1040 - + - - + + ( - ) + + - - + + + - - + + - + - + BS511 + + - + + + ( - ) + + + - - + - + - Discordant 4 9 2 4 4 8 7 4 7 7 5 7 6 4 9 7 7 0 8 6 6

+ + + - + -

LB210-I - + - " " " " " - + + - + - + - -

- _ " _ -

clones' ~~~~~~

a + and - = presence or absence of the rat gene, respectively. * + = rat chromosome present in more than 55% of the metaphases; (+) = rat chromosome present in 25-55%

of the metaphases; (-) = rat chromosome present in less than 25% of the metaphases; - = rat chromosome absent. When a chromosome was present in less than 25% of the metaphases (- in parentheses), the hybrid in question

was not taken in account to establish the number of discordancies for that particular chromosome.

PL-I E-I1 PLP-A PLP-B PLPC PRL GH

P L - I 100 47 31 38 33 38 40

PL-II

PLP-A

PLP-B

PLPC

PRL

GH

0 m m m s n a m m m m m

FIG. 3. Amino acid identities and similarities of the rat PRL-GH family. Similar amino acids are lysine and arginine; aspartic acid and glutamic acid; serine and threonine; and valine, leucine, and isoleucine.

cDNA library we identified 300 putative PLP-C clones. Twenty of the most strongly hybridizing clones were selected for secondary and tertiary screening. The cDNA insert sizes were determined by electrophoresis from 10 positive clones. The two longest clones, C-303 and C-308 (each 900 base pairs), were selected for partial sequencing which revealed that both clones contained the entire PLP-C coding region. The sequencing strategy for PLP-C cDNA clone C-308 and its restriction enzyme map are depicted in Fig. 1). XbaI, NcoI, and RsaI restriction sites were verified experimentally (data not shown). Each set of sequencing reactions was replicated at least three times with identical results. Complete nucleotide and predicted amino acid sequences of clone C-308 are shown in Fig. 2. PLP-C clone C-308 contains 880 nucleotides, an open reading frame of 714 nucleotides beginning at nucleotide 15 and continuing until a termination codon which begins at nucleotide 729. The predicted amino acid sequence of the protein encoded by the PLP-C clone is composed of 238 amino acids possessing a molecular weight of 27,232 and contains two potential N-linked glycosylation sites (Bahl and Shah, 1977) located at Asn3' and Asn'" (Fig. 2). PLP-C uses a TAA termination codon similar to that used in rat PRL (Gubbins

et al., 1980), PLP-A (Duckworth et al., 1986b), and PLP-B (Duckworth et al., 1988a). The 3"untranslated region con- tains at least one putative polyadenylation signal sequence (Proudfoot and Brownlee, 1976) at nucleotide positions 849- 860 (Fig. 2).

Comparison of the PLP-C Sequence with Members of the Rat PRL-GH Family-A comparison of the predicted PLP-C amino acid sequence with sequences of other rat PRL-GH family members is shown in Table I1 and Figs. 3 and 4. Structurally PLP-C is more closely related to PRL than GH (Fig. 3). Among the placental PRL-related proteins PLP-C shows the highest sequence homologies with PL-I1 and PLP- B, followed by PLP-A and PL-I (Fig. 3). PLP-C possesses 7 cysteine residues. Positioning of 6 of the PLP-C cysteine residues is conserved in pituitary PRL (Figs. 4 and 5). PLP- C is the only member of the rat placental PRL family that shows conservation of 2 cysteine residues in the N-terminal region. PLP-C has 3 tryptophan residues, one in a location homologous with other members of the PRL family TI-^'^', see Fig. 4).

Chromosomal Assignment of the PLP-C Gene-Chromo- soma1 assignments were based on the segregation of a 9.4- kilobase BamHI fragment. The PLP-C gene was localized to rat chromosome 17 (Table 11). The PLP-C probe did not hybridize with any mouse DNA sequences.

Temporal Pattern of PLP-C mRNA Expression-Northern blot analysis of day 19 placental RNA showed that the PLP- C cRNA probe hybridized to a transcript of approximately 1 kilobase (Figs. 6 and 7). PLP-C mRNA was first detectable between days 13 and 14 of gestation and increased as gestation progressed (Fig. 6).

