The Lipophorin Receptor of Drosophila melanogaster  

 

 

By 

 

 

 

Richard Dunbar‐Yaffe 

 

 

A thesis submitted in conformity with the requirements for the degree of Master of Science 

Graduate Department of Ecology & Evolutionary Biology 

University of Toronto School of Graduate Studies 

 

 

 

 

 

 

© Copyright by Richard Dunbar‐Yaffe, 2008   

  

Abstract Title: The Lipophorin Receptor of Drosophila melanogaster 

By Richard Dunbar‐Yaffe 

Degree: M.Sc. 

Department: Ecology and Evolutionary Biology 

University of Toronto 

Year: 2008 

Animals carry lipids such as hydrocarbons, fats, and sterols throughout their circulatory systems bound 

to a  carrier protein  known as  lipophorin.   The  lipophorin  receptor has been  characterized  in  locusts, 

mosquitoes and cockroaches yet  little  is known about  it  in Drosophila melanogaster.   To  this end, an 

antibody against the eleven variants of the lipophorin receptor was developed and tested.  Although this 

was  the  main  feature  of  the  work,  several  preliminary  experiments  using  RNA  interference  were 

conducted  to determine  the effects of  lipophorin  receptor.   Flies whose  lipophorin  receptor proteins 

were knocked down were  found  to have no major differences  in  locomotor activity  in  total darkness 

suggesting  that  their circadian  rhythms are unaffected.   The  same  flies were  found  to have extensive 

differences in their cuticular hydrocarbon profiles as compared with wild‐type flies.  Whole‐mount tissue 

staining  of  Drosophila  adult  brains  revealed  that  several  cells  in  the  central  nervous  system  are 

immunoreactive with the anti‐Lipophorin receptor antibody. 

   

ii  

Contents 

 

 

Chapter 1 – Mechanics of Insect Lipid Synthesis and Transport ............................................................ 1 

Introduction .............................................................................................................................................. 1 

Functions of Insect Hydrocarbons ............................................................................................................ 2 

Metabolism of Insect Lipids ...................................................................................................................... 3 

Transport of Insect Hydrocarbons ............................................................................................................ 6 

Lipophorin – The Insect Lipid Transporter ............................................................................................... 7 

The Lipophorin Receptor ........................................................................................................................ 11 

Conclusion .............................................................................................................................................. 18 

Chapter 2 – Characterization of the Drosophila Lipophorin Receptor ................................................. 20 

Introduction ............................................................................................................................................ 20 

Methods ................................................................................................................................................. 24 

Fly Food and Rearing Conditions ........................................................................................................ 24 

Creating Homozygous UAS‐DCR2; LpR1/2 RNA Interference Lines ................................................... 24 

Molecular Cloning and Microbiology ................................................................................................. 25 

Polyacrylamide Gel Electrophoresis and Western Blotting ................................................................ 26 

Haemolymph Collection and Purification ........................................................................................... 27 

Ligand Blotting .................................................................................................................................... 28 

Antibody Conditions ........................................................................................................................... 28 

Collection and Gas Chromatography of Cuticular Hydrocarbons ...................................................... 28 

Activity Monitoring ............................................................................................................................. 29 

Tissue Staining and Confocal Microscopy .......................................................................................... 29 

Results .................................................................................................................................................... 30 

Subcloning LpR2 into an Expression Vector ....................................................................................... 30 

Verifying Correct Insertion of LpR2 into pET21B ................................................................................ 35 

Generation of anti‐LpR Serum ............................................................................................................ 38 

Western Blot Testing of LpRv1 ........................................................................................................... 40 

Ligand Blotting Assay .......................................................................................................................... 45 

Effects of Lipophorin Receptor RNAi .................................................................................................. 49 

iii  

iv  

Whole‐Mount Tissue Staining Using LpRv1 ........................................................................................ 71 

Discussion ............................................................................................................................................... 75 

LpRv1 Recognizes the Lipophorin Receptor ....................................................................................... 75 

The Lipophorin Receptor Binds Lipophorin ........................................................................................ 77 

Circadian Rhythms are not Affected by the Lipophorin Receptor ..................................................... 79 

Cuticular Hydrocarbons are Affected by the Lipophorin Receptor .................................................... 80 

The Lipophorin Receptor is Present in the Brain ................................................................................ 83 

Conclusions and Future Directions ..................................................................................................... 84 

Appendix ........................................................................................................................................... 86 

Subcloning of desat1 .......................................................................................................................... 86 

Overexpression of desat(3), esat(2) and per(2) for Immunization .................................................. 88  d

   

Testing of desat(3) and perSv1 ........................................................................................................... 90 

Cited References ................................................................................................................................ 93 

Chapter 1 – Mechanics of Insect Lipid Synthesis and Transport 

Introduction 

The importance of lipids is evidenced by the host of research that has been conducted in an attempt to 

learn about their metabolism, transport, function, and regulation  in a variety of organisms.   Lipids are 

essential macromolecules; phospholipid compounds create  the membranes  that  separate cellular and 

organellar  contents  from  the  outside  world.    Lipid  precursors  are  biosynthesized  into  fat‐soluble 

hormones  involved  in the regulation of gene expression.   Lipid waxes on the cuticles of  insects protect 

them from desiccation, have functions in their immune systems, and act as signaling and communication 

devices.  Finally, lipids serve as a source of long‐term energy to be used in periods of starvation as well 

as to sustain strenuous activities such as flight in insects.  Lipids are not soluble in water; the necessity of 

their movement throughout an animal’s aqueous circulatory system is therefore a unique problem. 

Though  a  number  of  rewarding  applications  to  studying  lipids  relate  to  humans,  primary  research 

requires model organisms.   Insects are studied for several reasons (Soulages and Wells, 1994).   Insects 

have  a  short  life  cycle  and  fast  generational  time  allowing  scientists  to  perform  a  variety  of 

manipulations in a short period of time.  In addition, insects are extremely diverse; it is likely that with 

such  diversity  various  biologically  adapted  solutions  to  the  common  problem  of  lipid  transport  are 

present  (Soulages  and  Wells,  1994).    Also,  many  insects  have  sequenced  genomes  with  available 

mutants at almost any genetic  locus.    Such genetic manipulation allows  researchers  to  validate  their 

claims and place them in both physiological and genetic contexts.  Despite their diversity, insects seem 

to  retain  a  number  of  the  evolutionary  pathways  employed  by  higher  organisms with  respect  to  a 

number of their physiological activities (Soulages and Wells, 1994), making them doubly useful as study 

organisms. 

The focus of this chapter will be to review lipid and hydrocarbon transport in insects.  Because it places 

the concepts of this chapter in a more familiar context, mammalian lipid transport will also be discussed.  

A cursory overview of  lipid  synthesis  focused on hydrocarbons will be given.   Lipophorin,  the protein 

molecule used  to  transport  lipids  in  insects will be discussed with a  focus on hydrocarbon  transport.  

While the roles of lipophorin have received attention over the past few decades, its receptor has been 

1  

largely ignored.  This receptor forms the basis of this thesis and work related to it will hence be given a 

large  proportion  of  this  chapter.    This material  should  serve  as  an  introduction  to  the  scope  of  this 

thesis:  lipid  and  hydrocarbon  transport  in  Drosophila  and  its  implications  on  the  behavioural, 

communicatory and physiological aspects of hydrocarbons in Drosophila melanogater.  Work in this area 

comprises a fascinating scientific conquest because  it exemplifies the diversity with which both  insects 

and mammals approach the fundamentally similar problem of lipid transport. 

Functions of Insect Hydrocarbons 

Insects produce a  layer of cuticular wax on their cuticles that would be most analogous to the oils on 

human skin or the wax in animal ears.  A wealth of information is contained in these waxes as they vary 

among  individuals  (Howard and Blomquist, 2005). Function‐wise, they can be broken  into two specific 

subgroups of  roles: metabolic and communication.   The  term “communication” encompasses a broad 

set of roles for the hydrocarbons.  Firstly, they are involved in species recognition and mate recognition 

(Howard and Blomquist, 2005).   Species recognition  is effected by a number of volatile or non‐volatile 

hydrocarbons on the surface of the animal.  These hydrocarbons often differ in small ways between the 

sexes  of  one  species  allowing  potential mate  recognition  (Howard  and  Blomquist,  2005).    Secondly, 

hydrocarbons convey information in social contexts about task‐specific cues (such as those of an ant in 

its colony), cues as  to  the dominance or  fertility of a mate, and cues about dangerous predators  that 

some species have evolved to mimic (Howard and Blomquist, 2005; Sevala et al., 2000). 

In the fruit fly Drosophila melanogaster much work has been done related to hydrocarbons and mating 

cues.   When  a male  fly detects  the presence of  a  female  through her hydrocarbon  cues,  a  series of 

courtship behaviours begins (Jallon, 1984; Jallon and Hotta, 1979).  The male orients himself toward the 

female after following her for some time.   He then extends his wings to  ‘sing’ a courtship song that  is 

species specific and  is thought to convey  information about his fertility and dominance  (O'Dell, 2003).  

The male may then lick the female’s genitals and copulate (O'Dell, 2003); the female may display a series 

of behaviours most likely understood to be rejecting the male (Jallon, 1984).  If the female is receptive, 

however,  she may  deposit  a  volatile mixture  of  hydrocarbons  from  her  ovipositor  that  increase  the 

excitement of the male and induce copulation (Ferveur, 2005). 

Due to their relevance in studies of courthship behaviour, hydrocarbons on the fly have been the subject 

of intense analysis.  This is made feasible with the use of gas chromatography.  Many researchers have 

employed this method to identify and quantify hydrocarbons on the cuticle of the insect (Ferveur, 2005; 

2  

Jallon, 1984; Jallon and Hotta, 1979).  Hydrocarbons are easily collected by washing the cuticle of the fly 

in an organic  solvent  such as hexane;  this hexane  can  then be  subjected  to gas  chromatography.    In 

general, a  single  fly of  the Drosophila  species will have between one and  twenty micrograms of  total 

cuticular hydrocarbon on its cuticle (Ferveur, 2005).  Work on chemical cues in Drosophila has revealed 

that, while  saturated alkanes do not usually  induce behaviours, unsaturated hydrocarbons do  (Jallon, 

1984).  It has been demonstrated that the attractiveness of one fly to another is heavily dependent on 

its hydrocarbon possession (Jallon and Hotta, 1979).  The sensing of hydrocarbons to signal the presence 

of a good mate seems to trump other mating cues; Drosophila males will actively court one another in 

the presence of volatile hydrocarbons  isolated  from virgin Drosophila  females  (Tompkins et al., 1980).  

Hydrocarbon sensing seems to occur either through contact with the gustatory organs of the legs or the 

olfactory  organs  of  the  antennae  (Stocker,  1994).    Specific  to  Drosophila  melanogaster,  male 

hydrocarbons appear  to be monounsaturates while  female hydrocarbons  can be doubly unsaturated, 

yielding a specific sexual cue to males (Jallon, 1984). 

Metabolism of Insect Lipids  

Mammals  use  a  battery  of 

lipid  transport  techniques 

(Fredrickson  and  Gordon, 

1958);  upon  ingestion,  lipids 

(in  the  form  of  large,  low 

density  particles  called 

chylomicrons)  are  taken  in 

through  lacteals  within  the 

small  intestine  and 

transported  through  the 

lymphatic  system  until  they 

reach  the  blood‐borne 

circulatory  system  at  the 

thoracic duct.   They are  then 

degraded  by  tissues  which 

require  energy  to  form 

Figure 1 represents a schematic of mammalian lipid transport (Rodenburg and Van derHorst, 2005).   Mammals use a battery of different  lipid transport molecules.   Dietarylipids are packaged by  the  intestine  into  chylomicrons which  can  then be absorbedand stored by adipose; remnants are endocytosed into the liver.  The liver repackageslipids  into  lipoproteins  of  very  low,  low,  or  intermediate  density  (VLDL,  LDL,  IDL).When  these  lipoproteins are endocytosed by  tissues  they  lose  fat content and  theirdensity increases upon resecretion, forming high density lipoproteins or HDL. 

3  

Figure 2 A schematic of insect lipid transport (Rodenburg and Van der Horst, 2005).  Liverand adipose tissue are functionally replaced by the fat body which synthesizes lipophorinparticles.    Lipids  absorbed  through  the  gut  are  passed  directly  to  lipophorin  particlesthrough an unknown mechanism. Lipophorin transports lipids to the fat body for storageand processing or to using tissues for energy.  Note the simplicity of the insect system oflipid  transport  and  the  efficient  reusability  of  the  shuttle‐like  lipophorin which  is  notendocytosed and reprocessed at each stage of transport. 

chylomicron  remnants which are processed  in  the  liver  into very  low density  lipoproteins  (VLDL)  (see 

figure 1). VLDL  is secreted from the  liver as a cholesterol‐rich and  lipid rich carrier molecule; during  its 

time  in the circulatory system 

it  can  be  degraded  by  using 

tissues  into  lipoproteins 

which  range  in  density  and 

are  named  as  such  (low 

density  lipoproteins, 

intermediate  density 

lipoproteins,  high  density 

lipoproteins  and  very  high 

density  lipoproteins).    As 

lipids  are  consumed  from 

these  lipoprotein  particles 

their  densities  rise  due  to 

the increased protein to lipid 

ratio.    At  each  stage  of 

consumption,  the 

lipoproteins  are 

endocytosed,  processed,  and  then  released  back  into  the  circulatory  system with more  or  less  lipid.  

Much of the reloading of lipids takes place in the liver.  High density lipoprotein (HDL) has a scavenging 

role  in picking up excess  cholesterol and  lipid;  it  is able  to do  this as a  result of  its high density and 

relatively  low  fat  and  cholesterol  content.    HDL  also  serves  as  a  source  of  apolipoproteins  during 

exchanges with lipoproteins of lower densities.  

 The insects which have been studied, by contrast, rely on a single, more versatile transport component 

called  lipophorin  (see  figure 2).   Upon  ingestion of dietary  lipid, cells within  the midgut of  the animal 

process the  lipids  into diacylglycerols (DAG; glycerol esterified to two fatty acid chains)  (Shapiro et al., 

1988).    In  contrast  to  mammals  who  transport  almost  exclusively  triacylglycerols  (TAG),  insects 

exclusively transport dietary lipids in the form of DAG (Shapiro et al., 1988).  Despite this, 98% of stored 

lipid  appears  to be  in  the  form of  TAG  (Chino  and Gilbert,  1964).   No  reason  for  this discrepancy  is 

apparent.  Once the DAG is synthesized by the cells of the midgut, it is released into haemolymph (insect 

blood)  at which  point  it  binds with  the  transport  particle  lipophorin  (Chino  and Downer,  1982).    In 

4  

contrast  to mammalian  lipid  transport, exogenous  (ingested) and endogenous  (synthesized)  lipids are 

transported  through  the circulatory  system by  lipophorin.   The  fat body  (the  insect equivalent  to  the 

mammalian  liver and adipose  tissue)    synthesizes  the nascent particles of  lipophorin whose  structure 

will be discussed further (Shapiro et al., 1988). 

The release of  lipids, either from dietary sources or stored sources,  is regulated.   Over 40 years ago  it 

was  demonstrated  that  a  factor within  haemolymph  (now  understood  to  be  lipophorin)  elicited  the 

release  of  lipids  from  the  fat  body  into  the  haemolymph where  they  could  partner with  lipophorin 

(Chino and Gilbert, 1964).  In addition, these studies demonstrated that the release is an active process 

(Chino and Gilbert, 1964).  It was also shown that insect lipophorins are closely related and structurally 

similar because, at  least  in  the  cases of  the  insects  studied,  lipophorins were able  to elicit  release of 

lipids from cultured fat bodies of a different species.  Lipids do not leak into the haemolymph; cultured 

fat bodies released almost no  lipids  in the presence of biological buffers but very  large amounts  in the 

presence of haemolymph (Chino and Gilbert, 1964). 

The  hydrocarbons  of  insects  comprise  an  important  group  of  communicatory  and  defensive  lipids.  

Rudimentary evidence led to the original hypothesis that large, cuticle or fat body associated cells called 

oenocytes  (sometimes spelled “enocytes”) synthesize  the hydrocarbons  that  form cuticular wax  (Piek, 

1964).   Modern evidence now supports  the role of oenocytes as hydrocarbon producers  (Diehl, 1975; 

Fan et al., 2003).   Most communicatory hydrocarbons are desaturated at a position nine carbons from 

the  carbonyl  group  (Chertemps  et  al., 2006; Dallerac  et  al., 2000; Wicker‐Thomas  et  al., 1997).    The 

desaturation reaction is important both empirically, due to the observation that saturated hydrocarbons 

usually have  little behavioural effect  (Jallon, 1984), and experimentally  as  its  ablation  can  result  in  a 

variety of  social problems  (Coyne and Elwyn, 2006a, b; Fang et al., 2002).   Desaturation  reactions  (at 

least  in Drosophila melanogaster and sechellia) appear to be sexually dimorphic; female  flies display a 

large amount of doubly unsaturated hydrocarbons (dienes) while they are absent on male flies (Jallon, 

1984; Wicker‐Thomas  et  al.,  1997).    Both  sexes  desaturate  hydrocarbons  at  the  9‐position with  the 

enzyme desat1  (Dallerac et al., 2000; Wicker‐Thomas et al., 1997) but a genetic discrepancy between 

the two sexes causes females to desaturate some hydrocarbons a second time (Chertemps et al., 2006).  

Because  newly‐emerged  flies  of  both  sexes  display  similar  hydrocarbon  profiles  (Jallon  et  al.,  1980), 

there  has  been  speculation  that  sex‐specific  hormonal  control  of  hydrocarbon  desaturation may  be 

responsible for the extra double bond, possibly by enabling expression of the female‐specific desaturase 

5  

desatF  in  female  flies  of  D. melanogaster  and  sechellia  (Chertemps  et  al.,  2006; Wicker  and  Jallon, 

1995a, b). 

Transport of Insect Hydrocarbons 

After  the work  of  Piek,  the  function  of  oenocytes was 

reinvestigated  in  the  desert  locust  S.  gregaria  (Diehl, 

1975).    It was  noted  that  oenocytes  (found  associated 

with the fat body in this animal) contain large amounts of 

smooth endoplasmic reticulum which is consistent with a 

role  in producing  lipid‐soluble compounds  (Diehl, 1975).  

Cultured oenocytes also  interact with  labeled acetate  to 

produce  labeled hydrocarbons common to cuticular wax 

(Diehl,  1975).    Finally,  it  was  shown  that  labeled 

hydrocarbons  did  not  leak  into  the  incubation medium 

unless it contained haemolymph (Diehl, 1975).  This study 

suggests  an  in  vivo  role  for  the  rapid  release  of 

hydrocarbons  from  the  oenocytes  where  they  are 

synthesized  into  the haemolymph  though  it  is unlikely 

that  hydrocarbons  serve  any  direct  function  in  the 

circulatory  system.    More  likely  instead  is  that  the 

haemolymph  serves  to  transport  hydrocarbons within 

the animal. 

Oe

LpR

Tr

?

Lp

Figure  3  Possible  schemes  for  hydrocarbon  transportbetween  the  oenocytes  (open  white  circles)  and  thecuticle  (dark  curved  lines).    Black  lines  representexperimentally  verified  pathways  while  dashed  linesrepresent  possible  pathways  for  hydrocarbon  delivery.Hydrocarbons are produced  in  the oenocytes and  loadedonto  lipophorin  (gradient‐filled  hexagon).    They may  bethen  loaded  to  the  cuticle  through  interaction  with  alipophorin  receptor  (gradient  rounded  rectangles)  or  thetrachea of the animal (gradient cylinders).   They may alsoload passively to the cuticle. 

The advent of a rapid method  for  the purification of  insect  lipophorin  (Chino et al., 1981b; Chino and 

Kitazawa, 1981)  led to a number of conclusions about the transport of hydrocarbons from their site of 

synthesis (oenocytes) to their site of deposition (the cuticle of the insect).  Lipophorin purified from both 

the American cockroach and the locust was associated with large amounts of hydrocarbons in addition 

to  other  lipids  (Chino  et  al.,  1981b).    Of  importance,  however,  was  the  continuity  between  the 

hydrocarbons bound  to  lipophorin within  the  circulatory  system  and  the hydrocarbons  found on  the 

surface of the insects; such continuity was later observed in Drosophila preparations (Pho et al., 1996).  

Because  the hydrocarbons of  the  cuticular wax  so  strongly  resembled  those being  transported  in  the 

haemolymph,  a  model  for  transport  in  which  lipophorin  serves  to  “load”  hydrocarbons  from  the 

6  

oenocytes  and  then  “unload”  them  at  the  cuticle was  formed  (Chino  and Downer,  1982).    This was 

confirmed during a number of experiments in which labeled hydrocarbons from dissected integuments 

were  found  to  flow  into  a medium  containing purified  lipophorin while  they did not  flow  at  all  in  a 

medium devoid of it but otherwise physiologically acceptable (Fan et al., 2003; Katase and Chino, 1982).  

In addition, the rate of hydrocarbon release (measured by radioactivity recovered  in the medium) was 

proportional  to  the  concentration of  lipophorin  in  the medium  (Katase  and Chino, 1982).    Studies  in 

Drosophila have given  further  support  to  this model by demonstrating  that  the haemolymph pool of 

hydrocarbons decreases  in quantity with a concomitant  increase  in cuticular hydrocarbons  (Pho et al., 

1996).  Much in the same way that respiratory poisons inhibit the release of diacylglycerides (Chino and 

Gilbert,  1964),  they  hamper  the  release  of  hydrocarbons  into  the  haemolymph  suggesting  a mutual 

mechanism  of  lipid  transport  (Katase  and  Chino,  1982).    These  combined  observations  suggest  a 

mechanism of haemolymph  transport of hydrocarbons  from oenocyte  to cuticle;  there  is a possibility, 

however, that hydrocarbons are transported in some other fashion from lipophorin to the cuticle that is 

not reliant on the circulatory system, though  it  is unlikely due to the observation that  injected  labeled 

hydrocarbon  in the haemocoel of cockroaches produces  label on the cuticle of the animal (Katase and 

Chino, 1982). 

Though  the  above  experiments  support  the  assertion  that  hydrocarbons  are  loaded  at  their  site  of 

synthesis and then deposited at the cuticle (Chino and Downer, 1982; Katase and Chino, 1982), they do 

not explain the specificity with which hydrocarbons are exclusively unloaded (Katase and Chino, 1982).  

This question is further complicated by the fact that the loading mechanism at the oenocytes appears to 

be an active process similar in nature to the loading of diacylglycerides from the fat body.  This does not 

rule out  the possibility  that  two  separate  loading mechanisms exist or  that  the  relative quantities of 

hydrocarbons  in  the oenocytes or diacylglycerols  in  the  fat body encourage  specific  loading  from one 

mechanism.    It should be noted that  little  is known about the direct mechanisms that allow  loading of 

hydrocarbons  or  lipids  onto  lipophorin  at  source  points  (oenocytes,  fat  body)  or  unloading  at  sinks 

(cuticle, metabolic tissues). 

Lipophorin – The Insect Lipid Transporter 

In addition  to  its  role as a  lipid  carrier,  lipophorin  is also  the major Drosophila  circulatory protein as 

albumin is in mammals.  Lipophorin allows the transport of various types of lipids (sterols, hydrocarbons, 

fats) throughout the  insect body via the haemolymph (Chino, 1985; Katase and Chino, 1982; Ryan and 

7  

van der Horst, 2000; Soulages and Wells, 1994).   Its name was coined decades after  its discovery from 

the  greek  roots  lipos  (fat)  and  phoros  (bearing)  to  reflect  its multi‐use  distinction  from mammalian 

lipoproteins which  are  degraded  during  function  (Katase  and  Chino,  1982).    Because  the  density  of 

lipophorin is close to that of high density lipoprotein in mammals, it is often referred to as HDLp or high 

density  lipophorin.   Though studies on  lipophorin structure,  functionality, and  lipid content have been 

performed  in multiple model  species,  the  implications have been  similar with many  insect  species  so 

there is no reason to suspect any difference in the Drosophila model system (Soulages and Wells, 1994).  

Lipophorins of  insects studied to date contain two subunits: ApoLpI and ApoLpII (Shapiro et al., 1984).  

ApoLpI is the larger of the two proteins with an approximate molecular mass of 250 kDa in  the studied 

insects while ApoLpII  is much  smaller  having  an  approximate mass  of  75  kDa  (Shapiro  et  al.,  1984).  

Stoichiometrically,  there  appear  to  be  one  of  each  of  these  apolipoprotein  units  in  each  lipophorin 

particle (Pattnaik et al., 1979); this stands in contrast to mammalian lipoproteins which are composed of 

many  apoprotein  subunits  in  a  less  regimented  stoichiometric  ratio  (Shapiro  et  al.,  1984).    Despite 

differences,  lipophorins of  insects are  likely  related  to  lipoproteins  in mammals  (Kashiwazaki and  Ikai, 

1985).  

Recent cDNA cloning of the tobacco hornworm M. sexta suggests that both apolipoproteins are made 

from the same precursor polypeptide that  is cleaved to yield ApoLpI and ApoLpII  (Sundermeyer et al., 

1996).   The mechanism was  later discovered to  involve the serine protease furin  in Locusta migratoria 

(Smolenaars et al., 2005).    In both physiological and ectopic expression experiments, however,  it was 

also discovered  that nascent  lipophorin particles with a molecular mass and density  identical  to wild‐

type  lipophorin  which  behaves  as  wild‐type  lipophorin  can  still  be  created  in  the  absence  of  furin 

(Smolenaars  et  al.,  2005);  this  suggests  either  an  alternate  cleavage mechanism  or  an  alternate  and 

equally effective tertiary structure of ApoLpI/II when uncleaved.   Structural and functional  information 

about  these  liporproteins  would  be  extremely  valuable  in  characterizing  binding  properties  with  a 

potential receptor; direct evidence of the structural roles of either ApoLpI or ApoLpII is lacking.  Because 

proteolytic sensitivity studies on native  lipophorin  indicate  that  the  larger ApoLpI  is more sensitive  to 

cleavage  than  its  smaller counterpart, ApoLpII may be  somehow buried within  the  lipophorin particle 

structure and hence protected from proteolysis (Kashiwazaki and Ikai, 1985).   If ApoLpII  is sequestered 

within the protein, a picture is painted in which ApoLpII and perhaps the neutral lipids being carried by 

the  lipophorin particle are surrounded by the much  larger ApoLpI whose  interaction with the aqueous 

environment  is  more  stable.    Additionally,  lipid  binding  may  take  place  during  translation  (as  is 

suspected  to  occur  with  the mammalian  homolog  apoB)  prior  to  cleavage;  this  would  explain  the 

8  

observation that uncleaved apoLpI/II precursor is able to bind lipids (Smolenaars et al., 2005).  It should 

be noted that the  lack of protease sensitivity  in ApoLpII could also be a reflection of the stability of  its 

tertiary  structure  and  may  not  reveal  positioning  information  at  all  (Soulages  and  Wells,  1994).  

