Granulocyte-Macrophage Colony-stimulating Factor GeneTranscription Is Directly Repressed by the Vitamin D3 ReceptorIMPLICATIONS FOR ALLOSTERIC INFLUENCES ON NUCLEAR RECEPTOR STRUCTURE AND FUNCTION BYA DNA ELEMENT*

(Received for publication, July 21, 1997, and in revised form, January 20, 1998)

Terri L. Towers‡ and Leonard P. Freedman§

From the Cell Biology Program, Memorial Sloan-Kettering Cancer Center, Sloan-Kettering Division, Cornell UniversityGraduate School of Medical Sciences, New York, New York 10021

The primary function of activated T lymphocytes is toproduce various cytokines necessary to elicit an im-mune response; these cytokines include interleukin-2(IL-2), interleukin-4, and granulocyte-macrophage colo-ny-stimulating factor (GMCSF). Steroid hormones andvitamin A and D3 metabolites act to repress the expres-sion of cytokines. 1,25-Dihydroxyvitamin D3 (1,25-(OH)2D3) down-modulates activated IL-2 expression atthe level transcription, through direct antagonism ofthe transactivating complex NFAT-1/AP-1 by the vita-min D3 receptor (VDR). We report here that GMCSFtranscription in Jurkat T cells is also directly repressedby 1,25-(OH)2D3 and VDR. Among four NFAT/AP-1 ele-ments in the GMCSF enhancer, we have focused on onesuch element that when multimerized, is sufficient inmediating both activation by NFAT-1 and AP-1 and re-pression in response to 1,25-(OH)2D3. Although this ele-ment does not contain any recognizable vitamin D re-sponse elements (VDREs), high affinity DNA binding byrecombinant VDR is observed. In contrast to VDR inter-actions with positive VDREs, this binding is independ-ent of VDR’s heterodimeric partner, the retinoid X re-ceptor. Moreover, VDR appears to bind the GMCSFelement as an apparent monomer in vitro. Protease di-gestion patterns of bound VDR, and receptor mutationsaffecting DNA binding and dimerization, demonstratethat the receptor binds to the negative site in a distinctconformation relative to a positive VDRE, suggestingthat the DNA element itself acts as an allosteric effectorof VDR function. This altered conformation may ac-count for VDR’s action as a repressing rather than acti-vating factor at this locus.

The classical effects of the secosteroid 1,25-dihydroxyvitaminD3 (1,25-(OH)2D3)1 include the regulation of calcium absorp-

tion in the intestine, maintenance of mineral homeostasis inthe kidney, and regulation of bone formation and remodeling(1–3). More recently, the scope of vitamin D action has broad-ened with the detection of the nuclear receptor for this ligand,vitamin D3 receptor (VDR), in tissues such as skin, testis,pancreas, colon, muscle, breast, prostate, thymus, and bonemarrow. Generally, 1,25-(OH)2D3 acts as a growth inhibitor inmany of these cell types. For example, the ligand is a potentinducer of differentiation of promyelocytic leukemia cells (4–6).The identification of the cyclin-dependent kinase inhibitor geneproduct, p21Waf1,Cip1, as a direct target of 1,25-(OH)2D3 actionin myeloid cells (7) provides a direct link between the generalactions of this ligand and growth control/differentiation inthese cells. Transcription of the p21 gene is directly enhancedin response to 1,25-(OH)2D3 through the binding of VDR tospecific regulatory sites in the p21 promoter. VDR, as is typicalof many members of the nuclear hormone receptor superfamily,binds to DNA and activates transcription as a heterodimericcomplex with the retinoid X receptor (RXR) (8–11). VDR ho-modimers (12, 13) as well as monomers (9) are also capable ofbinding some vitamin D response elements (VDREs), such asthat found in the mouse osteopontin gene promoter (14), butare probably not capable of transactivating (15). The architec-ture of this consensus positive VDRE is two directly repeatinghexameric half-sites consisting of the sequence PuGG/TTCAspaced by three nucleotides (DR3) (13, 16). Transactivation byVDR from a DR3 is strictly ligand-dependent, where the ligandstabilizes VDR-RXR formation (9, 10), as well as enhancesinteractions with components of the transcriptional preinitia-tion complex, such as TFIIA (15) and perhaps as yet unidenti-fied coactivators, as has been demonstrated for several othersteroid and nuclear receptors (reviewed in Ref. 17).

Whereas considerable information exists describing transac-tivation by steroid/nuclear receptors, the mechanisms throughwhich these receptors elicit repression of activated transcrip-tion, which we call here transrepression, are poorly understood.Several genes have been identified as targets of transrepres-sion by various steroid and nuclear receptors (18–22). Genesthat are down-regulated in response to 1,25-(OH)2D3 includethose encoding human and chick parathyroid hormone (PTH)(23, 24), rat a1(I) collagen (25), human atrial natriuretic (26),interleukin-2 (IL-2) (27), and the rat bone sialoprotein (28). Forthe chick PTH and rat bone sialoprotein genes, imperfect DR3elements have been identified at promoter proximal sitesthrough which 1,25-(OH)2D3-mediated repression occurs. How-ever, the promoters for the human PTH, human atrial natri-uretic, and human IL-2 genes do not appear to contain canon-

* This work was supported in part by National Institutes of HealthGrants DK454460 (to L. P. F.) and CA08748 (to Sloan-Kettering). Thecosts of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked “adver-tisement” in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

‡ Sloan-Kettering Institute Rudin Scholar.§ Scholar of the Leukemia Society of America. To whom correspond-

ence should be addressed: Cell Biology Program, Memorial Sloan-Ket-tering Cancer Center, Cornell University Graduate School of MedicalSciences, 1275 York Ave., New York, NY 10021. Tel.: 212-639-2976;Fax: 212-717-3298; E-mail: l-freedman@ski.mskcc.org.

