EUKARYOTIC CELL, Apr. 2010, p. 502–513 Vol. 9, No. 41535-9778/10/$12.00 doi:10.1128/EC.00230-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

The NDR Kinase DBF-2 Is Involved in Regulation of Mitosis,Conidial Development, and Glycogen Metabolism

in Neurospora crassa�†Efrat Dvash,1 Galia Kra-Oz,1 Carmit Ziv,1 Shmuel Carmeli,2 and Oded Yarden1*

Department of Plant Pathology and Microbiology, The Robert H. Smith Faculty of Agriculture, Food and Environment,The Hebrew University of Jerusalem, Rehovot 76100,1 and School of Chemistry, Raymond and Beverly Sackler School of

Chemistry and Faculty of Exact Sciences, Tel Aviv University, Ramat Aviv 69978,2 Israel

Received 9 August 2009/Accepted 24 November 2009

Neurospora crassa dbf-2 encodes an NDR (nuclear Dbf2-related) protein kinase, homologous to LATS1, a corecomponent of the Hippo pathway. This pathway plays important roles in restraining cell proliferation andpromoting apoptosis in differentiating cells. Here, we demonstrate that DBF-2 is involved in three fundamentalprocesses in a filamentous fungus: cell cycle regulation, glycogen biosynthesis, and conidiation. DBF-2 ispredominantly localized to the nucleus, and most (approximately 60%) dbf-2 null mutant nuclei are delayed inmitosis, indicating that DBF-2 activity is required for properly completing the cell cycle. The dbf-2 mutantexhibits reduced basal hyphal extension rates accompanied by a carbon/nitrogen ratio-dependent bursting ofhyphal tips, vast glycogen leakage, defects in aerial hypha formation, and impairment of all three asexualconidiation pathways in N. crassa. Our findings also indicate that DBF-2 is essential for sexual reproductionin a filamentous fungus. Defects in other Hippo and glycogen metabolism pathway components (mob-1, ccr-4,mst-1, and gsk-3) share similar phenotypes such as mitotic delay and decreased CDC-2 (cell division cycle 2)protein levels, massive hyphal swellings, hyphal tip bursting, glycogen leakage, and impaired conidiation. Wepropose that DBF-2 functions as a link between Hippo and glycogen metabolism pathways.

The nuclear Dbf2-related (NDR) protein kinases are essen-tial components of signaling networks that control cellularprocesses in various organisms, including morphogenesis, exitfrom mitosis, cytokinesis, proliferation, differentiation, andapoptosis (23). Based on structural and functional conservationover long evolutionary distances, NDR kinases can be ascribedto one of two subgroups. One is comprised of mammalianNDR1/2, and the other is comprised of LATS1/2 (large tumorsuppressor 1/2), as well as their orthologs and related kinasesin different organisms.

The filamentous fungus Neurospora crassa has two NDRkinases, which representative both subgroups. These are en-coded by cot-1 (colonial temperature sensitive 1; NCU07296.3)and dbf-2 (NCU09071.3). While cot-1 (an ortholog of humanNDR1/2) is involved in apical hyphal cell elongation and po-larity (71), the role of dbf-2 (an ortholog of human LATS1/2)is yet unknown. Additionally, significant sequence similarities(52.8%) between the catalytic domains of DBF-2 and COT-1raise the question whether their functions or localizations over-lap. COT-1 has been localized to several intracellular compart-ments, including the cytoplasm and nucleus, and in associationwith the plasma membrane and various proteins (18, 19, 54).The role that COT-1 plays in the formation of branched cel-lular structures as well as its cellular localization has been

suggested to be preserved throughout evolution (54, 77). Sim-ilar conservation may also exist among DBF-2 and its or-thologs, of which human LATS1 and Drosophila melanogasterWTS/LATS are, by far, the most extensively analyzed (13, 45,53, 74, 75).

Both human LATS1 and NDR1 are widely expressed nu-clear serine-threonine kinases that have been implicated in cellproliferation and/or tumor progression. LATS1 has been re-cently established as one of the key members operating at thecore machinery of an emerging conserved signal transductionpathway yet to be elucidated in fungi—the Hippo pathway (13,22, 75). In D. melanogaster as well as in higher eukaryotes, theHippo pathway was found to participate in processes such ascell growth, proliferation, cell cycle, apoptosis, organ sizetumorigenesis, and cell contact inhibition (13, 45, 74). As part ofthis novel mechanism of regulation, DBF2 orthologs act inclose cooperation with other key members of the apparentlyconserved Hippo pathway such as serine/threonine sterile 20(STE20)-like kinases, which have been implicated in the up-stream activation of NDR kinases, and coactivators of theMps-one binder (MOB) family, which have been found toassociate with multiple NDR family kinases at the N terminus(23, 45). This mode of three-way interactions is well illustratedin Drosophila via the activation of the NDR kinase wts/lats bythe STE20-like hippo (hpo) and its association with the coac-tivator mats (mob as a tumor suppressor) (22). Recent studiesshowing parallel interactions between the human homologs ofwts/lats, hpo, and mats stress that this conserved pathway, har-boring DBF2 orthologs, is important in development and is avulnerable target for misregulation in cancer (45, 53).

At least three key members of the Hippo pathway can beidentified in Saccharomyces cerevisiae, based on structural and

* Corresponding author. Mailing address: Department of Plant Pa-thology and Microbiology, The Robert H. Smith Faculty of Agricul-ture, Food and Environment, The Hebrew University of Jerusalem,Rehovot 76100, Israel. Phone: 972-8-9489298. Fax: 972-9-9468785.E-mail: Oded.Yarden@huji.ac.il.

† Supplemental material for this article may be found at http://ec.asm.org/.

� Published ahead of print on 4 December 2009.

502

functional conservation: the NDR kinase DBF2, the coactiva-tor MOB1, and the Ste20-like kinase (CDC15). It was sug-gested that the binding of MOB1 to DBF2 enables CDC15 tophosphorylate DBF2 (35). Apart from its involvement inHippo signaling, previous studies of yeasts also revealed theinvolvement of DBF2 in exit from mitosis and cytokinesis (66).Yeast DBF2 interacts genetically and physically with MOB1,an interaction imperative both for its translocation from thenucleus to the mother-bud neck during cell cycle (16) and forits phosphorylation and activation by CDC15 (35). Consistentwith its late mitotic role, DBF2 protein kinase expressionpeaks after the metaphase-to-anaphase transition (66). Thesecomponents (and others) are part of the mitotic exit network(MEN) and parallel septation initiation network (SIN) de-scribed in budding and fission yeasts, respectively, and whosecounterparts have been identified in filamentous fungi (21, 28).In S. cerevisiae, DBF2 has also been identified as a componentof the CCR4 (carbon catabolite repression 4) transcriptionalcomplex, a general transcriptional regulator which affects ex-pression of numerous genes both positively and negatively(32). In addition, DBF2 disruption in yeasts results in glycogenaccumulation, indicative of the involvement of DBF2 in glyco-gen metabolism (69). DBF2 shares at least one essential func-tion with a homolog, DBF20, as yeasts with either gene deletedare viable but deletion of both genes results in lethality (66).

In contrast to yeasts, filamentous fungi posses a significantnumber of additional, complex, and at times unique cellularprocesses such as hyphal elongation and conidiation, all ofwhich require tight regulation. Thus, it is not surprising that inthe filamentous ascomycete Aspergillus nidulans, the DBF2 or-tholog SIDB has apparently gained additional functions be-yond its conserved role in cell cycle control and cytokinesis.

This is exemplified by its involvement in regulation of asexualreproduction, as disruption of SIDB results in abolishment ofconidiation (26).

In this study, the involvement of the conserved N. crassaHippo pathway component dbf-2 was identified in three fun-damental processes: cell cycle regulation, glycogen biosynthe-sis, and conidiation. Furthermore, by studying the involvementof other genes encoding proteins whose activity is associatedwith dbf-2, we have established a functional link betweenHippo signaling, glycogen metabolism, and conidiation in afilamentous fungus.

MATERIALS AND METHODS

Fungal strains, media, and growth conditions. General procedures and mediaused for growth, preservation, and manipulation of N. crassa were as previouslydescribed (9, 10) or can be obtained through the Fungal Genetic Stock Center(FGSC; www.fgsc.net). The N. crassa strains used in this study (Table 1) weregrown in either liquid or solid (supplemented with 1.5% agar) Vogel’s minimalmedium with 1.5% (wt/vol) sucrose (Vs), unless otherwise stated. The ccr-4,gsk-3, and mst-1 strains were obtained (from the FGSC) as heterokaryons andpurified, by isolation of microconidia, to a homokaryon state. When required, themedium was supplemented with 100 �g/ml hygromycin B (Calbiochem, River-side, CA), 20 �g/ml noursethricin (Werner Bioagents, Jena, Germany), 2.5 �g/mlbenomyl, or 100 �g/ml histidine.

For the carbon/nitrogen (C/N) ratio experiments, glucose and ammoniumnitrate were used as carbon and nitrogen sources, respectively. Briefly, nitrogenlimitation was imposed by a stepwise decrease in the ammonium nitrate concen-tration while the glucose level was kept constant (1.5%) with C/N ratios rangingfrom 0.1 to 10 (wt/wt).

For determining the effect of benomyl on mitotic delay, strains were firstcultured overnight and subsequently transferred to a fresh medium containingthe drug for 4 h prior to DAPI (4�,6-diamidino-2-phenylindole) staining.