Information  about  the  Drosophila  versions  of  ApoLpI/II  is  less  available;  this  is  partially  due  to  the 

reduced popularity of Drosophila as a model organism  for  lipid  transport, and partially due  to cloning 

and sequencing problems with  the abnormally  large mRNA  thought  to produce  the proapolipoprotein 

which  forms  ApoLpI  and  ApoLpII.    The  apolipophorin  candidate  gene  was  eventually  located  in 

Drosophila in the 102F region of the fourth chromosome (Kutty et al., 1996).  Because of its high affinity 

for  retinoid  compounds  and  fatty  acids,  it  was  named  RFABG  (Retinoid  and  Fatty  Acid  Binding 

Glycoprotein).  The gene product is a 3351 amino acid precursor with a putative localization sequence in 

the  first 25 amino acids.   Uncharacterized post‐translational mechanisms, similar  to  those of  the  furin 

pathway in L. migratoria, are likely to cleave at the single consensus sequence in the proapolipoprotein 

RXRR  (Kutty  et  al.,  1996;  Smolenaars  et  al.,  2005);  such  cleavage would  yield  the  predicted  70kDa 

protein as well as a >200kDa protein.  A furin candidate gene has indeed been found in Drosophila and is 

likely  to participate  in  this  cleavage  (Smolenaars et al., 2005).   Finally,  the processed apolipoproteins 

produced  in Drosophila  strongly  resemble ApoLpI/II  counterparts  in  other  insects  further  supporting 

their candidacy as lipophorin homologs (Kutty et al., 1996). 

Due  to  the  complex  nature  of  the  interaction  between  ApoLpI/II  and  carried  lipids,  neither 

apolipoprotein  leaves  the  lipophorin  particle  in  solution.    In  some  species,  a  third  apolipoprotein, 

ApoLpIII, exists and is exchangeable (Soulages and Wells, 1994).  This protein appears to be found only 

in  insects which use  lipids to  fuel  flight  (Soulages and Wells, 1994) and may act as a molecular switch 

depending  on  the  lipid  saturation  of  haemolymph‐borne  lipid  carriers  (Weers  and  Ryan,  2003).    Its 

structure has been revealed through X‐ray crystallography at a resolution of 2.5 angstroms  (Breiter et 

al., 1991).  This information is less valuable in understanding the mechanics of Drosophila lipid transport 

because ApoLpIII  has  yet  to  be  found  in  flies,  bees,  or  roaches  (Soulages  and Wells,  1994)  although 

preliminary  evidence  of  a  new  apolipophorin may  correspond  to  ApoLpIII  in  Drosophila  (Pho  et  al., 

1996). 

A  model  (see  figure  3)  for  the  structure  of  L.  migratoria  ApoLpI/II  has  been  produced  through 

comparisons with a solved X‐ray crystal structure of the lipovitellin protein of the silver lamprey as well 

as human apolipoprotein B  (Smolenaars et al., 2005).   The  structure  is not entirely  independent;  it  is 

based  on  two  existing  structures  linked  together  through  sequence  homology.    Additionally,  the 

9  

determined structure  is only partially useful because  in vivo the two apolipoproteins would be cleaved 

and operating with an altered structure.  Notwithstanding this, the predicted structure of L. migratoria 

ApoLpI/II is useful because it has been demonstrated that uncleaved ApoLpI/II precursors assemble to a 

structure  similar  to  that  of  native  lipophorin  (Smolenaars  et  al.,  2005).    The  predicted  lipophorin 

structure also shows similarity to mammalian apolipoprotein B suggesting that differences in circulatory 

lipid  transport  between  insects  and  mammals  may  be  caused  more  by  lipoprotein  receptors  than 

lipoproteins themselves (Rodenburg and Van der Horst, 2005).  

 Figure 4 The  insect apoLpI/II complex  (left) and the mammalian apolipoprotein B  (apoB) comlex  (right) has been reproduced (Rodenburg  and Van  der Horst,  2005).    These  structures were  generated  using  a modeling  technique  relying  on  sequence homology between apoLpI/II and a previously solved crystal structure.  Homologous beta‐sheets are denoted by βA, βB and βC.  Black  arrows  are  directed  towards  unmodelled  areas  containing  the  furin  sites  which  allow  cleavage  to  create  mature lipoprotein particles.  Note the similarity between the two lipid transport proteins. 

   

10  

 The Lipophorin Receptor 

Animals have a great degree of control over  the circulatory  transport of  their  lipids.   Specific  types of 

lipids, be they sterol, hydrocarbon or fat, can be unloaded at tissues as required.  These tissues can vary 

with time, developmental stage, metabolic need or function.  It is no surprise, therefore, that something 

more  sophisticated  than  simple diffusion permits  the entry of  lipids  from  the  circulatory  system  into 

using tissues.  In mammals, this function is performed by a variety of receptor molecules on cell surfaces 

which  internalize and degrade  lipoproteins (Fredrickson and Gordon, 1958).    In Drosophila and several 

insect species, however, the function of lipoprotein reception is accomplished by a single protein family: 

the lipophorin receptor. 

Although mammalian  lipoprotein  receptors  have  been  studied  for  a  long  time,  the  insect  lipophorin 

receptor  is a new addition to this area of research.    Its existence was first experimentally suggested  in 

the early 1980’s when lipophorin affinity was measured in homogenized fat body and muscle tissue of L. 

migratoria  (Hayakawa  and  Chino,  1984).    That  study  found  that  both  tissues  had  a  high  affinity  for 

purified lipophorin, confirming the existence of a receptor protein at the loading site for lipid transport 

(the fat body) as well as the unloading site (the muscle).  Additionally, injection of adipokinetic hormone 

(AKH) had  the effect of augmenting  the  receptivity of  the  tissues  to  lipophorin  (Hayakawa and Chino, 

1984);  this  augmentation  was  more  apparent  in  the  homogenized  muscle  tissue  which  seems 

reasonable given that AKH  is used to mobilize fat stores  in  insects who use  lipids to fuel flight muscles 

(Robinson  and Goldsworthy,  1976).    A  later  study  using  14C‐lipophorin  incubated with  homogenized 

flight muscle demonstrated an  increase  in radioactivity uptake relative to controls that was dependent 

on lipophorin concentration (Hayakawa, 1987).  This binding was drastically reduced by the addition of 

excess unlabeled lipohporin which competed for binding sites.  In addition, the specific binding analysis 

suggested  the  existence  of  only  one  type  of  lipophorin  binding  site  (Hayakawa,  1987).    Prior  to  any 

molecular  or  genetic  characterization,  these  data  present  several  important  findings:  binding  of 

lipophorin  to  its  receptor  in  flight muscle  tissue  is  specific  and  reversible with  a Kd of  approximately 

40μg/mL.    Additionally,  there  is  either  only  one  type  of  lipophorin  receptor,  or multiple  types with 

virtually  identical  binding  affinities.    This  study  also  demonstrated  that,  at  least  in  the  case  of  the 

receptor variant present on flight muscle, lipophorin is not internalized.  14C‐radioactivity inside the cell 

membranes was  found  to  remain at background  levels when homogenates were  incubated with  14C‐

lipophorin.  These levels were found to increase, however, when homogenates were incubated with 14C‐

diacylglycerol‐lipophorin (Hayakawa, 1987). 

11  

Further  studies were  carried  out  in M.  sexta.    Radioactive  experiments  demonstrated  that M.  sexta 

contains a saturable, single type of  lipophorin receptor that did not  internalize  lipophorin as had been 

surmised  previously  (Tsuchida  and Wells,  1990).    Ligand  blotting  experiments were  also  performed 

wherein radioactively labeled lipophorin was incubated with SDS‐PAGE separated protein fractions of M. 

sexta; the fractions which bound lipophorin had an apparent molecular mass of 120 kDa (Tsuchida and 

Wells, 1990).  The receptor was then purified using DEAE‐cellulose chromatography (Chino and Downer, 

1982).  Interestingly, the purified lipophorin receptor was able to distinguish between lipophorin in lipid‐

rich and  lipid‐depleted  states  (Tsuchida and Wells, 1990).   Although  the details of  the mechanism by 

which the receptor may do this are unknown, Tsuchida and Wells speculate that the depleted lipophorin 

could have a nominal size difference from the lipid‐rich lipophorin.  In any case it seems reasonable that 

such discrimination could exist because the Kd values, at  least  in M. sexta, suggest that the receptor  is 

permanently saturated with lipophorin; therefore, its preference for lipid‐rich lipophorin would increase 

the turnover of lipid‐depleted lipophorin from the receptor and overall efficiency of lipid transport.  Of 

further interest is the possibility that the lipophorin receptor may be able to distinguish among all types 

of lipophorin simply based on differences in density or particle size.  It has been noted that lipophorin is 

able  to deposit  a  variety of  lipids  at different  tissues despite  few  receptor  variants  in  some  species.  

Perhaps a  lipophorin particle carrying hydrocarbon destined for the cuticle has a different radius from 

one carrying diacylglycerol destined for energy‐using tissues.  If such a difference were to exist, it could 

explain  the method  by  which  insects  achieve  a  very  deliberate  degree  of  lipid  transport  specificity 

through a  very genetically  compact method.   Unfortunately,  lipophorin preparation methods are  still 

underdeveloped with  respect  to  this  level  of  specificity;  any  current method  of  purifying  lipophorin 

yields  a  heterogeneous mixture  of  particle  sizes;  in  addition  there  is  not  yet  a  standard method  for 

determination of the sizes of lipophorin particles and the various methods available produce conflicting 

results (Soulages and Wells, 1994). 

Despite  the  archetypal  role  for  lipophorin  as  a  reusable  lipid  shuttle,  certain  insect  tissues  have  the 

ability to internalize it (Dantuma et al., 1999).  The first cloned lipophorin receptor of the locust was of 

this type; it was found to be expressed largely in oocytes and young adult fat body with the purpose of 

internalizing  lipophorin  as  both  a  fat  and  protein  source  (Dantuma  et  al.,  1999).    The  authors  also 

investigated  the  genetic  regulation  of  the  transcript  of  the  newly  cloned  lipophorin  receptor  and 

discovered  it  to decrease with age;  this was not  surprising because  lipophorin endocytosis  in  the  fat 

body shows a similar decrease (Dantuma et al., 1999).  This did not explain the affinity that older adult 

12  

fat bodies retain for  lipophorin and suggests the existence of a different  lipophorin receptor that does 

not internalize lipophorin (Dantuma et al., 1999). 

The  receptor  cloned  by  Dantuma  et  al  was  found  to  share  homology  with  a  class  of  mammalian 

lipoprotein receptors.   Mammalian  lipoprotein receptors and  the  lipophorin receptor share conserved 

domains.   Usually, there  is a signal peptide directing membrane  insertion followed by a  ligand‐binding 

domain  that  is  often  rich  in  cysteine,  followed  by  an  EGF  precursor  domain,  a  linker,  a  single 

transmembrane domain and a cytosolic domain  (Yamamoto et al., 1984).   The cytosolic domain often 

contains  the  amino  acid  sequence  FDNPVY  which  recruits  clathrin  to  the  receptor  and  aid  in 

internalization (Dantuma et al., 1999).  The classic mammalian LDL receptor as well as the VLDL receptor 

seem  to  fall  into  this  group  along  with  the  newly‐cloned  insect  member  (Dantuma  et  al.,  1999; 

Yamamoto et al., 1984). 

Not  long after  the  cloning of  the  first  insect  lipophorin  receptor  from  the  locust, a  second endocytic 

lipophorin  receptor  variant was  cloned  from  the mosquito Aedes  aegypti  (Cheon  et  al.,  2001).    This 

receptor was deemed AaLpRov and owes the final part of its name to the fact that it is expressed chiefly 

in ovarian tissue.  Its region‐specific expression in addition to its ability to internalize lipophorin suggest 

a role in the endocytosis of both the lipid and protein content of lipophorin in order to furnish the yolk 

of  the  developing  oocytes  with  nutrients  (Cheon  et  al.,  2001).    The  predicted  protein  structure  of 

AaLpRov  is extremely similar to that of the LmLpR and the vertebrate VLDL receptor.    It comes from a 

gene of approximately 3.5 kb producing an 1156 amino acid protein structure with a molecular mass of 

128.9 kDa (Cheon et al., 2001).  

The  fat  body  lipophorin  receptor  of  the  wax  moth,  Galleria  mellonella  was  identified  through  a 

technique  known  as  ligand  blotting  (Lee  et  al.,  2003).    Ligand  blotting  allows  for  the  detection  of  a 

receptor  by  first  incubating  electrophoresed whole  or  purified  protein  lysates with  the  ligand,  then 

detecting the ligand through the use of a specific antibody (Lee et al., 2003).  In this case, Lee et al were 

able to identify a 97 kDa protein whose binding with lipophorin was both rapid and saturable (Lee et al., 

2003).    In addition,  the binding  kinetics were  shown  to be  sensitive  to  the  concentration of divalent 

calcium ions in the medium; chelating agents such as EDTA abolished the binding ability of lipophorin to 

its putative G. mellonella receptor further elucidating the mechanics of lipophorin‐receptor interactions 

(Lee et al., 2003).   Given that at  least two types of  lipophorin receptor exist  (an endocytic form found 

chiefly  in oocytes and fat body and a non‐endocytic form found  in using tissues)  it was surprising that 

the  ligand blotting assay revealed a clear, single band at 97 kDa and not at  least one additional band.  

13  

Perhaps  the  electrophoresis  conditions  destroyed  the  binding  ability  of  only  one  receptor  variant  or 

perhaps  both  receptor  variants  have  similar molecular masses  that  are  not  distinguishable  on  the 

polyacrylamide gels that were used.  It was also found in this study that the developmental stage of the 

animal had an effect on the quantity of the G. mellonella lipophorin receptor (Lee et al., 2003). 

The  appearance  of multiple  lipophorin  receptor  polypeptides may  result  from  splice  variants  of  few 

genes.  Evidence for this has already been shown in the mosquito where, shortly after the discovery of 

the ovarian lipophorin receptor (Cheon et al., 2001) a fat body variant was cloned (Seo et al., 2003).  The 

fat body variant AaLpRfb has a predicted molecular mass of 99.3 kDa, around 30 kDa smaller than the 

ovarian version (Cheon et al., 2001; Seo et al., 2003).  Southern blot analysis was used to verify that the 

transcripts  for  both  receptor  variants  arose  from  the  same  genetic  locus  (Seo  et  al.,  2003).    Slight 

differences were found to exist between the ovarian and fat body variants of the A. aegypti lipophorin 

receptor.  Though both versions contained the same five domains, the ovarian version had an additional 

cysteine‐rich repeat  in  its  ligand binding domain to give a total of eight repeats (Seo et al., 2003).   The 

seven repeats of the fat body lipophorin receptor match perfectly with repeats two through eight of the 

ovarian variant (Seo et al., 2003).  As with the G. mellonella lipophorin receptor (Lee et al., 2003), both 

temporal and spatial expression patterns were observed (Seo et al., 2003).   

 Ovarian  lipophorin  receptor mRNA  was  found  to  peak  just  after  the  blood meal  of  the mosquito 

presumably in order to rapidly store fats and proteins in developing oocytes during vitellogenesis (Seo et 

al., 2003).   Expression of  the  fat body  lipophorin  receptor was  found  to  increase  steadily post‐blood 

Figure 5 Conserved domain orientations of various VLDL receptor homologs among insect species (Cheon et al., 2001).  Note the relative similarity in the organization of the domains even among species only distantly related. 

14  

meal  and  to  remain  at  high  levels  once  the  ovarian  receptor mRNA  levels  subsided.    It  has  been 

suggested  that  the onset of  fat body  lipophorin  receptor expression  signals a  change  in  the animal’s 

physiology from that of vitellogenic needs (producing yolk protein and mobilizing fat for vitellogenesis) 

to that of post‐vitellogenic needs which usually consist of fat storage  in the fat body (Seo et al., 2003).  

The notion that up or down‐regulation of the expression of the lipophorin receptor can be mediated by 

physiological  and/or  temporal  constraints  is  validated  by  work  performed  on  the  locust  lipophorin 

receptor  (Van Hoof et al., 2003).   Although the endocytic  lipophorin receptor  is downregulated  in this 

animal four days after ecydsis,  its presence can be maintained by starving the animal (Van Hoof et al., 

2003);  perhaps  endocrine  signals  verifying  adequate  storage  of  required  lipids  in  the  fat  body  are 

necessary for the downregulation of the receptor. 

 

Currently,  several  lipophorin  receptors  have  been  cloned  in many  prominent  insect  species.    These 

include L. migratoria (Dantuma et al., 1999; Van Hoof et al., 2003), A. aegypti (Cheon et al., 2001; Seo et 

al.,  2003)  and  G. mellonella  (Lee  et  al.,  2003).    In  contrast  to  earlier work  that  suggested  that  the 

lipophorin receptor does not internalize lipophorin and that lipophorin is a reusable shuttle (Hayakawa, 

1987; Soulages and Wells, 1994; Tsuchida and Wells, 1990) each of the cloned receptors appears to be 

endocytic.    The  question  of whether  or  not  the  lipophorin  receptor  is  endocytic was  investigated  in 

cultured cell lines (Van Hoof et al., 2005).  Fluroescence microscopy was used to track fluorescent labels 

on lipophorin molecules during their incubation with Drosophila Schneider 2 (S2) cells.  When these cells 

had  been  transfected  with  L.  migratoria  LpR  cDNA,  internalization  of  the  fluorescent  signal  was 

observed;  in addition  the  signal was stored  in vesicles  resembling  the  fate of  internalized  low‐density 

lipoprotein  in mammalian cells (Van Hoof et al., 2005).   In addition, the researchers used L. migratoria 

fat  bodies  that  were  known  to  express  an  LpR  variant  endogenously  and  observed  the  opposite 

phenomenon:  recycling of  the  lipophorin particles  (Van Hoof et al., 2005).   This suggests  that  the cell 

type and physiological environment are contributing factors to whether or not  lipophorin particles are 

endocytosed by their receptor  (Van Hoof et al., 2005).   This seems reasonable because, as mentioned 

with  respect  to A. aegypti  LpR variants, different  life  stages as well as different  conditions of energy 

storage are  likely  to dictate  the advantage of  lipophorin  internalization.   This explanation  ignores  the 

fact that there are likely to be several variants of the lipophorin receptor which has been demonstrated 

more recently (Gopalapillai et al., 2006).  It is therefore possible that, rather than (or perhaps in addition 

to) physiological cues,  the  receptor variant expressed on  the cell  surface dictates whether or not  the 

lipophorin molecule will be  internalized once  it has docked at the receptor.   An additional possibility  is 

15  

that, despite the endocytic ability of some lipophorin receptor variants, the lipid payload carried by the 

lipophorin determines endocytosis. 

Given the observation that the lipophorin receptor could function differently depending on the cell type 

on which it resides or which particular transcript variant created it, the location of lipophorin receptors 

in  the  insect body  is very  important.   More  specifically,  the  spatial and  temporal distributions of  the 

lipophorin receptor variants  in each of the  insect model systems studied would be a crucial revelation 

for dissecting  the pathways of  insect  lipid  transport.   A partial characterization of  these  isoforms was 

recently published  in the silkworm Bombyx mori which appears to have four LpR  isoforms, all of which 

arise from alternative splicing of a single genetic locus (Gopalapillai et al., 2006).  The most notable facet 

of  this  work  is  that  the  four  isoforms  whose  cDNA  were  cloned  (BmLpR1,  BmLpR2,  BmLpR3,  and 

BmLpR4) appeared to have quite restrictive expression patterns in the animal (Gopalapillai et al., 2006).  

BmLpR1  seemed  to be  relatively ubiquitous  throughout  the animal with  the highest expression  levels 

occurring in the adult and pupal ovaries; interestingly this transcript was also found prominently in the 

brain.   LpR1  is distinguished  from  the other receptor transcripts by an 81 base pair  in‐frame  insertion 

resulting  in 27 additional amino acids  in  the O‐linked oligosaccharide domain with unknown  function.  

LpR2 transcript levels were also high in pupal and adult ovaries, pupal malphigian tubules, and pupal fat 

body and were moderate  in other  larval  tissues.   LpR3 expression was  restricted  to  the  fat body and 

ovary with minor  amounts  appearing  elsewhere.    LpR4,  interestingly,  seemed  to be  exclusive  to  the 

brain and central nervous system of the silkworm  (Gopalapillai et al., 2006).    In terms of  its predicted 

protein sequence, BmLpR4 is unique compared to those obtained for the rest of the silkworm isoforms 

as  well  as  those  obtained  for  the  locust  and mosquito  (Cheon  et  al.,  2001;  Dantuma  et  al.,  1999; 

Gopalapillai et al., 2006; Seo et al., 2003; Van Hoof et al., 2003).   BmLpR4 contains an 18 amino acid 

terminal  sequence  (within  its  cytosolic  domain)  that  is  almost  completely  unrelated  to  the  five 

sequences against which  it was compared  (Gopalapillai et al., 2006).    In a similar manner  to BmLpR4, 

human apolipoprotein E receptor 2  is predominantly expressed  in the brain and contains an additional 

59 amino acids on its cytoplasmic tail as compared with all other members of the VLDL receptor family 

(Li et al., 2001).    It should be noted that both B. mori LpR variants expressed predominantly  in neural 

tissue (BmLpR1 and BmLpR4) contain a highly conserved internalization sequence FDNPVY and probably 

possess  some  endocytic  ability  although  it  may  depend  on  the  type  of  cell  expressing  it  or  the 

physiological conditions of the cell (Gopalapillai et al., 2006).   Although  it has been demonstrated that 

these receptors both bind to lipophorin using the ligand binding assays described earlier, internalization 

of lipophorin in this species has not been verified (Gopalapillai et al., 2006).  It is also unclear why there 

16  

is a separate receptor variant expressed almost entirely in the brain of the silk moth.  Recent evidence 

procured  in  mammals  suggests  that  lipoprotein  receptors  in  neural  tissue may  have  a  role  in  the 

signaling cascades required for proper central nervous system development (Herz and Bock, 2002). 

The  most  recent  lipophorin  receptor  characterization  was  that  of  the  German  cockroach  Blattella 

germanica (Ciudad et al., 2007).  Two isoforms were cloned using cDNA.  Both sequences were similar in 

length  (around 3.1 kilobases) and had predicted protein molecular masses of 96.6 and 99.2 kDa;  the 

larger protein was deemed BgLpR‐L while the shorter was BgLpR‐S (Ciudad et al., 2007).  Reminiscent of 

the difference between BmLpR1 and the other three B. mori LpRs, BgLpR‐L differs from BgLpR‐S only in 

the presence of a 24 amino acid  insertion  in  its O‐linked oligosaccharide domain  (Ciudad et al., 2007).  

The  two  B.  germanica  variants  exhibit  the  internalization  sequence  FDNPVY  in  their  cytoplasmic 

domains  (Ciudad  et  al.,  2007).    In  contrast  to  the work  of Gopalapillai,  the  two  BgLpRs were  found 

ubiquitously  throughout  the  tissues  tested  (Ciudad et al., 2007).   Temporally  there was a distribution 

reminiscent  of  the mosquito  lipophorin  receptor  whereby  BgLpR‐L  peaked  in  ovarian  tissue  during 

vitellogenesis but both  isoforms were approximately equally expressed  in the fat body peaking after 4 

days of age  (Ciudad et al., 2007).  It  is also noteworthy that only a single band was observed when an 

antibody  raised  against  BgLpR  was  used  in  western  blotting;  the  authors  note  that  only  a  single 

transcript may be translated (Ciudad et al., 2007).  Another possibility however is that the resolution of 

the western blotting  technique was  insufficient  to distinguish proteins differing  in molecular mass by 

only 3 kDa.   This seems reasonable because the band detected by the antibody has a higher apparent 

molecular weight than  its predicted molecular weight; post‐translational modifications, therefore, may 

have more of an influence on protein migration than molecular mass alone and could cause the lighter 

BgLpR‐S to slow its migration to equal that of BgLpR‐L.  Furthermore, the authors looked for expression 

of BgLpR only  in ovarian and  fat body  tissue and  concede  that  the missing protein product  could be 

translated in other tissues they had not explored (Ciudad et al., 2007).  The authors were also the first to 

use RNA  interference  (RNAi)  to  reduce  levels of both BgLpR  isoforms; knockdown of  LpR RNA  in  the 

ovary resulted in a reduced level of lipophorin in the same tissue compared with controls (Ciudad et al., 

2007).  Similar treatment in the fat body, however, produced paradoxical results; mRNA levels dropped 

dramatically  as  one  would  expect  but  lipophorin  levels  remained  constant  until  the  effects  of  the 

interfering RNA diminished after three days (Ciudad et al., 2007). 

17  

Conclusion 

By comparison with  the vast amount of  literature  relating  to mammalian  lipid synthesis,  function and 

transport,  the  insect  counterparts  appear  to  be  young  areas  of  research.    In  terms  of  insect 

hydrocarbons, nearly thirty years of work have gone into understanding their functions but much work 

remains.    At  present,  only  certain  behavioural  effects  of  hydrocarbon  pheromones  have  been  well 

documented.   Recent work, however,  introduces an entirely new circadian aspect  to  the  synthesis of 

hydrocarbons whereby  the animal’s  subjective  time of day plays a  critical  role  in  the production and 

display of cuticular hydrocarbons (Levine, unpublished). 

Our understanding of  the mechanisms of  lipid  transport  in  insects, despite many  recent advances,  is 

basic.   While  there  is a  relative wealth of data  supporting  the  theory  that energetic  lipids are  loaded 

from the fat body to lipophorin particles in the circulatory system, the details of this process are poorly 

understood.    In  addition,  once  loaded  into  lipophorin  particles,  little  is  known  about  the  unloading 

process at, for example, using tissues or other sites.  It should be noted that despite a concrete role for 

lipophorin in the transport of hydrocarbon pheromones, even less is understood about the loading and 

unloading  of  hydrocarbons  at  the  oenocytes  following  synthesis  or  the  cuticle  preceding  display. 

Crystallographic studies of lipophorin in lipid‐rich or lipid‐depleted states as well as loaded with a variety 

of  lipids would be extremely useful  in determining  structure‐function  relationships.   Though  there do 

not appear  to be multiple subtypes of  lipophorin particles, one can only speculate  that  the degree of 

lipid  transport  specificity  achieved  in  insects precludes  the  absence of  some  recognition mechanism; 

research into the methods through which lipophorin particles are recognized for unloading at one tissue 

and not at another could provide insight into this conjecture. 

The complex transport specificity could also be achieved through  interactions between  lipophorin and 

its receptor and could possibly be mediated by the cellular environment of the receiving tissue.   Some 

insects  have  as  many  as  four  cloned  lipophorin  receptor  sequences  (Gopalapillai  et  al.,  2006)  but 

databases for sequenced organisms, such as Drosophila melanogaster show eleven possible transcripts.  

Once more,  these  sequences must  be  characterized  through  experimentation.    The many  lipophorin 

receptor isoforms could be providing the degree of circulatory transport specificity observed.  The other 

pressing  issue  related  to  lipophorin  receptors  seems  to  be  the  question  of whether  or  not  they  are 

endocytic  like  their mammalian VLDL‐related  receptor counterparts.   Each  cloned  lipophorin  receptor 

appears endocytic while earlier experiments have demonstrated a  lack of  lipophorin uptake  in various 

tissues.  Once more, lipophorin receptor subtypes or even the cellular environment could be causing the 

18  

discrepancy.    Perhaps  one  of  the more  intriguing  questions  about VLDL‐related  receptors  in  general 

relates to why there appears to be (at least in mammals and insects) a brain and central nervous system 

specific variant.   An understanding of  the physiological  roles and anatomical placement of  these and 

other  lipophorin  receptor  variants  is  undoubtedly  underway  and will most  likely  provide  fascinating 

insight into the lipid transport of insects. 