1 The abbreviations used are: 1,25-(OH)2D3, 1,25-dihydroxyvitaminD3; VDR, vitamin D3 receptor; VDRE, vitamin D response element;RXR, retinoid X receptor; PTH, parathyroid hormone; IL-2, interleu-kin-2; bp, base pair(s); PMA, phorbol myristate acetate; PHA, phytohe-magglutinin; GMCSF, granulocyte-macrophage colony-stimulating fac-

tor; EMSA, electrophoretic mobility shift assay; DBD, DNA-bindingdomain; CMV, cytomegalovirus.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 273, No. 17, Issue of April 24, pp. 10338–10348, 1998© 1998 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org10338

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

ical DR3-type VDREs that are functionally conferringtransrepression. Nevertheless, direct VDR binding has beendemonstrated within these promoters. The repressive site iden-tified in the human PTH gene consists of an extended imperfectVDRE half-site as well as some flanking sequence. In the IL-2promoter, Alroy et al. (27) found that the minimal sequencerequired to confer repression consists of a sequence known tobind the T cell transcription factor NFAT-1 as well as a weakAP-1 binding site. Included in this sequence is an extendedimperfect VDRE half-site. VDR DNA binding was shown to benecessary but not sufficient to confer repression.

Our previous study on the mechanism of repression of acti-vated IL-2 transcription by 1,25-(OH)2D3 in T cells provided amolecular explanation of how this ligand acts as a modestimmunosuppressing agent. 1,25-(OH)2D3-mediated effects in Tlymphocytes were first reported as a decrease in the prolifera-tion of peripheral blood lymphocytes (29). This effect was de-pendent on the expression of the VDR and was accompanied bya decrease in the mRNA levels of IL-2, interferon-g, and gran-ulocyte-macrophage colony-stimulating factor (GMCSF) (30–32). Interestingly, VDR is only expressed following activationin T cells (33), and therefore the direct transcriptional repres-sion of a primary response cytokine such as IL-2 and secondaryresponse factors such as GMCSF could lead to a progressivedeactivation of the immune response.

GMCSF is a glycoprotein that signals through a cell surfacereceptor of the hematopoietin receptor family. This signalingmolecule is synthesized in activated T cells, activated macro-phages, endothelial cells, and fibroblasts (34). GMCSF stimu-lates the proliferation and subsequent differentiation of leuko-cyte precursors, but its primary physiological function is torespond to immune activation and to promote the activation ofthe inflammatory response. An additional role for GMCSF ac-tivity was observed in lung tissue of GMCSF knockout mice(35). These mice displayed defects in the level of lung surfac-tant produced, and consequently developed respiratory pathol-ogies. Just as the lack of GMCSF expression can promotedisease, aberrant expression of GMCSF also has severe impli-cations in human disease. Various leukemias, such as acutemyeloid leukemia (36) and juvenile chronic myeloid leukemia(37), display a dysregulation of GMCSF. Constitutive expres-sion of GMCSF is also evident in chronic inflammatory condi-tions such as rheumatoid arthritis and asthma. Down-regula-tion of GMCSF gene expression may facilitate the gradualdiminution of the inflammatory response necessary for a re-turn to the homeostatic state in damaged tissue.

We demonstrate here that the down-regulation of GMCSFmRNA observed in response to 1,25-(OH)2D3 in peripheralblood lymphocytes is occurring at the level of transcription.Moreover, this repression is both VDR-dependent and 1,25-(OH)2D3 dose-dependent. We have delineated a 35-bp regionwithin the GMCSF enhancer that confers the 1,25-(OH)2D3-mediated repression. This region does not contain a consensusVDRE, but analogous to the IL-2 locus, it does include an AP-1site as well as a NFAT-1 element. Using a series of mutantoligonucleotides, we have narrowed down the receptor bindingsite to seven bases that have some homology to an extendednuclear receptor half-site. In contrast to paradigmatic het-erodimer binding, VDR binds the GMCSF element selectivelyand with high affinity as an apparent monomer, with no de-tectable contribution by RXR. Moreover, VDR appears to bepoised on the DNA in an altered conformation when bound tothe negative element as compared with a positive DR3 VDRE,suggesting that the DNA sequence itself is acting as an allos-teric effector of VDR function.

MATERIALS AND METHODS

Antibodies and Overexpressed Proteins—-Rat monoclonal anti-VDRantibody was purchased from Affinity BioReagents (Golden, CO). Poly-clonal anti-VDR antibody was generously provided by Affinity BioRe-agents. VDR was overexpressed in Escherichia coli using the pETsystem as described previously (9). To purify VDR, induced cell pelletswere lysed in a buffer containing 50 mM Tris-HCl, pH 7.5, 1 mM EDTA,500 mM NaCl, 5 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride(TED-500), plus 0.5 mg/ml lysozyme by Dounce homogenization andmicro-tip sonication. Sodium deoxycholate was added to a final concen-tration of 0.05%, and the sample was centrifuged for 1 h at 30,000 rpmin a Ti45 fixed angle rotor. The supernatant was transferred to a freshtube, and polymin P (Aldrich) was added to a final concentration of 0.2%over 10 min and incubated an additional 10 min at 4 °C. Samples werecentrifuged for 1 h at 30,000 rpm, and the supernatant was precipitatedby addition of ammonium sulfate to 30%. The sample was incubated at4 °C for 1 h, and centrifuged for 20 min at 20,000 rpm in a Ti45 rotor.The protein pellet was resuspended in TED-50 and purified by gelfiltration analysis as described previously (9). The VDR DNA-bindingdomain derivative (DBD) was purified as described previously (38). Themutant receptors VDR-L262G and VDR-K45A were purified exactly asdescribed for wild-type VDR. FLAG-RXRa was overexpressed in insectcells and purified as described previously (39).