Cellular Localization of PLP-C mRNA-PLP-C mRNA expression was restricted to the junctional zone of the rat chorioallantoic placenta (Fig. 7). PLP-C RNA was not de- tectable in labyrinth zone tissue at any time during the second half of gestation (data not shown). In situ hybridization analysis showed that PLP-C mRNA was specifically ex- pressed by spongiotrophoblast cells and some trophoblast giant cells of the junctional zone (Fig. 7). Incubation with PLP-C sense RNA probes failed to show any significant hybridization (Fig. 7).

23030

FIG. 4. Alignment of sequences corresponding with members of the rat PRL-GH family. Comparison of the amino acid sequences of members of the rat PRL-GH family. The predicted amino acid sequence of PLP-C is com- pared with amino acid sequences of PL- I (Robertson et al., 1990), PL-I1 (Duck- worth et al., 1986a), PLP-A (Duckworth et al., 1986b), PLP-B (Duckworth et a/., 1988a), PRL (Gubbins et al., 1980), and GH (Barta et al., 1981). Upper case let- ters indicate identity with the PLP-C sequence.

W E ? 80 129

PLP-c

PL-I

PL-I1

PLP-A

PLP-8

PRL

GH

PLP-c

PL-I

PL- I I

PLP-A

PLP-8

PRL

GH

PLP-c

PL-I

PL-I1

PLP-A

PLP-8

PRL

GH

FIG. 5. Schematic comparisons of the rat PRL-GH family. Sites for N-linked glycosylation are shown above each line, and cysteine residues are shown below each line. The presence of homol- ogous cysteine residues is indicated by shading.

DISCUSSION

We have described the isolation and characterization of a cDNA clone for PLP-C. PLP-C is the most abundant PRL- like protein produced by rat trophoblast cells during the latter part of pregnancy (Deb et al., 1991b). The amino acid sequence predicted from sequencing the PLP-C clone (present study) and the N-terminal PLP-C amino acid sequence previously determined by gas-phase sequencing (Deb et al., 1991b) pro- vide considerable insight regarding the structure of synthe- sized and secreted forms of the PLP-C protein. PLP-C is synthesized as a prohormone containing a 30-amino acid hydrophobic signal peptide at its N terminus. The signal peptide is cleaved between Ser" and Ile+' generating a mature 208-amino acid secretory protein. The N-terminal 45 amino acids of the mature protein previously determined by gas phase sequencing (Deb et al., 1991b) were identical to amino acids predicted from the PLP-C clone except for amino acid 31. Gas phase sequencing of the PLP-C protein indicated the presence of an arginine residue whereas the amino acid se- quence deduced from the nucleotide sequence of the PLP- cDNA indicated the presence of an asparagine. This discrep-

11 13 14 16 18 20 Day of Gestatlon

I

/

DAYS OF GESTATION

FIG. 6. Temporal-specific pattern of expression of PLP-C mRNA in the developing rat chorioallantoic placenta. Top panel, representative Northern blots were hybridized with 32P-labeled cRNA PLP-C probe. Seven pg per lane of total RNA isolated from the junctional zone of the chorioallantoic placenta on days 11,13, 14, 16, 18, and 20 of gestation were fractionated by formaldehyde gel electrophoresis and transferred to nitrocellulose. The primary PLP- C transcript migrated at a size of 1 kilobase. Bottom panel, composite representation of relative changes in PLP-C mRNA concentrations from several Northern blot analyses estimated by densitometry. Val- ues are expressed as a percentage of the highest value. Please note that day 14 values were quite variable indicating a significant tran- sition point in the expression of PLP-C mRNA.

ancy may be the result of an error in the gas phase sequencing or the existence of distinct PLP-C alleles.

The amino acid sequence and biochemical characteristics of PLP-C predicted from cDNA analysis are consistent with the inclusion of PLP-C in the PRL-GH family. Comparison of PLP-C with other members of the rat PRL-GH family demonstrates a closer structural relationship to pituitary PRL. Members of the placental PRL-GH family from non-