The study of lipid transport in insects remains in its  infancy especially when compared to the advances 

made in the mammalian counterpart.  In the case of Drosophila melanogaster, one of the most popular 

genetic model organisms  in use  today,  even  less  is  known  about  lipid  transport.    This has  created  a 

fundamental problem for researchers  interested  in hormones, pheromones and hydrocarbons, or  lipid 

metabolism  in such a ubiquitous organism.    In  this work,  the use of a polyclonal antibody against  the 

Drosophila lipophorin receptor sheds a small amount of light on a relatively unknown research topic.  A 

specific  antibody  has  been  developed which  recognizes  the  lipophorin  receptor  and  reacts with  this 

receptor on  specific  cells of  the brain.    In addition, a genetic knock‐down of  this  receptor using RNA 

interference  demonstrates  that  it  may  be  involved  in  the  mechanisms  of  the  cuticular  display  of 

Drosophila hydrocarbons.  Hopefully this research will open the door to a more complete functional and 

spatial description of  the  lipophorin  receptor  as well  as  the downstream physiological  consequences 

that may result from its ablation. 

   

19  

Chapter 2 – Characterization of the Drosophila Lipophorin Receptor 

Introduction The passage of  lipid compounds  (fats, sterols, hydrocarbons,  free  fatty acids)  throughout an organism 

has been an extensive area of research.  Most of this research, however, has been directed towards the 

understanding  of  the mammalian mechanisms  of  lipid  transport while  comparatively  little work  has 

focused on their insect counterparts.  The mechanisms involved in lipid transport differ between insects 

and mammals.  Certain aspects of transport, however, such as the need to transport fatty acids, sterols 

and  lipids  in  conjunction with  a protein  carrier,  are  shared.    Insects have  a one‐size‐fits‐all  transport 

molecule  called  lipophorin  that  is  responsible  for  the  carriage  of  energetic  lipids,  hydrocarbons  and 

sterols of varying density (Chino, 1985; Chino and Downer, 1982; Chino et al., 1981a; Chino and Gilbert, 

1965; Soulages and Wells, 1994).    In addition  to  its  functions  in  lipid  transport,  lipophorin  is also  the 

major  protein  constituent  of  insect  blood,  or  haemolymph  (Chino  et  al.,  1981a).    In  contrast  to 

mammalian  lipoproteins which are composed of several small  (approximately 40kDa) protein subunits 

which  vary  considerably  in  their  stoichiometric  contribution  to  the  lipoprotein  particle,  lipophorin  is 

composed of two protein subunits or apolipophorins: ApoLpI (250kDa) and ApoLpII (75kDa).  These two 

protein subunits are constant in the lipophorin structure and, in addition to the lipid payload carried by 

the lipophorin, constititute its entire structure (Pattnaik et al., 1979; Shapiro et al., 1984).  Despite their 

differences, it is strongly evident that lipophorin is related evolutionaily to mammalian apolipoprotein B 

(Kashiwazaki and  Ikai, 1985).   Firstly, both proteins are  rich  in β‐sheet secondary structure.   Although 

this may  be  a  necessary  component  for  lipid  transport  and  would  therefore  represent  convergent 

evolution,  the  amino  acid  content  of  apolipoprotein  B  strongly  resembles  that  of  lipophorin 

(Kashiwazaki and Ikai, 1985).  Preliminary, structural studies seem to indicate a similar tertiary structure 

of  the  two  proteins  (Rodenburg  and  Van  der  Horst,  2005).    Finally,  while  it  is  well  known  that 

mammalian  lipoproteins are endocytosed by  tissues and degraded  intracellularly,  lipophorin has been 

shown  to sometimes act as a reusable shuttle  in accordance with  the cell  type  to which  it delivers  its 

payload and the physiological state of the insect (Hayakawa, 1987; Soulages and Wells, 1994; Tsuchida 

and Wells, 1990; Van Hoof et al., 2005). 

20  

As in mammals, insects have a receptor for this transport molecule – the lipophorin receptor – which, in 

contrast  to mammalian  lipoprotein  receptors,  is  relatively  versatile  (Soulages  and Wells,  1994).    The 

insect lipophorin receptor replaces the host of density‐specific receptors found in mammals (Fredrickson 

and Gordon, 1958).   Receptors of  lipophorin have been studied  in several  insect species  including  the 

locust  (Dantuma et al., 1999; Dantuma et al., 1996; Hayakawa, 1987; Van Hoof et al., 2003),  tobacco 

hornworm (Tsuchida and Wells, 1990), mosquito (Cheon et al., 2001; Sappington et al., 1996; Seo et al., 

2003), german  cockroach  ([Anon], 2004; Ciudad et al., 2007) and  silkworm  (Gopalapillai et al., 2006).  

The lipophorin receptor shares several features with the mammalian very low density lipoprotein (VLDL) 

receptor.    It contains a  ligand binding domain which  is comprised of a varying number of cysteine‐rich 

repeats,  an  EGF‐precursor  domain,  an  O‐linked  oligosaccharide  domain,  a  single  transmembrane 

spanning  domain  as  well  as  a  small  cytosolic  domain  (Cheon  et  al.,  2001).    The  cytosolic  receptor 

domains of several insect species retain variants of the well‐conserved internalization sequence FDNPVY 

which is thought to recruit clathrin to the cell surface and facilitate endocytosis (Dantuma et al., 1999).  

It  remains unclear why  these  internalization  sequences  appear  to promote  lipophorin  endocytosis  in 

only some cases. 

In  Drosophila  there  are  two  variants  of  the  lipophorin  receptor:  LpR1  (Accession  No.  CG31092, 

Chromosome 3R 96F1‐96F2) and LpR2 (Accession No. CG31095, Chromosome 3R 96E10‐96F1).  At least 

six predicted LpR1 splice variants are thought to exist, each producing peptides with a distinct molecular 

weight (LpR1‐PA, 98.3kDa; LpR1‐PB, 114kDa; LpR1‐PC, 102.7kDa; LpR1‐PD, 92.3kDa; LpR1‐PE, 109.5kDa; 

LpR1‐PF, 118.4kDa).   The final seven exons of the gene are constantly expressed except  in the case of 

LpR1‐PD which is missing exon 4.  LpR2 is also thought to produce several peptides of varying molecular 

weight  (LpR2‐PA,  113.2kDa;  LpR2‐PB,  91.6kDa;  LpR2‐PC,  113.2;  LpR2‐PD,  41.1kDa;  LpR2‐PE,  117kDa; 

LpR2‐PF, 95.4kDa; LpR2‐PG, 116.9kDa).  Several exons at the 3’ end of the transcript are constant in all 

variants but variability in splicing seems higher than that of LpR1. 

There  is  evidence  that  insect  hydrocarbons,  in  addition  to  fats,  sterols  and  free  fatty  acids,  are 

transported throughout the haemolymph by lipophorin, presumably docking at lipophorin receptor sites 

(Chino et al., 1981b; Diehl, 1975; Pho et al., 1996).    Insect hydrocarbons  serve a variety of  functions: 

they comprise a cuticular wax that  is thought to prevent dessication, they function  in conjunction with 

the  insect  immune system to prevent  infection and their volatility allows them to function as chemical 

messengers to convey social messages between animals.  Insect hydrocarbons are synthesized by large, 

cuticle‐associated cells called oenocytes which can vary  in position depending on the species of  insect 

21  

(Piek,  1964).    An  insect  cuticule may  contain many  hydrocarbons  ranging  in  chain  length  from  18 

carbons  to  around  30  carbons;  behavioural  assays  have  been  used  to  elucidate  the  communicatory 

function in only a few of these hydrocarbons.  Cuticular hydrocarbons are found in three varieties: those 

which  are  saturated  (straight  hydrocarbons  of  variable  length),  unsaturated  (containing  at  least  one 

double bond) and methylated (those with branches  in the hydrocarbon chain).   While the functions of 

many  hydrocarbons  are  unknown,  those  thought  to  have  communicatory  functions  are  desaturated, 

having at least one double bond in their structure (Chertemps et al., 2006; Dallerac et al., 2000; Jallon, 

1984;  Wicker‐Thomas  et  al.,  1997).    This  desaturation  is  sex‐specific  in  the  case  of  Drosophila 

melanogaster  and  is  carried  out  in  the  oenocytes  by  sex‐specific  variants  of  desaturase  genes 

(Chertemps et al., 2006; Dallerac et al., 2000; Wicker‐Thomas et al., 1997; Wicker and  Jallon, 1995a).  

Though the method by which cuticular hydrocarbons are delivered from their site of synthesis to their 

site of deposition is unknown, it has been proposed that hydrocarbons are haemolymph‐borne during at 

least some of this process  (Chino and Downer, 1982).   Evidence has also accumulated to  indicate that 

the  synthesis  of  insect  hydrocarbon  is  likely  to  be  under  the  influence  of  a  circadian  clock  (Levine, 

unpublished).    In  addition,  it  has  also  been  demonstrated  that  the  circadian  clock  of  insects  can  be 

‘reset’ using cues obtained from other insects or social experience (Levine et al., 2002).  If these cues are 

indeed the cuticular hydrocarbons  likely to be under circadian control, then agitation of the  lipophorin 

transport dynamics of the animal could lead to both circadian and hydrocarbon effects. 

What  is currently known about the Drosophila branch of  lipophorin receptors results from sequencing 

evidence  and  experiments  in  other  insect  species.    To  improve  this,  we  hoped  to  learn  about  the 

Drosophila  lipophorin  receptor  primarily  using  two  techniques.  The  first was  to  create  a  polyclonal 

antibody against the lipophorin receptor.  This would allow us to have insight into the levels and spatial 

localization of protein expression in various Drosophila tissues.  Antibodies enable researchers to do this 

by binding specifically to the target protein, or antigen, of interest.  The position of the antigen is then 

inferred indirectly by detecting the position of the antibody against it using a secondary antibody with a 

detection  tag  that could be  fluorescent or have  some enzymatic activity.   Antibodies are used  in  two 

ways  in  this work: primarily  they can detect proteins  immobilized and blotted onto membranes after 

electrophoresis  through western blotting.    Secondly,  they  can  detect  the  spatial properties of  target 

antigens  by  staining  fixed  tissues  with  the  antibody  and  then  visualizing  them  with  a  confocal 

microscope.    Because  we  were  interested  in  the  link  between  the  central  circadian  clock  and  the 

lipophorin  receptor, we  imaged Drosophila brains stained with our generated anti‐LpR antibody  in an 

attempt  to  localize neural  lipophorin  receptor.   Because mammalian  lipoprotein  receptors have been 

22  

identified  as  neural  specific  (Herz  and  Bock,  2002) we  expected  to  find  a  variant  of  the  lipophorin 

receptor expressed  in  the Drosophila brain.   Due  to a partially verified  link between circadian  rhythm 

and  cuticular  hydrocarbons  (Levine,  unpublished),  and  the  potential  that  cuticular  hydrocarbons  are 

linked to lipophorin and its receptor, we were particularly interested in whether the neural localization 

of the lipophorin receptor is coincident with that of circadian clock function markers. 

The second technique used to  learn about the Drosophila  lipophorin receptor employed powerful RNA 

interference (RNAi) lines driven by the GAL4‐UAS system to specifically knock down expression of one or 

both  of  the  two  main  variants  of  the  predicted  Drosophila  lipophorin  receptor.    In  short,  RNA 

interference is a gene‐silencing pathway dependent upon exogenously supplied or ectopically expressed 

double‐stranded RNA; its purpose is often gene silencing or translational repression (Hammond, 2005).  

Because  of  the  versatility  associated with  using  the GAL4‐UAS  system  in Drosophila,  knockdowns  at 

specific  tissues and stages can be easily achieved.   A variety of Drosophila  lines containing  transgenic 

GAL4  constructs  exist;  this  construct  originally  isolated  from  yeast  is  a  transcriptional  activator  that 

binds to an upstream activation sequence (UAS) causing the transcription of a target gene.  Placed under 

the control of the correct promoter, the GAL4 protein will only be found in desired tissues.  Because the 

GAL4 transcriptional activator has no known activity on endogenous Drosophila genes, flies containing 

this  transgene  exhibit  no  direct  phenotypic  effect.   When  a  line  containing  the GAL4  transcriptional 

activator is crossed to a line containing a UAS construct upstream of a gene of interest, (such as an RNA 

interference sequence,) the end result is that the gene of interest is expressed only in the tissues under 

the  control  of  the  GAL4  promoter.    RNAi  lines  obtained  against  LpR1  and  LpR2  (directed  against 

sequences  common  to all  transcriptional variants at each  locus) were used  to attempt  tissue‐specific 

translational repression of the lipophorin receptor. 

Given  the  short  time  since  its  discovery,  the  extent  of  the  characterization  of  the  Drosophila  RNAi 

pathway  is  surprising.   Several genes are  involved  in  the RNA  silencing pathway  that  is central  to  the 

functioning of RNAi; mutants in these genes are defective in translational and transcriptional repression 

(Grishok et al., 2001; Hammond, 2005).  In the same manner, overexpression of the same genes under 

the control of the GAL4‐UAS system may improve the translational repression of RNAi systems (Dietzl et 

al., 2007; Lee et al., 2004).   Dicer‐2  is one of the main genes responsible for the formation of the RNA 

interference gene silencing complex; for this reason, UAS‐Dicer‐2 (UAS‐DCR2) was incorporated into all 

UAS‐RNAi  constructs  used  herein  in  an  effort  to  bolster  the  tissue‐specific  translational  repression 

desired.   RNAi  function  is  impaired  in neuronal  tissue  for unknown  reasons  (Dietzl et al., 2007).   This 

23  

impairment  is reduced when Dicer‐2  is  incorporated  in neuron‐specific RNAi experiments (Dietzl et al., 

2007).  Because these RNAi lines were used in several neuron‐specific GAL4 driver lines, and because the 

effects of  lipophorin  receptor  knockdown  in neural  tissue was of particular  interest,  incorporation of 

Dicer‐2 was particularly important. 

We attempted  reduction of LpR1 and LpR2 under  the control of  several GAL4  lines: embryonic  lethal 

abnormal vision  (elav), pigment dispersing  factor  (pdf), R32  (clock‐cell  specific), and heat  shock.   The 

expression pattern of elav‐GAL4 has been described as panneuronal; R32 is known to be expressed in all 

clock cells of the Drosophila brain while pdf is expressed in a subset of these.  The heat shock promoter, 

though primarily activated at 37°C is thought to be constitutively active at temperatures of 25°C which 

were used  in  fly  rearing.   Because circadian clock  function and hydrocarbons appear  to be  linked, we 

measured  the  effect  of  these  tissue‐specific  LpR  knock‐downs  on  the  cuticular  hydrocarbons  of 

Drosophila  males.    We  expected  that,  in  accordance  with  the  seemingly  integral  role  of  LpR  for 

hydrocarbon  transport, we would  identify a  reduction  in  the  cuticular quantities of  several,  if not all, 

hydrocarbons.  Additionally, RNAi lines were tested in activity monitors to try to identify an effect of LpR 

knock down on circadian rhythms. 

Methods 

Fly Food and Rearing Conditions All Drosophila melanogaster stock lines were maintained on standard yeast‐sucrose‐agar medium.  Food 

was created by mixing all ingredients (12 g/L agar, 15 g/L sucrose, 30 g/L glucose monohydrage, 35 g/L 

active dry yeast, 15 g/L cornmeal, 10 g/L wheat germ, 10 g/L soy flour and 30 g/L molasses)  in hot tap 

water  and  then  heating  and  stirring  the  resulting mixture  on  a  395°C  element  until  its  temperature 

reached 85°C.  The heat was then lowered to 120°C for ten minutes, after which the food mixture was 

removed to a fume hood and allowed to cool 47°C while stirring constantly.  5 mL of propionic acid and 

10 mL of 10% w/v Tegosept in 95% ethanol were added to each litre of cooled food.  The food was then 

poured using blunt cannula‐tipped syringes  in the amount of 8 mL per vial.     Food was allowed to dry 

overnight and was kept refrigerated at 4°C prior to use.  Drosophila stocks were kept in prepared vials at 

24°C with a 12‐12 light dark cycle changing vials every 14‐20 days. 

Creating Homozygous UAS­DCR2; LpR1/2 RNA Interference Lines RNAi lines were obtained from the Vienna Drosophila RNAi Centre (VDRC) for both LpR1 (stock #14756; 

CG31095)  and  LpR2  (stock  #  25684;  CG31092).    Both  lines  contained  insertions  on  the  second 

24  

chromosome; LpR2‐RNAi  lines were viable as homozygotes while LpR1‐RNAi  lines were  lethal and thus 

balanced with the second‐chromosome balancer CyO which conferred curly wings on  its bearer.   UAS‐

DCR2  lines  obtained  from  Paul  Taghert  contained  a  homozygous‐viable  insertion  on  the  first 

chromosome.    Males  of  the  DCR2  line  were  crossed  to  females  of  genotype  FM7/FM7; 

Sp(Sternoplural)/CyO.    A  sibling  cross  between  the  resultant  genotypes UAS‐DCR2/Y;  Sp/+  and UAS‐

DCR2/FM7; CyO/+ resulted in the stable line UAS‐DCR2/UAS‐DCR2; Sp/CyO.  Males of the LpR RNAi lines 

were crossed to FM7/FM7; Sp/CyO.   A sibling cross between the resultant genotypes FM7/+; UAS‐LpR 

RNAi/CyO and FM7/Y; UAS‐LpR/CyO produced the two stable  lines FM7/FM7; UAS‐LpR1 RNAi/CyO and 

FM7/FM7; UAS‐LpR2 RNAi/UAS‐LpR2 RNAi.   Males of each of these LpR RNAi stable  lines were crossed 

with UAS‐DCR2/UAS‐DCR2; Sp/CyO.   A sibling cross between the resulting offspring UAS‐DCR2/Y; UAS‐

LpR RNAi/CyO and UAS‐DCR2/FM7; UAS‐LpR RNAi/CyO produced  the  two stable  lines UAS‐DCR2/UAS‐

DCR2; UAS‐LpR1 RNAi/CyO and UAS‐DCR2/UAS‐DCR2; UAS‐LpR2 RNAi/UAS‐LpR2 RNAi. 

Molecular Cloning and Microbiology All E. coli strains used for the subcloning and isolation of LpR2 (TOP10F and DH5α) were grown at 37°C 

in Luria‐Bertani (LB) medium (solid or liquid) supplemented with 100 μg/mL ampicillin.  The E. coli BL21 

strain used specifically for the overexpression of T7‐tagged fusion proteins were grown in Terrific Broth 

rather  than  LB medium.    Protein  inductions  took  place  between  30  and  37°C  depending  on  optimal 

conditions.    Expression  of  foreign  constructs  in  E.  coli  pET21  vectors  (EMD  Biosciences  Catalog  No. 

69741‐3)  was  accomplished  through  induction  using  Isopropyl  β‐D‐1‐thiogalactopyranoside  (IPTG; 

Sigma‐Aldrich Product No.  I5502).   Polymerase Chain Reaction (PCR) was performed using the forward 

primer  LPR2A‐F  (5’‐GGGTCGACAACATGGGACCAATA‐3’)  and  reverse  primer  LPR2A‐R  (5’‐

GGCTCGAGCCGCTAAACTGGCAA‐3’)    or  LPR2B‐F  (5’‐GGGTCGACAACATGGGACCAATA‐3’)  and  reverse 

primer  LPR2B‐R  (5’‐GGCTCGAGCCGCTAAACTGGCAA‐3’)  ordered  from  Sigma‐Genosys.    Agarose  gel 

electrophoresis was performed using 1% agarose in standard Tris‐Acetate EDTA buffer.  Electrophoresis 

was monitored using the GeneRuler® marker (Fermentas Catalog No. SM0311) diluted appropriately  in 

6X  DNA  electrophoresis  loading  buffer.    Agarose  DNA  gels  were  stained  for  30  minutes  after 

electrophoresis  in  an  ethidium  bromide  (10μg/mL)  bath  and  destained  in  aqueous  1mM magnesium 

sulfate prior to visualization under ultraviolet light.  Plasmid minipreparations were performed using the 

Sigma  Genelute  Plasmid  Miniprep  kit  (Sigma  Lot  No.  074K6160)  according  to  the  manufacturer’s 

instructions.   Agarose  gel  extractions were  performed  using  the QIAquick Gel  Extraction  Kit  (Qiagen 

Catalog No. 28706).   Restriction digests were performed using enzymes purchased  from New England 

Biolabs  in  the  recommended digestion buffers.    Ligations were performed using T4 DNA  Ligase  (New 

25  

England  Biolabs  Catalog  No.  M0202)  in  the  appropriate  buffers  according  to  the  manufacturer’s 

instructions.    Cloning  of  PCR  products  into  the  pCR®  2.1  TOPO  vector was  accomplished  using  the 

pCR®2.1  TOPO  TA  Cloning  Kit  (Invitrogen  Catalog  No.  K2020‐20)  according  to  the  manufacturer’s 

instructions.   Rapid disruption plasmid minipreps were performed according  to  the  standard protocol 

(Sambrook and Russell, 2001).   Electroporation of electrically  competent E.  coli was performed using 

electroporator tubes with a 2 mm gap at a potential of 2.5 kV.  Electroporated cells were quickly placed 

in  SOC medium without  antibiotic  (Sambrook  and  Russell,  2001)  for  one  hour  to  recover  and  then 

spread over LB plates supplemented with ampicillin. 

Polyacrylamide Gel Electrophoresis and Western Blotting Polyacrylamide  gels  varying  in  concentration  between  6%  and  12%  were  cast  using  30% 

Acrylamide/Bisacrylamide  37.5:1  with  2.6%  C  (BioRad  Catalog  No.  161‐0158)  according  to  standard 

protocols (Sambrook and Russell, 2001).  Proteins were electrophoresed at 150V for approximately 1‐1.5  

hours  in the BioRad Mini‐PROTEAN 3 electrophoresis system  (Biorad).   Electrophoresis was monitored 

using SDS‐PAGE Standards (BioRad Broad Range Catalog No. 161‐0317) or Prestained Standards (BioRad 

Broad  Range  Kaleidoscope  Prestained Marker  Catalog No.  161‐0324).   Membrane  transfer  also  took 

place  in the BioRad Mini‐PROTEAN 3 western blotting system  for 2‐4 hours with stirring and on  ice at 

100V.  Proteins were either transferred to Pure Nitrocellulose (Pall Corporation Biotrace NT Product No. 

66485) or polyvinylidene fluoride (PVDF; BioRad Immun‐Blot PVDF Membrane 0.2 μm Catalog No. 162‐

0176).   Electrophoresis buffer was diluted  from a 5X stock  (15.1g/L TRIS, 72.0g/L glycine, 5.0g/L SDS).  

Protein  transfers  took place  in  a western blotting buffer  (3g/L  TRIS,  14.4g/L  glycine,  20% methanol).  

PVDF  membranes  were  wetted  in  99%  methanol  prior  to  and  after  electrophoretic  transfer.  

Membranes were blocked with gentle rocking overnight at 4°C in Tris‐buffered Saline with Tween (TBST; 

2.42g/L Tris, 8g/L sodium chloride, 0.1% Tween, pH 7.6) supplemented with 5% w/v Carnation Non‐Fat 

Powdered Milk.    All  other  steps  took  place  at  room  temperature.    Primary  antibodies were  added 

directly  to  this  solution  at  a  concentration  of  1:2000  for  approximately  1  hour.   Membranes were 

washed  in TBST  two  to  four  times  for 5  to 15 minutes each.   Secondary antibodies were added at a 

concentration of 1:5000  for 45 minutes and  then washed  two  to  four  times  for 5  to 15 minutes each 

with  TBST.    Colorimetric  development  of  alkaline‐phosphatase  secondary  antibodies  (Jackson 

Immunoresearch  laboratories Goat‐anti‐Rabbit Alkaline Phosphatase Conjugated Antibody Catalog No. 

63581; BioRad Goat‐anti‐Rabbit Alkaline Phosphatase Conjugated Antibody Catalog No. 170‐6518) took 

place  by washing  the membrane  twice  in  alkaline  phosphatase  buffer  (12.1g/L  Tris,  5.84g/L  sodium 

chloride, 1.02g/L magnesium chloride hexahydrate, pH 9.5) and adding, to the second wash, 165 μg/mL 

26  

5‐Bromo‐4‐Chloro‐3‐Indoyl Phosphate Toluidine Salt (BCIP; BioShop Lot No. 24524) and 220 μg/mL Nitro 

Blue Tetrazolium (NBT; BioShop Lot No. 7A2742).  Colorimetric development was monitored and rarely 

exceeded five minutes.  Membranes were then washed using distilled water.  Fluorescent development 

of  horse‐radish  peroxidase‐conjugated  secondary  antibodies  (Jackson  Immunoresearch  Laboratories 

Goat‐anti‐rabbit peroxidase  conjugated  secondary  antibody Catalog No. 61797) was performed using 

the Amersham ECL Plus Western Blotting Detection System (GE Healthcare RPN2132) according to the 

manufacturer’s  instructions.  Polyacrylamide  gels  whose  proteins  were  not  electrophoretically 

transferred  to membranes were  stained  for  several hours using Coomassie Blue R250  and destained 

overnight  in an aqueous solution of 5% v/v methanol and 7% v/v glacial acetic acid.   These gels were 

then dried overnight using  the GelAir cellophane support  (BioRad Catalog No. 165‐1779EDU and 165‐

1775EDU).    E.  coli  protein  lysates  for  PAGE  were  prepared  by  harvesting  cells  with  benchtop 

centrifugation  then  resuspending  them  in  appropriately  diluted  6X  SDS  Sample  Buffer  (0.35M  Tris 

hydrochloride  at  pH  6.8,  0.128g/mL  SDS,  0.38g/mL  glycerol,  0.093g/mL  dithiothreitol,  0.12mg/mL 

bromophenol blue).   Lysates were then boiled for 5 minutes and stored at ‐20°C until use.   Drosophila 

protein  lysates were prepared by grinding whole flies or separated fly heads and the remainder of the 

flies  in  a  chilled  protease‐resistant  sample  buffer  (100mM  potassium  chloride,  20mM  HEPES  (4‐(2‐

hydroxyethyl)‐1‐piperazineethanesulfonic acid), 5% glycerol, 10mM EDTA (ethylene diamine tetraacetic 

acid), 0.1% Triton‐X 100, 1mM dithiothreitol, 10μg/mL aprotinin, 5μg/mL  leupeptin).   The mixture was 

then centrigued at room temperature at 20 000 x g  for 5 minutes and the supernatant decanted to a 

separate container.   To  the  supernatant was added  the appropriate dilution of 6X SDS Sample Buffer 

after which the sample was boiled for five minutes and stored at ‐20°C until use. 