Plasmids—The GMCSF reporter constructs used in transient trans-fection experiments were created as follows: 716GMCSF-LUC–pGL-2was digested with SmaI and NheI, alkaline phosphatase-treated, andgel-purified. The PvuII/XbaI, 1.4-kilobase pair fragment insert wasderived from pHGM716CAT (provided by P. Cockerill, Hanson Centerfor Research, Australia) corresponding to the GMCSF enhancer frag-ment from 22.6 kilobase pairs to 23.3 kilobase pairs as well as 600 bpof the GMCSF promoter. Positive clones were verified by dideoxynucle-otide DNA sequencing. N3GMCSFLUC–pGL2 basic plasmid was di-gested with SacI and XhoI, filled in with Klenow enzyme, alkalinephosphatase-treated, and gel-purified. The PvuII N3GMCSF fragmentinsert was derived from plasmid HGMN3CAT (provided by P.Cockerill). This fragment consists of the NFAT/AP-1 site at position 550within the 716 bp of the GMCSF minimal enhancer sequence, multim-erized three times, yielding a 158-bp fragment fused to the 600-bpGMCSF promoter fragment. GMCSFLUC–pGL2 basic plasmid was di-gested with SstI and XhoI, filled in by Klenow enzyme, alkaline phos-phatase-treated, and gel-purified. The PvuII/StuI 600-bp GMCSF pro-moter fragment was derived from HMGN3CAT. Expression plasmidswere generated using the cytomegalovirus-driven pRC-CMV vector (In-vitrogen); CMV-VDR (40) was constructed as described previously. VDRmutant constructs were subcloned as described for wild-type VDR.

Oligonucleotide-directed in Vitro Mutagenesis—Site-directed mu-tagenesis was carried out using pCMV-VDR as template, generatingsingle-stranded DNA, and synthesizing the mutant strand with themutagenic oligonucleotide. For VDR-L262G, the mutagenic oligonucleo-tide 59-TGACTTCAGCCCTACGATCTGGT-39 was used to changeleucine 262 to a glycine residue. VDR-K45A was generated using themutant oligonucleotide 59-CTGAAGAAGCCTGCGCAGCCTTC-39 tochange lysine 45 to an alanine residue. Mutant pools were screened forthe appropriate codon changes by dideoxynucleotide DNA sequencing.The mutated VDR was transferred to a T7 overexpression vector as anNdeI-BamHI fragment, and protein was produced and purified as de-scribed for wild-type VDR.

Electrophoretic Mobility Shift Analysis—VDR DNA binding was as-sessed by gel mobility shift electrophoresis using conditions describedpreviously (11). The VDRE from the mouse osteopontin gene (DR3) wasgenerated as complimentary oligonucleotides of the sequence 59-GATC-CACAAGGTTCACGAGGTTCACG TCCG-39 (top strand). The NFAT/AP-1 site at position 550 within the 716 bp of the GMCSF enhancer(GM550) was synthesized as complimentary oligonucleotides of thesequence 59-GATCTCTTATTATGACTCTTGCTTTCCTCCTTTCA-39(top strand). The sequence of the NFAT-IL2 oligonucleotide top strandis 59 CTAGCAGAAAGGAGGAAAAACTGTTT CATACAGAAGGCGTT-39. Mutant oligonucleotides are listed in Fig. 3A. Equimolar amounts ofcomplimentary strands were annealed and 32P-end-labeled as describedpreviously (38). Overexpressed, purified VDR was preincubated with 12fmol of the indicated oligonucleotide duplex for 20 min at room temper-ature together with 50 mg of poly(dI-dC)/ml in binding buffer (20 mM

Tris-HCl, pH 7.9, 1 mM EDTA, 50 mM KCl, 10% glycerol, 0.05% NonidetP-40, and 1 mM dithiothreitol). Protein-DNA complexes were resolvedby electrophoresis on 10% nondenaturing acrylamide gels run in 0.53Tris borate-EDTA, at 250 V, constant voltage at 4 °C. Gels were driedand subjected to autoradiography. For supershift analyses, receptors

Repression of GMCSF Transcription by VDR 10339

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

were preincubated with preimmune sera or specific antibody for 10 minat room temperature. DNA was then added, and incubation proceededfor an additional 20 min at room temperature. Electrophoretic mobilityshift assay (EMSA) was performed as described above.

Proteolytic Clipping Assay—EMSAs were carried out as describedabove with the following modifications. 100 ng of recombinant VDR wasincubated with 20 fmol of the indicated 32P-end-labeled oligonucleotideduplex for 20 min at room temperature. Trypsin protease (Life Tech-nologies, Inc.) was made up in 137 mM NaCl at a stock concentration of25 mg/ml. Trypsin protease was then added directly to the bindingreactions to the indicated final concentration for 10 min at room tem-perature. For the time-course experiment, 10 ng/ml trypsin was addeddirectly to the binding reactions for the indicated times. Complexeswere resolved by electrophoresis on 10% nondenaturing acrylamide gelsas described above, dried, and subjected to autoradiography.

Cell Transfection and Reporter Assays—The T cell line Jurkat wastransfected by electroporation method using BTX (San Diego) 0.2 cu-vettes. Cells were grown in RPMI medium containing sodium pyruvate,glutamine, and penicillin-streptomycin to a final concentration of 100mg/ml. Fetal calf serum was added to 10%, and cells were maintained ata density of approximately 8 3 105 cells/ml. For transfection, cells werewashed in RPMI medium and resuspended in this medium to a densityof 3 3 107 cells/200 ml. Each transfection reaction contained 5 mg ofreporter plasmid, 1.25 mg of internal control plasmid, 500 ng of producerplasmid, and 5 3 106 cells. All reactions are done in triplicate and withtwo treatments. Therefore, six reactions were transfected per BTXcuvettes in a final volume of 200 ml. BTX settings were as follows; T 5500 V, C 5 1700 microfarads, R 5 72 ohms, S 5 126 V. After electro-poration, cells were incubated for 30 min and the contents of eachcuvette was then added to 6 ml of RPMI containing sodium pyruvate,glutamine, penicillin-streptomycin, and charcoal-stripped fetal calf se-rum to 10%. Cells were plated as 1 ml of transfection mix added to 14ml of the same stripped serum containing medium and allowed toincubate 24 h (5% CO2, 37 °C). At 24 h after transfection, cells weretreated in one of the following ways for 9 h: (a) no treatment, (b)addition of activating agents phorbol myristate acetate (PMA, 50 ng/ml;Sigma) and phytohemagglutinin (PHA, 2 mg/ml; Sigma), (c) addition of5 3 1028 M 1,25-(OH)2D3 (Biomol), or (d) addition of activating agentsand 1,25-(OH)2D3. Experiments were harvested and normalized to pro-tein concentration as well as to b-galactosidase activity produced off theinternal control plasmid CMV-b-gal included in each transfection.Equal amounts of total cell extract were added to luciferase assays, andresults were quantitated as relative light units using a luminometer.