Prolactin-like Protein C 23031

A B

tissue J L

FIG. 7. Cell-specific pattern of expression of PLP-C mRNA i n t h e day 19 rat chorioallantoic placenta. Top panel, Northern blot analysis of PLP-C mIiNA in the junctional (lane A ) and laby- rinth (lane R ) zones of the chorioallantoic placenta. RNA was frac- tionated by formaldehyde gel electrophoresis (7 pg/lane) and trans- ferred to nitrocellulose before hybridization with the "YP-labeled cRNA PLP-C probe. Note that PLP-C mRNA was restricted to the junctional zone. Bottom panel, PLP-C mRNAs were hybridized in situ for 4 h a t 42 "C with '"S-labeled antisense PLP-C probes, and RNase-resistant hybrids were detected autoradiographically. Control sections were incubated with sense PLP-C probes. All sections were lightly stained with hematoxylin. A and R are identical sections hybridized with an antisense PLP-C probe and photographed under bright and dark fields, respectively; C and D are identical sections hybridized with a sense PLP-C probe and photographed under bright and dark fields, respectively. Note the intense hybridization of PLP- C mRNA in the junctional zone of the section incubated with the PLP-C antisense probe ( R ) and the absence of hybridization in sections incubated with the sense PLP-C probe (D). PLP-C mRNA is specifically localized to spongiotrophoblast cells and some tropho- blast giant cells. Abbreviations: dc, decidua; JZ , junctional zone; LZ, labyrinth zone. Magnification, X 40.

primate species all show a closer structural relationship to pituitary PRL (Duckworth et al., 1988b; Kessler et al., 1989; Ogren and Talamantes, 1988; Colosi et al., 1989). In contrast, members of the human placental PRL-GH family show a greater structural similarity to pituitary GH (Miller and Eber- hardt, 1983).

A core of 4 cysteine residues is similarly positioned in each member of the PRL-GH family (Fig. 5) and is probably the primary factor determining inclusion in the PRL-GH family. Unlike the other five members of the rat placental PRL-GH family, PLP-C possesses two cysteine residues in its N ter- minus located in positions homologous to the N-terminal cysteine residues of pituitary PRL (Fig. 5). PLP-C also con- tains a cysteine residue at position 98 (Fig. 5). PL-I and PLP- A also possess an additional cysteine residue in a similar location (Duckworth et al., 1986b; Robertson et al., 1990) (Fig. 5). Positioning of cysteine residues undoubtedly has impor-

tant structural and functional implications as has been dem- onstrated for mouse PL-I1 (Davis and Linzer, 1989).

PLP-C can be modified by the addition of carbohydrate at two putative N-linked glycosylation sites. PLP-C is princi- pally secreted in two forms: an N-glycanase-sensitive 29-kDa protein possessing affinity for concanavalin A and a 25-kDa protein lacking sensitivity to N-glycanase or affinity for con- canavalin A (Deb et al., 1991b). It remains to be determined whether one or both putative glycosylation sites are involved in the posttranslational generation of 29 kDa PLP-C. The potential for carbohydrate addition seems to be the norm for most members of the placental PRL-GH family in nonprimate species (Colosi et al., 1987; Deb et al., 1989; Deb and Soares, 1990; Deb et al., 1991a, 1991b; Duckworth et al., 1986b, 1988a; Kessler et al., 1989; Linzer et al., 1985; Linzer and Nathans, 1985; Schuler and Hurley, 1987; Schuler et al., 1988; Yamak- awa et al., 1990), the exceptions being rodent PL-11s (Duck- worth et al., 1986a; Jackson et al., 1986; Southard et al., 1989) and ovine P L (Colosi et al., 1989). While the addition of carbohydrate to pituitary PRLs has been shown to modify the lactogenic properties of PRL (Markoff et al., 1988), the influ- ence of glycosylation on the activities of the placental PRL- GH family is unknown.

The biological actions of PLP-C are presently unknown. Although PLP-C does not appear to be a lactogenic hormone,' it may still interact with some members of the prolactin receptor family, with GH receptors, or possibly with unique receptor populations. Alternatively, PLP-C may not resemble a classic hormone but may possess unique biological actions. Elucidation of the biological actions of PLP-C will be assisted by the availability of purified PLP-C protein. The use of the PLP-C cDNA described in this report to generate recombi- nant PLP-C protein should assist in acquiring purified PLP- C preparations for future biological studies.

The PLP-C gene was localized to chromosome 17 of the rat genome. Other members of the PRL gene family, including PRL, PL-11, PLP-A, and PLP-B, have also been localized to rat chromosome 17 (Cooke et al., 1986; Levan et al., 1991). In contrast, GH has been localized to chromosome 10 of the rat genome (Cooke et al., 1986). Rat chromosome 17 has been shown to be a t least partially homologous to mouse chromo- some 13 and human chromosome 6 (Levan et al., 1991). Each of these chromosomes contains members of the PRL gene family (Owerbach et al., 1981; Jackson-Grusby et al., 1988 Levan et al., 1991).