Haemolymph Collection and Purification 

27  

Collection  of Drosophila  haemolymph was  performed  using  a modification  of  a  procedure  described 

elsewhere (Lucas et al., 2004).  Bottles with 0.15‐0.16g of flies which were 4‐6 days old were frozen by 

placing a 50mL conical tube containing the flies within liquid nitrogen. The sample was then vortexed at 

high speed to detach fly heads from bodies to allow for insect bleeding. Frozen flies were placed inside a 

3mL VectaSpin tube which contained 1mL of aqueous buffer. The aqueous buffer solution was used  in 

order  to  retrieve  small molecules  and  soluble  proteins.  The  buffer was  composed  of: monosodium 

phosphate (7.8g/L), sodium chloride (8.77g/L), ethylenediaminetetraacetic acid (EDTA) (1.86g/L), sodium 

azide (0.10g/L), leupeptine (10μL/mL), benzamidine (10μL/mL), and aprotinine (10μL/mL). These agents 

aid  in  preventing  protein  degradation  and  clotting.  VectaSpin  tubes  were  lightly  vortexed  for  two 

minutes to encourage bleeding. Then the sample was centrifuged at 2000 x g for two minutes at 4°C to 

pull  large body parts  from  the crude extract. Supernatant was collected and  transferred  into a 1.5mL 

polypropylene SuperSpin Eppendorf tube. Eppendorf tubes were centrifuged for 30 minutes at 30 000 x 

g at 4°C. Supernatant was kept on ice to inhibit remaining protease activity.  The supernatant was then 

loaded  onto  a  pre‐wetted  column  (BioRad  Biospin  chromatography  columns  Catalog  No.  732‐6008) 

prepared with DEAE‐cellulose  (Sigma‐Aldrich Product No. D3764‐100G).   The  column was  then eluted 

with phosphate buffer (0.2M sodium phosphate, pH 6.8) and 10 1mL fractions were collected into 1.5mL 

tubes.  Fractions were assayed separately for lipophorin content and purity. 

 

Ligand Blotting SDS‐PAGE  and western  blotting  techniques were  performed  as  noted.    SDS  and  dithiothreitol were 

omitted from sample buffers for native protein products.   Membranes were blocked overnight  in TBST 

supplemented  with  5%  Carnation  Non‐Fat  Powdered  Milk.    All  other  steps  took  place  at  room 

temperature.   DEAE‐cellulose  purified  haemolymph was  added  directly  to  the  blocking  solution  at  a 

dilution of 1:500 for a period of one hour.  The membrane was then washed in TBST three times for 15 

minutes each time and replaced  in blocking solution.   Anti‐apoLpI or anti‐apoLpII was then added at a 

dilution of 1:2000 for one hour.   The membrane was then washed  in TBST three times for 15 minutes 

each time and the appropriate alkaline‐phosphatase conjugated secondary antibody was added for 45 

minutes.   The membrane was washed three times for 15 minutes each time  in TBST and then washed 

twice in alkaline phosphatase buffer.  Colorimetric development took place as noted above. 

Antibody Conditions Peptide and antibody production was performed by Pacific  Immunology  Inc. Ramona, CA.   Antibodies 

were generated by using  solid phase peptide  synthesis  to produce  immunogen‐grade peptides which 

were then conjugated to Keyhole Limpet Haemocyanin (KLH) prior to injection into New Zealand White 

Rabbits.  Rabbits were maintained on a standard 13 week protocol prior to exsanguinations.  Sera from 

each rabbit were stored at ‐80°C in the absence of sodium azide, or at 4°C with 1mM sodium azide. 

Collection and Gas Chromatography of Cuticular Hydrocarbons Extraction of cuticular hydrocarbons has been previously described (Ferveur, 1991).  Flies 3‐6 days after 

eclosion were anaesthetized in diethyl ether.  Each fly was placed in a 1.5 mL glass conical vial with a 200 

μL insert.  The inserts contained 50μL of a standard mixture (10 μg/mL of octadecane and 10 μg/mL in 

hexane solvent).   Flies were  then shaken at  low speed  for 2 minutes and  removed  from  the standard 

mix. Samples were analyzed using a gas chromatograph joined to a flame‐ionization detector (Varian CP‐

28  

3800 with autosampler CP‐8400). The column employed was a DB‐1 custom capillary column with a 5m 

X 0.25mm guard column (J&W Scientific;  length 20m, diameter 0.18mm and film 0.18 μm; model 100‐

2000).    Chromatograms were  processed with  Varian GC Workstation  (Version  6.30)  software.  Peaks 

were identified by comparing retention times to n‐alkane standards (10μL/mL) and using strains whose 

main  hydrocarbons  had  been  identified  by  mass  spectroscopy.  All  peaks  were  normalized  with 

hexacosane  from the standard solution.  All chemicals were purchased from Aldrich Chemical Company 

Inc. 

 

Activity Monitoring Flies  were  sorted  on  carbon  dioxide  pads  and  allowed  to  recover  for  at  least  24  hours  following 

anesthesia prior to any behavioural testing (Greenspan, 2004).  Males of each genotype were between 3 

and  6  days  old  and were  loaded  into  activity  tubes  containing  a  small  amount  of  agar‐sucrose  for 

hydration and feeding after which point the other end of the activity tube was closed gently with cotton.  

Activity  tubes  were  fastened  to  Drosophila  Activity  Monitoring  (DAM2)  systems  (Trikinetics,  inc.  

Waltham, MA).   Flies were maintained in the appropriate lighting cycle (either 12‐12 light dark or total 

darkness) without interruption.  Data was acquired through DAM System Software for Windows version 

3.02 and was analysed using MatLab R2006b (Mathworks  inc.   Natwick, MA) with previously described 

algorithms for analysis of circadian rhythms (Levine et al., 2002). 

 

Tissue Staining and Confocal Microscopy Male flies of each genotype were dissected in PBS (0.1M Phosphate Buffered Saline, pH 7.4) and tissues 

of interest were fixed for 45 minutes in 4% paraformaldehyde.  Tissues were washed in 0.2M phosphate 

buffer,  blocked  in  4%  normal  goat  serum  with  0.5%  Triton‐X  for  3  hours,  and  incubated  with  the 

appropriate  dilution  of  primary  antibody  for  24‐48  hours.    Tissues  were  washed  once  more  and 

incubated with  the  appropriate  dilution  of  secondary  antibody  in  2%  normal  goat  serum with  0.5% 

Triton‐X for approximately 24 hours at 4°C.   Tissues were kept  in the dark to avoid photo‐bleaching of 

the  fluorophores  on  the  secondary  antibodies.    Tissues were  then  cleared  for  at  least  24  hours  in 

glycerol.  Tissues were loaded onto glass slides in Vectashield® Mounting Medium (Vector Laboratories 

Product No. H‐1000) and visualized using the Zeiss 510 Laser Scanning Confocal Microscope.   The Zeiss 

510 is controlled by Zeiss LSM software for Microsoft Windows NT.  The Ar/HeNe lasers of the LSM 510 

29  

can excite fluorochromes with the following wavelengths in the visible spectrum: 458 nm, 476 nm, 488 

nm, 514 nm, 543 nm and 633 nm.  Tissue staining and microscopy were performed by Olga Sizova. 

Results 

Subcloning LpR2 into an Expression Vector In order to obtained the full‐length cDNA sequence of the gene, an E. coli clone containing LpR2 cDNA 

was  ordered  from  the  Canadian Drosophila Microarray  Centre  (CDMC).    The  curated  gene  from  the 

Drosophila  genome project  for  LpR2  is CG31092.   Two  variants of  this  gene were  available  from  the 

CDMC  and  both were  ordered.    These were  named  LD11117  (96 well  plate  reference UG74G6)  and 

GH26833  (96 well plate  reference  (CH14BE6)  and were  expected  to  contain 3.3kb  and  2.3kb  cDNAs, 

respectively.  LD11117 is available in pBS SK‐ which confers ampicillin resistance and was hence streaked 

onto LB plates supplemented with ampicillin.   GH26833 is available in p0T2 which conferred resistance 

to  chloramphenicol;  these  clones  were  therefore  grown  on  LB  plates  supplemented  with 

chloramphenicol at the appropriate concentration (Sambrook and Russell, 2001).  Plates were incubated 

at  37°C  overnight  and  well‐isolated  colonies  were  used  to  inoculate  3mL  of  liquid  LB  medium 

supplemented with  the  appropriate  antibiotic.    Liquid  cultures were  allowed  to  grow overnight  (~16 

hours) prior to harvesting.  Plasmid minipreparations were performed to isolate the plasmids containing 

the  two genes of  interest.   PCR was performed using primer pairs  LPR2A‐F/LPR2A‐R  for  the  LD11117 

clone and LPR2B‐F/LPR2B‐R for the GH26833 clone. 

Optimized  PCR  conditions were  required  for  the  two  separate  clones  due  to  differences  in  the G/C 

content and melting temperatures of the two primers, as well as the difference  in the size of the two 

amplicons.  Several template concentrations were used when amplifying GH26833 (1:100, 1:200, 1:500 

and 1:1000 template:solution).   Thermal cycling conditions were 95°C  (40s), 67°C  (40s) and 72°C  (70s) 

for 35 cycles.   A 2.3kb amplicon was generated in each of the template concentrations (figure 6).  PCR of 

Figure 6 Agarose gel electrophoresis of amplicons resulting from PCR reactions using templates LD1117 (lanes 1‐8) and GH26833 (lanes 9‐12).  White triangles indicate expected amplicon size (3.3kb lanes 1‐8 and 2.3kb lanes 9‐12).  PCR reactions in lanes 1‐4 were performed with an annealing temperature of 63°C while all other PCR reactions were performed at 67°C.  Lanes 1‐4, 5‐8, and 9‐12 comprise three sets of decreasing template concentrations (1:100, 1:200, 1:500, 1:1000).  Lane M represents the marker. 

30  

LD11117 was  attempted  in  the  aforementioned  concentrations  and  at  two  annealing  temperatures; 

thermal cycling conditions were 95°C (40s), 63°C/67°C (40s) and 72°C (80s) for 35 cycles.  Only the lower 

annealing temperature produced products with the expected 3.3kb amplicon size. 

Lanes 1‐4 and 9‐12 of the above figure were excised from the gel under ultraviolet light keeping care to 

minimize exposure times and damage to the DNA.  DNA was purified from the agarose for use with the 

Invitrogen TOPO TA cloning kit.  A 6μL ligation reaction was created (4.2μL purified PCR product, 0.6μL 

10X PCR buffer, 0.6μL 10X dNTP mix, 0.6μL pCR 2.1 TOPO vector).  This ligation mixture was left at room 

temperature  for  30 minutes.    1μL  of  this mixture  was mixture  was  used  in  the  electroporation  of 

TOP10F’ E. coli.   This mixture was spread over LB plates containing  the appropriate concentrations of 

ampicillin and X‐gal (Sambrook and Russell, 2001).   Ampicillin was used to  identify cells that had been 

transformed successfully while X‐gal was used to verify that the vectors had not undergone self‐ligation; 

thus, dark blue colonies were avoided.   Colonies were  selected and used  to grow  lawns on LB plates 

containing ampicillin.  A rapid disruption minipreparation was performed (Sambrook and Russell, 2001) 

and  the  results  are  shown  in  the  figure below.    Lane 10 of both  clone  types  represents  a dark blue 

colony selected as a negative control.  Colonies with motilities retarded compared to those of negative 

controls were selected for further analysis. 

Figure 7 Rapid disruption minipreparation of LD11117 and GH26833 pCR2.1 TOPO clones.  Lanes 1‐9 of both clones represent positive (white) colonies while lane 10 of both clones represents a negative (blue) colony used as a control.  White triangles show plasmids containing the insert which retards their mobility as compared with that of the two negative clones in lane 10.  As expected, the mobility of the LD11117‐containing plasmids is reduced compared to that of the GH26833 plasmids as a result of its their larger size. 

31  

In order to use the SalI and NotI restriction sites provided by the pCR2.1 TOPO vector to subclone the 

two  cDNA  sequences  into  pET21B,  the  orientation  of  the  cloned  inserts  needed  to  be  determined.  

Because the pCR2.1 TOPO cloning system relies only on TA cloning of the overhangs  remaining on PCR 

products, either insertion orientation was equally likely. 

Thus, to determine the orientation of the inserted PCR product, restriction sites engineered into the PCR 

primers LPR2A/B‐F and LPR2A/B‐R were used.   The primer pair used to amplify the LD11117 fragment 

contained a SalI restriction site on  the  forward primer and a HindIII site on  its reverse primer.    In  the 

correct orientation (figure 8) HindIII digestion of the pCR2.1 TOPO vector containing the LD11117 insert 

would yield a  large  fragment approximately corresponding  to  the  size of  the LD11117  insert  (3.3kb)  .  

Likewise, the primer pair used to amplify the GH26833 fragment contained a SalI restriction site on the 

forward primer and an XhoIII site on its reverse primer.  Therefore in the correct orientation in the TOPO 

vector, an XhoI digestion of the plasmid would not produce a fragment corresponding to the size of the 

insert  but  instead  would  produce  a  single  linear  fragment  corresponding  to  the  linearized  plasmid 

(figure 8).  Positive TOPO clones 1‐5 for both LD11117 and GH26833 (figure 7) were grown overnight in 

LB medium supplemented with ampicillin.   Cells were harvested and minipreparations of plasmid DNA 

were performed.   2μL of plasmid DNA was subjected  to a 15μL digestion  in 1.5μL 10X NEB restriction 

buffer, 0.5μL of either HindIII or XhoI and 11μL of deionized water.   Restriction digests demonstrated 

that  TOPO  clones  2,  3  and  4  generated  with  the  LD11117  PCR  product  were  suitably  oriented  for 

SalI/NotI subcloning while none of the clones of the GH26833 PCR product were suitable.  Given that the 

likelihood of  insertion  in either orientation  is 50%, the results of GH26833 TOPO cloning are extremely 

rare.   More of the white TOPO clones were examined using XhoI digests (data not shown) and all gave 

the  result  observed.    The  plausible  explanation  for  this  is  that, when  in  the  orientation  desired  for 

SalI/NotI cloning, the GH26833 insert does not interfere with the functioning of the LacZ component of 

the  TOPO  vector;  therefore  colonies  with  the  insert  in  the  correct  orientation  would  not  be 

distinguishable from colonies with no insert.  It was decided therefore to abandon the attempt to clone 

GH26833 and focus solely on LD11117. 

 

 

 

 

32  

 

Figure 8 Determination of possible orientations of LD11117 and GH26833 PCR fragments in pCR2.1 TOPO vector. A) Map of thepCR2.1 TOPO cloning site with black labeled insert; desired orientation of SalI/HindIII restriction sites are shown coloured andgray arrows indicate that the orientation of these sites is random. B) Same as above; desired orientation of SalI/XhoI restrictionsites are shown coloured.  C) Restriction digest of LD11117 and GH26833 TOPO clones 1‐5 with HindIII (left) and XhoI (right).3.3kb and 2.3kb bands are liberated LD11117 and GH26833 cDNA while 4kb bands are linearized TOPO plasmid. 

33  

Since  directional  insertion  into  pET21B was  desired,  (figure  8,)  an  LD11117  TOPO  clone was  doubly 

digested with SalI and NotI  in  the NEB  recommended buffer.   Two 40μL  reactions  (34μL TOPO  clone 

minipreparation  or  pET21B  minipreparation,  4μL  10X  NEB  digest  buffer,  1μL  SalI,  1μL  NotI)  were 

incubated at 37°C for two hours.   The products were electrophoresed and visualized (figure 9).   Bands 

were excised from the gel and then purified.   A 10μL  ligation reaction  (7.5μL digested LD11117 TOPO, 

1μL  digested  pET21B,  1μL  NEB  ligation 

buffer,  0.5μL  T4  DNA  ligase)  was 

incubated  at  room  temperature  for  4 

hours.    1μL  of  this  mixture  was  then 

transformed  into  DH5α  E.  coli.    The 

transformation mixture was  spread over 

LB plates and allowed to grow overnight.  

The  resulting  colonies  were  examined 

using a  rapid disruption minipreparation 

to ensure  tranformation with  the vector 

containing the  insert (figure 9).   7 clones 

that were examined exhibited a mobility 

shift corresponding to the presence of an 

insert.    The  DH5α  strain  of  E.  coli  was 

selected  for  transformation  due  to 

reduced  transformation  efficiencies 

when  trying  to  transform  ligated 

pET21B+LD11117  directly  into  the 

protein  expression  strain  BL21.    Thus, 

transformed  DH5α  E.  coli were  used  to 

inoculate 3mL of liquid medium and grown 

overnight.   Their plasmids were harvested 

and  then used  to  transform E.  coli of  the 

less  efficient  BL21  strain  for  protein 

expression  purposes.    DH5α  clones 

number 2 and 3 were arbitrarily chosen for 

this purpose (figure 9). 

Figure 9 a) Restriction digest of LD11117 TOPO insert as well as pET21Bvector in preparation for  ligation.  Digest was performed using SalI andNotI  incubated  at  37°C  for  2  hours.    Indicated  3.3kb  band  (LD11117insert)  and  6.0kb band  (linearized pET21B) were  excised  from  the  geland  purified.  b)  Electrophoresed  products  from  gel  extraction  andpurification technique.  The 6kb and 3.3kb bands of high purity indicatea  successful gel extraction.  c) Verification of  insertion based on  linearand  circularized  plasmid  mobility  shift.  d)  Rapid  disruptionminipreparation of positive DH5α E.  coli  clones;  clones 2, 3, 5, 6, 7, 9and 10 contain an insert and exhibit retarded mobility compared to thecontrol pET21B lane. 

34  

Verifying Correct Insertion of LpR2 into pET21B 

LpR2 (LD11117) was cloned into E. coli of the BL21 strain in order to allow inducible ectopic expression.  

Therefore, determination of the correct insertion orientation and functioning of the engineered plasmid 

was ultimately determined through expression studies.  Several BL21 expression clones which were able 

to grow on LB medium  supplemented with ampicillin  following  transformation with pET21B+LD11117 

were chosen for expression studies.  The LD11117 predicted protein sequence would yield a protein of 

1064  amino  acids  with  a molecular  weight  of  117kDa.    Because  the  pET21B  vector  adds  a  T7‐tag 

recognition  sequence  upstream  of  the  inserted  protein  sequence,  molecular  weight  numbers  are 

approximately accurate.  Single, well‐isolated colonies of 20 BL21 clones of LD11117 inserted in pET21B 

were each used to  inoculate 1mL of LB medium supplemented with ampicillin.   These cells were then 

incubated at 37°C for approximately 3 hours until reaching an optical density at 595nm of around 0.5.  

Cells were then induced with 1‐2mM IPTG for 3 hours.  Cells were harvested and resuspended in 50μL of 

2X SDS‐Sample buffer and homogenized.   Cells were  then placed  in a 100°C water bath  for 5 minutes 

and electrophoresed on an 8% polyacrylamide gel which was  then stained  in Coomassie brilliant blue 

and dried  (figure 10).   Despite  the ability  to see  the overexpression of glutathioine‐S  tranferase  (GST; 

~30kDa)  within  the  positive  control  BL21  strains  containing  pGEX,  no  overexpression  of  LpR2  was 

apparent.   

Figure 10 SDS‐PAGE expression of LD11117 (LpR2) BL21 E. coli clones after 3 hours induction in LB‐ampicillin.  The expected sizeof  this  expression  variant  of  LpR2  is  117kDa  and  no  band  is  apparent;  positive  control  lanes  (pGEX)  exhibit  obviousoverexpression of glutathione‐S  transferase  (GST) with a  visible band at 30kDa.   M  represents marker  lanes  (Bio‐rad BroadRange, unstained) with molecular weights noted in to the left of the figure. 

Empirical evidence has  suggested  that  changing  the expression medium  can  sometimes  facilitate  the 

expression of difficult proteins.  In addition, changing the concentration of IPTG can also have an effect. 

Therefore, to attempt to attain a suitable level of LpR2 overexpression from the BL21 clone, the above 

35  

procedure  was  repeated  with  two  variations:  rather  than  standard  LB  medium,  terrific  broth  (TB) 

medium was used (Sambrook and Russell, 2001).  Also, rather than 1‐2mM IPTG, 8mM IPTG was used to 

induce  the  clones  for  3  hours.    The  pET21  vector  series  provides  an  additional  mechanism  for 

determining whether the correct gene  is  inserted  in the correct reading frame and orientation; the N‐

terminal T7‐tag is an 11 amino acid sequence that is not found elsewhere in the bacterial proteome and 

is  therefore  likely  to only be  found  in  the expressed  tag on  the ectopic protein.   A western blot was 

therefore included (figure 11) to verify not only the size of the expressed protein attached to the T7‐tag, 

but  also  the  correct  orientation  (improperly  inserted  genes  are  likely  to  introduce  premature  stop 

Figure  11 Western  blot  and  Coomassie  stained  SDS‐PAGE  gels  to  verify  the  presence  and  overexpression  of  LD11117(LpR2)  in pET21B.   Left  two  lanes: monoclonal mouse anti‐T7  tag antibody detects  the presence of a 117kDa peptide  inLD11117  E.  coli  but  not  in  control  pGEX  lines  expressing  ectopic  glutathione‐S  transferase  (GST).    Right  two  lanes:Coomassie blue staining detects an overexpressed 30kDa band in pGEX control cells and a 117kDa band in LD11117 cellswhich is not present in control lines.  M: Bio‐rad Broad Range SDS protein standards. 

36  

codons into the coding sequence and hence produce a smaller protein).  The results demonstrated that, 

under the correct induction conditions, ectopic expression of LpR2 was possible in LD11117 E. coli BL21 

clones.  Additionally, the overexpressed T7‐LpR2 was correctly identified by the monoclonal anti‐T7 tag 

antibody  indicating  that  the overexpressed protein with  a  size of 117kDa was not  artifactual.   While 

these data  indicate  that  the BL21  clones are  likely  to  contain  the  correct  insert,  sequencing was also 

performed.   The sequences yielded (figure 12) demonstrate clearly that the LD11117 PCR product was 

inserted in the correct orientation into the pET21B vector.  Sequencing accuracy was low in the centre of 

the gene (as each sequence read  is only effective to around 700 base pairs) but the accuracy at the 5’ 

and  3’  ends  of  the  inserted  gene  was  sufficient  to  confirm  insertion.

 

Figure 12 Sequences of  LD11117  clones  in pET21B vector minipreparations  from E.  coli BL21  strain. a) Multiple  cloning  site orientation  and  sequence  from  pET21  vectors.    The  T7  promoter  and  terminator  primers  indicated  here  were  used  in sequencing and flank the inserted sequence.  d) Abridged sequence alignment showing only the 5’ and 3’ ends of the sequence indicating a correct  insertion.   Cap_LD203F  indicates the sequence resulting  from the T7 forward primer; cap_203R  indicates the reverse compliment of the sequence resulting from the T7 terminator primer; cap_LpR2A represents the known sequence of  the  LD11117  Drosophila  genome  project  clone;  contig‐0  represents  the  consensus  generated.    Shaded  areas  represent identity between the 5’ and 3’ ends of the known sequence and the 5’ and 3’ sequences of the LD11117 pET clone. 

37  

Generation of anti­LpR Serum The design of  the antigen used  to create  the antiserum against  the  lipophorin receptor was of critical 

importance.    Rather  than  designing  at  least  four  different  antigens,  (against  each  of  the  predicted 

lipophorin  receptor  sequences,)  a more efficient  approach of developing  a  single  antiserum  targeted 

against all  four predicted  receptor  sequences was chosen.   This was done  for  two  reasons; designing 

multiple  antisera  would  be  costly  and  time‐consuming.    Also,  because  this  work  is  an  initial 

characterization of the Drosophila  lipophorin receptor, promiscuous antisera could be used to  identify 

probable  areas  of  expression which  could  later  lead  to  the  design  of more  specific  antisera.    Four 

Drosophila polypeptides were chosen as templates of the lipophorin receptor; these were based on the 

four  sequences  (named  BmLpR1,  BmLpR2,  BmLpR3  and  BmLpR4)  of  the  silk  worm  Bombyx  mori 

(Gopalapillai et al., 2006).  Using a BLAST (basic local alignment search tool) search (Altschul et al., 1990), 

it was determined that these sequences corresponded to four variants of two different drosophila genes 

(DmLpR1 and DmLpR2). 

The design of the ideal antigen (herein referred to as LpRv1) would encompass several characteristics: it 

would share minimal sequence similarity with other proteins of the study organism,  its counterpart on 

the protein of interest would be exposed to the aqueous solution and not buried within the hydrophobic 

core, and it would maximize the immune response of the injected animal.  Of paramount importance is 

the lack of sequence similarity with other proteins in the study organism; should there be any sequence 

similarity, the antigen  injected  into the  immunizing animal could produce antibodies with promiscuous 

affinities.    In the case of the design of the antibody used  in this work, cross‐reactivity was desired but 

only among the four proteins mentioned.   Several other receptor molecules share sequence homology 

with DmLpR1/2 so antigenic areas had to be chosen carefully.   The antigenic region used to  inject the 

immunizing animals had to be exposed on the protein rather than buried in the hydrophobic core.  This 

was especially pertinent  for a membrane‐bound  receptor  such as  LpR;  should an antigenic  region be 

chosen  that  is buried  in  the native  conformation of  the protein,  the  immunized animal may produce 

antibodies  specific  to  it,  but  they  may  be  ineffective  in  tissue  preparations  in  which  the  protein 

conformation protects  the antigen.   Hydrophobic portions of  the protein are  likely  to be buried  in  its 

core or, in the case of a membrane‐bound receptor, part of the transmembrane region that is unlikely to 

be exposed to the surrounding medium.  To ensure that only exposed regions of the protein were used 

as antigens, hydropathy indices (the extent to which peptide sequences are hydrophobic) were  

38  

 Figure 13 a) Adapted (Gopalapillai et al., 2006).  Schematic representation of the domains in the B. mori lipophorin receptor; cysteine‐rich repeats of the ligand binding domains (I‐VIII), cysteine‐rich repeats of the EGF precursor homology domain (A‐C), O‐linked oligosaccharide domain (O), transmembrane domain (T) and cytosolic domain (CY). b) ClustalW alignment of the top four sequences matching the B. mori LpR sequences.  Poor regions for antigen choice in developing anti‐LpR are indicated in red (transmembrane) or blue (cytoplasmic).  Acceptable regions are shown in green.  Stars beneath each peptide indicate identity among all four sequences. 

considered in the design process.  This consideration also maximizes the ability of the antigen to elicit an 

immune response in the host animal (figure 13). 

The  region  ultimately  chosen  as  an  antigen was NH2‐TQSIYKAPIDEGN‐C‐COOH.    The NH2  and  COOH 

represent  the amino and carboxy  termini of  the peptide.   A cysteine  residue had  to be added  to  the 

sequence in order to allow sulfur‐based conjugation between the peptide and KLH.  This region had the 

least  cross‐reactivity potential with other Drosophila proteins.    In  addition,  it was present  in  all  four 

isoforms  of  the  Drosophila  lipophorin  receptor  and  had  a  negative  hydropathy  index,  indicating 

hydrophilicity. The sequence was sent to Pacific  Immunlogy  inc. (Ramona, CA).   Peptide chemists used 

39  

solid‐phase peptide synthesis to produce the 15 amino acid peptide and then conjugated it to the carrier 

protein prior to  injecting  it  into rabbits.   Rabbits were maintained on a 13 week protocol during which 

they  received  four  injections of  immunogen.   During  this  time, a  single pre‐immune  serum as well as 

four production bleeds and one final exsanguination from each rabbit was received.  The LpRv1 antigen 

was injected into two New Zealand white rabbits to maximize the potential for developing high affinity 

antibodies. 

Western Blot Testing of LpRv1 Several avenues were explored to test the specificity, quantity and affinity of the LpRv1 antisera.   The 

cloned LD11117 peptide proved useful because it allowed testing of the antisera in a medium that was 

likely to contain high levels of cross‐reactivity; this is logical considering that the immune system of each 

rabbit is likely to contain at least some antibodies against E. coli peptides.  In addition, by ensuring that 

the  commercially  available  anti‐T7 monoclonal  antibody  recognized  the  same  peptide  as  the  LpRv1 

antiserum, we were able to verify its relative specificity.  More important, however, is the performance 

of the antiserum in lysates collected from Drosophila.  Thus, each serum collection (production bleeds, 

pre‐immunization bleeds and  final bleeds) was  tested  in a Canton‐S and yellow‐white per0 Drosophila 

background  using  separated heads  and bodies of  the  animals.    The  yellow‐white  per0  control  simply 

served  in  this  case as an additional background  strain and  could hence  confirm  results obtained  in a 

Canton‐S background.    In all cases of  the LpRv1 antisera, production bleed 1 was virtually  identical  to 

production bleed 2 and was hence omitted.   Alkaline phosphatase development was used for the first 

set of blots  (figure 14) because of  its  relatively  inexpensive development  reagents as  compared with 

chemiluminescent development.   For the same reason, pure nitrocellulose was used rather than PVDF 

membranes. 