RNase Protection Assay—Jurkat cells were transiently transfectedas described previously with the reporter construct N3GMCSFLUC, aswell as the producer plasmids pRC-CMV or pCMV-VDR. Transfectedcells were treated with the activating agents PMA (50 ng/ml) and PHA(2 mg/ml) alone or in the presence of 1 3 1028 M 1,25-(OH)2D3. All cellswere treated with 10 mM cycloheximide for the duration of the experi-ment. Cells were harvested after 6 h of treatment, and total RNA wasisolated using Trizol reagent (Life Technologies, Inc.). The antisenseluciferase probe was generated as described previously (27). 3 mg ofRNA was ethanol-precipitated with 1 3 105 cpm of either luciferaseantisense probe or an antisense b-actin probe. The reaction was thenresuspended in hybridization buffer (Ambion RPA II kit), heated to90 °C, and vortexed thoroughly. Hybridization reaction was incubatedovernight at 45 °C. Digestion of unprotected RNA was performed by theaddition of a 1:100 dilution of an RNase A/RNase T1 mixture, andallowed to incubate at 37 °C for 30 min. Protected fragments wereethanol precipitated, resuspended in a glycerol loading buffer andheated to 90 °C for 4 min. Reactions were analyzed on a 6% denaturingpolyacrylamide gel run at 400 V at room temperature.

Immunoblotting—Transfected Jurkat cells were harvested and re-suspended in 250 mM Tris buffer, pH 8.0. Whole cell extracts wereprepared by repeated freeze/thaw lysis, and centrifuged at 14,000 rpmat 4 °C for 15 min in a microcentrifuge. Supernatants were retained,and protein concentration was determined by the Bradford method(Bio-Rad). 30 mg of whole cell extract was analyzed by SDS-polyacryl-amide gel electrophoresis. Protein was transferred to polyvinylidenedifluoride membrane (NEN Life Science Products) at 140 mA for 30 minin 25 mM Tris, 192 mM glycine, and 20% methanol. The membrane wasblocked in 5% nonfat dry milk (Carnation) in phosphate-buffered salineovernight at room temperature. Monoclonal rat anti-VDR (AffinityBioreagents) was diluted 1:6000 in phosphate-buffered saline, 1% non-fat dry milk, 0.1% Tween 20 and incubated for 3 h. The membrane waswashed extensively in phosphate-buffered saline, 0.1% Tween 20. Themembrane was then incubated in a secondary antibody solution con-sisting of a 1:2000 dilution of horseradish peroxidase-conjugated sheep

anti-rat IgG (Amersham Pharmacia Biotech) in phosphate-bufferedsaline, 1% nonfat dry milk, 0.1% Tween 20 for 45 min. Membrane waswashed as previously described and developed by using enhancedchemiluminescence (Amersham Pharmacia Biotech).

RESULTS

VDR Directly Mediates Repression of the GMCSF Locus byActing through a NFAT/AP-1 Site in the GMCSF Enhancer—A

FIG. 1. A, GMCSF enhancer/promoter constructs used in transienttransfections experiments. Each reporter contains a 600-bp fragmentthat defines the GMCSF promoter region (striped), fused to either a716-bp fragment from 22600 to 23316 (2716GMSCF) in the GMCSFenhancer or a reiterated 30-bp subfragment defining a compositeNFAT/AP-1 site from 22750 to 22780 (N3GMCSF) (42). B, VDR trans-represses transcriptional activation of the GMCSF enhancer/promoter.A VDR producer plasmid, CMV-VDR, was used to cotransfect the hu-man T cell line Jurkat with the indicated reporter constructs. The cellswere transfected by electroporation, using 5 mg of reporter and 500 ngof producer plasmid. At 24 h after transfection, the cells were either leftuntreated, or treated with activating agents PMA (50 ng/ml) and PHA(2 mg/ml), with 5 3 1028 M 1,25-(OH)2D3, or with both activating agentsand 1,25-(OH)2D3. Cells were incubated an additional 9 h and thenharvested. Luciferase levels were normalized to both protein concen-tration as well as to an internal control plasmid, CMV-b-gal. For allexperiments, activation is set at 100%. C, 1,25-(OH)2D3-mediated re-pression does not require de novo protein synthesis. Jurkat cells weretransiently transfected with the reporter plasmid N3GMCSFLUC(shown in A) in the presence of 10 mM cycloheximide, activating agents,in the presence and absence of a VDR producer plasmid and 1,25-(OH)2D3. RNA was prepared and ribonuclease protection assays of theluciferase reporter transcript carried out. The protected RNA fragmentsof the predicted size of 400 nucleotides (pGEMluc) and 276 nucleotides(b-actin) are shown. Lanes 1 and 3, activating agents alone, without orwith CMV-VDR, respectively; lanes 2 and 4, activating agents plus 1 31028 M 1,25-(OH)2D3, without or with CMV-VDR, respectively. A ribo-probe to b-actin served as an internal control.