Electroporation was performed according to the method of Margolin et al.(38). The transformants were screened by their resistance to either hygromycin

TABLE 1. Neurospora crassa strains used in this study

Strain Relevant genotypea Comment Source or reference

4200 ORS-SL6a Wild type, mat a FGSCb catalog no. 4200ku-70 strain �mus-51::bar�; his-3; mat a FGSC catalog no. 9717rgb-1RIP strain rgb-1RIP::hphr; mat A NCU09377.3 69ppe-1 strain �ppe-1::hphr; mat A NCU03436.3 S. Seiler (Georg-August-University,

Germany)mob-1 strain �mob-1::hphr; mat a NCU01605.3 S. Seiler (Georg-August-University,

Germany)mst-1 strain �mst-1::hphr; �mus-51::bar�; mat a NCU00772.3 FGSC catalog no. 11523ccr-4 strain �ccr-4::hphr; �mus-51::bar�; mat a NCU07779.3 (heterokaryon) FGSC catalog no. 11498gsk-3 strain �gsk-3::hphr; �mus-51::bar�; mat a NCU04185.3 (heterokaryon) FGSC catalog no. 11500dbf-2 strain �dbf-2::hphr; �mus-51::bar�; his-3; mat a NCU09071.3 This studyG10 his-3�::Pdbf-2-dbf-2�-sgfp�; �mus-51::bar�;

mat Adbf-2 (A) pED4 transformant This study

b7_1 Pdbf-2-dbf-2�-sgfp�; natr; �mob-1::hphr; mat a mob-1 (a) pED4 and pBSIIgpdnatr

cotransformantThis study

R54 �ccr-4::hphr; �mus-51::bar�; mat a This studys1_d Pdbf-2-dbf-2�-sgfp�; natr �ccr-4::hphr;

�mus-51::bar; mat aR54 (a) pED4 and pBSIIgpdnatr

cotransformantThis study

r4_6 Pdbf-2-dbf-2�-sgfp�; natr; rgb-1RIP::hphr; mat A rgb-1RIP (A) pED4 and pBSIIgpdnatr

cotransformantThis study

t3_2 Pdbf-2-dbf-2�-sgfp�; natr; �sit-4::hphr; mat A sit-4 (A) pED4 and pBSIIgpdnatr

cotransformantThis study

32 �gsk-3::hphr; �mus-51::bar�; mat a This studyhex-1 strain �hex-1; pan-2�; mat A NCU8332.3 25prk-9 strain prk-9::hphr; �mus-51::bar�; mat A/a NCU04096.3 7

a natr, nourseothricin resistant; hphr, hygromycin resistant.b FGSC, Fungal Genetic Stock Center.

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 503

B or nourseothricin and by phenotypic complementation of his-3 (ability to growwithout histidine supplementation).

Nucleic acid extraction and analysis. Recombinant DNA methods and N.crassa total RNA isolation were performed according to standard protocols (52)and as previously described (76). PCR was performed according to standardprotocols (52), using SuperTerm JMR801 polymerase (JMR Holdings, SaintLouis, MO). Primers used in this study are listed in Table 2. Sequencing wasperformed at the Center for Genomic Technologies, the Hebrew University ofJerusalem, Israel.

For reverse transcription-PCR (RT-PCR), RNA samples were treated withRQ1 RNase-free DNase (Promega, Madison, WI) and then purified with theRNeasy kit (Qiagen) according to the manufacturer’s protocol. Purified RNA (5�g) was used for the RT procedures using SuperScript II RNase H reversetranscriptase (Invitrogen, Carlsbad, CA) according to the manufacturer’s instruc-tions. Relative quantification of gene expression was performed using SYBRgreen real-time RT-PCR on an ABI Prism 5700 sequence detection system(Applied Biosystems, Foster City, CA). RT-PCR mixtures were composed of a12-pmol concentration of each primer, 12.5 �l of SYBR green PCR master mix(Applied Biosystems), 5 �l of cDNA (a 1:100 dilution of the cDNA productproduced as described above), and nuclease-free water to a final volume of 25 �l.Amplification conditions were as follows: 30 min at 48°C, 10 min at 95°C, andthen 40 cycles that consisted of 15 s at 95°C and 1 min at 60°C. Total cDNAabundance in the samples was normalized using the act gene (NCU04173.3),which encodes actin, as a control. In all experiments, samples were amplified intriplicate, and the average cycle threshold was then calculated and used todetermine the relative expression of each gene. Three independent experimentswere carried out in the same manner, and the final average and standard errorof the relative expression values were calculated.

Disruption of dbf-2. Disruption of dbf-2 was performed using the Neurosporagenome project gene knockout kit (obtained from the FGSC) according to themethod of Colot et al. (8). Briefly, the construct for homologous recombinationof NCU09071.3 was provided by the Neurospora knockout project. The cassettewas transformed into the N. crassa ku-70 strain (FGSC catalog no. 9717), whichfacilitates high-frequency gene replacement events of the construct at the targetlocus by preventing nonhomologous recombination due to the disruption of agene encoding a protein required for nonhomologous end joining of double-stranded DNA breaks (40). Several transformants were obtained and screenedfor dbf-2 gene replacement by PCR using primers dbf-2 1247F and dbf-2 2058R(for the dbf-2 open reading frame [ORF]) and HPH565F and HPH1139R (toidentify homologous recombination events) and were verified by Southern blotanalysis. One of the candidate dbf-2 deletion transformants was crossed with anN. crassa wild-type (wt) strain (FGSC catalog no. 4200) to obtain the dbf-2deletion in a wild-type background. Since we were not able to obtain viable dbf-2ascospores, dbf-2 deletion transformants in a ku-70 background were usedthroughout this study, while both ku-70 and wt strains were used as controlstrains.

Determining growth rate. For growth rate measurements, 10 �l of a conidialsuspension (1 � 107 conidia/ml) was inoculated in race tubes (9) containingVogel’s minimal medium. The race tubes were incubated for several days at34°C, and the radial growth was measured twice daily.

DAPI and calcofluor white staining. A DAPI stock solution (14.3 mM) wasprepared by dissolving 5 mg of DAPI in 1 ml of dimethyl formamide (DMF) andstored at �20°C. In order to prepare a DAPI working solution (300 nM), 1 �l ofDAPI stock solution was added to 50 ml of phosphate-buffered saline (PBS; 15mM Na2HPO4, 5 mM NaH2PO4, 32 mM NaCl, pH 7.2). Neurospora cultures, 1to 3 days old, grown in Vs liquid medium were dyed with the DAPI workingsolution and immediately analyzed by fluorescent microscopy. The fluorescentdigital images acquired were used for the quantification of nuclear morphotypesin each strain. The prevalence of elongated nuclei was calculated based on theaverage of three experiments, in which 10 fields were counted for each strain. Forcalcofluor white staining, samples were treated with a solution of 10-�g/mlcalcofluor prior to observation by fluorescent microscopy.

Production of a DBF-2::GFP fusion protein construct. The putative dbf-2(NCU09071.3) promoter and ORF (approximately 4.2 kb) were amplified, with-out the stop codon, as an EcoRV/XbaI fragment (4.2 kb) utilizing primersdbf-2gf13F and dbf-2gf4208R (Table 2) and cloned into a pDrive vector (Qiagen)to yield pED3. The pED3 insert, retrieved by an EcoRV/XbaI double digestion,was ligated with SmaI/XbaI-double-digested pMF267 (a promoterless sgfp plas-mid used for green fluorescent protein [GFP] tagging, targeted to the his-3 locusof N. crassa [15]). This yielded pED4, an expression plasmid used for DBF-2localization and for complementation of the dbf-2 mutation by expressing afull-length N. crassa DBF-2 protein with a C-terminal GFP tag, under theregulation of the dbf-2 promoter. pED4 was linearized by NdeI and transformedinto dbf-2. PCR amplification and sequencing of a pED4 sequence (798 bp)located at the dbf-2 and sgfp ORF intersection, utilizing primers PED4NF3066and PED4NR3864 (Table 2), were used to verify full insertion of the pED4plasmid into dbf-2 transformants exhibiting full complementation of the dbf-2and his-3 mutations.

Glycogen analysis. Iodine vapor staining was conducted based on the work ofWilson et al. (69), with some modifications. Liquid medium used for growth of2-day-old mycelial cultures was filtrated and vacuum concentrated with a Speed-Vac (Savant, Farmingdale, NY). From each sample, a droplet of concentratedmedium was placed at the center of a Whatman filter paper (no. 1). Similarly,mycelium-colonized agar plugs (0.5 cm in diameter) obtained from the expand-ing margins of 4-day-old cultures grown in solid media were first placed at thecenter of a Whatman filter paper and then quickly removed, so that the mycelialstrands were “printed” on the filter paper. The filter papers on which both liquidand solid medium-grown samples had been printed were then sealed with 3 to 4granules of crystalline iodine (BDH Chemicals, Poole, United Kingdom) in50-ml tubes for approximately 5 min and subsequently removed and visualized bylight microscopy.

For glycogen identification by 1H nuclear magnetic resonance (NMR) analysis,hyphal tip cytoplasmic leakages observed at the expanding margins of dbf-2 cellswere collected (utilizing a dissecting microscope) from 50 (5-cm-diameter) petridishes of 3-day-old dbf-2 cultures. After lyophilization, the sample (2.5 mg),dissolved in D2O (0.5 ml), was analyzed on a Bruker Avance 400 spectrometer(operating at 400.17 MHz for 1H), and spectra were compared to those of aglycogen standard (Sigma-Aldrich).