Pre‐immune  sera  collected  from  both  rabbits  repeatedly  showed  little  or  no western  blot  reactivity 

(figure 14).  Because colorimetric development was used, pre‐immune blots were allowed to develop for 

a greater  length of  time  (around 15  to 20 minutes)  than blots  incubated with production  sera.   This 

allowed  us  to  ensure  that  there  was  no  reactivity  of  the  rabbit  serum  prior  to  injection  with  the 

immunogen.    In  both  rabbits,  relative  background  detection  levels  seem  to  decrease  between  the 

second production bleed and  the  final bleed with  the  least  relative background on  the  fourth or  final 

bleeds.  Interestingly, the two rabbits seem to have generated isoform‐specific antibodies.  Because the 

same  immunogen  was  used  to  immunize  both  rabbits,  such  specificity  is  purely  an  artifact  of  the 

unpredictability of the mammalian immune system.  The first immunized rabbit (rabbit 1) seems to have 

40  

an affinity for an approximately 100 kDa peptide; several variants of the Drosophila lipophorin receptor 

1 and 2  (CG31095 and CG31092,  respectively) are of  this approximate size.   Thus,  it appears  that  the 

immune  sera  of  this  rabbit  recognize  the  correct  peptide.    The  second  immunized  rabbit  (rabbit  2) 

produced antisera with an affinity towards a  larger peptide between 100 and 150 kDa  (approximately 

115  kDa).    Several  variants  of  the  gene  products  at  the  aforementioned  loci  correspond  to  this 

approximate size and it is therefore likely that the immune sera of this rabbit also recognize a lipophorin 

receptor variant.   

 

Figure  14  Immune  serum  testing  for  LpRv1  (anti‐DmLpR).    Canton‐S  and  per0  fly  lysates  were  electroblotted  onto  pure nitrocellulose membranes and the antisera from two different rabbits (Rabbit 1 and Rabbit 2) were used at a dilution of 1:2000 on ten replicate blots.   Bio‐rad Goat anti‐rabbit secondary antibodies were used at a dilution of 1:5000.   Lanes are  labeled as follows: m (Bio‐Rad Kaleidoscope® prestained marker; visible bands are 250kDa, 150kDa, 100kDa, 75kDa) h (heads) b (bodies).  Heads  and  bodies  were  collected  and  electrophoresed  for  both  Drosophila  genotypes.    Black  arrows  represent  probable lipophorin receptor immunoreactivity and are situated at molecular weights of ~100kDa (Rabbit 1) and ~115kDa (Rabbit 2). 

 

 

41  

Another interesting observation is the fact that the first rabbit almost exclusively recognizes peptides in 

the body of the fly, while the second rabbit almost exclusively recognizes peptides  in the head  (figure 

14).  This could suggest that the variant to which the serum of each rabbit has more affinity is present in 

larger quantities  in the two tissues.   In any case, both sera are useful and their differences on western 

blots will be useful in determining which peptides are most likely to be expressed in different tissues. 

The observation that LpRv1 sera recognize a peptide at approximately the correct molecular weight  is 

not sufficient to claim that  it recognizes the Drosophila  lipophorin receptor.   In order to verify this, we 

used the cloned T7‐LpR (LD11117 in pET21) lysates from E. coli.  Verification that the peptide recognized 

by  the  anti‐T7  tag  antibody  is  the  same  peptide  recognized  by  the  LpRv1  serum  is more  concrete 

evidence demonstrating  the specificity of the polyclonal antibody.   Samples of heads and bodies  from 

Canton‐S flies as well as lysates from E. coli containing the LD11117 PCR product in pET21 as well as E. 

coli  containing  a  control  peptide  unrelated  to  LpR2 were  electroblotted  onto  PVDF membranes  and 

visualized using ECL. 

 

Figure 15 Western Blots of Canton‐S heads and bodies, E. coli lysates containing LD11117 (Lpr2) in pET21 or control peptide in pET21.  Lane labels are as follows: m (marker, Bio‐rad Kaleidoscope® prestained marker) h (heads) b (bodies) T7‐LpR (LD11117 PCR product  in pET21B) T7‐Control  (Drosophila peptide unrelated  to  LpR  in pET21).   Relevant marker bands are marked at 150kDa and 100kDa.  Three anti‐sera were used: LpRv1 Rabbit 1 bleed 4 (left), LpRv1 Rabbit 2 bleed 4 (middle) and monoclonal anti‐T7 (right).  Black arrows represent peptides of interest. 

It is clear from the above figure (figure 15) that the peptides recognized by LpRv1 from each rabbit are 

indeed related to the LD11117 sequence of LpR2 cloned into E. coli.  As with the tests featured earlier, 

the first  immunized rabbit seems to retain  immuno‐specificity for a  lower molecular weight version of 

42  

the  lipophorin receptor.   Once again,  the second rabbit seems  to be  immunoreactive against a higher 

molecular weight (~115kDa) peptide as with test bleeds.   Since this peptide more closesly matches the 

molecular weight of the cloned LD11117 sequence, they appear as nearly equal molecular weights on 

western blots.    In both cases, the T7‐LpR peptide  is clearly  illuminated by the antibody and provides a 

much clearer  signal  than either  fly  lysate.   Additionally,  the T7‐control  lane only contains background 

immunoreactivity that  is obvious  in either E. coli  lysate.     The monoclonal anti‐T7 antibody recognizes 

the T7‐LpR sequence demonstrating a clear and precise band at approximately 115 kDa.  As expected, it 

recognizes fragments of the control peptide in the lane to the right as well. 

As a final test of the  immunospecificity of the LpRv1 antibody, the sera were tested  in preparations of 

Drosophila who were deficient  in  their production of  LpR2.   To accomplish  this,  stocks were ordered 

from the Exelixis Drosophila Stock Center at Harvard Medical School.  These stocks contained piggyback 

insertions which, though uncharacterized, were expected to disrupt the gene of interest.  Each of these 

stocks as well as the gene notation of their insertions is shown in table 1. 

Table 1 A  list of the gene disrupting  insertions ordered  from the Exelixis Drosophila Stock Center at Harvard Medical School.  Contained  in the  list are the stock code,  insertion notation and rack  location for ordering.   Stocks contained piggy back or p‐elements and were thought to disrupt LpR2 expression. 

Stock Code  Insertion  Rack Location C02771  PBac[PB]LpR2c02771  XC161‐0338‐D11 E00374  PBac[RB]LpR2e00374  XC162‐4148‐A12 E01190  PBac[RB]LpR2e01190  SP102‐1714‐C04 E03380  PBac[RB]LpR2e03380  SP167‐3181‐B02 F03030  PBac[WH]LpR2f03030  STOUT‐2966‐B09 D04404  P[XP]LpR2d04404  SP332‐1789‐C04  

43  

 

Figure 16 Western blot analyses of stocks obtained from the Exelixis Drosophila Stock Center at Harvard Medical School.  Flies were  separated  into  heads  (h)  and  bodies  (b)  for  each  genotype.    Control  flies  of  the  yellow‐ white‐  genotype  (yw) were employed.  Markers were omitted for clarity as only relevant portions of the blot are shown.  Black arrows represent the band of interest; as before rabbit 1 recognizes a band of approximately 100kDa while rabbit 2 recognizes an approximately 115kDa band.    The  immunoreactive product  in  rabbit  1  appears  to be  at  a higher  relative  concentration  than  that of  some of  the mutants.    The  immunoreactive  product  from  rabbit  2  does  not  change  appreciably  between  yellow‐  white‐  controls  and mutants. 

Western blot data resulting from the mutant stocks is difficult to interpret.  In samples from rabbit 1 in 

the figure 16, yellow‐ white‐ (yw) controls appear to have a higher  level of the peptide of  interest than 

some of  the other  fly genotypes.   This  is not absolute, however, given  that at  least equal quantity of 

immunoreactivity seen with this antiserum in stocks of E01190 and E03380.  In all stocks and genotypes, 

as  expected,  Rabbit  1  recognized  a  peptide  in  the  head  of  approximately  100kDa  while  rabbit  2 

recognizes a peptide  in predominantly body preparations of approximately 115kDa.   All Exelixis stocks 

obtained disrupt the gene LpR2 which should be immunoreactive with the antibody.  We were unable to 

find stocks containing deletions or disruptions from any of the public stock centres for LpR1.  However, 

given  the observation  that  the antiserum  from  rabbit 1 shows some decline  in  immunoreactivity with 

some  preparations  of  the  LpR2‐disrupted  stocks  and  rabbit  2  does  not,  it  seems  that  rabbit  1  has 

produced an antibody more  suited  to  LpR2 while Rabbit 2 has produced an antibody more  suited  to 

LpR1.   From these data we might also assume that LpR1  is the variant expressed predominantly  in the 

body of the fly while LpR2  is expressed predominantly  in the head.   This conjecture  is, of course, only 

partially substantiated by our results. 

44  

Ligand Blotting Assay Information  about  the  Drosophila  lipophorin  receptor  results  mainly  from  comparisons  with  other 

species.    Transcript  and  protein  product  information  is  based on  predicted  sequences  and  therefore 

requires  substantiation  through experimental evidence.   Therefore, while  the predicted  sequences of 

DmLpR1  and DmLpR2  and  their numerous  transcripts  suggest  that  they have  ligand binding domains 

specific to lipophorin, this has yet to be determined experimentally.  In order to do this, we used a ligand 

blotting  assay  (figure  17).    Also  called  a  far western  blot,  this  type  of  assay  relies  on  an  additional 

hybridization partner in the ligand identification process.  A western blot is prepared in the usual fashion 

with the exception that at least one lane of the animal lysate is not subjected to the denaturing effects 

of  dithiothreitol,  β‐mercaptoethanol,  or  extensive  heating.    The  blot  is  incubated with  the  ligand  of 

interest  (in  this  case  lipophorin) prior  to  antibody  incubation.  The blot  is  then developed using  anti‐

lipophorin antibodies and the appropriate secondary antibody.  As mentioned in chapter 1, lipophorin is 

composed of two molecular components deemed ApoLpI and ApoLpII.  The larger component ApoLpI is 

250kDa while  the  smaller  is  75kDa.    Neither  of  these  sizes  is  similar  to  the  100‐115kDa  lipophorin 

receptor and hence a band on the ligand blot corresponding to this size range is indicative of a positive 

result (the anti‐lipophorin antibody detecting lipophorin bound to its receptor).  We would expect that, 

since the  lipophorin  ligand  is added to the solution and not electroblotted,  it will be washed off unless 

specifically bound  to  its  receptor.   Bands  are 250kDa  and 75kDa  corresponding  to one of  the native 

apolipophorin molecules are also expected since they constitute a portion of the Drosophila lysate used. 

 

Figure  17 A  schematic  representation of  the  ligand blot  assay used  to determine whether or not  the predicted Drosophila lipophorin  receptor  is  able  to  bind  lipophorin.    Lipophorin  (as  well  as  many  other  proteins)  are  electroblotted  onto nitrocellulose  and  then  incubated  with  lipophorin,  followed  by  anti‐LpI  or  anti‐LpII  and  then  the  appropriate  alkaline phosphatase‐conjugated  secondary  antibody.    The  results  of  this  blot  indicate  the  position  of  lipophorin  bound  to  the membrane through an interaction with the lipophorin receptor. 

45  

Prior to the ligand blot, lipophorin needed to be isolated (see materials and methods for procedure).  In 

vitro or ectopic expression methods such as cloned lipophorin components would not have sufficed for 

this procedure;  the  lipophorin must be  in  its approximate native  conformation  in order  to  retain  the 

ability  to bind  to  its  receptor.    In order  to verify  the  lipophorin content of  the collected haemolymph 

DEAE‐cellulose eluents, a western blot was performed using both rat and‐LpI and rabbit anti‐LpII (figure 

18). 

 

Figure 18 Western blots to determine the specificity of the anti‐ApoLpI and anti‐ApoLpII antibodies as well as to determine the titer of native lipophorin within haemolymph extracts.  Black arrows represent the expected band size of each apolipoprotein (250kDa for ApoLpI and 75kDa for ApoLpII). In each case, eluent 2 appears to contain the maximum immunoreactivity with the sera.  Specificity of the anti‐ApoLpI antibody is questionable (left) but specificity of anti‐ApoLpII is acceptable (right). 

 

Each of the three eluates  from the DEAE‐cellulose chromatography performed on native haemolymph 

extracts were used  in the western blot.   Rat anti‐ApoLpI antibodies detected a band at approximately 

46  

250kDa  in each eluate but displayed the maximum  immunoreactivity  in the case of the second eluate.  

Unfortunately,  despite  the  large  immunoreactivitiy,  specificity  was  questionable  as  a  result  of  the 

numerous extra bands  in the second  lane.   Although these bands could represent background noise of 

the western blot, their absence  in the other  lanes  is suggestive of a non‐specific antibody.   The rabbit 

anti‐ApoLpII,  conversely,  displayed  remarkable  specificity  in  all  three  eluates  also  with  strong 

immunoreactivity in the second eluate.  Therefore, each of the eluates contains at least a small amount 

of relatively pure native  lipophorin;  in addition, each of the antisera against the two apolipoproteins  is 

relatively specific but the anti‐ApoLpII seems to have very clean immunoreactivity. 

The  ligand blot was performed as  indicated  in the materials and methods (figure 19).    It was expected 

that only blot  incubated with one of  the haemolymph DEAE‐cellulose eluates would produce a  signal 

and  this was  confirmed by  the absence of  immunoreactivity on blots  incubated with  control  solution 

instead.   No eluates  in  the absence of denaturing conditions produced any bands at  the approximate 

molecular weight of  the  lipophorin  receptor when detection was performed with  the  rat anti‐ApoLpI 

antibody.   In fact, smears  in each of these  lanes suggest  improper electrophoresis and potential  ligand 

binding given that these smears are absent under the control  incubation condition.   Under denaturing 

conditions,  a  250kDa  band was  visible  in  all  three  eluate  incubations  suggesting  that  it was  ApoLpI 

derived from the fly lysates.  The absence of such a band in the control incubation with 0.2M phosphate 

buffer is surprising and not readily explicable. 

Under denaturing conditions  in all four treatments performed with the rabbit anti‐ApoLpII antibody, a 

75kDa band  is visible (figure 19).   This  likely corresponds to the denatured ApoLpII from the fly  lysates 

electroblotted  onto  the  nitrocellulose.    The  lanes  with  fly  lysate  prepared  under  non‐denaturing 

conditions show remnants of a 75kDa band suggesting only partial denaturing as well as, in the case of 

incubation with haemolymph eluate 2, a band at approximately 100kDa.  Because several variants of the 

predicted Drosophila lipophorin receptor are of approximately this size, this band likely results from an 

interation between haemolymph‐borne lipophorin and its receptor immobilized on the western blot. 

47  

 

Figure 19 Ligand blot analysis of whole Canton‐S lysates.  Lysates were prepared under denaturing (95°C, dithiothreitol) or non‐denaturing conditions and electrophoresed on polyacrylamide gels.   Proteins were electroblotted onto nitrocellulose wherein they were incubated with a 1:500 dilution of one of the substances listed below each blot (0.2M phosphate buffer, one of three DEAE‐cellulose haemolymph eluates).  Blots were then incubated with one of two primary antibodies at a dilution of 1:2000. a) Rat anti‐apoLpI, b) Rabbit anti‐ApoLpII.   Development using  the appropriate secondary antibody reveals  the position of both lectroblotted and incubated lipophorin components.  Black arrows at 250kDa, 75kDa, and 100kDa represent immunoreactivity ith apoLpI, ApoLpII and lipophorin receptor‐bound apoLpII, respectively. 

ew

48  

 

 

Effects of Lipophorin Receptor RNAi Two Drosophila  lines  containing antisense RNA directed against DmLpR1 and DmLpR2 were obtained 

from the Vienna Drosophila RNAi Centre (Dietzl et al., 2007).   Antisense RNA (RNAi) was placed under 

the control of the yeast upstream activating sequence (UAS) which can be conditionally activated by the 

presence of the yeast transcriptional activator GAL4.   Both the RNAi  line against LpR2 (CG31092, VDRC 

No.  25684)  and  LpR1  (CG31095, VDRC No.  14756) were  crossed  into  lines  containing  the UAS‐DCR2 

construct (see materials and methods).  Information about the sequence and lethality of both RNAi lines 

is provided (Dietzl et al., 2007). 

These UAS‐RNAi; UAS‐DCR2 lines were crossed to several GAL4 lines: embryonic lethal abnormal vision 

(elav), pigment dispersing factor (pdf), R32 (clock‐cell specific), and heat shock.  The expression pattern 

of elav‐GAL4 has been described as panneuronal; R32  is known to be expressed  in all clock cells of the 

Drosophila brain while pdf is expressed in a subset of these.  Finally, the heat shock promoter is known 

to be approximately constitutively active but more strongly activated at temperatures of 37°C.  Thus, for 

two days prior to any testing, lines containing the heat‐shock GAL4 construct were heat shocked at 37°C 

for  one  hour  at  the  same  circadian  time  each  day.    To  determine  if  any  of  these  GAL4  lines  in 

combination with the two RNAi‐DCR2 lines had an effect on the behavior of male Drosophila, flies were 

placed in activity monitors.  Flies were allowed to entrain to a 12:12h light‐dark cycle for at least 3 days 

and were then placed  in  total darkness to monitor the  free‐running rhythm.   Flies were monitored by 

summing  the activity of beam breaks which occur each  time  the  fly  traverses  its activity  tube  in one 

minute intervals and performing analyses on the data (see materials and methods, figures 20‐24).  Flies 

whose activity patterns indicated that they had not survived the entire duration of the testing period or 

had only survived some part  thereof were removed  from  the analysis  in all cases.   Certain  flies which 

appeared to be arrhythmic were examined and removed where indicated. 

49  

 

Figure  20  Activity  statistics  generated  for  the  following  lines  in  approximately  10  days  of  total  darkness:  UAS‐LpR1 RNAi/heatshock‐GAL4  (top,  n=16), UAS‐LpR2  RNAi/heatshock‐GAL4  (middle,  n=16), w1118/heatshock‐GAL4  (bottom,  n=16).  Having no RNAi construct to interfere with gene expression, the third line should act as a control line.  Shown are actograms of summed activity (left), corrected and averaged activity data (middle) and an autocorrelation plot containing estimates of the period as well as its significance (RS>1.0 indicates significance, RI indicates the vertical value of the * on the plot) (right). 

50  

 

 

Figure 21 Activity statistics generated for the following  lines  in approximately 10 days of total darkness: UAS‐LpR1 RNAi/pdf‐GAL4  (top, n=16), UAS‐LpR2 RNAi/pdf‐GAL4  (middle, n=15), w1118/pdf‐GAL4  (bottom, n=16).   Having no RNAi  construct  to interfere with gene expression,  the  third  line  should act as a  control  line.    Shown are actograms of  summed activity  (left), corrected  and  averaged  activity data  (middle)  and  an  autocorrelation plot  containing estimates of  the period  as well  as  its significance (RS>1.0 indicates significance, RI indicates the vertical value of the * on the plot) (right). 

51  

 

Figure 22 Activity statistics generated for the following  lines  in approximately 10 days of total darkness: UAS‐LpR1 RNAi/R32‐GAL4  (top, n=16), UAS‐LpR2 RNAi/R32‐GAL4  (middle, n=15), w1118/R32‐GAL4  (bottom, n=16).   Having no RNAi construct  to interfere with gene expression,  the  third  line  should act as a  control  line.    Shown are actograms of  summed activity  (left), corrected  and  averaged  activity data  (middle)  and  an  autocorrelation plot  containing estimates of  the period  as well  as  its significance (RS>1.0 indicates significance, RI indicates the vertical value of the * on the plot) (right). 

52  

 

Figure 23 Activity statistics generated for the following lines in approximately 10 days of total darkness: UAS‐LpR1 RNAi/ELAV‐GAL4 (top, n=16), UAS‐LpR2 RNAi/ELAV‐GAL4 (middle, n=12), w1118/ELAV‐GAL4 (bottom, n=5).   Having no RNAi construct to interfere with gene expression,  the  third  line  should act as a  control  line.    Shown are actograms of  summed activity  (left), corrected  and  averaged  activity data  (middle)  and  an  autocorrelation plot  containing estimates of  the period  as well  as  its significance (RS>1.0 indicates significance, RI indicates the vertical value of the * on the plot) (right). 

53  

 

Figure 24 Activity statistics generated for the following lines in approximately 10 days of total darkness: UAS‐LpR1 RNAi/w1118 (top, n=15), UAS‐LpR2 RNAi/w1118 (bottom, n=15).  Both lines were used as heterozygotes to test and control for the amount of  leaky  expression  of  the  RNAi  construct  that  could  occur  independent  from  GAL4  activation.    Shown  are  actograms  of summed activity (left), corrected and averaged activity data (middle) and an autocorrelation plot containing estimates of the period as well as its significance (RS>1.0 indicates significance, RI indicates the vertical value of the * on the plot) (right). 

54  

 

Figure 25 Bar graphs representing the average periods obtained for each of the 14 genotypic combinations placed  in activity tubes. Genotypes are shown on the  lower axis, mean period on the y axis.   Error bars represent 95% confidence  intervals for period estimates.    In each graph,  from  left  to  right, genotypes are UAS‐LpR1 RNAi/GAL4, UAS‐LpR1 RNAi/w1118, UAS‐LpR2 RNAi/GAL4, UAS‐LpR2 RNAi/w1118, w1118/GAL4. Letters above each bar represent statistically homogenous subgroups based on Tukey’s HSD post‐hoc comparisons of means. a) One‐way ANOVA; F[4,73]=10.4, p<1.0x10

‐6.  b) One‐way ANOVA; F[4,72]=3.2, p= 0.017.  c) One‐way ANOVA; F[4,72]=5.5, p= 0.0006. d) One‐way ANOVA; F[4,58]=0.94, p= 0.45.   Because  the difference  in mean period was not statistically significant  in the case of the elav‐GAL4 driver  line comparison, Tukey’s HSD post‐hoc test was not performed. 

55  

 

Figure 26 Bar graphs representing the average periods obtained for each of the 14 genotypic combinations placed in activity tubes once flies determined to be arrhythmic had been removed. Genotypes are shown on the lower axis, mean period on the y axis.  In each graph, from left to right, genotypes are UAS‐LpR1 RNAi/GAL4, UAS‐LpR1 RNAi/w1118, UAS‐LpR2 RNAi/GAL4, UAS‐LpR2 RNAi/w1118, w1118/GAL4.  Error bars represent 95% confidence intervals for period estimates.  Letters above each bar represent statistically homogenous subgroups based on Tukey’s HSD post‐hoc comparisons of means. a) One‐way ANOVA; F[4,73]=10.4, p<1.0x10

‐6.  b) One‐way ANOVA; F[4,71]=2.6, p= 0.043. c) One‐way ANOVA; F[4,69]=5.9, p= 0.0003. d) One‐way ANOVA; F[4,54]=1.03, p= 0.40.  Because the difference in mean period was not statistically significant in the case of the elav‐GAL4 driver line comparison, Tukey’s HSD post‐hoc test was not performed. 

56  

 

Figure 27 Selected representative actograms from individual flies.  Genotypes are indicated in the top left corner of each of the eight actograms.  The top left actogram of genotype elav‐GAL4/w1118 is representative of a rhythmic fly while the other seven actograms are representative of the arrhythmic flies removed during some of the analyses.  At the left side of each actogram are labels for each day; the day indicated as well as the next day are shown on a single line.  Each day is therefore represented twice in an actogram.  The notches at the bottom of each actogram represent the hours within a single day; because there are two days, a total of 48 hours are represented  in each  line.   Black triangles  indicate the  last time a 12:12  light‐dark cycle was used to entrain the fly.  Driven rhythms (those occurring as a result of a light‐dark cycle) occurred on days 1 through 3 and their activity has been omitted from this figure. 

Table 2 Average period (hours) and percent arrhythmicity by genotype as judged by actograms collected on individual 4‐6 day old males of each genotype.  Arrhythmic actograms are shown in figure 27.  Period calculations are shown in figures 20‐24. 

Genotype  Total  Arrhythmic  % Arrhythmic  Period (h) 

UAS‐LpR1 RNAi / hs‐GAL4  16  0  0%  24.4 UAS‐LpR2 RNAi / hs‐GAL4  16  0  0%  24.1 w1118 / hs‐GAL4  16  0  0%  23.9 UAS‐LpR1 RNAi / R32‐GAL4  16  2  13%  24.5 UAS‐LpR2 RNAi / R32‐GAL4  15  0  0%  24.4 w1118 / R32‐GAL4  16  0  0%  24.3 UAS‐LpR1 RNAi / pdf‐GAL4  16  1  6%  24.1 UAS‐LpR2 RNAi / pdf‐GAL4  15  0  0%  23.8 w1118 / pdf‐GAL4  16  0  0%  24.1 

57  

UAS‐LpR1 RNAi / elav‐GAL4  16  2  13%  24.0 UAS‐LpR2 RNAi / elav‐GAL4  12  2  17%  23.8 w1118 / elav‐GAL4  5  0  0%  24.0 UAS‐LpR1 RNAi / w1118  15  0  0%  24.5 UAS‐LpR2 RNAi / w1118  15  0  0%  24.2  

Figures  20  through  24  demonstrate  averaged  activity  analysis  plots  for  each  genotype  used  in  the 

LpR1/LpR2 RNAi experiment.  A period was yielded for each genotype and is shown in table 2. 

Periods for  individual flies were calculated through generation of  individual actograms similar to those 

found in figures 20‐24 (not shown).  The three genotypes produced for each GAL4 driver line (UAS‐LpR1 

RNAi,  UAS‐LpR2  RNAi  and  w1118)  along  with  the  two  control  lines  UAS‐LpR1/w1118  and  UAS‐

LpR2/w1118  were  compared  in  four  one‐way  ANOVA  statistical  tests.    Tests  of  heat  shock‐GAL4 

(F[4,73]=10.4, p<1.0x10‐6), R32‐GAL4 (F[4,72]=5.5, p= 0.0006) and pdf‐GAL4 (F[4,72]=3.2, p= 0.017) were found 

to be statistically significant while a test of elav‐GAL4 lines revealed no statistically significant difference 

in period (F[4,58]=0.94, p= 0.45).  On statistically significant differences in period, a Tukey’s HSD post‐hoc 

comparison of means was performed.  In the case of the heat shock‐GAL4 lines, it was found that UAS‐

LpR1 RNAi/ hs‐GAL4 as well as UAS‐LpR1 RNAi/w1118 produced statistically homogenous period which 

were  also  statistically  distinct  from  that  of  the  w1118/hs‐GAL4  control  line.    While  the  pdf‐GAL4 

statistical test revealed an effect of genotype on period, the Tukey’s HSD comparison revealed that both 

LpR RNAi lines had statistically homogenous period with the control line w1118/pdf‐GAL4.  Finally, while 

both UAS‐LpR2 RNAi/w1118 and UAS‐LpR2 RNAi/R32‐GAL4  lines had  statistically equal periods  to  the 

control  line w1118/R32‐GAL4, UAS‐LpR1  RNAi/w1118  and UAS‐LpR1  RNAi/R32‐GAL4  had  statistically 

longer periods. 