Repression of GMCSF Transcription by VDR10340

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

group of genes encoding the cytokines IL-2, GMCSF, and in-terferon-g that are activated in response to T cell stimulationare also repressed by the secosteroid 1,25-(OH)2D3. We previ-ously demonstrated that 1,25-(OH)2D3-mediated repression ofIL-2 transcription is a direct, VDR-dependent effect (40). Todetermine if the down-regulation of GMCSF mRNA levels ob-served in response to 1,25-(OH)2D3 is also occurring at the levelof transcription, a transient transfection experiment was per-formed with the promoter constructs depicted in Fig. 1A. 716bp of the GMCSF enhancer located from position 22600 bp to23316 bp from the start site of transcription were fused to theGMCSF promoter and subcloned into a luciferase reporterbackbone construct yielding the construct 2716GMCSF-LUC.This construct was used to transiently transfect, with or with-out a VDR producer plasmid, Jurkat cells, a transformed T cellleukemia cell line. In each transfection series, cells were (a) leftuntreated, (b) treated for 9 h with the activating agents PMAand PHA, (c) treated with 1,25-(OH)2D3 alone, or (d) treatedwith activating agents and 1,25-(OH)2D3. Activation levelswere reduced by only 14% upon the addition of 1,25-(OH)2D3 inthe absence of overexpressed VDR (Fig. 1B). It has been re-ported that VDR is not expressed in resting peripheral bloodlymphocytes, and is only detectable following activation (33).We have been able to detect VDR expression in non-activatedJurkat cells but at very low levels (for example, see Fig. 7A).However, upon transient overexpression of VDR, activationlevels were reduced by nearly 60% following addition of 1,25-(OH)2D3 (Fig. 1B). This repression was also ligand dose-de-pendent, with maximal repression of 98% occurring at 1 3 1026

M 1,25-(OH)2D3 (data not shown). The increase in repression inresponse to VDR levels and ligand concentration indicates thatthe effects are both receptor- and ligand-dependent. The 1,25-(OH)2D3 repression is independent of de novo protein synthesissince the observed down-regulation of GMCSF mRNA as de-tected in ribonuclease protection assays was resistant to thepresence of 10 mM cycloheximide (Fig. 1C).

The 716-bp region of the GMCSF enhancer used in the re-porter assays contains several binding sites for the transcrip-tion factor NFAT-1 as well as for AP-1 family members (41, 42).Interestingly, Alroy et al. (27) showed that 1,25-(OH)2D3-me-diated repression of IL-2 gene transcription was occurringthrough a NFAT/AP-1 composite site centered at 2270 in theIL-2 enhancer. Since cis elements mediating activation couldnot be separated from putative cis-acting repressing sites, theIL-2 element alone was multimerized to assess its ability torepress. In this context, this site was sufficient to confer bothactivation and VDR-dependent repression to a minimal pro-moter. Since a similar situation exists in the GMCSF enhancer,we made an analogous construct consisting of the NFAT/AP-1site located at position 550 within the 716-bp GMCSF en-hancer, since it had been previously shown to be capable offunctioning on its own as an enhancer element in activated Tcells (42). The NFAT/AP-1 site was multimerized three times,fused to the GMCSF promoter, and subcloned into a luciferasereporter plasmid. This construct, called N3GMCSF-LUC (Fig.1A), was used in transient transfection experiments to deter-mine if this particular NFAT/AP-1 site in the GMCSF enhanceris sufficient to mediate the 1,25-(OH)2D3-dependent repres-sion. As shown in Fig. 1B, the N3GMCSF-LUC reporter wasrepressed by 60% upon addition of ligand and overexpressedVDR. This level of repression was identical to that observed

FIG. 2. RXR does not participate with VDR in binding to theGM550 element. A, binding analysis on a positive VDRE (DR3) (lanes1–6) versus the negative GM550 element (lanes 7–12). Lanes 1 and 7,probe alone; lanes 2 and 8, 25 ng of purified FLAG-RXRa; lanes 3 and9, 40 ng of purified VDR; lanes 4 and 10, 80 ng of VDR; lanes 5 and 11,12.5 ng each of VDR and RXRa; lanes 6 and 12, 25 ng each of VDR andRXRa. The positions of the VDRzDNA and VDRzRXRzDNA complexesare indicated. B, comparison of the VDR and VDRzRXR binding profilesto two different negative elements. NFAT-IL2 is a composite site fromthe human IL-2 promoter necessary and sufficient to mediate bothactivation and 1,25-(OH)2D3-induced repression (27). Lanes 1 and 8 areprobe alone; lanes 2 and 9, 30 ng of VDR; lanes 3 and 10, 14 ng of RXR;lanes 4–7 and 11–14, 30 ng of VDR and a titration of RXR from 14 ng to35 ng. C, the DNA binding species bound to the negative element isVDR. In lanes 1–4, 40 ng of VDR were incubated with GM550 (lanes 1and 2) or DR3 (lanes 3 and 4) probe in the absence or presence of 3 mgof a VDR-specific monoclonal antibody (VDR-MAb). In lanes 6–10, 40 ngof VDR were incubated with either DR3 (lanes 6 and 7) or GM550 (lanes

9 and 10) probe in the absence or presence of 3 mg of a FYN-specificmonoclonal antibody. In lanes 12 and 13, 10 ng each of Jun and Fosproteins were incubated with GM550 probe in the presence or absenceof VDR monoclonal antibody. 10 fmol of DR3 and 12 fmol of GM550were used as indicated.

Repression of GMCSF Transcription by VDR 10341

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

with the full 716 bp of the GMCSF enhancer element (Fig. 1B).This result confirms that this NFAT/AP-1 site is also sufficientto confer activation by PMA and PHA (42), and demonstratesthat it is sufficient to mediate repression by 1,25-(OH)2D3. It isimportant to note that the GMCSF enhancer contains threeadditional NFAT/AP-1 sites within the 716-bp enhancer whichmay be able to confer activation, and therefore possibly 1,25-(OH)2D3-mediated repression, although we have yet to testthese sites. We also observed a modest repressive contribution(25%) acting through the GMCSF promoter alone (Fig. 1B). Thepromoter contains several transcription factor binding sites,among them an element known as CLEO (43). Interestingly,the promoter also contains a YY1 element, which has beenshown to display an antagonizing effect on VDR function (71).This element consists of a weak AP-1 site as well as an Etselement. The possibility exists that such sites could also con-tribute to the observed repression.