Determining conidial numbers. In order to quantify the abundance of differentconidial types, conidia were harvested from 15-day-old cultures and their totalnumber was determined using a hemocytometer. Arthroconidia were countedseparately based on their distinguishable rectangular shape. The total conidialsuspension was filtrated via a Millipore Durapore Millex-SV 0.5-�m filter forseparation of microconidia (�3 �m [36]), and their number was then deter-mined. The number of macrconidia was calculated by subtracting the number ofarthroconidia and microconidia from the total conidial count. Conidial chainswere counted as a single unit. Two independent experiments were carried out inthe same manner, in which two conidial counts were conducted for each strain.

Western blot analysis. Total protein isolation was conducted based on thework of Gorovits and Yarden (20). Cell lysate protein concentrations werequantified by the Bradford protein assay (5). Western blotting was performed bystandard procedures (52) and based on that previously described by Gorovits andYarden (20). Antibodies used throughout this study included anti-Cdc2 p34(PSTAIRE) sc-53 (rabbit) primary antibody and the goat anti-rabbit peroxidase-coupled secondary antibody (Amersham Biosciences, Freiburg, Germany). Gen-eral protein staining for demonstration of equal loading was performed with theMemcode reversible protein stain kit for nitrocellulose membranes (Pierce,Rockford, IL). Western blot analyses were repeated several times, using proteinextracts from two independent experiments.

TABLE 2. Primers used in this study

Name Sequence Use

dbf-2 1247F TCGCTTCTACATTGCCGAGA PCRdbf-2 2058R TTGCTGCTTCTCATGCACCT PCRdbf-2gf13F TCTAGATGCTGATGTCCTCT

GCCTTGPCR

dbf-2gf4208R GATATCCATCGTACCAAAATTGTTGCTCTC

PCR

PED4NF3066 GTCCTCCTTGAAGTCGATGC PCRPED4NR3864 GCGTAGATGCTAACCAG

CGTAPCR

HPH565F CGGTGTCGTCCATCACAGTT PCRHPH1139R TCGCCCTTCCTCCCTTTATT PCRcdc-2rtF GATACTGCCACAGCCACCGT Real-time

RT-PCRcdc-2rtRN ATGCCTTGAATGCGGGA

TAGGReal-time

RT-PCRactrt575604F TCCATCATGAAGTGCGA

TGTCReal-time

RT-PCRactrt575437R TTCTGCATACGGTCGGA

GAGAReal-time

RT-PCR

504 DVASH ET AL. EUKARYOT. CELL

Microscopy. Light microscopy was performed with a Zeiss Axioscope micro-scope equipped with a Nikon DXM1200F digital camera. Fluorescence micros-copy was performed with two Zeiss filter sets (excitation filter, 365 nm, andemission filter, 420 nm; excitation filter, 395 to 440 nm, and emission filter, 470nm) for visualizing DAPI staining and GFP, as well as calcofluor white, respec-tively.

For scanning electron microscopy (SEM), samples were fixed for 4 h with 5%(vol/vol) glutaraldehyde in 0.1 M phosphate buffer, pH 7.2. The samples werewashed five times with the same buffer and then dehydrated in a series of 25 to100% ethanol washes. The fixed samples were dried for 1 h in a CPD7 50 drier(Bio-Rad) and gold coated in an E5150 Polaron SEM coating system apparatus(Bio-Rad). The samples were observed under a JEOL (Tokyo, Japan) JSM 35microscope.

RESULTS

DBF-2 is required for proper asexual development and sex-ual reproduction in N. crassa. To analyze the role of DBF-2 inN. crassa, a dbf-2 deletion strain was produced using a cassettedesigned for dbf-2 homologous recombination (i.e., harboringthe bacterial hph gene between the 5� and 3� flanking regionsof dbf-2). The ku-70 strain was used to facilitate the homolo-gous recombination (8). However, sexual reproduction wasseverely affected by the loss of dbf-2, as dbf-2 ascospores ob-tained from crosses between the dbf-2 mutant (in a ku-70background) and the wt strain were not viable. Therefore, inorder to obtain homokaryon deletion strains, microconidiaharboring the dbf-2 deletion nuclei were isolated (12). Thedbf-2 deletion strains grew significantly slower than the wild-type and ku-70 control strains. Specifically, when grown on Vsmedium, the dbf-2 deletion strain exhibited reduced basal hy-phal extension rates (17% of the rates of the wt and ku-70control strains), as measured in race tubes, accompanied by adefect in septation (see Fig. S1 in the supplemental material)similar to that observed in the Aspergillus nidulans homologsidB (26). In addition, the dbf-2 strain exhibited severe impair-ment of different stages of asexual reproduction. In particular,reduced aerial hypha formation and a conidial separation de-fect of macroconidia along with overproduction of micro- andarthroconidia were observed (detailed analysis is provided be-low). Overall, the pleiotropic nature of the dbf-2 mutant indi-cates that DBF-2 is a kinase involved in several processes inboth vegetative and sexual developmental growth phases of N.crassa.

DBF-2 is a nuclear protein involved in mitosis. Since in S.cerevisiae DBF2 was shown to be associated with anaphaseand/or telophase progression (16, 65), we examined whetherthe deletion of the kinase would also affect cell cycle progres-sion in N. crassa. Utilizing DAPI staining, we found that whilenuclei in hyphae and conidia of the control strains were round,a distinctive elongated nuclear phenotype was evident in thedbf-2 mutant (Fig. 1). This phenotype resembles that describedby Somers et al. (57), showing that N. crassa telophase isdifferent from similar stages in other organisms, as towardtelophase completion, the daughter nucleus appears elongatedrather than having the regular, round shape regained duringentrance to interphase. In order to provide a quantitative as-sessment of the phenotype observed, the percentage of elon-gated nuclei within the population was determined. This re-vealed a 6-fold-higher ratio of elongated nuclei in the dbf-2mutant than that found in the control strains (Fig. 1). Even

though a majority of the nuclei were delayed in mitosis, hyphalgrowth (albeit slower) was still maintained.

Cellular localization of DBF-2 was determined by follow-ing the expression of a DBF-2::GFP fusion protein, ex-pressed under the control of its natural (dbf-2) promoter.The G10 strain (Table 1), a dbf-2 mutant transformant ex-pressing the DBF-2::GFP chimera, exhibited full phenotypiccomplementation of the dbf-2 mutant, indicative of properactivity of the fusion protein. Thus, the G10 strain exhibitednormal hyphal morphology and growth rates, produced aerialhyphae, and conidiated in a manner indistinguishable fromthat of the wild type. Furthermore, no cytoplasmic leakagefoci, characteristic of the parental strain (see below) wereobserved. Fluorescence microscopy of the G10 strain revealedthat, in N. crassa, DBF-2 localizes to the nucleus (Fig. 1), withno evidence (at the resolution and fluorescent intensity used)for its presence in the cytoplasm.

Defects in DBF-2 function affect glycogen metabolism.When cells were grown on either solid or liquid Vs medium,significant cytoplasmic leakage foci from hyphal tips were ob-served in cultures of dbf-2 mutants (Fig. 2A and B). As DBF2was listed in a report on a systematic approach to identifyinggenes affecting glycogen storage in S. cerevisiae (69), we sus-

FIG. 1. Mitosis is impaired in the dbf-2 mutant. In contrast to theround nuclear morphology in the wt and ku-70 control strains, thedbf-2 mutant nuclei are elongated, as determined by DAPI staining ofhyphae (top panels). Round nuclei are also observed in conidia of thewt (middle panels; fluorescence and fluorescence with bright field,respectively), whereas nuclei in constricted proconidial chains of thedbf-2 strain are elongated. Scale bars represent 50 �m (wt and dbf-2strains), 25 �m (ku-70 strain), and 10 �m (middle panels). The prev-alence of elongated nuclei in the different strains is shown (bottom leftpanel). Data shown are based on the averages of three experiments, inwhich nuclei in 10 fields (of each strain) were counted. Bars indicatestandard errors. DBF-2::GFP expressed in the nucleus of a pED4 dbf-2transformant (G10) fully complements the dbf-2 mutant phenotype(bottom right panel).

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 505

pected that the phenotype observed at the hyphal tips of thedbf-2 strain may result from glycogen accumulation, eventhough no glycogen leakage has been associated with S. cerevi-siae dbf2 mutants. This possibility was supported by resultsobtained following the exposure of cultures to iodine vapor,where staining (indicative of the presence of glycogen) wasfound to be markedly more intense in the dbf-2 mutant than inthe wt (Fig. 2B). The identity of the polymer leaking fromthe dbf-2 mutant was further confirmed by 1H NMR analysisof the droplet material collected from growing hyphal tips, asthe sample presented signals at �H 5.27 (broad singlet, 1H) and�H 3.00 to 4.00 (m, 6H), identical in all respects with theglycogen standard (Fig. 2C). Results of this analysis confirmedthat the major substance within the droplets was, in fact, gly-cogen and established the fact that dbf-2 is involved in glycogenmetabolism in a filamentous fungus.

Given that reserve carbohydrate metabolism can be affectedby the carbon/nitrogen (C/N) ratio in the medium (31), wecultured the dbf-2 strain on media with different C/N ratios.The sizes and localizations of glycogen leakages from dbf-2mutant hyphae showed a clear correlation with variations inthe C/N ratio. During growth on a high (10)-C/N-ratio medium(for comparison, Vs has a C/N ratio of approximately 11), thedroplets observed were large and located mainly at hyphal tips(Fig. 3). When cells were cultured on media with decreasingC/N ratios, the size of the droplets was reduced and the loca-tion of leakage foci shifted to subapical regions of the hyphalextension fronts. A complete block in leakage was observed ata C/N ratio of 0.1. The observed phenotypic suppression of the

glycogen leakage by alteration of C/N ratios is indicative of aregulatory link between dbf-2, glycogen metabolism, and envi-ronmental sensing.