Because  the effect of arrhythmic  flies present  in  the analysis  (see  figure 27,  table 2)  could mask  the 

potential  results of period  comparisons,  they were  removed  and  the  above  analyses were  repeated.  

Once more, tests of heat shock‐GAL4 (F[4,73]=10.4, p<1.0x10‐6), R32‐GAL4 (F[4,69]=5.9, p= 0.0003) and pdf‐

GAL4  (F[4,71]=2.6,  p=  0.043) were  found  to  be  statistically  significant while  a  test  of  elav‐GAL4  lines 

revealed no  statistically  significant difference  in period  (F[4,54]=1.03, p= 0.40).   Because no  flies  in  the 

heat shock‐GAL4 set of experiments were determined  to be arrhythmic,  this adjustment did not alter 

significance.  Significance was doubled by the removal of several arrhythmic flies in the case of the R32‐

GAL4  experiment,  while  it  was  nearly  abolished  in  the  case  of  pdf‐GAL4.    As  before,  elav‐GAL4 

experiments did not reveal a significant difference in period.  As before, a Tukey’s HSD post‐hoc analysis 

58  

was  carried  out.    The  analysis  did  not  change  in  the  case  of  the  heat  shock‐GAL4  and  pdf‐GAL4 

experiments.    In  the  case  of  the  R32‐GAL4  experiment,  however,  UAS‐LpR2  RNAi/R32‐GAL4  had  a 

statistically distinct and shorter period from all other lines considered. 

It was  also  noted  that  several  of  the  LpR  RNAi  constructs  in  trans with GAL4  driver  lines  produced 

arrhythmic  flies.   While these  flies were excluded  from some analyses with regard to period, they are 

intriguing mainly because no arrhythmic flies of any control genotype (including UAS‐LpR1 RNAi/w1118 

or  UAS‐LpR2  RNAi/w1118)  were  observed  (see  table  2).    Percent  arrhythmicity  was  minimal;  the 

maximum proportion of arrhythmic flies within one genotype was 17% (2 out of 12 flies) in the case of 

UAS‐LpR2 RNAi / elav‐GAL4.   This  is surprising given that the genotypes of this particular GAL4  line did 

not yield statistically different periods.  Most crosses did not produce arrhythmic flies. 

In  addition  to  the  behavior  of  the  files  resulting  from  the  GAL4/UAS‐RNAi  crosses,  their  cuticular 

hydrocarbons were also considered.   Given the tangible relationship between  lipophorin and cuticular 

wax in other species, we wanted to determine the effects, if any, which might result from disruption of 

one of the two lipophorin receptor classes in Drosophila melanogaster on cuticular hydrocarbons.  Thus, 

5 male  flies  from each genotype  that were 4‐6 days old were placed  individual  in hexane  to removed 

their  cuticular wax  and  the  resultant  solution was  subjected  to  gas  chromatgrophy  and  analysis  (see 

materials and methods).  In the case of progeny bearing the heat shock‐GAL4 contruct, they were heat 

shocked at least twice at 37°C at the same circadian time of day prior to hydrocarbon extraction.  For all 

genotypes, hydrocarbons were extracted at the same circadian time.   Cuticular hydrocarbons from the 

three genotypes produced for each GAL4 driver line (UAS‐LpR1 RNAi, UAS‐LpR2 RNAi and w1118) along 

with the two control lines UAS‐LpR1/w1118 and UAS‐LpR2/w1118 were compared in a one‐way ANOVA 

statistical test for each hydrocarbon compound.  P‐values are shown in the table 3 below.  Values of all 

hydrocarbon species have been normalized to the added standard, nC26. 

   

59  

Table  3  Comparison  of  statistical  significance  by  GAL4  driver  line  and  cuticular  hydrocarbon.    One‐way  ANOVA  statistical analyses were performed on  the cuticular hydrocarbons  from  the  three genotypes produced  for each GAL4 driver  line  (UAS‐LpR1 RNAi, UAS‐LpR2 RNAi and w1118) along with the two control lines UAS‐LpR1/w1118 and UAS‐LpR2/w1118.  These GAL4 driver lines comprise the columns of the table.  Each hydrocarbon was analyzed separately and the results are shown in each row.  Non‐significant differences in hydrocarbon quantity among genotypes in each experiment are filled in green; moderately significant  differences  (0.001<p<0.05)  are  shaded  in  orange while  strongly  significant  differences  (p<0.001)  are  not  filled.  Hydrocarbons  denoted  nCXX  comprise  saturated  hydrocarbons  of  chain  length  XX.    Hydrocarbons  denoted  by  CXX:1(A) comprise monounsaturated hydrocarbons of  length XX with unsaturation at position A.   Hydrocarbons denoted by 2MeCXX comprise methylated compounds with a methyl group at position 2 and length XX.  cVA represents cis‐vaccenyl acetate. 

GAL4 Driver/ Hydrocarbon  elav‐GAL4  pdf‐GAL4  R32‐GAL4  hs‐GAL4 

nC18 0.20849  0.001337  0.003043  0.007703 

nC21 1.15E‐06  3.95E‐06  0.003371  0.000989 

C22:1(7) 0.075592  1.37E‐07  0.037567  0.019352 

cVA 0.00494  0.003361  0.262018  0.226506 

nC22 5.46E‐09  6.51E‐07  2.23E‐05  2.68E‐07 

C23:1(9) 0.000259  0.000533  0.010348  0.149218 

C23:1(7) 4.49E‐06  0.004836  0.055439  0.003452 

C23:1(5) 1.26E‐05  0.000657  0.000891  0.000241 

nC23 3.28E‐09  6.12E‐06  8.41E‐06  0.000546 

C24:1(9) 7.03E‐05  2.59E‐05  9.99E‐06  0.006622 

C24:1(7) 2.6E‐08  0.042364  0.00497  0.017697 

C24:1(5) 0.001706  4.42E‐05  1.19E‐05  0.001834 

nC24 7.04E‐07  3.61E‐05  2.47E‐07  4.81E‐05 

2MeC24 1.66E‐06  0.000179  0.000122  6.85E‐05 

C25:1(9) 0.003508  0.842919  0.165333  0.075484 

C25:1(7) 4.95E‐09  0.053826  1.29E‐07  0.003231 

C25:1(5) 2.65E‐09  0.993703  0.00128  0.800813 

nC25 6.14E‐05  0.000101  1.48E‐06  0.00068 

nC26 .  .  .  . 

2MeC26 1.69E‐09  1.8E‐08  2.56E‐07  9.28E‐11 

C27:1(7) 5.88E‐06  0.003818  0.015854  0.016842 

nC27 1.19E‐06  0.00079  4.49E‐09  4.53E‐08 

nC28 0.000493  0.011524  0.000156  0.000764 

2MeC28 0.00121  0.004114  0.000245  8.07E‐08 

nC29 5.3E‐05  0.001337  2.82E‐05  4.3E‐07 

2MeC30 0.004343  3.95E‐06  0.001205  3.66E‐05  

Several hydrocarbon species appeared to be undisturbed by the perturbation of the lipophorin receptor 

in  these experiments.   Because nC18  is not  found within  the repertoire of hydrocarbons produced on 

the fly, it was expected to be non‐ (or marginally) significant for each of the driver lines.  Because nC26 is 

the standard to which all other hydrocarbon values are normalized,  its value was static and hence not 

60  

considered  in  statistical  analyses.    Cis‐vaccenyl  acetate  (cVA)  was  noted  to  have  little  statistical 

significance  throughout  these  analyses.   Most  other  hydrocarbon  species were  at  least moderately 

affected  by  perturbations  in  lipophorin  receptor  RNA.    Several  species were  strongly  affected  by  all 

driver lines used. 

Because hydrocarbons may tend to behave in classes rather than as individual and distinct compounds, 

they were also compared in this respect.  Thus, the same comparison as above was carried out with the 

exception  that,  rather  than  individual  compounds,  groups  of  compounds were  used  as multivariate 

response  variables.    MANOVA  was  thus  carried  out  on  three  separate  classes  of  hydrocarbons 

(saturated, unsaturated and methylated).   The p‐values  from Pillai’s trace were the most conservative 

and are hence reported for this analysis.  The MANOVA demonstrated that, when considered as classes 

rather  than  individuals,  all  GAL4  driver  line  experiments  produced  strong  effects  in  the  cuticular 

hydrocarbons of the individual flies. 

Table 4 Table of p‐values of Pillai’s trace results from a Multivariate ANOVA (MANOVA) comparing the effects of genotype (three genotypes produced for each GAL4 driver line (UAS‐LpR1 RNAi, UAS‐LpR2 RNAi and w1118) along with the two control lines UAS‐LpR1/w1118 and UAS‐LpR2/w1118) on hydrocarbon class (multivariate).    

Hydrocarbon Class / GAL4 Driver 

Saturated  Unsaturated  Methylated 

elav‐GAL4  <0.001  <0.001  <0.001 pdf‐GAL4  0.002  <0.001  0.002 R32‐GAL4  <0.001  0.002  <0.001 hs‐GAL4  <0.001  <0.001  <0.001 

 

   

61  

 

Figure 28  Individual comparison of hydrocarbon quantities  in each genotype.   Hydrocarbon  identity  is  indicated as the y‐axis title.   Bars on  the x‐axis  represent means  from each genotype.   Shorthand notations are used: LpR1  (UAS‐LpR1 RNAi), LpR2 (UAS‐LpR2 RNAi), w (w1118), hs (heat shock‐GAL4), pdf (pdf‐GAL4), elav (elav‐GAL4), r32 (R32‐GAL4).   Error bars represent the standard error of the mean.  Within each group of a single GAL4 experiment, the three treatments were compared with a one‐way ANOVA and Tukey’s HSD post‐hoc comparison of means (if applicable).   Groups whose means were statistically different from the control group (w1118/GAL4) are indicated by black lines; * represents 0.001<p<0.05, ** represents p<0.001. 

62  

 

Figure 29  Individual comparison of hydrocarbon quantities  in each genotype.   Hydrocarbon  identity  is  indicated as the y‐axis title.   Bars on  the x‐axis  represent means  from each genotype.   Shorthand notations are used: LpR1  (UAS‐LpR1 RNAi), LpR2 (UAS‐LpR2 RNAi), w (w1118), hs (heat shock‐GAL4), pdf (pdf‐GAL4), elav (elav‐GAL4), r32 (R32‐GAL4).   Error bars represent the standard error of the mean.  Within each group of a single GAL4 experiment, the three treatments were compared with a one‐way ANOVA and Tukey’s HSD post‐hoc comparison of means (if applicable).   Groups whose means were statistically different from the control group (w1118/GAL4) are indicated by black lines; * represents 0.001<p<0.05, ** represents p<0.001. 

63  

 

Figure 30  Individual comparison of hydrocarbon quantities  in each genotype.   Hydrocarbon  identity  is  indicated as the y‐axis title.   Bars on  the x‐axis  represent means  from each genotype.   Shorthand notations are used: LpR1  (UAS‐LpR1 RNAi), LpR2 (UAS‐LpR2 RNAi), w (w1118), hs (heat shock‐GAL4), pdf (pdf‐GAL4), elav (elav‐GAL4), r32 (R32‐GAL4).   Error bars represent the standard error of the mean.  Within each group of a single GAL4 experiment, the three treatments were compared with a one‐way ANOVA and Tukey’s HSD post‐hoc comparison of means (if applicable).   Groups whose means were statistically different from the control group (w1118/GAL4) are indicated by black lines; * represents 0.001<p<0.05, ** represents p<0.001. 

64  

 

Figure 31  Individual comparison of hydrocarbon quantities  in each genotype.   Hydrocarbon  identity  is  indicated as the y‐axis title.   Bars on  the x‐axis  represent means  from each genotype.   Shorthand notations are used: LpR1  (UAS‐LpR1 RNAi), LpR2 (UAS‐LpR2 RNAi), w (w1118), hs (heat shock‐GAL4), pdf (pdf‐GAL4), elav (elav‐GAL4), r32 (R32‐GAL4).   Error bars represent the standard error of the mean.  Within each group of a single GAL4 experiment, the three treatments were compared with a one‐way ANOVA and Tukey’s HSD post‐hoc comparison of means (if applicable).   Groups whose means were statistically different from the control group (w1118/GAL4) are indicated by black lines; * represents 0.001<p<0.05, ** represents p<0.001. 

65  

The 22‐carbon aliphatic hydrocarbon nC22 was found to be multiply affected by specific perturbations in 

the  lipophorin receptor (figure 28).   Under ubiquitous knock down of the receptor, with the UAS‐RNAi 

constructs  under  the  promotional  control  of  the  heat  shock  promoter,  nC22  was  found  to  be 

significantly less abundant than the control condition of hs‐GAL4/w1118.  Additionally, under panneuronal 

knock down as driven by the elav‐GAL4 line, a similar reduction in the abundance of nC22 was observed 

in  the  case of UAS‐LpR2 RNAi while an equally  significant  increase  in nC22 was observed when elav‐

GAL4 was used to drive UAS‐LpR1 RNAi.   Although mean  levels of nC22 under the control condition of 

pdf‐GAL4/w1118 were elevated  in comparison with other control  flies, pdf driven knockdown of either 

LpR reduced nC22 abundance.  Finally, despite a tendency visible in figure 28, R32‐driven knock‐down of 

either LpR did not provide statistically different abundances of nC22 as compared with R32‐GAL4/w1118. 

The unsaturated pheromone C23:1(5) was also strongly affected by some of the knock‐down conditions 

(figure  28).    Panneuronal  knock  down  of  either  LpR  proved  to  reduce  its  abundance  several  fold;  it 

appeared, however, that the control condition elav‐GAL4/w1118 produced abnormally high  levels of this 

hydrocarbon.    This  pattern  was  apparent  in  several  other  hydrocarbon  species  and,  though 

extraordinary,  represents  the mean  of  five male  flies  and  is  hence  unlikely  to  have  resulted  from 

measurement error.  Ubiquitous knock‐down of LpR1 produced statistically lower levels of C23:1(5) than 

controls  but  no  effect  was  observed  when  LpR2  was  knocked  down  under  the  same  promotional 

control.    Knock‐down  of  both  LpRs  under  the  control  of  R32‐GAL4  reduced  C23:1(5)  abundance 

significantly but no  significant difference  in  its abundance was detected under  the  control of  the pdf 

promoter.    It  should be noted  that  the control  condition UAS‐LpR2 RNAi/w1118  seemed quite variable 

and produced a high standard error of the mean. 

nC23 was found to be reduced compared to controls only when LpR2 was knocked down panneuronally; 

UAS‐LpR1  RNAi/elav‐GAL4    and  elav‐GAL4/w1118  produced  homogenous  levels  of  nC23.    Ubiquitous 

knock‐down of LpR1 under the heat shock promoter, conversely, produced statistically reduced levels of 

nC23 while  similar  knock‐down  of  LpR2  had  no  effect.    The  results  of  both  R32  and  pdf‐controlled 

knockdown of either LpR are the same; abundance of nC23 was reduced in both cases (figure 29). 

nC24 was found to behave strangely when LpR1 or LpR2 was knocked down under the control of elav‐

GAL4 (figure 29).  LpR1 knock‐down produced statistically higher levels of nC24 while LpR2 knock‐down 

had  the  opposite  effect.    In  the  case  of  heat  shock‐GAL4  and  R32‐GAL4,  knock‐down  of  either  LpR 

reduced the  levels of nC24  in a strongly significant manner.   Under the control of pdf‐GAL4, however, 

only knock‐down of LpR2 produced statistically lower levels of nC24 than controls. 

66  

Levels of 2MeC24 were among the most labile in these experiments as compared with other methylated 

hydrocarbons.    Statistically,  however,  only  under  the  control  of  elav‐GAL4  were  levels  of  2MeC24 

different from controls.  Knockdown of either receptor under the control of elav‐GAL4 reduced levels of 

2MeC24.    All  other  treatment  groups were  relatively  homogenous  (figure  30).    2MeC26  (figure  31) 

behaved  in  a nearly  identical  fashion  to 2MeC24  further demonstrating  that hydrocarbons  are more 

likely to behave in groups than as individuals.  As with 2MeC24, 2MeC26 was knocked down when either 

RNAi construct was placed under the control of elav‐GAL4 compared to elav‐GAL4/w1118 control flies. 

The alphatic hydrocarbon nC25 (figure 30) was strongly affected under several experimental conditions.  

The  two  clock‐cell promoters R32‐GAL4  and pdf‐GAL4  affected  this hydrocarbon equally;  levels were 

strongly  reduced compared  to controls when either LpR was knocked down.    In  the case of  the more 

ubiquitous knock‐downs  such as elav  (panneuronal) and heat  shock  (ubiquitous),  levels of nC25 were 

reduced only when LpR2 was knocked down while levels remained homogenous with those of controls 

when LpR1 was knocked down. 

The  longest aliphatic hydrocarbon  to be strongly affected  in most cases was nC27  (figure 31).   Oddly, 

while  elav‐GAL4/UAS‐LpR2  RNAi  produced  levels  of  nC27  that  were  statistically  homogenous  with 

controls, elav‐GAL4/UAS‐LpR1 RNAi  flies exhibited  close  to  a  three‐fold  increase  in nC27.   Under  the 

control  of  the  heat  shock  promoter  and  the  pdf  promoter,  only  knock‐down  of  LpR2  produced 

statistically  lower  levels  of  nC27.   Under  the  control  of  the R32  promoter,  however,  knock  down  of 

either LpR strongly reduced levels of nC27. 

67  

 

Figure 32 Comparison of total hydrocarbon quantities  in each genotype obtained from adding the normalized values of each hydrocarbon compound for each fly.  Bars on the x‐axis represent means from each genotype.  Shorthand notations are used: LpR1  (UAS‐LpR1 RNAi),  LpR2  (UAS‐LpR2 RNAi), w  (w1118),  hs  (heat  shock‐GAL4),  pdf  (pdf‐GAL4),  elav  (elav‐GAL4),  r32  (R32‐GAL4).    Error  bars  represent  the  standard  error  of  the mean.   Within  each  group  of  a  single GAL4  experiment,  the  three treatments were compared with a one‐way ANOVA and Tukey’s HSD post‐hoc comparison of means  (if applicable).   Groups whose  means  were  statistically  different  from  the  control  group  (w1118/GAL4)  are  indicated  by  black  lines;  *  represents 0.001<p<0.05, ** represents p<0.001. 

 

In addition to individual hydrocarbons, total hydrocarbon quantities on the cuticles of the males used in 

the RNAi experiments were also compared  (figure 32).   Total  levels of hydrocarbon were obtained for 

each male  considered  by  adding  the  quantities  of  the  individual  hydrocarbons which were  originally 

normalized  to  the standard nC26.   Because nC26  is present  in a  fixed amount, adding  the normalized 

values  together provides a valid,  if not absolute, measure of  total hydrocarbon content.   Within each 

group  of  a  GAL4  experiment  (GAL4/w1118,  GAL4/UAS‐LpR1  RNAi,  GAL4/UAS‐Lpr2  RNAi)  the  three 

genotypes  were  compared  via  one‐way  ANOVA  and,  if  found  to  be  significant,  were  divided  into 

homogenous subgroups through a Tukey’s HSD post‐hoc comparison of means.   Groups whose means 

68  

were  statistically  distinct  from  the  GAL4/w1118  control  line  were  considered  to  have  different 

hydrocarbon quantities. 

elav‐GAL4 driven knock‐down of LpR1 and LpR2 produced statistically lower total hydrocarbon quantity 

on  the  cuticle.   This difference was  substantial  (nearly  three‐fold)  in  the  case of elav‐GAL4/UAS‐LpR2 

RNAi.  When ubiquitously driven by the heat shock promoter, both RNAi lines produced lower levels of 

total  hydrocarbon  but  only  the  difference  between  controls  and  UAS‐LpR1  RNAi  was  found  to  be 

statistically significant.  A similar case was observed in the case of pdf‐driven knock‐down of LpRs.  Only 

in  the case of UAS‐LpR2 RNAi were  total hydrocarbon  levels statistically  lower  than  those of controls.  

Finally, as with elav‐GAL4, R32‐GAL4 driven reduction of either LpR RNAi strongly reduced hydrocarbon 

quantities.    The  hydrocarbon  quantities  of  the  control  lines  UAS‐LpR1  RNAi/w1118  and  UAS‐LpR2 

RNAi/w1118 were  generally  lower  than  each  set  of  GAL4/w1118  lines.    This  could  represent  potential 

leakiness of the UAS‐RNAi constructs. 

To confirm that the effects observed  in both activity and hydrocarbon experiments are the result of a 

reduction  in the abundance of one of the  lipophorin receptor peptides, a western blot was performed 

using LpRv1 serum harvested from both rabbits 1 and 2 (figure 33). 

69  

 

Figure 33 Western blot analysis of elav‐GAL4, pdf‐GAL4, R32‐Gal4 or heat  shock‐GAL4 placed  in  trans with either UAS‐LpR1 RNAi or UAS‐LpR2 RNAi  in male  flies.   Heads were  separated and electrophoresed  separately  from  the  remainder of  the  fly (lanes h and b).  LpRv1 antiserum from rabbit 1 was used in (a) and that from rabbit 2 was used in (b).  Main bands recognized by the antisera in previous tests are indicated with black arrows (100kDa for rabbit 1 (a) and 115kDa for rabbit 2 (b)) although other bands may be apparent. 

70  

Despite  relatively  strong phenotypic data  resulting  from  the UAS‐RNAi  constructs,  there  is no  strong 

indication of a knock‐down of the protein product of either LpR1 or LpR2 from western blot data (figure 

33).  Antisera from rabbit 1, as discovered during the testing phase, recognize several potential peptides 

in  fly body  lysates and one particular peptide  (~90kDa)  in  the  fly head.   Neither of  these appears  to 

change appreciably between GAL4/w1118 lines and GAL4/UAS‐RNAi lines.  One exception may be the two 

lower molecular weight  bands  in  the  fly  body  lysates  of  hs‐GAL4/w1118  as  compared with UAS‐LpR2 

RNAi/hs‐GAL4 which appears noticeably  lighter.   An  interesting result obtained from the serum of this 

rabbit is the lack of a band in the head lysates of elav‐GAL4/w1118 as comapared with elav‐GAL4 in trans 

with either UAS‐RNAi  line.   This  is  indeed opposite of our expectations and may be an experimental 

artifact. 

Antisera from rabbit 1, as before, recognize a peptide relatively strongly at approximately 115kDa with 

dominant immunoreactivity in head lysates.  Very little variability in immunoreactivity is apparent when 

using this antiserum.  In accordance with the unexpected results obtained in the elav‐GAL4 experimental 

lines when  LpRv1  serum  from  rabbit  1 was  used,  UAS‐LpR1  RNAi/elav‐GAL4  appears  to  have much 

higher immunoreactivity in the head lysates as compared with elav‐GAL4/w1118. 

Whole­Mount Tissue Staining Using LpRv1 LpRv1 anti‐serum provided  reliable  results using western blotting  techniques  to  identify  the extent  to 

which  tissues  or  genotypes  express  variants  of  the  lipophorin  receptor.    To  identify  the  areas  of 

localization of the protein confocal microscopy was used.  The brains of female flies aged 5‐8 days were 

dissected and fixed prior to staining with LpRv1 alone or in combination with other antibodies and then 

staining  with  secondary  antibody  (see  materials  and  methods).    As  with  western  blotting,  it  was 

apparent  that  the  sera  from  the  two  different  immunized  rabbits  recognized  different  areas  of  the 

Drosophila brain (figures 34 and 35).   LpRv1 rabbit 1 appeared to recognize cells at the anterior of the 

Drosophila brain near the point at which the optic  lobe meets the rest of the brain.   At  least two (and 

sometimes three) cells were strongly labeled in each preparation; results were repeated to confirm that 

these  cells were  not  being  labeled  as  artifacts.    Pre‐immune  sera  from  this  particular  rabbit  do  not 

strongly  label any cells  in  the vicinity of  those  labeled by LpRv1 Rabbit 1 bleed 4  (figure 34, panel c).  

These results were confirmed in multiple specimens. 

71  

 

Figure 34 Whole mount tissue staining of adult female Drosophila brains of age 5‐8 days using LpRv1 antiserum from rabbit 1, bleed 4.  a) and b) represent different depths of the same brain stained with LpRv1 rabbit 1, bleed 4 using the 20X objective.  c) shows  a  representative  brain  stained with  the  pre‐immune  serum  from  the  same  rabbit  and was  generated with  the  20X objective.  e) represents the the portion of a) enclosed by a white box and was created with the 40X objective.  f) represents the portion of b) enclosed by a white box and was created with the 40X objective.   Strongly  labeled cells are  indicated by white arrows in panels a, b, d and e.  Alexafluor® 568‐conjugated goat anti‐rabbit IgG was used as a secondary antibody. 

72  

 

Figure 35 Whole mount tissue staining of adult female Drosophila brains of age 5‐8 days using LpRv1 antiserum from rabbit 2, bleed 4.  Both images were taken using the 20X objective.  a) represents the pre‐immune serum of LpRv1 rabbit 2 while b) represents LpRv1 rabbit 2 bleed 4.  Strongly labeled cells are indicated by white arrows. Alexafluor® 568‐conjugated goat anti‐rabbit IgG was used as a secondary antibody. 

 

73  

 

Figure 36 Whole‐mount tissue staining of adult female Drosophila brains of age 5‐8 days using LpRv1 antiserum from rabbit 2, bleed 4 as well as anti‐PDF serum produced in guinea pig.  Secondary antibodies were Alexafluor® 488‐goat anti‐rabbit IgG and Cy5‐goat anti‐guinea pig IgG.  A 40X objective was used in a) while a 20X objective was used in b).  Conditions were identical in a) and b) except that pre‐immune serum, rather than production bleed, was used as anti‐LpR. 

LpRv1 rabbit 2 appeared to recognize cells near the posterior (bottom) of the Drosophila brain near the 

point at which  the optic  lobe meets  the  rest of  the brain.   One, or potential  two  cells were  strongly 

labeled  in  each  preparation;  results  were  repeated  to  confirm  that  these  cells  were  not  staining 

artifacts.  Pre‐immune sera from this particular rabbit confirm that these results have not been obtained 

in  err;  staining  of  the whole  brain  using  LpRv1  rabbit  2  pre‐immune  serum  produces  brains  lacking 

strongly labeled cells (figure 34, panel a). 

To determine if LpR is found in clock neurons, we used whole‐mount tissue staining with two antibodies; 

the first was directed against pigment dispersing factor (pdf), which is known to label a subset of clock 

cells in the Drosophila brain. The second was LpRv1 rabbit 2 bleed 4.  It was found that, while LpRv1 and 

74  

anti‐PDF  label  the  same  set of approximately  four distinct  cells  (figure 36, panel a),  this  labeling was 

shared when LpRv1 was exchanged for pre‐immune serum from LpRv1 rabbit 2 (figure 36, panel b).  The 

labeling  is not  identical  in both experiments, but  in each case the anti‐PDF  labels the same neurons as 

LpRv1 as well as its control; these results were repeatable.  This suggests that staining of the clock cells 

by LpRv1 during these experiments may have been artifactual. 

Discussion 

LpRv1 Recognizes the Lipophorin Receptor The specificity of LpRv1 as well as  its affinity  for  the  lipophorin  receptor was  tested  in multiple ways.  