VDR Is Capable of Binding to a Noncanonical Negative Ele-ment in the GMCSF Enhancer with High Affinity, Independentof RXR—As mentioned, our previous study on the IL-2 en-hancer demonstrated that the target for 1,25-(OH)2D3-transre-pression was also a composite NFAT/AP-1 element (27). Al-though this region lacks a readily identifiable vitamin Dresponse element, at least as defined by the consensus positiveVDRE, we found that VDR and VDRzRXR were in fact able tobind this NFAT/AP-1 site specifically (see Ref. 27 and Fig. 2B).Moreover, VDR mutants that disrupted specific DNA bindingto the element in vitro were incapable of conferring transre-pression in vivo. We therefore asked if the NFAT/AP-1-contain-ing region at position 550 within the GMCSF enhancer, whichconfers 1,25-(OH)2D3-transrepression, also binds VDR selec-tively. Like the IL-2 element, the GMCSF site does not containany recognizable VDREs. A 35-bp oligonucleotide duplex con-taining the NFAT/AP-1 site, termed GM550, was synthesized,

and DNA binding was analyzed by EMSA. An additional oligo-nucleotide containing a positive DR3 VDRE served as a controlfor in vitro DNA binding by recombinant VDR and RXR. Fig.2A demonstrates that VDR alone, but not RXR alone, boundboth the DR3 and GM550 probes (lanes 2–4 and 8–10). Sur-prisingly, the high affinity VDR-RXR heterodimeric complex,which is the predominant species on the DR3, was not detectedon GM550 (compare lanes 5 and 6 with lanes 11 and 12).Moreover, the VDR-GM550 complex migrated with a fastermobility than that of the VDR-DR3 complex (Fig. 2A, lanes 9and 10 versus lanes 3 and 4). The complex bound to the GM550element is indeed VDR, since an anti-VDR monoclonal anti-body directed against the C-terminal region of the VDR DNA-binding domain blocked receptor binding to both the DR3 andGM550 sites (Fig. 2C, lanes 2 and 4). but a monoclonal antibodyraised against an unrelated protein, the Src family memberFyn, was unable to disrupt both complexes (lanes 7 and 10).Moreover, the VDR monoclonal antibody was unable to perturbthe JunzFos binding complex on the negative element, indicat-ing that the loss of a binding complex by the anti-VDR antibodywas specific to VDR. In addition, the VDR-GM550 complex iscompeted specifically by an excess of DR3 competitor oligonu-cleotide but not the analogous amount of an oligonucleotidecontaining a glucocorticoid response element (data not shown).

The absence of RXR in VDRzGM550 binding suggested thatRXR is not involved in VDR-mediated transrepression. Thisgeneralization, however, does not seem to hold, since VDRbound predominately as a heterodimer with RXR to the NFAT-1/IL-2 element (Fig. 2B, lanes 1–7 versus 8–14). Heterodimerswill form on the GM550 element at high concentrations; how-ever, this binding is noncooperative and therefore unlikely tobe functional. These results indicate that the VDR species atthe negative site in GMCSF is distinct from that observed onboth the positive DR3 VDRE and the negative NFAT/AP-1

FIG. 3. Delineation of a VDR recog-nition site within the GM500 element.A, mutant oligonucleotides used in theEMSA profiles. Boldface, lowercase lettersfor nucleotides denote mutated bases.NFAT binding site is boxed; AP-1 bindingsite is underlined. B, DNA binding anal-ysis of VDR to various mutant oligonu-cleotide duplexes. In each series, a con-centration range of purified VDR (0, 20,40, 80, and 200 ng) was incubated with 14fmol of the indicated probe.

Repression of GMCSF Transcription by VDR10342

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

element in the IL-2 enhancer. These data also infer that VDRmay possibly be a monomer and/or in an altered conformationwhen bound to the GM550 repressive element, based on itsfaster mobility relative to VDR on the DR3 in the EMSA.

The VDR Binding Site within GM550 Is a Core of Seven BasePairs That Overlaps the NFAT-1 Binding Site—To furtherdelineate the binding site for VDR in the GM550 element, aseries of mutant oligonucleotide duplexes, shown in Fig. 3A,were synthesized and tested in gel mobility shift assays. Asseen in Fig. 3B, mutation of the AP-1 site (lanes 16–20) had noeffect on VDR binding. Similarly, alterations generated in theGM550 mutB oligonucleotide (lanes 21–25), which include thelast two bases of the AP-1 site and three bases that separatethe AP-1 and NFAT sites (Fig. 3A), also had little effect onVDR’s ability to bind. However, mutations that completelychange the NFAT binding site as well as six additional basesthat extend into the AP-1 binding site (GM550 mutA; Fig. 3A)completely abolished VDR binding (Fig. 3B, lanes 6–10). Tak-ing into account that the GM550(2AP1) mutant oligonucleo-

tide confers normal VDR affinity and mutA abolishes binding,we reasoned that the NFAT binding site may be critical forVDR recognition. We therefore generated GM550(2NFAT),where only the NFAT-1 binding site was mutated (Fig. 3A). Asseen in Fig. 3B (lanes 11–15), VDR binding to this oligonucleo-tide is severely reduced. Thus, the lack of VDR binding toGM550 mutA and 2NFAT mutant probes defines the sequenceGCTTTCC, which superficially resembles an extended VDREhalf-site, as the minimal requirement for VDR binding to theGM550 negative element.