Members of the rat placental PRL-GH family have become useful tools for monitoring the differentiation of trophoblast cells of the rat chorioallantoic placenta. The expression of different members of the PRL-GH family has been shown to reflect the activities of different trophoblast cell types and the activities of trophoblast cells during different phases of gestation (Campbell et al., 1989; Faria et al., 1990; Duckworth et al., 1990; Deb et al., 1991a, 1991b). The rat chorioallantoic placenta is composed of two morphologically and functionally distinct regions, the junctional and labyrinth zones (Soares, 1987). The junctional zone, which borders the uterine decidua, contains two trophoblast cell types (spongiotrophoblast cells and trophoblast giant cells) specifically expressing PLP-C, while trophoblast cells developing in association with fetal mesenchymal and vascular structures in the labyrinth zone are devoid of PLP-C. PLP-C expression is restricted to the 3rd week of gestation in the rat (Deb et al., 1991b; and present study). The cell- and temporal-specific patterns of PLP-C mRNA (present study) and protein (Deb et al., 1991b) expres- sion are identical to those reported for two other members of

' S. Deb and M. J. Soares, unpublished findings.

23032 Prolactin-like Protein C

the placental PRL family, PLP-A and PL-Iv (Campbell et al., 1989; Deb et al., 1991a). The physiological significance of the cell- and temporal-specific patterns of expression of these three PRL-related genes has not been determined.

In summary, we have isolated and characterized a cDNA to a new member of the rat placental PRL-GH family, PLP-C. The PLP-C gene resides on chromosome 17 and is expressed in a cell- and temporal-specific pattern.

Acknowledgments-We gratefully acknowledge Drs. Ok-Kyong Park and Kelly E. Mayo of Northwestern University for their gen- erous gift of the rat placental cDNA library. We also acknowledge Carla Green for her advice and assistance in DNA sequencing and extend our appreciation to James M. Rengel for his assistance with the various computer analyses, Linda Carr for help with the prepa- ration of the manuscript, and Michele Riviere and Douglas Larsen for technical assistance. Additionally, we thank Drs. Daniel Linzer and Peter Colosi for their advice during the initial stages of this project.

REFERENCES

Bahl, 0. P., and Shah, R. G. (1977) in The Glycoconjugates (Horowitz, M. I., and Pigman, W., eds) pp. 385-442, Academic Press, New York

Barta, A., Richards, R. I., Baxter, J. D., and Shine, J . (1981) Proc. Natl. Acad. Sci. U. S. A . 78, 4867-4871

Benton, W . D., and Davis, R. W . (1977) Science 196,180-182 Campbell, W . J., Deb, S., Kwok, S. C. M., Joslin, J. A., and Soares,

Colosi, P., Talamantes, F., and Linzer, D. I. H. (1987) Mol. Endocrinol.

Colosi, P., Thordarson, G., Hellmiss, R., Singh, K., Forsyth, I. A., Gluckman, P., and Wood, W . I. (1989) Mol. Endocrinol. 3, 1462- 1469

Cooke, N. E., Szpirer, C., and Levan, G. (1986) Endocrinology 119,

Davis, J. A., and Linzer, D. I. H. (1989) Mol. Endocrinol. 3,949-953 Deb, S., and Soares, M. J. (1990) Mol. Cell. Endocrinol. 74, 163-172 Deb, S., Youngblood, T., Rawitch, A., and Soares, M. J . (1989) J.

Biol. Chem. 264, 14348-14353 Deb, S., Faria, T. N., Roby, K. F., Larsen, D., Kwok, S. C. M.,

Talamantes, F., and Soares, M. J. (1991a) J . Biol. Chem. 266,

Deb, S., Roby, K. F., Faria, T. N., Larsen, D., and Soares, M. J .

Denhardt, D. T. (1966) Biochem. Biophys. Res. Commun. 23, 641-

Duckworth, M. L., Kirk, K. L., and Friesen, H. G. (1986a) J. Biol.

Duckworth, M. L., Peden, L. M., and Friesen, H. G. (1986b) J. Biol.

Duckworth, M. L., Peden, L. M., and Friesen, H. G. (1988a) Mol.