The first method used was ectopic overexpression of an LpR variant in E. coli.  This was accomplished by 

sub‐cloning  LpR2  transcript  E  (CG31092)  into  the  Novagen®  pET21  expression  vector.    Despite  our 

inability to clone both of the  lipophorin receptor variants  (CG31095)  into a suitable expression vector, 

the  cloned  LpR2  should  be  sufficient  to  demonstrate  the  efficacy  of  the  antibody.    Primarily,  the 

antibody was  raised against a  sequence  that was common  to  the variants of  the  lipophorin  receptor.  

Thus, despite a lack of variety in the E. coli expression controls, LD11117 in pET21 should suffice.  Also, 

there are  least 10 transcripts predicted for the Drosophila  lipophorin receptor and each has a differing 

coding  sequence.    The  inability  to  obtain  all  of  these  transcriptional  variants  in Drosophila Genome 

Project  clones would make  verification  that  LpRv1  recognizes  all  LpR  variants with  equal  specificity 

impossible.    It  is, however, reasonable to clone more LpR transcript variants  for  further verification of 

LpRv1  as  each  variant may  have  different  folding  patterns which may  obscure  or  enhance  antibody 

reactivity.  This is unlikely to affect SDS‐PAGE western blots as they depend on the denaturation of the 

antigen prior to its electrophoresis; it may, however, be useful in experiments using native‐PAGE. 

LpRv1 antiserum  from both rabbits was able  to recognize  the cloned LpR  (figure 15).    In addition,  the 

same band was identified by a monoclonal anti‐T7 antibody.  Because the T7‐tag epitope is absent in E. 

coli,  this  is  acceptable  verification  that  LpRv1  recognizes  the  same  peptide  as  anti‐T7;  hence,  LpRv1 

recognizes T7‐LpR2.  E. coli controls are a useful and convenient method for testing an antibody but are 

ultimately foreign to the model organism of interest.  Because they ectopically express a foreign protein, 

there  is a possibility that  it will not be synthesized properly due to the physiological conditions within 

the bacterium.   There  is also a possibility  that  the overexpression of LpR  in E. coli does not  reflect  is 

proportions in fly tissues; thus a specific antibody with weak affinity may recognize overexpressed LpR2 

75  

but  fail to recognize a peptide  in Drosophila  lysates.    It was  for these reasons that LpRv1 bleeds were 

tested in western blots of fly lysates (figure 14).  

Strangely, given that the rabbits used for immunization were injected with the same peptide sequence, 

each rabbit produced a serum that seemed to be preferentially reactive with a different variant of the 

lipophorin  receptor.    Because  both  LpR1  and  LpR2  produce  variants with molecular weights  ranging 

from 90 to 120kDa, it is impossible to judge the contributing LpR variant from the simple size difference 

between the  immunoreactive peptides.   The western blots  indicate not only a size difference between 

the immunoreactive peptides, but a potentially interesting tissue distribution. Flies in these experiments 

were separated into head and body preparations.  It was found that antisera from rabbit 1 recognized a 

100kDa band in fly body lysates with relatively little reactivity in heads.  By contrast, serum from rabbit 2 

exhibited  a  different  phenomenon  in which  a  slightly  larger  band  (~115kDa) was  recognized  almost 

exclusively in the head of the fly while a much lighter band of this size was detected in the body.  If the 

100kDa band  represents one or  several variants of  the  lipophorin  receptor,  its  size at  least  rules out 

several variants.   The band could represent multiple similarly sized peptides, and  its  level of reactivity 

could represent either differential immunoreactivity of LpRv1 with variants of the receptor or different 

expression  levels  of  LpR  variants.    The  100kDa  band  is  likely  to  be  LpR1‐PA,  LpR1‐PC,  LpR2‐PF,  or  a 

combination of those.  The 115kDa band has a greater number of possibilities: LpR1‐PB, LpR1‐PF, LpR2‐

PA, LpR2‐PC, LpR2‐PE or LpR2‐PG.  Once more, some combination of these is equally possible.  The band 

or bands reacting with LpRv1 could be identified if more precise western blotting tools were used. 

Other bands exist  in  the western blots performed  to date but  their presence  is deemed background.  

The presence of high molecular weight bands with dense  immunoreactivity could also be glycolylsated 

lipophorin receptor.   Without a Drosophila control  line  in which all  forms of LpR have been removed, 

such  as  a  null mutant,  the  confounding  bands  found  using  LpRv1  cannot  be  completely  considered 

background  and  could  represent  degradation  products  of  LpR.    Because  LpR  is  ectopic  to  E.  coli, 

however,  and  because  E.  coli  overexpressing  ectopic  proteins  not  related  to  LpR  show  little 

immunoreactivity on western blots with LpRv1, we judge the antibody to be relatively specific. 

What  could  cause  the  two different  rabbits  to develop  antisera with  varying degrees of  specificity  is 

unclear.    The  only  reasonable  explanation  is  that  the  antibodies  produced,  assuming  that  the  local 

amino  acid  environment  influences  their  interaction with  LpR, were  somehow  unable  to  reach  the 

epitope in some versions of the lipophorin receptor. 

76  

While a lipophorin receptor null mutant would have been the most useful fly genotype in characterizing 

LpRv1,  a  sufficient  reduction  in  LpR  protein  content  would  serve  the  purpose  equally  well.  

Unfortunately  no  experimental  evidence  has  verified  any mutant  stock which  exhibits  reduced  LpR 

expression.   We  ordered  several  stocks  from  the  Exelixis  stock  collection  at Harvard Medical  School 

(table 1) each containing a p‐element mediated insertion that was thought to disrupt the LpR2 gene.  It 

was clear that LpRv1 Rabbit 2 Bleed 4 did not recognize any difference among the genotypes indicating 

that either  this  antiserum  is  ineffective or  it  recognizes more  specifically  some  variant of  LpR1.   The 

second  possibility  is  more  likely  given  the  affinity  of  production  bleeds  of  rabbit  2  for  ectopically 

overexpressed T7‐LpR.  LpRv1 Rabbit 1 Bleed 4 showed some difference in the 100kDa band among the 

genotypes  considered.    The  100kDa  band  appears  to  be  reduced  in  most  of  the  stock  genotypes 

compared to yellow‐ white‐ except  in the case of E01190.   Since characterization of these  lines has not 

been performed,  it  is  impossible  to determine whether or not  this  result  is  spurious.   Western blots 

were repeated many times with these  lines, each generating a similar result.   At the very  least,  it does 

not rule out the efficacy of LpRv1. 

The Lipophorin Receptor Binds Lipophorin We performed a ligand blotting assay (figures 17 and 19) to determine whether or not a peptide the size 

of the lipophorin receptor identified by LpRv1 binds to lipophorin itself.  In order to perform the ligand 

blotting  assay  we  collected  Drosophila  haemolymph  using  a  modified  procedure  which  has  been 

described  (Lucas  et  al.,  2004).   While  ectopic  overexpression  of  lipophorin may  have  been  a more 

suitable  method  to  obtain  purified  lipophorin,  the  two  apolipoproteins  that  constitute  mature 

lipophorin  are  known  to  require post‐translational  processing  and  are hence unlikely  to be  correctly 

translated  in E. coli (Kutty et al., 1996; Smolenaars et al., 2005).   Three 1mL eluates of DEAE‐cellulose‐

purified  haemolymph  exhibited  strong  immunoreactivity  with  the  anti‐ApoLpI  and  anti‐ApoLpII 

antibodies (figure 18).   From figure 18,  it appeared that the second haemolymph eluate contained the 

most ApoLpI and ApoLpII (and, by inference, the most native lipophorin before being subjected to SDS‐

PAGE).  The second eluate, also appeared to have the least refined immunoreactivity in the case of anti‐

ApoLpI;  it  showed multiple  bands  of  lower molecular weight  than  the  predicted  250kDa  suggesting 

potential  degradation  of  the  antigen  or  cross‐reactivity  of  the  antibody.    Anti‐ApoLpII,  conversely, 

showed strong immunoreactivity against the second eluate which was well‐localized to the 75kDa range 

of the expected band.  Thus, it was expected that the anti‐ApoLpII antibody would yield clearer results in 

the ligand blot. 

77  

The Anti‐LpI antibody, while giving a clear signal at 250kDa in the denatured lane, produced a cryptically 

strong signal in the native lane of the gel (figure 19).  The denatured lane acts as an internal control for 

the antibody and confirms  its affinity for ApoLpI; the extensive reactivity throughout the native  lane  is 

difficult  to  interpret.   The  structure of ApoLpI has not been well  studied;  it  is  therefore possible  that 

under  non‐denaturing  electrophoresis  conditions,  its  movement  within  a  polyacrylamide  gel  is 

unpredictable  and  does  not  correspond with  its  size.    This would  explain  the  relatively widespread 

reactivity  in  the  native  lane.    It  is  also  unclear  why  the  control  gel  for  ApoLpI  showed  no 

immunoreactivity; because fly lysates were used rather than in vitro transcribed LpR as in other studies 

(Lee et al., 2003) we would expect to identify a band at the approximate size of ApoLpI in all cases. 

The experimental ligand blots using the anti‐ApoLpII antibody suggest that the lipophorin receptor does 

bind  lipophorin or, more specifically, a compound containing ApoLpII that  is believed to be  lipophorin.  

As  in  the  case  of  anti‐ApoLpI,  there  is  a  dearth  of  immunoreactivity  in  the  control  blot  in which  no 

lipophorin was used; in the denatured lane there is a trace of immunoreactivity at approximately 75kDa.  

This band is apparent in both lanes of the other three blots (figure 19).  When haemolymph eluate 2 was 

used, however, a band of approximately 100kDa  is observed  in the native  lane but not the denatured 

lane.  This result supports the proposition that the 100kDa band identified by LpRv1 is indeed a variant 

of  the Drosophila  lipophorin  receptor.   Several problems exist, however.   Because  there are multiple 

variants  of  the  lipophorin  receptor  in Drosophila  containing  the  ligand  binding  sequence, we would 

expect much more diverse  immunoreactivity  in  the native  lane  than was observed.    Immunoreactivity 

would be expected for sizes ranging from 90 to 120kDa.   One possibility  is that the 100kDa  lipophorin 

receptor  band  (which may  be  composed  of multiple  similarly‐sized  variants)  simply  contains more 

protein than other lipophorin receptors and was more visible with the development techniques used in 

the  ligand blotting.   This would also explain  the preferential affinity  for  the 100kDa band  seen using 

LpRv1 Rabbit 1 antisera.    It  is also  surprising, given  the  immunoblots  in  figure 18,  that only eluate 2 

produced  immunoreactivity  at  the  expected  apparent molecular weight;  eluates  1  and  3  contained 

proteins with  relatively high  immunoreactivity  towards anti‐ApoLpII.    It  is  thus unclear why only one 

eluate  produced  a  signal  at  100kDa  during  ligand  blotting.    It  is  possible  that  the  conformational 

condition  of  the  lipophorin  is  dependent  on  concentration;  in  this  case  eluate  2,  having  the  highest 

apparent concentration of ApoLpII would  retain more  lipophorin  in  its native conformation.    In either 

case  this  result  should  be  repeated  for  verification  of  the  lipophorin  receptor  immunoreactivity.    It 

would also be beneficial to use ECL chemiluminescent development techniques on PVDF membranes in 

78  

order  to  enhance  the  detection  sensitivity  of  the  method  as  compared  with  alkaline‐phosphatase 

development on nitrocellulose membranes. 

Circadian Rhythms are not Affected by the Lipophorin Receptor Using LpR1 and LpR2 RNA  interference  lines obtained from the Vienna Drosophila RNAi Centre (VDRC) 

we attempted tissue‐specific reduction in the levels of LpR1 and LpR2.  Figures 20‐24 demonstrate that 

circadian rhythm  is certainly not abolished by the tissue‐specific activation of UAS‐LpR1/2 RNAi.   What 

was  interesting to note was that several  flies containing RNAi constructs transcriptionally activated by 

several of  the GAL4 constructs were arrhythmic.   This  finding suggests  that  there may be a genotypic 

effect  on  circadian  rhythm  in  these  experiments  that  may  have  reduced  penetrance  in  the  test 

population. 

While period  averages were  computed  for each  genotype  and  are  shown  in  figures 20‐24,  individual 

rhythms were also  computed  (data not  shown) and used  to  calculate  variability  in  circadian  rhythms 

among each genotype.  These data were then used to determine statistically (using ANOVA) whether the 

period was significantly different among  the gentoypes.    In each case, UAS‐LpR1/2 RNAi  in  trans with 

each  GAL4  line  as  well  as  w1118  were  compared  (figure  25).    Control  lines  were  considered  to  be 

GAL4/w1118 and therefore only genotypes whose periods differed from the control lines were likely to be 

biologically significant in addition to their statistical significance. 

Heat‐shock  driven  knockdown  of  LpR1  produced  a  statistically  higher  rhythm  than  that  of  controls.  

While each experiment with the exception of that using pdf‐GAL4 as an expression driver had an overall 

significance, the control groups were statistically homogenous with UAS‐LpR1/2 RNAi/GAL4 suggesting 

that a statistical type one error had been made.   Flies which demonstrated a  lack of circadian rhythm 

were  removed  from  the  data  and  it  was  re‐analyzed  using  the  statistical  measures  previously 

mentioned.   Because no flies were arrhythmic  in the heat‐shock experiment, this did affect heat shock 

results.   Results using R32‐GAL4, however, were altered.    In  this case, only R32‐GAL4/UAS‐LpR2 RNAi 

produced a statistically reduced rhythm with respect to controls. 

The effects observed here are cryptic.  While there is much statistical significance, the minor changes in 

period that have produced it are far smaller than what the field of circadian rhythms usually accepts as a 

significant difference.  The statistical relevance of the experiment, however, is not lost.  By comparison 

to  some experiments,  small numbers of  flies were used  in  this experiment  (n=16, maximum).   When 

small numbers are used, however,  there  is generally a greater variability  in means and hence a  taller 

79  

statistical barrier to significance; when  large numbers of tests subjects are used, statistical parameters 

relax to the point where false positives are commonplace.  This would therefore suggest that the results 

of our RNAi experiment are the opposite of what might be expected; using small numbers of flies and 

obtaining the  levels of significance we obtained certainly demands further experimentation with  larger 

numbers of test subjects to verify repeatability. 

Although  we  observe  effects  of  the  lipophorin  receptor  RNAi  in  this  case,  it  is  necessary  to 

experimentally verify the knockdown of the lipophorin receptor protein through western blotting (figure 

33).  The results in figure 33 do not demonstrate a knockdown of the receptor.  This does not necessarily 

indicate a spurious or artifactual  result  for RNAi experiments.   One possible explanation  relies on  the 

localized expression drivers used.   Both pdf‐GAL4 and R32‐GAL4, assuming that they are only activated 

in the cells in which we would expect them to be active, are expressed in an extremely small number of 

neurons.  Therefore, unless a substantially large proportion of the total lipophorin receptor protein pool 

is expressed in these cells, western blotting would be unlikely to detect a reduction in protein quantity.  

The reason that  little knockdown was observed using elav‐GAL4 driver  lines  is also unclear.   Assuming 

that elav‐GAL4 is expressed exclusively in neurons, we would expect to observe a substantial knockdown 

of  LpR  in  the head preparations.   This either  suggests  that  the RNAi  lines  are  ineffective or  that  the 

lipophorin receptor, while expressed in the heads of the flies, is not expressed extensively in the brain.  

The lipophorin receptor could instead be expressed in cuticular, fat body or antennal region of the head.  

In heat  shock‐GAL4  lines,  there appears  to be an experimental difference;  two  low molecular weight 

bands  (approximately  85‐90kDa)  appear  to have  a higher  level of  immunoreactivity  in w1118/hs‐GAL4 

controls than UAS‐LpR2 RNAi/hs‐GAL4 flies when LpRv1 Rabbit 1 Bleed 4 was used.   Because the heat 

shock  promoter  exists  ubiquitously  throughout  Drosophila  cells,  we  expect  the  knockdown  to  be 

strongest and most apparent in this particular set of GAL4/UAS lines.  The fact that the aforementioned 

difference  is  the  only  observable  difference  among  all  gentoypes  is  disquieting  and merits  further 

experimentation, perhaps using RNA techniques to verify the knockdown of the lipophorin receptor. 

Cuticular Hydrocarbons are Affected by the Lipophorin Receptor Many  cuticular hydrocarbons of male Drosophila melanogaster appear  to be  strongly affected by  the 

genotypes  used  in  the RNAi  experiments  (table  3).   Due  to  the  fact  that  nC18,  an  internal  standard 

added to the hexane mixture prior to gas chromatography, appeared to change significantly  in several 

experiments, the acceptable  level of type one error was adjusted to reduce false positives; differences 

were deemed strongly significant if their p‐values were below 0.001.   

80  

Graphs of  the  levels of  strongly affected hydrocarbons are  shown  for each genotype  in  figures 28‐31 

while a  comparison of  the  total hydrocarbon quantity on  the  cuticle  is  shown  in  figure 32.   Because 

lipophorin  is thought to  ‘carry’ hydrocarbons to their site of deposition (the cuticle), we expected that 

knocking down the  lipophorin receptor, at  least  in the more ubiquitous GAL4 driver  lines such as heat 

shock  and  elav‐GAL4 would  reduce  hydrocarbon  content.    This was  observed  for  total  hydrocarbon 

quantity  in which most  combinations  of  GAL4/UAS  RNAi  resulted  in  statistically  lower  hydrocarbon 

quantities as compared with the appropriate GAL4/w1118 control line.  Notable exceptions are UAS‐LpR2 

RNAi/heat shock GAL4 and UAS‐LpR1 RNAi/pdf‐GAL4.  While reducing the levels of LpR1 in a countable 

number  of  cells  such  as  those  expressing  pdf  may  not  be  expected  to  reduce  total  hydrocarbon 

quantities,  ubiquitous  LpR  reduction  as  in  the  case  of  UAS‐LpR2  RNAi/heat  shock‐GAL4  would  be 

expected to reduce total hydrocarbon.  The reason for this discrepancy is unclear, especially considering 

that,  in  both  non‐significant  cases  the  other  UAS‐LpR  RNAi  genotype  did  produce  a  reduced  total 

cuticular hydrocarbon quantity. 

Individual hydrocarbons varied considerably as compared with their total.  Some, such as cVA and most 

monoenes 25 carbons in length, were generally not affected by these experiments.  This is not surprising 

in the case of cVA as this particular hydrocarbon is synthesized in the ejaculatory bulb and is thought to 

be transferred to the  female  in the ejaculate during copulation to deter  further copulation with other 

males (Butterwo.Fm, 1969).   It  is, however, surprising  in the case of the 25 carbon monoenes as these 

have been one of  the  few hydrocarbons whose behavioural effects have been studied  to date.   Large 

quantities of these 25 carbon monoenes have been shown to induce wing vibration in males suggesting 

that they have a role in courtship (Jallon, 1984; Jallon et al., 1980).  The observation that they are largely 

unaffected by GAL4‐driven  repression of  the  lipophorin  receptor  in ubiquitous  instances  such as heat 

shock‐GAL4  is  surprising  and may  suggest  that  these  communicatory pheromones  reach  the  cuticule 

through an alternative route.  These compounds were strongly affected only using the elav‐GAL4 driver 

to knock down LpR expression; though cells containing elav‐GAL4 should also have contained hs‐GAL4 

this  result  suggests  that  knock‐down  of  the  lipophorin  receptor  in  non‐clock  neurons  may  affect 

hydrocarbon output.  Because it does not seem to occur when knockdown is ubiquitous, the effect may 

represent an element of neuronal control of hydrocarbon output rather than the mechanical inability to 

display hydrocarbons. 

In  several  cases,  UAS‐LpR1  RNAi/elav‐GAL4  was  found  to  have  a  higher  level  of  certain  cuticular 

hydrocarbons than the appropriate GAL4 control  line.   This was observed especially  in nC22, nC24 and 

81  

nC27.   The  fact  that  the  three hydrocarbons most  strongly affected are of  the  same  class  suggests a 

biologically significant effect.   Also, the observation that neural‐specific knockdown of LpR1 repeatedly 

produces this effect suggests that it is unlikely to be experimentally artifactual. 

The most  strongly  affected monoene  hydrocarbon was  C23:1(5)  or  5‐Tricosene.    The  effects  of  this 

hydrocarbon have been  studied  in  a preliminary  fashion  in  several Drosophila  strains  and have been 

inconclusive (Hedlund et al., 1996).  One study found that 5‐tricosene had a strong inhibitory effect on 

copulation and significantly delayed in the onset of male courtship behavior (Ferveur and Sureau, 1996).  

We find a strong reduction in the levels of 5‐Tricosene on male flies when UAS‐LpR1 RNAi is driven by all 

GAL4 drivers used except pdf‐GAL4.   The  situation  is  similar  for  the  case of UAS‐LpR2 RNAi with  the 

exception that heat shock‐GAL4 driven expression does not produce a significant effect on 5‐Tricosene.  

Without  fully  understanding  the  behavioural  effects  of  this  hydrocarbon,  assigning  meaning  to  its 

reduction  is challenging other than to  identify that  its actions are related to the  lipophorin receptor  in 

some way. 

Methylated,  or  branched  hydrocarbons  are  a  distinct  class  with  little  known  effect  in  Drosophila.  

Evidence  from  the  wasp model  system  indicates  that  the  quantity  of  these  hydrocarbons may  be 

involved  in  nestmate  recognition; wasps  perfumed with  excess methylated  hydrocarbons  have  been 

shown  to  be  rejected  by  their  nestmates  (Howard  and  Blomquist,  2005).    Here we  show  the most 

significant RNAi effects on 2‐methyl‐tetracosane (figure 30) and 2‐methyl‐hexacosane (figure 31).  Both 

hydrocarbons only show a significant reduction from controls under the promotion of elav‐GAL4; both 

UAS‐LpR1  and UAS‐LpR2 RNAi demonstrate  significant  reduction.   Examining  the means of  the other 

control and experimental genotypes  found  in  the  same graphs, however,  suggests  that  it may be  the 

unusually high  level of both these compounds  in elav‐GAL4/w1118 causing the significance.   The reason 

for the high levels associated with this control genotype are unclear; they are repeated in at least these 

two  cases  yet  may  represent  experimental  artifacts.    Only  further  experimentation  can  determine 

whether or not this control genotype is producing the observed effect. 

They effects shown for hydrocarbons  in these RNAi experiments are unclear.   While  it seems  logical to 

assume that down regulation of the lipophorin receptor in numerous tissues would be likely to equally 

down  regulate  cuticular  hydrocarbon  expression,  this  is  not  always  the  case.    In  fact,  several 

hydrocarbons  appear  to  undergo  a  concomitant  increase  with  lipophorin  receptor  reduction.    The 

results shown here are preliminary; experiments of this nature are usually performed  in triplicate at a 

minimum to verify that the observed effects are not spurious.  It is for this reason that this experiment 

82  

must be repeated to verify the observed effects.  Our failure to demonstrate a strong knock down of the 

lipophorin  receptor,  as  previously  mentioned,  confounds  the  results  obtained  here  as  well.    In 

ubiquitous cases such as under  the control of  the heat shock‐GAL4 driver, we would expect  the UAS‐

RNAi constructs, assuming that they work correctly, to significantly reduce the protein quantity of the 

lipophorin  receptor.    Instead,  in most  cases, we  observe  little  or  no  difference.    Repetition  of  the 

western  blots  shown  in  figure  33  is  a  necessity  prior  to  drawing  any  experimental  conclusion.  

Additionally,  the  use  of  reverse‐transcriptase  quantitative  PCR  could  be  used  to  determine  LpR 

transcript levels in response to these knock down experiments; this, or more sensitive western blotting 

techniques, could demonstrate a knock down. 

An additional possibility  is  that  there are  confounding effects  caused by  the  inclusion of UAS‐Dicer‐2 

with each RNAi  line.    Ideally, Dicer‐2 or any gene upstream of the yeast upstream activating sequence 

would  only  be  active  in  the  presence  of GAL4;  additionally, GAL4 would  only  be  present  under  the 

desired promotional  control.   Unfortunately  these  ideals are  rarely  true and  leaky UAS expression as 

well  as  promiscuous  GAL4  activity  are  experimental  realities.    In  addition,  because  Dicer‐2  is  an 

endogenous gene involved in the natural RNAi‐like pathways of Drosophila, its upregulation may cause 

additional effects  in addition to enhancing the effects of RNAi.   For this reason, future experiments of 

this nature should contain the omitted controls involving UAS‐Dicer‐2 expression driven by each of the 

GAL4 lines used. 

The Lipophorin Receptor is Present in the Brain Although  it was demonstrated through western blotting that the heads of flies contain peptides which 

are immunoreactive with LpRv1, this does not conclusively implicate the central nervous system or brain 

as  expressing  the  lipophorin  receptor.    Several  tissues of non‐neuronal nature  exist  in  the head  and 

could  express  LpR.    For  this  reason,  the  LpRv1  antisera  were  used  in  whole‐mount  tissue  staining 

applications  of  the  Drosophila  brain  (see  materials  and  methods).    Although  pre‐immune  sera 

demonstrated  little  or  no  immunoreactivity  on  western  blots  and  identification  of  LpR  has  been 

demonstrated,  the  differing  envioronment  of  whole‐mount  tissue  staining  necessitated  additional 

controls.   Under whole‐mount  conditions,  as  opposed  to western  blots,  proteins  are  in  their  native 

conformation with the exception that they have been fixed using organic reagents.   Proteins  in whole‐

mount tissue would therefore be in a different conformation than the same proteins encountered on a 

western  blot  in  their  denatured,  partially  linear  conformation.    Thus,  immunoreactivity  could  be 

increased  in tissues, possibly due to epitpopes on proteins which occur only when part of the peptide 

83  

backbone  folds  to  come  in  contact with another area.    Similarly,  immunoreactivity  could be  reduced 

because epitopes are obscured by the tertiary structure of the protein. 

Pre‐immune sera from LpRv1 rabbit 1 and rabbit 2 were tested in Drosophila brains (figures 34, panel c 

and 35, panel a).  It is clear from each of these results that there is little or no immunoreactivity beyond 

what may be considered background  levels.   Thus, the fourth production bleed of each antiserum was 

tested  in  the  same  tissue.   Antisera  from  rabbit 1  recognize  approximately  four  cells  at  the  anterior 

portion of the brain near the border between the optic lobe and the midbrain.  These cells are shown in 

figure 34 panels a, b, d and e).  Our understanding of the position and potential identity of these cells is 

incomplete.    These  cells  are  close  to  the  area  in which we would  expect  pdf‐containing  neurons  to 

reside;  for  this  reason we  plan  to  test  them  using  LpRv1  antiserum  in  conjungtion with  an  anti‐pdf 

antibody to examine colocalization. 

Antisera from the second rabbit recognize a set of cells  in the same region as those from rabbit 1 but, 

additionally, strongly recognize cells at the posterior portion of the brain also along the border between 

the midbrain and optic lobe.  Although we are unable to identify the cells at the posterior portion of the 

brain, we suspect that the anteriorly  labeled cells are clock neurons.   For this reason we tested LpRv1 

antiserum  together with anti‐PDF antiserum  in a colocalization experiment  (figure 36).   While we did 

observe  colocalization  when  LpRv1  rabbit  2  bleed  4  was  paired  with  guinea  pig  anti‐PDF,  similar 

colocalization was observed in the case of the pre‐immune serum from the same rabbit.  For this reason 

we must consider the  immunoreactivity of the anterior cells spurious.   The posterior cells which were 

strongly  labeled, however, were completely absent when using pre‐immune sera suggesting  that  they 

are indeed viable results. 