To date, the function of DBF-2 in signal transduction path-ways regulating glycogen metabolism has not been character-ized. Moreover, as it is a Hippo pathway component, the in-volvement of DBF-2 in glycogen metabolism implies afunctional link between Hippo signaling and glycogen metab-olism pathways. In order to further elucidate this possibility,we analyzed mutants of several genes (Table 1): mst-1 (a ster-ile-20-related kinase), mob-1 (Mps one binder), ccr-4 (carboncatabolite repression 4), and gsk-3 (glycogen synthase kinase3), whose orthologs in different organisms have been shown tobe involved in either Hippo signaling (mst-1 and mob-1) orglycogen biosynthesis (gsk-3 and ccr-4) pathways through in-teraction with DBF-2 orthologs (see the Discussion). This in-cluded, for the first time, a comparative morphological char-acterization of knockout mutants of these genes and of thedbf-2 mutant. We found that, with significant resemblance tothe dbf-2 mutant, three noticeable defects were displayed bythe strains harboring the mentioned mutations: cytoplasmicleakage, massive hyphal swellings, and hyphal tip bursting (Fig.4). In addition, the mob-1 mutant also displayed a defect inseptation (see Fig. S1 in the supplemental material). It wasnotable that the phenotypic severity ranged between the dif-ferent mutants, as large cytoplasmic leakages (approximately400 �m in diameter) were observed in the dbf-2 and mob-1mutants while smaller ones (approximately 100 �m in diame-ter) were observed in the mst-1, gsk-3, and ccr-4 mutants. Thestriking similarities between the different phenotypic effectscaused by disruption of these genes strongly indicate that themutants share defects in a common pathway.

Altered conidiation in strains harboring defects in dbf-2 andglycogen pathway components. Aerial hypha formation is theinitial step in macroconidial development (11, 60, 61). As thedbf-2 mutant does not produce proper aerial hyphae, we ex-amined if defects in other Hippo and glycogen pathway com-ponents also confer similar morphological consequences. Ourresults show that in mutant strains lacking mst-1, mob-1, orccr-4, reduced aerial hypha formation was evident (Fig. 5). Theccr-4 mutant, in particular, showed the most prominent resem-blance to the dbf-2 mutant, with a fully arrested aerial hyphaformation defect.

The involvement of Hippo and glycogen pathway compo-nents in asexual conidiation in N. crassa was further estab-

FIG. 2. The dbf-2 mutant is characterized by massive glycogen leak-age. (A) Intact hyphal cells are characteristic of wt growth on standardmedia, while growth of the dbf-2 strain either on solid or in liquidmedia (middle and right panels, respectively) is accompanied by largecytoplasmic leakage foci at the hyphal tips (arrows). (B) Minimaliodine vapor staining is observed in the wt whereas intense iodinevapor staining is observed in the dbf-2 mutant grown in liquid (upperpanel) or on solid (lower panel) media. Arrows indicate iodine vaporstaining of leakage foci from hyphal tips of the dbf-2 strain. Imageswere obtained by light microscopy. (C) The predominant content ofthe cytoplasmic leakage is glycogen, as determined by 1H NMR anal-ysis of the droplet material collected from growing dbf-2 mutant hyphaltips, compared with a glycogen standard (upper and lower spectra,respectively).

FIG. 3. The extent of glycogen leakage in the dbf-2 strain is depen-dent on the carbon/nitrogen (C/N) ratio in the growth medium. Thestrain was cultured on minimal glucose (1.5%) medium with variousconcentrations of NH4NO3. Arrows mark the locations of glycogendroplets.

506 DVASH ET AL. EUKARYOT. CELL

lished by performing scanning electron microscopy analysis ofthe different mutants, at late stages of asexual development. AsN. crassa produces three types of asexual conidia (61), wewanted to determine whether any or all of these pathways wereaffected. The qualitative morphological analysis was accompa-nied by quantification of the abundance of each conidial typeproduced by the individual mutants. In the different mutantsharboring defects in the Hippo and glycogen pathways, themacroconidiation pathway is blocked prior to the formation of

minor constrictions, resulting in conidiophore structures ar-rested at an immature stage. These results correlate well witha major decrease (up to 90%) in macroconidial abundance,which is due to the conidial separation defect (conidial chainswere counted as single reproductive units). In contrast, micro-conidiation and arthroconidiation pathways were markedly up-regulated, possibly as a bypass of the arrest in macroconidia-tion. This was expressed by a significant increase (orders ofmagnitude) in the percentage of microconidia produced as wellas a higher percentage (3- to 5-fold) of arthroconidia in com-parison to the control strains, in which almost no microconidiawere formed and arthroconidia were only about 0.5% of thetotal conidia produced (Fig. 6).

Mitotic delay typifies defects in dbf-2 and glycogen pathwaycomponents in N. crassa. As the morphological defects in thedifferent dbf-2 and glycogen metabolism pathway mutantshighly resembled those observed in the dbf-2 mutant, we ex-amined if the defects imposed also include impairment of cellcycle progression. DAPI staining of nuclei revealed that, with

FIG. 4. Defects in the putative N. crassa dbf-2 (Hippo) and glycogen metabolism pathway components share common morphological conse-quences. Typically, all the genetic defects are accompanied by hyphal swelling, bursting of hyphal tips (arrows in the center column), andcytoplasmic leakage (arrows in the right column).

FIG. 5. Various dbf-2 (Hippo) and glycogen metabolism pathwaymutants exhibit altered aerial hypha production (as evident from thepresence of fungal biomass on flask walls). All strains were photo-graphed 2 weeks after inoculation.

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 507

remarkable similarity to the dbf-2 strain, the mutants analyzed(mst-1, ccr-4, gsk-3, and mob-1) exhibited a significantly highernumber of intensively stained elongated nuclei (indicative ofmitotic delay) than that found in the control strains (Fig. 7).Specifically, the dbf-2 and ccr-4 mutants showed the highestpercentage of elongated nuclei within the nuclear population(6-fold higher than the control strains), followed by mob-1 andgsk-3 (5- and 4-fold higher than the control strains, respec-tively) (Fig. 7). In order to verify that the common phenotypicfeature of these mutants is, in fact, a delay in cell cycle pro-gression, we determined the effect of benomyl, a beta-tubulindepolymerizing agent, on the elongated nuclei (49). In allcases, the use of a sublethal concentration of the drug (2.5�g/ml) resulted in the alleviation of the high abundance ofelongated nuclei, indicative of a true defect in the mitotic cycle(see Fig. S2 in the supplemental material).

Altered cdc-2 expression in mutants impaired in dbf-2 andglycogen pathway components. Biochemical and genetic anal-yses have shown that the human Hippo pathway componentDBF2 homolog, LATS1, negatively regulates CDC2 (cell divi-sion cycle 2), probably by physical interaction (63). It is alsoknown that inhibition of CDC2 triggers a phosphorylation-dephosphorylation cascade regulating glycogen metabolismthrough activation of glycogen synthase kinase 3 (GSK3), aknown inhibitor of glycogen biosynthesis (29, 39, 63). On thebasis of these findings, we assumed that CDC2 expressionwould be affected by defects in different components of thedbf-2 (Hippo) and glycogen metabolism pathways in N. crassa.When probed with anti-CDC2 (34-kDa) antibodies, a signifi-

FIG. 6. Conidial production patterns in the dbf-2 mutant resemble those of other Hippo and glycogen metabolism pathway componentmutants. The abundances of macroconidia (top panel), microconidia (middle panel), and arthroconidia (bottom panel) were determined instrains with mutations in genes involved in dbf-2 (Hippo) and glycogen signaling. While typical conidial separation can be observed in thewt strain, the process is impaired in the dbf-2 mutant (top panel). Microconidia are produced in abundance in the dbf-2 mutant and are attimes engulfed by curling hyphae (middle panel). Typical production of arthroconidia in the wt strain is markedly lower than that observedin the dbf-2 mutant (bottom panel). Comparative quantification of the abundance of different conidial types is presented on the right sideof each row.

FIG. 7. Impaired mitosis accompanies defects in dbf-2 (Hippo) andglycogen pathway components. (A) Elongated nuclei (as visualized byDAPI staining) can be observed in the mst-1, ccr-4, mob-1, and gsk-3strains. (B) Comparative quantification of the percentage of elongatednuclei in strains defective in putative components of N. crassa dbf-2(Hippo) and glycogen metabolism pathways in comparison to the wtand ku-70 control strains. Bars indicate standard errors.

508 DVASH ET AL. EUKARYOT. CELL

cant decrease in CDC-2 protein levels could be observed inthe different mutants, with the exception of gsk-3 (Fig. 8). Themost striking decrease in CDC-2 levels was detected in thedbf-2, ccr-4, and mob-1 mutants. In most of the strains ana-lyzed, two protein bands, approximately 1 kDa apart, wereevident, suggesting that the antibodies used may have detectedboth the phosphorylated (35-kDa) and the unphosphorylated(34-kDa) forms of CDC-2 in the fungal protein extract. If thisis the case, it is possible that the putative phosphorylationpattern may be altered in the ccr-4 mutant, which exhibitedonly the upper, 35-kDa band.