The GM550 Negative Element Acts as an Allosteric Effector ofVDR—The faster mobility profile exhibited by VDR whenbound to the negative GM550 versus the positive DR3 observedin Fig. 2 suggested that VDR binding to the negative elementwas unique. To address this, several approaches were taken tocompare VDR binding to each element. First, a gel mobilitysupershift assay was carried out. Fig. 4A illustrates that whenVDR was prebound to the DR3, a polyclonal antibody raisedagainst the receptor (distinct from that shown in Fig. 2B) wasable to specifically supershift the receptor-DNA complex (lane6). However, when VDR was preincubated with GM550, nei-ther the preimmune serum nor this VDR-specific antibodysupershifted the complex (lanes 11 and 12). As was observed inFig. 2, the VDRzGM550 complex migrated with a faster mobil-ity when compared with VDR bound to the DR3. Additionalevidence that VDR utilizes an alternative strategy in bindingthe negative element was derived from a VDR mutant gener-ated by site-directed mutagenesis termed VDR-K45A. This ly-sine, at residue 45, is absolutely conserved among all theknown members of the steroid and nuclear receptor superfam-ily and lies within the specificity a-helix of the receptor DBD,immediately proceeding the first zinc finger. This lysine resi-due has been shown in several crystal structures to be makingdirect side-chain contacts on positive hormone response ele-ments (44). As expected, DNA binding of the K45A mutant tothe DR3 VDRE was completely abolished in the presence orabsence of RXR (Fig. 4B, lanes 11–15). However, VDR-K45Awas capable of binding to the negative GM550 element, albeitwith a slightly lower affinity than the wild-type receptor (lanes16–20). As with wild-type VDR, addition of RXR had no effecton the binding. This result suggests that a specific contactwithin the receptor DNA-binding domain essential for interac-tion with a positive response element is not making an equiv-alent contact on the negative GM550 site. Transient transfec-tion of cells with the VDR-K45A mutant correlates with the invitro DNA binding data. The K45A mutant receptor was unableto activate transcription from a DR3-regulated reporter, butrepressed from the GM550 element (although repression isreduced to a similar extent as VDR-DNA binding is decreased;data not shown). Taken together, the data reinforce the impor-tance of DNA binding by VDR on the GM550 element but inferthat VDR is associating with this element in a conformationthat is distinct from how it binds a positive VDRE. This differ-ence in VDR conformation would presumably be imposed bythe DNA element itself.

To directly investigate whether the GM550 element can actas an allosteric effector of VDR, a proteolytic clipping assay wasperformed. As is evident from the results presented in Fig. 5,GM550 induced a pronounced conformational change in VDRrelative to the receptor bound to the DR3 as assayed by prote-ase sensitivity. VDR is highly resistant to the proteolytic effectsof trypsin at amounts as high as 100 ng/ml, but only when it isprebound to the negative element (Fig. 5A, lanes 1–8). In con-trast, preincubation of VDR with the DR3 yielded a progressivecleavage pattern with increasing trypsin concentrations (lanes9–16). A nearly identical pattern was observed when a time

FIG. 4. VDR recognizes positive and negative DNA bindingelements in distinct ways. A, anti-VDR antibody supershifts VDRbound to the DR3 but not to the GM550 probe. 60 ng of VDR waspreincubated with DR3 (lanes 1–6) or GM550 probes (lanes 7–12). A1:10 dilution of either preimmune sera (PI; lanes 2, 5, 8, and 11) orVDR-specific polyclonal antisera (lanes 3, 6, 9, and 12) was then addedto the binding reactions, and complexes were resolved by EMSA. B, aVDR mutant unable to bind to the DR3 can recognize the GM550element. Binding of the zinc finger mutant K45A in the presence andabsence of RXR to both DR3 and GM550 probes (lanes 11–20) wascompared with the same amounts of wild-type VDR (lanes 1–10). Ineach series, 40 ng of VDR, K45A, or RXR alone (lanes 2, 3, 7, 8, 12, 13,17, and 18), 20 ng of VDR-K45A plus 10 ng of RXR (lanes 4, 9, 14, and19), or 40 ng of VDR-K45A plus 20 ng of RXR (lanes 5, 10, 15, and 20)were used. Ab, antibody.

Repression of GMCSF Transcription by VDR 10343

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

course of induction was carried out using a constant amount ofprotease (Fig. 5B). The resistant profile observed when VDRwas bound to GM550 is indicative of a more compacted receptorconformation on the DNA. These allosteric effects induced bythe negative element might create new surfaces on the protein,which may be necessary to elicit the repressive function. DNA-induced structural changes have been demonstrated with Junand Fos (45).

VDR Binds to the GM550 Element as a Monomer—We havedemonstrated that the high affinity DNA binding species onGM550 does not include RXR (Figs. 2 and 4B), indicating thatthe repressing VDR species is not a heterodimer. Cheskis andFreedman (9) demonstrated that, in addition to the usual het-erodimeric binding, VDR is also capable of binding to themouse osteopontin positive VDRE as both homodimers andmonomers, whereby preformed homodimers on DNA are disso-ciated to monomers upon addition of 1,25-(OH)2D3. To addresswhether VDR is binding to GM550 as a homodimer or a mon-omer, we took advantage of a truncated version of VDR consti-tuting only the DBD. In the absence of the strong dimerizationinterface that co-localizes to the C-terminal ligand-binding do-main, the VDR DBD cannot form dimers in solution, and assuch resolves as both monomers and cooperative dimers on aDR3 in gel shift assays (13). When gel mobility shifts werecarried out comparing VDR DBD binding to the positive versusnegative element, as shown in Fig. 6A, the VDR DBD yielded

two bound species with the DR3 (lanes 1–6), representing mo-nomeric and cooperative dimeric species (dbd1 and dbd2, re-spectively), but resolved only one bound band with the GM550probe, running with the same mobility as the faster of the twobound species seen with the DR3 probe (lanes 7–12). This isconsistent with a VDR monomer associated with the GM550element. As a control for monomeric binding, we used an oli-gonucleotide duplex containing only one half-site from the DR3element (DR1/2); this probe restricted binding to predomi-nately a single bound species that is presumably a VDR mon-omer (lanes 13–18). To further demonstrate this, a mixingexperiment was carried out in which full-length VDR and VDRDBD were co-incubated, bound to each probe, and resolved byEMSA (Fig. 6B). Although an intermediate species consistingof a VDRzDBD heterodimer bound to the positive DR3 elementwas readily apparent (lanes 6 and 7), no such species wasdetected on the negative GM550 element, even at high concen-trations of both receptors (lanes 11 and 12). These data stronglysuggest that the DNA binding species on the GM550 element isa VDR monomer.