Duckworth, M. L., Peden, L. M., Schroedter, I. S., Shah, P., and

M. J. (1989) Endocrinology 125, 1565-1574

1,767-776

2451-2454

1605-1610

(1991b) Endocrinology 128, 3066-3072

646

Chem. 261, 10871-10878

Chem. 261,10879-10884

Endocrinol. 2,912-920

Friesen, H. G. (1988b) in Proinctin Gene Family and Its Receptors (Hoshino, K., ed) pp. 79-88, Elsevier Science Publishing Co., Inc., New York

Duckworth, M. L., Schroedter, I. C., and Friesen, H. G. (1990)

Faria, T. N., Deb, S., Kwok, S. C. M., Talamantes, F., and Soares, Placenta 11,143-155

M. J . (1990) Deu. Biol. 141, 279-291 Gubbins, E. J., Maurer, R. A., Lagrimini, M., Erwin, C. R., and

Donelson, J. E. (1980) J. Biol. Chem. 255,8655-8662 Islam, M. Q., and Levan, G. (1987) Hereditas 107, 127-130 Jackson, L. L., Colosi, P., Talamantes, F., and Linzer, D. I. H. (1986)

Proc. Natl. Acad. Sci. U. S. A. 83, 8496-8500 Jackson-Grusby, L. L., Pravtcheva, D., Ruddle, F. H., and Linzer, D.

I. H. (1988) Endocrinology 122,2462-2466 Kessler, M. A., Milosavljevic, M., Zieler, C. G., and Schuler, L. A.

(1989) Biochemistry 28,5154-5161 Lathe, R. (1985) J. Mol. Biol. 183, 1-12 Levan, G., Klinga, K., Szpirer, C., and Szpirer, J. (1990) in Genetic

Maps (O'Brien, S. J., ed) 5th Ed., pp. 480-488, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Levan, G., Szpirer, J., Szpirer, C., Klinga, K., Hanson, C., and Islam, M. Q. (1991) Genomics 10,699-718

Linzer, D. I. H., and Nathans, D. (1985) EMBO J. 4, 1419-1423 Linzer, D. I. H., Lee, S. J., Ogren, L., Talamantes, F., and Nathans,

Markoff, E., Sigel, M. B., Lacour, N., Seavey, B. K., Friesen, H. G.,

Miller, W. L., and Eberhardt, N. L. (1983) Endocr. Reu. 4, 97-130 Ogren, L., and Talamantes, F. (1988) Znt. Reu. Cytol. 112, 1-65 Owerbach, D., Rutter, W . J., Cooke, N. E., Martial, J. A., and Shows,

Park, 0.-K., and Mayo, K. E. (1991) Mol. Endocrinol. 5,967-978 Proudfoot, N. J., and Brownlee, G. G. (1976) Nature 263,211-214 Puissant, C., and Houdebine, L.-M. (1990) BioTechniqes 8, 148-149 Robertson, M. C., Croze, F., Schroedter, I. C., and Friesen, H. G.

(1990) Endocrinology 127, 702-710 Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular

Cloninp: A Laboratory Manual. Cold Spring Harbor Laboratory,

D. (1985) Proc. Natl. Acad. Sci. U. S. A . 82,4356-4359

and Lewis, U. 3. (1988) Endocrinology 123, 1303-1306

T. B. (1981) Science 212,815-816

Cold Siring Harbor, NY

Sci. U. S. A . 74,5463-5467

"

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad.

Schuler, L. A., and Hurley, W . L. (1987) Proc. Natl. Acad. Sci. U. S.

Schuler. L. A.. Shimomura. K.. Kessler. M. A,, Zieler, C. G., and A. 84,5650-5654

Bremel, R. D. (1988) Biochemktry 27,'8443-8448 Soares, M. J. (1987) J. Reprod. Fertil. 79, 335-341 Soares, M. J., Julian, J. A,, and Glasser, S. R. (1985) Deu. Biol. 107,

Soares, M. J., Schaberg, K. D., Pinal, C. S., De, S. K., Bhatia, P., and

Southard, J. N., Do, L., Smith, W . C., and Talamantes, F. (1989)

Southern, E. (1975) J. Mol. B id . 98,503-517 Szpirer, J., Levan, G., Thorn, M., and Szpirer, C. (1984) Cytogenet.

Cell Genet. 38, 142-149 Yamakawa, M., Tanaka, M., Koyama, M., Kagesato, Y., Watahiki,

M., Yamamoto, M., and Nakashima, K. (1990) J. Biol. Chem. 265,

520-526

Andrews, G. K. (1987) Deu. Biol. 124, 134-144

Mol. Endocrinol. 3, 1710-1713

8915-8920