The decrease in CDC-2 protein levels could be attributed todownregulation of cdc-2 transcription or, alternatively, to re-duced protein stability. In order to examine whether cdc-2transcription is decreased in the different mutants, real-timeRT-PCR analysis was performed (utilizing primers cdc-2rtFand cdc-2rtRN and primers actrt575604F and actrt575473R[Table 2; Fig. 8C]). In contrast to the expected downregulationof cdc-2 transcript levels (which would explain the reduction inCDC-2 protein levels), no significant differences in cdc-2 tran-script levels in dbf-2, mst-1, and gsk-3 mutants were observed.Moreover, 3- and 1.5-fold-higher cdc-2 transcription levelswere observed in the ccr-4 and the mob-1 mutants, respectively.Thus, it is conceivable that the decrease in CDC-2 proteinlevels observed in the Hippo/glycogen pathway mutants is aconsequence of reduced protein stability.

ccr-4 and rgb-1 are required for proper cellular localizationof DBF-2. The association of DBF2 with MOB1 and with

CCR4 has been previously reported (23, 32). The fact thatMOB1 has been shown to localize to the nucleus and theobservation that CCR4 is cytoplasmic suggest that not all as-sociations of the two proteins with DBF2 are simultaneous andthat such associations may be involved in, or required for,proper localization of the kinase (16, 62, 64). Other proteinsthat may influence DBF2 localization are protein phosphatase2A (PP2A) and sporulation-induced transcribed sequence(SIT4, a PP2A-related protein), as human PP2A inhibitsLATS1 through inhibition of MST2 (STE20 homolog) andSIT4 is known to suppress the DBF2 mutation in yeasts (42,46). In order to determine whether a deficiency of these pro-teins results in the altering of DBF-2’s nuclear localization inN. crassa, the fused DBF-2::GFP protein was expressed in theccr-4, mob-1, rgb-1RIP (in which a PP2A B regulatory subunitwas inactivated by repeat-induced point mutations [72]), andppe-1 (the N. crassa SIT4 homolog) mutants. No significantmislocalization of DBF-2 could be observed in the mob-1 andppe-1 strains, where the protein was found to predominantlylocalize to the nucleus. However, in the ccr-4 and rgb-1RIP

mutants, we observed a marked increase in cytoplasmic levelsof DBF-2::GFP and its accumulation in large cytoplasmic or-ganelles (Fig. 9). These findings link the intracellular localiza-tion of DBF-2 with CCR-4 as well as PP2A while at the sametime demonstrating that MOB-1, though known to physicallyinteract with DBF-2 (34), is not required for its nuclear local-ization. The differential localization of DBF-2 in the variousmutants is an important initial step in determining the mech-anistic nature of DBF-2 protein complex members.

DISCUSSION

In this study, we disrupted the N. crassa dbf-2 gene andstudied the consequences of its inactivation. It was not surpris-ing to identify, in addition to the conserved roles of dbf-2, novel(effect on sexual reproduction and dependency on ccr-4 andrgb-1 for localization), unique (involvement in three conidia-tion pathways), or altered (differential effect on CDC-2) func-tions of this kinase in N. crassa, as protein kinases have beenshown to selectively adapt roles in different organisms (2).

DBF-2 is involved in multiple cellular functions in N. crassa.Inactivation of dbf-2 in N. crassa results in a pleiotropic effect,and yet the mutant is viable. This is in contrast to the lethalconsequence of inactivating both DBF2 and DBF20 in S. cer-evisiae, indicating that in the filamentous fungus at least some

FIG. 8. Altered cdc-2 expression in various mutants harboring de-fects in (dbf-2) Hippo and glycogen pathways. (A and B) Decreasedcdc-2-encoded protein levels (detected at 34 and 35 kDa) in dbf-2,ccr-4, mob-1, and mst-1 mutants, compared to the wt and ku-70 controlstrains, as determined by Western blot analysis (A). A general proteinstain demonstrating equal loading is shown as well (B). (C) Changes incdc-2 expression in different mutants impaired in dbf-2 and glycogenpathway components as determined by real-time RT-PCR. Thequantity of cdc-2 cDNA measured was normalized to that of actincDNA, in extracts from each mutant. Data shown are the averageexpression levels based on three experiments. Bars indicate stan-dard errors. The abundance of cDNA from the wt strain sampleswas assigned a value of 1.

FIG. 9. Abnormal localization of DBF-2::GFP expressed in themob-1, ppe-1, ccr-4, and rgb-1RIP strains (but not in the mob-1 or ppe-1mutant) as determined by fluorescent microscopy. Accumulation ofDBF-2 in the cytoplasm and in large cytoplasmic organelles is markedby arrows. For normal localization of DBF-2::GFP, see the G10 panelin Fig. 1.

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 509

functions of the protein are redundant. This is in line withprevious observations pointing out the presence of differencesin gene/protein function between yeasts and filamentous fungi(3, 17).

The lack of dbf-2 had a clear effect on hyphal growth, asevident from the fact that dbf-2 deletion strains exhibit reducedbasal hyphal extension rates. The involvement of DBF-2 in thisprocess may be a novel function gained in the course of evo-lution from yeasts, as additional inputs are likely to be requiredto modulate the complexity of filamentous growth. In agree-ment with our findings, mutants with mutations of the A. nidu-lans DBF2 homolog sidB have been reported to produce fluffycolonies which are significantly smaller than those of the wildtype (26). The role of DBF2 in cellular growth has also beendemonstrated in higher eukaryotes, as Lats1�/� mice exhibitedsignificant growth retardation (70).

The dbf-2 strain exhibited reduced aerial hypha formation,and subsequently, macroconidiation was reduced. Other N.crassa mutants that exhibit defects in blastoconidiation whichare accompanied by increased arthroconidium production in-clude rgb-1RIP (72) and frost (which encodes a homolog of theyeast cdc1 gene [58]) mutants. In A. nidulans, sidB mutants failto produce conidia altogether (26). Thus, even though bothdbf-2 and sidB belong to the septation initiation network (forexample, on the basis of septation defects; see Fig. S1 in thesupplemental material), the roles of dbf-2 and sidB differ sig-nificantly, as our results clearly indicate that the involvement ofDBF-2 in N. crassa conidiation occurs after commitment to thisdevelopmental process, in contrast to A. nidulans, whereconidiation is blocked prior to initiation. This may well belinked to the divergent modes of A. nidulans and N. crassaconidiation (1), including the presence of multiple conidiationpathways in the latter. The crucial role of septation in growthand development is further emphasized by the fact that thedbf-2 mutant and the mob-1 mutant, both of which exhibitimpaired septation, tend to accumulate suppressors in whichseptation is resumed. The nature of these suppressors has yetto be determined.

Our findings also indicate, for the first time, that DBF-2 isessential for sexual reproduction in a filamentous fungus. In-terestingly, mice lacking the dbf-2 homolog (Lats1�/�) alsoshowed infertility (70). How DBF-2 may affect the function ofN. crassa mating type loci and interacting genes/gene productshas yet to be elucidated. The fact that CDC15 (a DBF2-inter-acting protein in S. cerevisiae) is required for meiosis II exit, aswell as for spore morphogenesis (44), suggests that DBF2 maybe linked with sexual reproduction in yeasts as well.

We found that, in N. crassa, DBF-2 is predominantly local-ized in the nucleus, as has been shown in other organisms (41,59, 66, 68, 73). Taking into consideration the role that DBF2homologs have been shown to play in cell cycle progression (4,62, 65–68), this is expected. Based on the elongated phenotypeof the nuclei observed in this study, along with the effect ofbenomyl on nuclear morphology in the mutants, we concludedthat in N. crassa, impairment of DBF-2 confers a block incell cycle progression, as has been shown in other systems.Stretched/broken nuclear morphology has been observed inthe N. crassa rho-4 (encoding a monomeric GTPase) mutant,which also exhibits septation defects and cytoplasmic leakage(50, 51). However, in addition to the morphological differences

between rho-4 mutant nuclei and those observed in the dbf-2/glycogen pathway mutants, in the rho-4 mutant the alterednuclear morphology was accompanied by a variance in nucleardistribution along the hyphal cell which was attributed to ab-errant actin and microtubule cytoskeleton assembly shown tooccur in that mutant (51). The fact that we did not observefragmented nuclei in the mutants studied here and that thebenomyl treatment did not affect nuclear positioning is indic-ative that the elongated nuclear morphology was not due to ageneral defect in microtubule dynamics in these mutants.

In humans, defects in LATS1 affect cell cycle progression aswell, and yet this effect is not limited to a single specific stage(e.g., early prophase or early anaphase [63]). Taken together, itis clear that DBF2 has a role in cell cycle progression in avariety of organisms. Nonetheless, this is another example offunctional deviation of this kinase across evolution. It is tempt-ing to speculate that the presence of cytoplasmic continuity inthe filamentous fungi may contribute to the higher uniformityof the effect that DBF2 has on the nuclear population in agiven fungus. Even though a significant accumulation of nucleidelayed in mitosis was observed in the dbf-2 mutant, hyphalgrowth was only partially impaired. As not all nuclei appearedelongated, it is conceivable that an additional protein(s), yet tobe identified, can enable progression (albeit partial or slower)through mitosis, parallel to DBF-2.