Conclusions and Future Directions While  the  main  feature  of  this  work  was  the  production,  testing  and  potential  future  use  of  the 

antiserum against  the  lipophorin  receptor of Drosophila,  several experiments of a preliminary nature 

were carried out.  We can be relatively confident, given the number of subjects used in the experiment, 

that the  lipophorin receptor RNAi, when activated by any of the GAL4  lines used,  is unlikely to have a 

major  effect  on  circadian  rhythm  in  locomotor  activity.    This  is  because,  although  significant,  the 

differences between control lines and experimental lines were often small and not of the caliber which 

generally denotes significance in this field.  We infer reliability of these data as a result of their relative 

cleanliness and the strength of the rhythms observed. 

84  

It is clear that there is an effect on cuticular hydrocarbons using lipophorin receptor RNAi.  Several GAL4 

driver lines have already been employed in these pilot experiments but these represent a small portion 

of those which may have an effect.   Because of their role  in hydrocarbon production, a  fruitful  future 

experiment  may  involve  an  oenocyte‐specific  GAL4  line  which  has  been  generated  by  our  lab;  in 

addition,  a  ubiquitous  GAL4  driver  such  as  actin‐GAL4  may  be  more  suitable  to  demonstrate  the 

widespread  effects  of  the  lipophorin  receptor.    Finally,  cuticular  hydrocarbons  have  their  most 

interesting  effects  on  behaviour.    Therefore,  it would  be  beneficial,  if  a  substantial  knock  down  in 

lipophorin  receptor  content  could  be  demonstrated,  to  use GAL4/UAS‐LpR  RNAi  flies  in  behavioural 

courtship  experiments.    In  this  manner,  courtship  anomalies  could  be  detected  and  related  to 

subsequent reduction or increase in the quantity of certain hydrocarbons.  To validate these and other 

experiments,  however,  the  effectiveness  of  the  two  RNAi  lines  employed  must  be  verified  at  the 

transcript or protein level. 

We have only begun to  identify the tissues  in which the  lipophorin receptor  is expressed.   In this work 

we demonstrated  that  at  least  two  LpR  variants  are present  in  the head of  the  fly  through western 

blotting and whole‐mount  tissue  staining.   Dissection of other  tissues  for use  in western blotting and 

tissue staining could demonstrate additional locations of the lipophorin receptor.  Specifically, dissected 

oenocytes would be of primary interest given their role in hydrocarbon production.  Also, LpRv1 is only 

capable  of  identifying  lipophorin  receptors  in  general.    A more  specific method  for  identifying  each 

variant of the lipophorin receptor would involve production of isoform‐specific antibodies.  This venture 

would  be  costly  and  time  consuming;  an  alternative  would  be  the  use  of  fluorescence  in  situ 

hybridization  (FISH)  techniques  that depend on nucleotide base‐pairing  rather  than  antibody‐antigen 

interactions.   These have  the added advantage of variant specificity and  reduced background.    In  this 

manner,  variants  in  different  tissues  such  as  the  head,  antenna,  or  cuticle  could  be  detected  using 

dissection  followed by northern blotting  techniques.    In addition,  the specific variants  in  the brain  (or 

other tissues) could be identified using FISH techniques and confocal microscopy. 

Performance of  these and  similar experiments  in Drosophila melanogaster  represent an exciting new 

area of research which combines the current interest in lipid metabolism and biochemistry with that of 

social  and  chemical  communication  in  a  genetically manipulable  species.   While Drosophila  is  not  a 

traditional model  species  for  lipid  research,  it  is  clear  that  benefits  such  as  a  sequenced  genome, 

countless genetic tools, as well as social and hydrocarbon research could be well applied to this area. 

85  

Appendix Subcloning of desat1 Using  the  primers  desatF  (5’‐AAGGATCCAACATGCCGCCCA‐3’)  and  desatR  (5’‐

GGGAATTCCTAAACCCTCCCATGATTGG‐3’)  desat1  (CG5887)  cDNA  clones  from  the  Canadian Drsophila 

Microarray Centre GH23546 and RH21245 were subjected to PCR.  These 1.1 kb PCR products were both 

cloned  into  pCR  2.1  TOPO  vectors  which  were  transformed  into  TOP10F’  E.  coli  strains,  and  then 

subcloned  into  E.  coli  pET21  vectors  in  the  BL21  strain  for  overexpression.    Both were  successfully 

cloned but only GH23546 produced  a protein product of  the  correct  length  (43  kDa) while RH21245 

appeared to have a truncated product (21 kDa).  SDS‐PAGE expression assays were not sensitive enough 

to display the ectopic expression of desat1.   Western blots using anti‐T7 monoclonal antibodies reveal 

the protein products of cloned GH23546 and RH21245 (figure 37). 

   

86  

 

 

Figure 37 Subcloning of desat1 (CG5887) from Canadian Drosophila Microarray Centre clones GH23546 and RH21245. a) PCR results carried out using plasmid template concentrations of 1:100, 1:200, 1:500, 1:1000 (left to right) for each CDMC clone. c) Rapid disruption minipreparation of TOPO clones; clone 7 is the control.  b) determination of directional insertion orientation in TOPO clones using a NotI digest; those with a single band are of desired orientation. d) Restriction digest of TOPO clones with desired orientation as well as pET 21A vector. e) Rapid disruption minipreparation of E. coli BL21 clones of both CDMC desat1 constructs.  f)  SDS‐PAGE  expression  of  T7‐desat1  shows  no  difference  between  controls  and  T7‐desat1  clones.  g)  anti‐T7 western blot shows that the proteins are expressed and that RH21245 produces a truncated product of an unexpected size. 

87  

Overexpression of desat(3), desat(2) and per(2) for Immunization desat(3), desat(2) and per(2), were antigens generated by Dr. Tony So for overexpression in a GST‐fusion 

vector  and  immunization  in  rabbits.    SDS‐PAGE  expression  assays  were  carried  out  to  verify  the 

overexpression of  the GST  fusion construct  in each case and  it was  then purified using a glutathione‐

sepharose  column and eluted with glutathione.   2‐5mg of  these eluates were  combined,  frozen, and 

sent  to  Pacific  Immunology  Inc.  (Ramona,  CA)  for  the  purpose  of  injection  into New  Zealand white 

rabbits.  Rabbits were maintained on a standard 13‐week protocol during which pre‐immune sera, four 

production bleeds and a final exsanguinations from each of two rabbits per immunogen were generated 

for testing (figure 38). 

88  

 

Figure 38 Overexpression and purification of desat(3), desat(2), and per(2) antigens generated by Dr. Tony So.  Gels represent SDS‐PAGE expression assays of each construct in native E. coli lysates (above, left) with desat(2) in lane 1, desat(3) in lane 2 and per(2)  in  lane 3.   Once purified, eluates 1, 3, 5, 7 and 9 were run on SDS‐PAGE gels and are shown under the heading of the appropriate overexpressed antigen. 

89  

Testing of desat(3) and perSv1 PerSv1 was generated using a previously described peptide sequence which produced viable antibodies 

(Siwicki et al., 1992).  This antigen was generated and immunized using the same procedures as LpRv1. 

Preliminary tests indicated that desat(2) and per(2) seemed to be nonfunctional.  This could be because 

desat(2) was generated using C‐terminus of the RH21245 clone which produces an apparently truncated 

protein.  There has traditionally been difficulty in creating anti‐period antibodies.  Desat3v1 and perSv1 

antibodies were examined on western blots to verify their accuracy.   Desat3 appeared to be relatively 

accurate  in  the  case  of  rabbit  2,  identifying  a  band  at  the  approximate molecular weigh  to  desat  in 

whole Drosophila  lysates.    Anti‐T7  antibodies  and  desat3v1  revealed  a  band  of  the  same molecular 

weight using cloned GH23546 overexpression constructs (figure 39). 

PerSv1 antibodies do not appear to recognize a peptide of the approximately correct molecular weight 

in Drosophila lysates (160kDa).  PerSv1 sera from rabbit 1, though, recognize a series of peptides which 

may represent degradation products of period  in  the T7‐per  lanes of western blots but not  in  the T7‐

control lanes (figure 40). 

90  

 

Figure 39 Testing of desat3v1  in Drosophila and E. coli.   The antisera  from  rabbit 1  (panel a,  top  row) do not  recognize  the correct band while those from rabbit 2 (panel a,  lower row) recognize a band at 45kDa, the approximate molecular weigh of desat.   T7‐monoclonal antibodies and desat3v1 both recognize T7‐desat from GH23546 overexpression constructs while they fail to recognize anything in control lanes (panel b). 

91  

 

Figure 40 Testing of perSv1 in Drosophila and E. coli.  The antisera from rabbit 1 (panel a, top row) do not recognize the correct band.  Those from rabbit 2 (panel a, lower row) also fail to recognize a band at approximately 160kDa.  T7‐per appears to be recognized by perSv1 while the T7‐control lane appears relatively empty of label. 

   

92  

Cited References [Anon]  (2004). Molecular characterization of the  lipophorin receptor of Blattella germanica. Journal of Insect Science 4, ‐. 

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J.  (1990). Basic Local Alignment Search Tool. Journal of Molecular Biology 215, 403‐410. 

Breiter,  D.R.,  Kanost, M.R.,  Benning, M.M., Wesenberg,  G.,  Law,  J.H., Wells, M.A.,  Rayment,  I.,  and Holden,  H.M.  (1991).  Molecular‐Structure  of  an  Apolipoprotein  Determined  at  2.5‐a  Resolution. Biochemistry 30, 603‐608. 

Butterwo.Fm (1969). Lipids of Drosophila ‐ a Newly Detected Lipid in Male. Science 163, 1356‐&. 

Cheon, H.M., Seo, S.J., Sun, J.X., Sappington, T.W., and Raikhel, A.S. (2001). Molecular characterization of the VLDL receptor homolog mediating binding of lipophorin in oocyte of the mosquito Aedes aegypti. Insect Biochemistry and Molecular Biology 31, 753‐760. 

Chertemps, T., Duportets, L., Labeur, C., Ueyama, M., and Wicker‐Thomas, C. (2006). A female‐specific desaturase gene responsible for diene hydrocarbon biosynthesis and courtship behaviour in Drosophila melanogaster. Insect Molecular Biology 15, 465‐473. 

Chino,  H.  (1985).  Lipid  Transport:  Biochemistry  of  Hemolymph  Lipophorin.  Comprehensive  Insect Physiology, Biochemistry and Pharmacology 10, 115 ‐ 135. 

Chino, H., and Downer, R.G.H. (1982). Insect Hemolymph Lipophorin ‐ a Mechanism of Lipid Transport in Insects. Advances in Biophysics 15, 67‐92. 

Chino,  H.,  Downer,  R.G.H.,  Wyatt,  G.R.,  and  Gilbert,  L.I.  (1981a).  Lipophorins,  a  Major  Class  of Lipoproteins of Insect Hemolymph. Insect Biochemistry 11, 491‐491. 

Chino, H., and Gilbert,  L.I.  (1964). Diglyceride Release  from  Insect Fat Body  ‐ Possible Means of  Lipid Transport. Science 143, 359‐&. 

Chino, H., and Gilbert, L.I. (1965). Lipid Release and Transport  in Insects. Biochimica Et Biophysica Acta 98, 94‐&. 

Chino, H., Katase, H., Downer, R.G.H., and Takahashi, K. (1981b). Diacylglycerol‐Carrying Lipoprotein of Hemolymph of  the American Cockroach  ‐ Purification, Characterization, and Function.  Journal of Lipid Research 22, 7‐15. 

Chino, H., and Kitazawa, K. (1981). Diacylglycerol‐Carrying Lipoprotein of Hemolymph of the Locust and Some Insects. Journal of Lipid Research 22, 1042‐1052. 

Ciudad,  L., Belles,  X.,  and  Piulachs, M.D.  (2007).  Structural  and RNAi  characterization of  the German cockroach  lipophorin  receptor,  and  the  evolutionary  relationships  of  lipoprotein  receptors.  Bmc Molecular Biology 8, ‐. 

Coyne,  J.A.,  and  Elwyn,  S.  (2006a).  Desaturase‐2,  environmental  adaptation,  and  sexual  isolation  in Drosophila melanogaster. Evolution 60, 626‐627. 

Coyne,  J.A.,  and  Elwyn,  S.  (2006b).  Does  the  desaturase‐2  locus  in  Drosophila melanogaster  cause adaptation and sexual isolation? Evolution 60, 279‐291. 

Dallerac, R., Labeur, C., Jallon, J.M., Knippie, D.C., Roelofs, W.L., and Wicker‐Thomas, C. (2000). A Delta 9 desaturase gene with a different substrate specificity is responsible for the cuticular diene hydrocarbon polymorphism  in Drosophila melanogaster.  Proceedings  of  the National  Academy  of  Sciences  of  the United States of America 97, 9449‐9454. 

93  

Dantuma, N.P., Potters, M., De Winther, M.P.J.,  Tensen, C.P., Kooiman,  F.P., Bogerd,  J.,  and Van der Horst, D.J. (1999). An  insect homolog of the vertebrate very  low density  lipoprotein receptor mediates endocytosis of lipophorins. Journal of Lipid Research 40, 973‐978. 

Dantuma, N.P., VanMarrewijk, W.J.A., Wynne, H.J., and VanderHorst, D.J. (1996). Interaction of an insect lipoprotein with its binding site at the fat body. Journal of Lipid Research 37, 1345‐1355. 

Diehl, P.A.  (1975). Synthesis and Release of Hydrocarbons by Enocytes of Desert Locust, Schistocerca‐Gregaria. Journal of Insect Physiology 21, 1237‐1246. 

Dietzl, G., Chen, D.,  Schnorrer,  F.,  Su, K.C., Barinova,  Y.,  Fellner, M., Gasser, B., Kinsey, K., Oppel,  S., Scheiblauer, S., et al. (2007). A genome‐wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature 448, 151‐U151. 

Fan,  Y.L.,  Zurek,  L.,  Dykstra,  M.J.,  and  Schal,  C.  (2003).  Hydrocarbon  synthesis  by  enzymatically dissociated  oenocytes  of  the  abdominal  integument  of  the  German  Cockroach,  Blaftella  germanica. Naturwissenschaften 90, 121‐126. 

Fang, S., Takahashi, A., and Wu, C.I.  (2002). A mutation  in  the promoter of desaturase 2  is correlated with sexual isolation between drosophila behavioral races. Genetics 162, 781‐784. 

Ferveur, J.F. (1991). Genetic‐Control of Pheromones in Drosophila‐Simulans .1. Ngbo, a Locus on the 2nd Chromosome. Genetics 128, 293‐301. 

Ferveur,  J.F.  (2005).  Cuticular  hydrocarbons:  Their  evolution  and  roles  in  Drosophila  pheromonal communication. Behavior Genetics 35, 279‐295. 

Ferveur,  J.F.,  and  Sureau,  G.  (1996).  Simultaneous  influence  on  male  courtship  of  stimulatory  and inhibitory pheromones produced by live sex‐mosaic Drosophila melanogaster. Proceedings of the Royal Society of London Series B‐Biological Sciences 263, 967‐973. 

Fredrickson, D.S., and Gordon, R.S. (1958). Transport of Fatty Acids. Physiological Reviews 38, 585‐630. 

Gopalapillai, R., Kadono‐Okuda, K.,  Tsuchida, K.,  Yamamoto, K., Nohata,  J., Ajimura, M.,  and Mita, K. (2006). Lipophorin receptor of Bombyx mori: cDNA cloning, genomic structure, alternative splicing, and isolation of a new isoform. Journal of Lipid Research 47, 1005‐1013. 

Greenspan,  R.J.  (2004).  Fly  pushing  :  the  theory  and  practice  of Drosophila  genetics,  2nd  edn  (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press). 

Grishok, A., Pasquinelli, A.E., Conte, D.,  Li, N., Parrish, S., Ha,  I., Baillie, D.L., Fire, A., Ruvkun, G., and Mello, C.C. (2001). Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C‐elegans developmental timing. Cell 106, 23‐34. 

Hammond, S.M. (2005). Dicing and slicing ‐ The core machinery of the RNA interference pathway. Febs Letters 579, 5822‐5829. 

Hayakawa, Y.  (1987). Characterization of  Lipophorin Receptor  in  Locust  Flight Muscles. Biochimica Et Biophysica Acta 919, 58‐63. 

Hayakawa, Y., and Chino, H.  (1984). The Possible Binding‐Site of Lipophorin at  the Cell‐Surface of Fat‐Body and Muscle of the Locust. Zoological Science 1, 910‐910. 

Hedlund,  K.,  Bartelt,  R.J.,  Dicke, M.,  and  Vet,  L.E.M.  (1996).  Aggregation  pheromones  of  Drosophila immigrans, D‐phalerata, and D‐subobscura. Journal of Chemical Ecology 22, 1835‐1844. 

Herz,  J.,  and  Bock,  H.H.  (2002).  Lipoprotein  receptors  in  the  nervous  system.  Annual  Review  of Biochemistry 71, 405‐434. 

Howard,  R.W.,  and  Blomquist,  G.J.  (2005).  Ecological,  behavioral,  andbiochemical  aspects  of  insect hydrocarbons. Annual Review of Entomology 50, 371‐393. 

94  

Jallon, J.M. (1984). A few chemical words exchanged by Drosophila during courtship and mating. Behav Genet 14, 441‐478. 

Jallon,  J.M.,  Antony,  C.,  Gallois,  M.,  and  Venard,  R.  (1980).  1st  Characterization  of  Aphrodisiac Substances  in Drosophila‐Melanogaster. Comptes Rendus Hebdomadaires Des Seances De L Academie Des Sciences Serie D 291, 717‐719. 

Jallon,  J.M., and Hotta, Y.  (1979). Genetic and Behavioral‐Studies of Female Sex Appeal  in Drosophila. Behavior Genetics 9, 257‐275. 

Kashiwazaki,  Y.,  and  Ikai,  A.  (1985).  Structure  of  Apoproteins  in  Insect  Lipophorin.  Archives  of Biochemistry and Biophysics 237, 160‐169. 

Katase, H., and Chino, H.  (1982). Transport of Hydrocarbons by  the Lipophorin of  Insect Hemolymph. Biochimica Et Biophysica Acta 710, 341‐348. 

Kutty,  R.K.,  Kutty,  G.,  Kambadur,  R.,  Duncan,  T.,  Koonin,  E.V.,  Rodriguez,  I.R.,  Odenwald, W.F.,  and Wiggert, B.  (1996). Molecular  characterization and developmental expression of a  retinoid‐ and  fatty acid‐binding glycoprotein  from Drosophila  ‐ A putative  lipophorin. Journal of Biological Chemistry 271, 20641‐20649. 

Lee,  C.S.,  Han,  J.H.,  Lee,  S.M.,  Hwang,  J.S.,  Kang,  S.W.,  Lee,  B.H.,  and  Kim,  H.R.  (2003). Wax moth, Galleria mellonella fat body receptor for high‐density lipophorin (HDLp). Archives of insect biochemistry and physiology 54, 14‐24. 

Lee, Y.S., Nakahara, K., Pham, J.W., Kim, K., He, Z.Y., Sontheimer, E.J., and Carthew, R.W. (2004). Distinct roles for Drosophila Dicer‐1 and Dicer‐2 in the siRNA/miRNA silencing pathways. Cell 117, 69‐81. 

Levine,  J.D.,  Funes,  P.,  Dowse,  H.B.,  and  Hall,  J.C.  (2002).  Resetting  the  circadian  clock  by  social experience in Drosophila melanogaster. Science 298, 2010‐2012. 

Li,  Y.H.,  Lu, W.Y., Marzolo, M.P.,  and  Bu,  G.J.  (2001).  Differential  functions  of members  of  the  low density  lipoprotein  receptor  family  suggested by  their distinct endocytosis  rates.  Journal of Biological Chemistry 276, 18000‐18006. 

Lucas, C., Pho, D.B., Fresneau, D., and Jallon, J.M. (2004). Hydrocarbon circulation and colonial signature in Pachycondyla villosa. Journal of Insect Physiology 50, 595‐607. 

O'Dell, K.M.C. (2003). The voyeurs' guide to Drosophila melanogaster courtship. Behavioural Processes 64, 211‐223. 

Pattnaik,  N.M.,  Mundall,  E.C.,  Trambusti,  B.G.,  Law,  J.H.,  and  Kezdy,  F.J.  (1979).  Isolation  and Characterization  of  a  Larval  Lipoprotein  from  the  Hemolymph  of  Manduca‐Sexta.  Comparative Biochemistry and Physiology B‐Biochemistry & Molecular Biology 63, 469‐476. 

Pho,  D.B.,  Pennanech,  M.,  and  Jallon,  J.M.  (1996).  Purification  of  adult  Drosophila  melanogaster lipophorin and its role in hydrocarbon transport. Archives of insect biochemistry and physiology 31, 289‐303. 

Piek, T. (1964). Synthesis of Wax in the Honeybee (Apis‐Mellifera L). Journal of Insect Physiology 10, 563‐572. 

Robinson, N.L., and Goldsworthy, G.J.  (1976). Adipokinetic Hormone and Flight Metabolism  in Locust. Journal of Insect Physiology 22, 1559‐1564. 

Rodenburg,  K.W.,  and  Van  der  Horst,  D.J.  (2005).  Lipoprotein‐mediated  lipid  transport  in  insects: Analogy to the mammalian  lipid carrier system and novel concepts for the functioning of LDL receptor family members. Biochimica Et Biophysica Acta‐Molecular and Cell Biology of Lipids 1736, 10‐29. 

Ryan, R.O., and van der Horst, D.J. (2000). Lipid transport biochemistry and its role in energy production. Annual Review of Entomology 45, 233‐260. 

95  

Sambrook,  J., and Russell, D.W.  (2001). Molecular cloning  : a  laboratory manual, 3rd edn  (Cold Spring Harbor, N.Y., Cold Spring Harbor Laboratory Press). 

Sappington, T.W., Kokoza, V.A., Cho, W.L., and Raikhel, A.S.  (1996). Molecular characterization of  the mosquito  vitellogenin  receptor  reveals  unexpected  high  homology  to  the  Drosophila  yolk  protein receptor. Proceedings of  the National Academy of Sciences of  the United States of America 93, 8934‐8939. 

Seo, S.J., Cheon, H.M., Sun,  J.X., Sappington, T.W., and Raikhel, A.S.  (2003). Tissue‐ and  stage‐specific expression of two lipophorin receptor variants with seven and eight ligand‐binding repeats in the adult mosquito. Journal of Biological Chemistry 278, 41954‐41962. 

Sevala, V.L., Bagneres, A.G., Kuenzli, M., Blomquist, G.J., and Schal, C. (2000). Cuticular hydrocarbons of the dampwood termite, Zootermopsis nevadensis: Caste differences and role of lipophorin in transport of hydrocarbons and hydrocarbon metabolites. Journal of Chemical Ecology 26, 765‐789. 

Shapiro,  J.P., Keim, P.S., and Law,  J.H.  (1984). Structural Studies on Lipophorin, an  Insect Lipoprotein. Journal of Biological Chemistry 259, 3680‐3685. 

Shapiro, J.P., Wells, M.A., and Law, J.H. (1988). Lipid Transport in Insects. Annual Review of Entomology 33, 297‐318. 

Siwicki, K.K., Schwartz, W.J., and Hall, J.C. (1992). An Antibody to the Drosophila Period Protein Labels Antigens in the Suprachiasmatic Nucleus of the Rat. Journal of Neurogenetics 8, 33‐&. 

Smolenaars, M.M.W., Kasperaitis, M.A.M., Richardson, P.E., Rodenburg, K.W., and Van der Horst, D.J. (2005). Biosynthesis and  secretion of  insect  lipoprotein:  involvement of  furin  in  cleavage of  the apoB homolog, apolipophorin‐II/I. Journal of Lipid Research 46, 412‐421. 

Soulages, J.L., and Wells, M.A. (1994). Lipophorin ‐ the Structure of an Insect Lipoprotein and Its Role in Lipid Transport in Insects. Advances in Protein Chemistry, Vol 45 45, 371‐415. 

Stocker,  R.F.  (1994).  The  Organization  of  the  Chemosensory  System  in  Drosophila‐Melanogaster  ‐  a Review. Cell and Tissue Research 275, 3‐26. 

Sundermeyer,  K., Hendricks,  J.K.,  Prasad,  S.V.,  and Wells, M.A.  (1996).  The  precursor  protein  of  the structural apolipoproteins of  lipophorin: cDNA and deduced amino acid sequence.  Insect Biochemistry and Molecular Biology 26, 735‐738. 

Tompkins, L., Hall,  J.C., and Hall, L.M.  (1980). Courtship‐Stimulating Volatile Compounds  from Normal and Mutant Drosophila. Journal of Insect Physiology 26, 689‐697. 

Tsuchida, K., and Wells, M.A. (1990). Isolation and Characterization of a Lipoprotein Receptor from the Fat‐Body of an Insect, Manduca‐Sexta. Journal of Biological Chemistry 265, 5761‐5767. 

Van Hoof, D., Rodenburg, K.W., and van der Horst, D.J. (2003). Lipophorin receptor‐mediated lipoprotein endocytosis in insect fat body cells. J Lipid Res 44, 1431‐1440. 

Van Hoof, D.,  Rodenburg,  K.W.,  and  Van  der Horst, D.J.  (2005).  Receptor‐mediated  endocytosis  and intracellular trafficking of lipoproteins and transferrin in insect cells. Insect Biochemistry and Molecular Biology 35, 117‐128. 

Weers,  P.M.M.,  and  Ryan,  R.O.  (2003).  Apolipophorin  III:  a  lipid‐triggered  molecular  switch.  Insect Biochemistry and Molecular Biology 33, 1249‐1260. 

Wicker‐Thomas, C., Henriet, C., and Dallerac, R. (1997). Partial characterization of a fatty acid desaturase gene in Drosophila melanogaster. Insect Biochem Mol Biol 27, 963‐972. 

Wicker, C.,  and  Jallon,  J.M.  (1995a). Hormonal‐Control of  Sex‐Pheromone Biosynthesis  in Drosophila‐Melanogaster. Journal of Insect Physiology 41, 65‐70. 

96  

97  

Wicker, C., and Jallon, J.M. (1995b). Influence of Ovary and Ecdysteroids on Pheromone Biosynthesis in Drosophila‐Melanogaster (Diptera, Drosophilidae). European Journal of Entomology 92, 197‐202. 

Yamamoto, T., Davis, C.G., Brown, M.S., Schneider, W.J., Casey, M.L., Goldstein, J.L., and Russell, D.W. (1984). The Human Ldl Receptor ‐ a Cysteine‐Rich Protein with Multiple Alu Sequences in Its Messenger‐Rna. Cell 39, 27‐38. 

  Acknowledgements I would like to express my sincere gratitude to those who have helped me in this work; surely without their contribution this work would not have been possible.  Specific thanks go to Farheen Mohammed for tremendous help with all areas of the research shown here, Adrienne Chu for help with cuticular hydrocarbon extraction and analysis, Jade Atallah for help with activity monitoring and analysis, Olga Sizova and Julia Schnonfeld for dissections, Jonathan Schneider and Tony So for help with cloning and molecular methods, Joshua Krupp, Jean‐Christophe Billeter, Hania Pavlou, and Scott Douglas for extremely helpful and education discussions.