DBF-2 is involved in glycogen metabolism. The dbf-2 mutantexhibited a C/N-ratio-dependent bursting of hyphal tips andvast cytoplasm leakage (Fig. 3). The cytoplasmic exudate wasidentified as glycogen, establishing a new role of DBF-2 innegative regulation of glycogen metabolism in N. crassa. Asreserve carbohydrate metabolism can be affected by the C/Nratio in the medium (14, 31, 47), we propose that decreasingC/N ratios results in a dramatic reduction in glycogen accumu-lation and thus prevents the hyphal tip leakage phenomenonobserved during growth of the dbf-2 mutant. The C/N-ratio-dependent bursting of hyphal tips and glycogen-rich exudatesare typical of the dbf-2 strain and were not observed in anadditional mutant (the hex-1 mutant [25]) exhibiting septationdefects accompanied by cytoplasmic leakage, suggesting thatthis is not an effect common to all mutants exhibiting thementioned phenotype. In yeasts, DBF2 has been shown to berequired for the phosphorylation of the A and B subunits(Vma1p and Vma2pa, respectively) of the vacuolar H�-ATPase (37). As this ATPase has been suggested to affectglycogen degradation (69), the hyperaccumulation of glycogenthat we have observed can perhaps be attributed to both theeffect of DBF-2 on the glycogen synthesis pathway (see below)and its effect on glycogen degradation.

Mutants with defects in dbf-2 and glycogen metabolismpathway components share similar phenotypes. In order tostudy the potential functional link between dbf-2 and glycogenmetabolism, with an emphasis on the possibility of interactionsbetween the tentative Neurospora Hippo and glycogen metab-olism pathways, we analyzed mutants defective in several genes(mst-1 [a sterile-20-like kinase], mob-1 [Mps one binder], ccr-4,and gsk-3 [glycogen synthase kinase 3]) whose orthologs belongto the mentioned pathways. We found that, similarly to thedbf-2 strain, these mutants also display defects such as mitoticdelay and decreased CDC-2 protein levels, massive hyphalswellings, hyphal tip bursting, glycogen leakage, and impaired

510 DVASH ET AL. EUKARYOT. CELL

conidiation. Even though mst-1 shows the highest structuralsimilarity to the human Mst2 (shown to be the upstream acti-vator of Lats1), N. crassa harbors an additional STE20-relatedkinase-encoding gene—prk-9 (NCU04096) (8)], which showshigh structural similarity to the Schizosaccharomyces pombeSIN component sid1. The phenotypic defects observed in theprk-9 deletion strain also resemble those observed in the dbf-2and glycogen pathway mutants (even though it appears that thepresence of elongated nuclei in the mst-1 mutant exceeds thatfound in the prk-9 mutant, in a manner more resembling thatseen in the dbf-2 mutant). Thus, the possibility that prk-9 mayalso feed into the mentioned pathways or even have functionsoverlapping with those of mst-1 should not be excluded. Ourobservations are supported by previous reports which havestudied some of these components separately. For example,the fact that MOB1 and DBF2 can physically associate is welldocumented in Drosophila (27) and, recently, in N. crassa aswell (34). The similar overlap in some of the phenotypic de-fects (including the typical SIN defect [see Fig. S1 in the sup-plemental material]) can thus be explained by the lack of oneof the complex components. A similar argument can be madefor CCR4, which has also been shown to complex with DBF2(32). As both DBF2 and MOB1 have been shown to be regu-lated by STE20 (33, 48), the absence of this upstream compo-nent may well result in the lack of active DBF2/MOB1 andDBF2/CCR4 complexes.

On the basis of the reduction in CDC-2 levels in the dbf-2,ccr-4, and mob-1 mutant strains, we propose that DBF-2 maynegatively regulate CDC-2 activity. This possibility can be de-rived on the basis of different reports concerning LATS1which, once integrated, imply that a signal transduction path-way involving LATS1, CDC2, and PP1 (protein phosphatase 1)operates in cell cycle regulation and also, with the involvementof GSK3 (a glycogen synthase kinase), in glycogen biosynthe-sis in human cells (29, 39, 63).

In accordance with the described dependence of variouscellular functions on DBF2, MOB1, and CCR4 (known tointeract with each other or with other CCR4 transcriptionalcomplex components [27]), the similarities in phenotypic con-sequences which are a result of impaired function of down-stream components should be expected. This includes hyphalswelling, bursting, and glycogen leakage, which have been ob-served in all the Hippo/glycogen pathway components exam-ined here (the most prominent being in the dbf-2, mob-1, andccr-4 mutants). We suggest that due to impaired Hippo path-way signaling, the hyphae undergo glycogen hyperaccumula-tion which consequently causes the observed swelling andeventual bursting of hyphae. The different mutants also exhib-ited mitotic delay, implying a connection between glycogenaccumulation and cell cycle progression. In yeast cells glycogenaccumulated during G1 is metabolized at the bud emergencephase (43, 55). Thus, it is possible that due to the mitotic delayobserved in the different N. crassa mutants, the cells continueto accumulate glycogen (a process initiated in G1). Stoppingglycogen accumulation may depend on exit from mitosis.

One of the unique developmental attributes that can now beassociated with both Hippo and glycogen metabolism pathwaysis asexual sporulation. In all the mutants analyzed, conidiationwas significantly affected. However, the consequences of inac-tivation of the different genes were not uniform. The most

striking deviation was in the ccr-4 mutant, where in contrast tothe other mutants, the microconidiation pathway was not up-regulated. One explanation for this is that microconidiation isa process regulated by a complex requiring only DBF-2 andMOB-1 (rather than a complex which includes CCR-4 as well).

DBF-2 as a link between Hippo and glycogen metabolismpathways. To date, a functional link between the Hippo path-way and glycogen metabolism has not been proposed. On thebasis of our results, along with those previously described, wesuggest that at least some of the functions of the Hippo andglycogen biosynthesis pathways are coordinated.

It appears that the two pathways share a core factor—DBF2.This protein can associate with both Hippo pathway compo-nents (e.g., MOB1 and STE20 [6, 27, 34]), while it has alsobeen shown to associate with CCR4, which is also involved inglycogen metabolism (via a transcriptional activator interme-diate, identified in yeasts as MSN2/4 [30, 56]), or, possibly, byinhibition of CDC2, as implied by our results (Fig. 8). Thestriking similarities between the multiple phenotypic effectscaused by disruption of these genes strongly suggest that theybelong to common pathways. Further support for the interac-tions among at least some of the mentioned gene products wasobtained by analyzing the effects of various mutant back-grounds on DBF-2 localization. The fact that DBF-2::GFP wasimproperly localized in the ccr-4 and rgb-1RIP (yet not inmob-1) mutants not only supports the functional link betweensome of these pathway components but also establishes, for thefirst time, a dependency of DBF-2 localization, in N. crassa, onCCR-4 and PP2A (protein phosphatase 2A; see below). InDrosophila CCR4 is mainly cytoplasmic (64). It is possible thatsmall amounts of CCR-4 also function in the cytoplasm in N.crassa. If this be the case, the increased presence of DBF-2::GFPin the cytoplasm of the ccr-4 mutant can be explained as a meansto compensate for the lack of a fungal cytoplasmic DBF2/CCR4complex. The accumulation of DBF-2::GFP in large cytoplasmicorganelles (Fig. 9) may serve to regulate the excess of DBF-2 inthe cytoplasm.

The linking of these pathways can be based on the presenceof an upstream activator—a member of the STE20 kinasefamily. Based on our results, MST-1 is a positive regulator ofDBF-2 function and a negative regulator of glycogen biosyn-thesis. Other upstream elements include PP2A, which is anegative regulator of the human STE20 ortholog (42). It islikely that PP2A (and specifically the B regulatory subunitencoded by rgb-1) functions in a similar manner in N. crassa, aswe have observed an increase in cytoplasmic DBF-2::GFP inthe rgb-1RIP strain. The specificity of this interaction is sup-ported by the fact that a defect in a structurally relatedphosphatase (ppe-1) did not result in mislocalization ofDBF-2::GFP. The fact that a reduction in PP2A activity hasbeen shown to correlate with a reduction in glycogen synthesis(7, 24) further supports the dbf-2 (Hippo) and glycogen me-tabolism pathway link. The presence of gsk-3, a major compo-nent of the glycogen synthesis pathway, downstream of DBF-2has been established here, on the basis of the phenotypic con-sequences of its inactivation. We propose that its DBF-2-reg-ulated function is conferred via the conserved glycogen bio-synthesis pathway components cdc-2 and pp-1 (29, 39, 63).

Integrating our results led us to hypothesize that DBF-2operates as part of different coexisting complexes with MOB-1

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 511

and CCR-4, which function in addition to other independentactivities of the complex components. The possible associationof DBF2 within these complexes may indicate that the proteinserves as a linking unit between primary metabolism and de-velopmental and growth processes.

ACKNOWLEDGMENTS

We thank Nir Osherov for his helpful comments on the manuscriptand Stephen Osmani for his comments and suggestions concerninganalysis of mitotic delay. We thank Stephan Seiler for the ppe-1 (SIT4-like) and mob-1 strains and Greg Jedd for the hex-1 strain.

This research was funded by the Israel Science Foundation and theDeutsche Forschungsgemeinschaft.

REFERENCES

1. Bailey-Shrode, L., and D. J. Ebbole. 2004. The fluffy gene of Neurosporacrassa is necessary and sufficient to induce conidiophore development. Ge-netics 166:1741–1749.

2. Banuett, F. 1998. Signalling in yeasts: an information cascade with links tofilamentous fungi. Microbiol. Mol. Biol. Rev. 62:249–274.

3. Borkovich, K. A., L. A. Alex, O. Yarden, M. Freitag, G. E. Turner, N. D.Read, S. Seiler, D. Bell-Pedersen, J. Paietta, N. Plesofsky, M. Plamann, M.Goodrich-Tanrikulu, U. Schulte, G. Mannhaupt, F. E. Nargang, A. Radford,C. Selitrennikoff, J. E. Galagan, J. C. Dunlap, J. J. Loros, D. Catcheside, H.Inoue, R. Aramayo, M. Polymenis, E. U. Selker, M. S. Sachs, G. A. Marzluf,I. Paulsen, R. Davis, D. J. Ebbole, A. Zelter, E. R. Kalkman, R. O’Rourke, F.Bowring, J. Yeadon, C. Ishii, K. Suzuki, W. Sakai, and R. Pratt. 2004.Lessons from the genome sequence of Neurospora crassa: tracing the pathfrom genomic blueprint to multicellular organism. Microbiol. Mol. Biol. Rev.68:1–108.

4. Bothos, J., R. L. Tuttle, M. Ottey, F. C. Luca, and T. D. Halazonetis. 2005.Human LATS1 is a mitotic exit network kinase. Cancer Res. 65:6568–6575.

5. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation ofprotein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248–254.

6. Chan, E. H., M. Nousiainen, R. B. Chalamalasetty, A. Schafer, E. A. Nigg,and H. H. Sillie. 2005. The Ste20-like kinase Mst2 activates the human largetumor suppressor kinase Lats1. Oncogene 24:2076–2086.

7. Clotet, J., F. Posas, G. Z. Hu, H. Ronne, and J. Arifio. 1995. Role of proteinphosphatase 2A in the control of glycogen metabolism in yeast. Eur. J. Bio-chem. 229:207–214.

8. Colot, H. V., G. Park, G. E. Turner, C. Ringelberg, C. M. Crew, L.Litvinkova, R. L. Weiss, K. A. Borkovich, and J. C. Dunlap. 2006. A high-throughput gene knockout procedure for Neurospora reveals functions formultiple transcription factors. Proc. Natl. Acad. Sci. U. S. A. 103:10352–10357.

9. Davis, R. H. 2000. Neurospora—contributions of a model organism. OxfordUniversity Press, New York, NY.

10. Davis, R. H., and F. J. de Serres. 1970. Genetic and microbiological researchtechniques for Neurospora crassa. Methods Enzymol. 17A:79–143.

11. Ebbole, D. J. 1996. Morphogenesis and vegetative differentiation in filamen-tous fungi. J. Genet. 75:361–374.

12. Ebbole, D. J., and M. S. Sachs. 1990. A rapid and simple method forisolation of Neurospora crassa homokaryons using microconidia. FungalGenet. Newsl. 37:17–18.

13. Edgar, B. A. 2006. From cell structure to transcription: Hippo forges a newpath. Cell 124:267–273.

14. Francois, J., and J. L. Parrou. 2001. Reserve carbohydrates metabolism inthe yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 25:125–145.

15. Freitag, M., P. C. Hickey, N. B. Raju, E. U. Selker, and N. D. Read. 2004.GFP as a tool to analyze the organization, dynamics and function of nucleiand microtubules in Neurospora crassa. Fungal Genet. Biol. 41:897–910.

16. Frenz, L. M., S. E. Lee, D. Fesquet, and L. H. Johnston. 2000. The buddingyeast Dbf2 protein kinase localizes to the centrosomes and moves to the budneck in late mitosis. J. Cell Sci. 113:3399–3408.

17. Galagan, J. E., S. E. Calvo, K. A. Borkovich, E. U. Selker, N. D. Read, D.Jaffe, W. FitzHugh, L. J. Ma, S. Smirnov, S. Purcell, B. Rehman, T. Elkins,R. Engels, S. Wang, C. B. Nielsen, J. Butler, M. Endrizzi, D. Qui, P. Ianak-iev, D. Bell Pedersen, M. A. Nelson, M. Werner Washburne, C. P. Selitren-nikoff, J. A. Kinsey, E. L. Braun, A. Zelter, U. Schulte, G. O. Kothe, G. Jedd,W. Mewes, C. Staben, E. Marcotte, D. Greenberg, A. Roy, K. Foley, J. Naylor,N. Stange Thomann, R. Barrett, S. Gnerre, M. Kamal, M. Kamvysselis, E.Mauceli, C. Bielke, S. Rudd, D. Frishman, S. Krystofova, C. Rasmussen,R. L. Metzenberg, D. D. Perkins, S. Kroken, C. Cogoni, G. Macino, D.Catcheside, W. Li, R. J. Pratt, S. A. Osmani, C. P. DeSouza, L. Glass, M. J.Orbach, J. A. Berglund, R. Voelker, O. Yarden, M. Plamann, S. Seiler, J.Dunlap, A. Radford, R. Aramayo, D. O. Natvig, L. A. Alex, G. Mannhaupt,D. J. Ebbole, M. Freitag, I. Paulsen, M. S. Sachs, E. S. Lander, C. Nusbaum,

and B. Birren. 2003. The genome sequence of the filamentous fungus Neu-rospora crassa. Nature 422:859–868.

18. Gorovits, R., O. Propheta, M. Kolot, V. Dombradi, and O. Yarden. 1999. Amutation within the catalytic domain of COT1 kinase confers changes in thepresence of two COT1 isoforms and in Ser/Thr protein kinase and phos-phatase activities in Neurospora crassa. Fungal Genet. Biol. 27:264–274.

19. Gorovits, R., K. A. Sjollema, J. H. Sietsma, and O. Yarden. 2000. Cellulardistribution of COT1 kinase in Neurospora crassa. Fungal Genet. Biol. 30:63–70.

20. Gorovits, R., and O. Yarden. 2003. Environmental suppression of Neuros-pora crassa cot-1 hyperbranching: a link between COT1 kinase and stresssensing. Eukaryot. Cell 2:699–707.

21. Harris, S. D. 2006. Cell polarity in filamentous fungi: shaping the mold. Int.Rev. Cytol. 251:41–77.

22. Harvey, K., and N. Tapon. 2007. The Salvador-Warts-Hippo pathway—anemerging tumour-suppressor network. Nat. Rev. Cancer 7:182–191.

23. Hergovich, A., M. R. Stegert, D. Schmitz, and B. A. Hemmings. 2006. NDRkinases regulate essential cell processes from yeast to humans. Nat. Rev.Mol. Cell Biol. 7:253–264.

24. Jablonka, W., S. Guzman, J. Ramirez, and M. Montero-Lomeli. 2006.Deviation of carbohydrate metabolism by the SIT4 phosphatase in Saccharo-myces cerevisiae. Biochim. Biophys. Acta 1760:1281–1291.

25. Jedd, G., and N.-H. Chua. 2000. A new self-assembled peroxisomal vesiclerequired for efficient resealing of the plasma membrane. Nat. Cell Biol.2:226–231.

26. Kim, J. M., L. Lu, R. Shao, J. Chin, and B. Liu. 2006. Isolation of mutationsthat bypass the requirement of the septation initiation network for septumformation and conidiation in Aspergillus nidulans. Genetics 173:685–696.

27. Komarnitsky, S. I., Y. C. Chiang, F. C. Luca, J. Chen, J. H. Toyn, M. Winey,L. H. Johnston, and C. L. Denis. 1998. DBF2 protein kinase binds to and actsthrough the cell cycle-regulated MOB1 protein. Mol. Cell. Biol. 18:2100–2107.

28. Krapp, A., and V. Simanis. 2008. An overview of the fission yeast septationinitiation network (SIN). Biochem. Soc. Trans. 36:411–415.

29. Kwon, Y. G., S. Y. Lee, Y. Choi, P. Greengard, and A. C. Nairn. 1997. Cellcycle-dependent phosphorylation of mammalian protein phosphatase 1 bycdc2 kinase. Proc. Natl. Acad. Sci. U. S. A. 94:2168–2173.

30. Lenssen, E., N. James, I. Pedruzzi, F. Dubouloz, E. Cameroni, R. Bisig, L.Maillet, M. Werner, J. Roosen, K. Petrovic, J. Winderickx, M. A. Collart,and C. De Virgilio. 2005. The Ccr4-Not complex independently controls bothMsn2-dependent transcriptional activation—via a newly identified Glc7/Bud14 type I protein phosphatase module—and TFIID promoter distribu-tion. Mol. Cell. Biol. 25:488–498.

31. Lillie, S., and J. R. Pringle. 1980. Reserve carbohydrate metabolism inSaccharomyces cerevisiae: responses to nutrient limitation. J. Bacteriol. 143:1384–1394.

32. Liu, H.-Y., J. H. Toyn, Y.-C. Chiang, M. P. Draper, L. H. Johnston, and C. L.Denis. 1997. DBF2, a cell cycle-regulated protein kinase, is physically andfunctionally associated with the CCR4 transcriptional regulatory complex.EMBO J. 16:5289–5298.

33. Ma, C., and A. Mitra. 2002. Intrinsic direct repeats generate consistentpost-transcriptional gene silencing in tobacco. Plant J. 31:37–49.

34. Maerz, S., A. Dettmann, C. Ziv, Y. Liu, O. Valerius, O. Yarden, and S. Seiler.2009. Two NDR kinase-MOB complexes function as distinct modules duringseptum formation and tip extension in Neurospora crassa. Mol. Microbiol.74:707–723.

35. Mah, A. S., J. Jang, and R. J. Deshaies. 2001. Protein kinase Cdc15 activatesthe Dbf2-Mob1 kinase complex. Proc. Natl. Acad. Sci. U. S. A. 98:7325–7330.

36. Maheshwari, R. 1999. Microconidia of Neurospora crassa. Fungal Genet.Biol. 26:1–18.

37. Makrantoni, V., P. Dennison, M. J. R. Stark, and P. J. Coote. 2007. A novelrole for the yeast protein kinase Dbf2p in vacuolar H�-ATPase function andsorbic acid stress tolerance. Microbiology 153:4016–4026.

38. Margolin, B. S., M. Freitag, and E. U. Selker. 1997. Improved plasmids forgene targeting at the his-3 locus of Neurospora crassa by electroporation.Fungal Genet. Newsl. 44:34–36.

39. Morfini, G., G. Szebenyi, H. Brown, H. C. Pant, G. Pigino, S. DeBoer, U.Beffert, and S. T. Brady. 2004. A novel CDK5-dependent pathway for reg-ulating GSK3 activity and kinesin-driven motility in neurons. EMBO J.23:2235–2245.

40. Ninomiya, Y., K. Suzuki, C. Ishii, and H. Inoue. 2004. Highly efficient genereplacements in Neurospora strains deficient for nonhomologous end-join-ing. Proc. Natl. Acad. Sci. U. S. A. 101:12248–12253.

41. Nishiyama, Y., T. Hirota, T. Morisaki, T. Hara, T. Marumoto, S. Iida, K.Makino, H. Yamamoto, T. Hiraoka, N. Kitamura, and H. Saya. 1999. Ahuman homolog of Drosophila warts tumor suppressor, h-warts, localized tomitotic apparatus and specifically phosphorylated during mitosis. FEBS Lett.459:159–164.

42. O’Neill, E. E., D. Matallanas, and W. Kolch. 2005. Mammalian sterile 20-likekinases in tumor suppression: an emerging pathway. Cancer Res. 65:5485–5487.

512 DVASH ET AL. EUKARYOT. CELL

43. Paalman, J. W. G., R. Verwaal, S. H. Slofstra, A. J. Verkleij, J. Boonstra, andC. T. Verrips. 2003. Trehalose and glycogen accumulation is related to theduration of the G1 phase of Saccharomyces cerevisiae. FEMS Yeast Res.3:261–268.

44. Pablo-Hernando, M. E., Y. Arnaiz-Pita, H. Nakanishi, D. Dawson, F. delRey, A. M. Neiman, and C. R. Vazquez de Aldana. 2007. Cdc15 is requiredfor spore morphogenesis independently of Cdc14 in Saccharomyces cerevi-siae. Genetics 177:281–293.

45. Pan, D. 2007. Hippo signaling in organ size control. Genes Dev. 21:886–897.46. Parkes, V., and L. H. Johnston. 1992. SPO12 and SIT4 suppress mutations

in DBF2, which encodes a protein kinase that is periodically expressed.Nucleic Acids Res. 20:5617–5623.

47. Parrou, J. L., B. Enjalbert, L. Plourde, A. Bauche, B. Gonzalez, and J.Francois. 1999. Dynamic responses of reserve carbohydrate metabolism un-der carbon and nitrogen limitations in Saccharomyces cerevisiae. Yeast 15:191–203.

48. Praskova, M., F. Xia, and J. Avruch. 2008. MOBKL1A/MOBKL1B phos-phorylation by MST1 and MST2 inhibits cell proliferation. Curr. Biol. 18:311–321.

49. Prigozhina, N. L., C. E. Oakley, A. M. Lewis, T. Nayak, S. A. Osmani, andB. R. Oakley. 2004. -Tubulin plays an essential role in the coordination ofmitotic events. Mol. Biol. Cell 15:1374–1386.

50. Rasmussen, C. G., and N. L. Glass. 2005. A Rho-type GTPase, rho-4, isrequired for septation in Neurospora crassa. Eukaryot. Cell 4:1913–1925.

51. Rasmussen, C. G., R. M. Morgenstein, S. Peck, and N. L. Glass. 2008. Lackof the GTPase RHO-4 in Neurospora crassa causes a reduction in numbersand aberrant stabilization of microtubules at hyphal tips. Fungal Genet. Biol.45:1027–1039.

52. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold SpringHarbor, NY.

53. Saucedo, L. J., and B. A. Edgar. 2007. Filling out the Hippo pathway. Nat.Rev. Mol. Cell Biol. 8:613–621.

54. Seiler, S., N. Vogt, C. Ziv, R. Gorovits, and O. Yarden. 2006. The STE20/germinal center kinase POD6 interacts with the NDR kinase COT1 and isinvolved in polar tip extension in Neurospora crassa. Mol. Biol. Cell 17:4080–4092.

55. Sillje, H. H., E. G. ter Schure, A. J. Rommens, P. G. Huls, C. L. Woldringh,A. J. Verkleij, J. Boonstra, and C. T. Verripset. 1997. Effects of differentcarbon fluxes on G1 phase duration, cyclin expression, and reserve carbo-hydrate metabolism in Saccharomyces cerevisiae. J. Bacteriol. 179:6560–6565.

56. Smith, A., M. P. Ward, and S. Garrett. 1998. Yeast PKA represses Msn2p/Msn4p-dependent gene expression to regulate growth, stress response andglycogen accumulation. EMBO J. 17:3556–3564.

57. Somers, C. E., R. P. Wagner, and T. C. Hsu. 1960. Mitosis in vegetativenuclei of Neurospora crassa. Genetics 45:801–810.

58. Sone, T., and A. J. F. Griffiths. 1999. The frost gene of Neurospora crassa isa homolog of yeast cdc1 and affects hyphal branching via manganese ho-meostasis. Fungal Genet. Biol. 28:227–237.

59. Sparks, C. A., M. Morphew, and D. McCollum. 1999. Sid2p, a spindle polebody kinase that regulates the onset of cytokinesis. J. Cell Biol. 146:777–790.

60. Springer, M. L. 1993. Genetic control of fungal differentiation: the threesporulation pathways of Neurospora crassa. Bioessays 15:365–374.

61. Springer, M. L., and C. Yanofsky. 1989. A morphological and genetic anal-ysis of conidiophore development in Neurospora crassa. Genes Dev. 3:559–571.

62. Stoepel, J., M. A. Ottey, C. Kurischko, P. Hieter, and F. C. Luca. 2005. Themitotic exit network Mob1p-Dbf2p kinase complex localizes to the nucleusand regulates passenger protein localization. Mol. Biol. Cell 16:5465–5479.

63. Tao, W., S. Zhang, G. S. Turenchalk, R. A. Stewart, M. A. St. John, W. Chen,and T. Xu. 1999. Human homologue of the Drosophila melanogaster latstumour suppressor modulates CDC2 activity. Nat. Genet. 21:177–181.

64. Temme, C., S. Zaessinger, S. Meyer, M. Simonelig, and E. Wahle. 2004. Acomplex containing the CCR4 and CAF1 proteins is involved in mRNAdeadenylation in Drosophila. EMBO J. 23:2862–2871.

65. Toji, S., N. Yabuta, T. Hosomi, S. Nishihara, T. Kobayashi, S. Suzuki, K.Tamai, and H. Nojima. 2004. The centrosomal protein Lats2 is a phosphor-ylation target of Aurora-A kinase. Genes Cells 9:383–397.

66. Toyn, J. H., and L. H. Johnston. 1994. The Dbf2 and Dbf20 protein kinasesof budding yeast are activated after the metaphase to anaphase cell cycletransition. EMBO J. 13:1103–1113.

67. Toyn, J. H., and L. H. Johnston. 1993. Spol2 is a limiting factor that interactswith the cell cycle protein kinases Dbf2 and Dbf20, which are involved inmitotic chromatid disjunction. Genetics 135:963–971.

68. Visintin, R., and A. Amon. 2001. Regulation of the mitotic exit proteinkinases Cdc15 and Dbf2. Mol. Biol. Cell 12:2961–2974.

69. Wilson, W. A., Z. Wang, and P. J. Roach. 2002. Systematic identification ofthe genes affecting glycogen storage in the yeast Saccharomyces cerevisiae:implication of the vacuole as a determinant of glycogen level. Mol. Cell.Proteomics 1:232–242.

70. Yang, X., D. M. Li, W. Chen, and T. Xu. 2001. Human homologue ofDrosophila lats, LATS1, negatively regulates growth by inducing G2/M ar-rest or apoptosis. Oncogene 20:6516–6523.

71. Yarden, O., M. Plamann, D. J. Ebbole, and C. Yanofsky. 1992. cot-1, a generequired for hyphal elongation in Neurospora crassa, encodes a proteinkinase. EMBO J. 11:2159–2166.

72. Yatzkan, E., and O. Yarden. 1999. The B regulatory subunit of proteinphosphatase 2A is required for completion of macroconidiation and otherdevelopmental processes in Neurospora crassa. Mol. Microbiol. 31:197–209.

73. Yoshida, S., and A. Tohe. 2001. Regulation of the localization of Dbf2 andMob1 during cell division of Saccharomyces cerevisiae. Genes Genet. Syst.76:141–147.

74. Zeng, Q., and W. Hong. 2008. The emerging role of the hippo pathway in cellcontact inhibition, organ size control, and cancer development in mammals.Cancer Cell 13:188–192.

75. Zhao, B., Q. Y. Lei, and K. L. Guan. 2008. The Hippo-Yap pathway: newconnections between regulation of organ size and cancer. Curr. Opin. CellBiol. 20:638–646.

76. Ziv, C., R. Gorovits, and O. Yarden. 2008. Carbon source affects PKA-dependent polarity of Neurospora crassa in a CRE-1-dependent and inde-pendent manner. Fungal Genet. Biol. 45:103–116.

77. Ziv, C., G. Kra-Oz, R. Gorovits, S. Maerz, S. Seiler, and O. Yarden. 2009.Cell elongation and branching are regulated by differential phosphorylationstates of the NDR kinase COT1 in Neurospora crassa. Mol. Microbiol.74:974–989.

VOL. 9, 2010 DBF-2 AND GLYCOGEN PATHWAYS IN N. CRASSA 513