A second approach we took to demonstrate that theVDRzGM550 complex is indeed monomeric utilized a dimeriza-tion mutant of VDR, VDR-L262G. This mutation, locatedwithin helix 4 of the LBD, renders VDR incapable of het-erodimerizing with RXR and therefore unable to activate tran-scription from a reporter gene regulated by the osteocalcin

FIG. 5. Differential susceptibility toprotease digestion suggests distinctVDR conformations on a positive ver-sus negative recognition element. A,trypsin protease titration. 100 ng of puri-fied VDR was preincubated with the indi-cated radiolabeled probe with GM550(lanes 1–8) or DR3 (lanes 9–16) and sub-jected to trypsin digestion for 10 min withthe indicated amounts of protease. B,time course of protease digestion. 100 ngof VDR bound to the GM550 and DR3probes were subjected to a trypsin diges-tion at a fixed amount (10 ng/ml) for theindicated times.

Repression of GMCSF Transcription by VDR10344

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

VDRE (46). We generated the VDR-L262G mutant in the con-text of the full-length receptor and first tested its activity totransactivate from a positive VDRE in COS cells (Fig. 7A, leftpanel). COS cells were used to initially test VDR-L262G activ-ity because these cells do not express endogenous VDR thatmight obscure the effect of the mutant receptor. VDR-L262Gwas unable to transactivate a reporter construct driven by theDR3 VDRE in response to 1,25-(OH)2D3, whereas wild-typeVDR was able to transactivate this reporter more than 100-fold(an identical result was also observed with this reporter andVDR-L262G in Jurkat cells; data not shown). Since this mutantcan still bind ligand with near wild-type affinity (46), and itsexpression in the transfected COS cells is identical to wild-typeVDR (Fig. 7A), its inability to transactivate in vivo is due to theloss of its dimerization function. We then tested VDR-L262G’sability to repress transcription from the GM550 element bytransiently transfecting Jurkat cells with the mutant receptortogether with the N3GMCSF-LUC reporter construct describedin Fig. 1. In contrast to the lack of transactivation from thepositive VDRE, the L262G mutant is still able to transrepressactivated transcription, albeit not quite to wild-type levels,

from the GM550 element in Jurkat cells in response to 1,25-(OH)2D3 (Fig. 7A, right panel), suggesting that dimerization ofVDR is not required for its repressing function.

We therefore tested the ability of the VDR-L262G dimeriza-tion mutant to bind to both the positive and negative elementsin vitro (Fig. 7B). As reported previously (46), VDR-L262G isunable to heterodimerize with RXR on the positive DR3 (lanes9 and 10). Moreover, this mutant cannot homodimerize since nodetectable binding was observed on the DR3 in the absence ofRXR (lanes 7 and 8 versus 3 and 4). In contrast, the VDR-L262G mutant bound to the negative element GM550 with anapparent higher affinity than wild-type VDR and was unaf-fected by the addition of RXR (lanes 13–16 versus 17–20). Over-all, this DNA binding profile correlates with the transfectiondata in that the dimerization mutant was able to transrepressfrom the GM550 element, but could not activate from the DR3(Fig. 7A). Taken together, the DNA-binding domain and dimer-ization mutant experiments strongly suggest that theVDRzGM550 complex consists of a VDR monomer that is actingas the functional repressive complex at the GM550 element.

DISCUSSION

The paradigm for vitamin D3 receptor binding to DNA ele-ments that confer transcriptional activation in response to1,25-(OH)2D3 is a dimeric receptor species comprising one mol-ecule of VDR and one molecule of RXR bound to two directlyrepeating hexameric half-sites (consensus: PuGG/TTCA),which are spaced by three nucleotides, and termed DR3 (re-viewed in Ref. 47). Each monomeric subunit makes a series ofasymmetric interactions at the two DNA-binding domains, andsymmetrical contacts within each ligand-binding domain. Theheterodimeric complex can then presumably interact directlywith the preinitiation complex or indirectly through a numberof coactivators (15, 48–53), whose identities and functions arejust now being defined, yielding the net result of transcrip-tional activation. This of course is all contingent on ligandbinding, and the role of ligand in all of this appears to bemanifold. Ligand binding increases the affinity of VDR for RXR(9, 10, 54) and therefore for the cognate DNA binding element,it induces conformational changes in the tertiary structure ofthe receptor (55–57), and it enhances interactions with compo-nents of the transcriptional machinery, presumably resultingin the stabilization of the preinitiation complex so that produc-tive initiation can occur.

Since transcriptional repression is essentially the antago-nism of all of these events, it is not surprising that the mech-anism of transrepression by a nuclear receptor as we currentlyunderstand it is fundamentally different from activation. Anumber of genes have been described that are targets of re-pression by steroid and nuclear receptors, and a variety ofmechanisms ranging from DNA-independent inhibition of pos-itive factor (22, 58) to competition for common binding sites ona promoter have been proposed (18, 19, 21, 24, 28, 40, 59–61).However, what has not been adequately accounted for is howthe same trans-factor, i.e. a steroid/nuclear receptor, can acti-vate some target genes and repress others. An attractive hy-pothesis proposed by Yamamoto and others (62) is that inscenarios involving direct DNA binding, it is the DNA elementitself that acts as an allosteric effector of receptor structure/function. This is feasible since in those cases where negativeelements have been delineated, they rarely resemble positiveelements (24, 26, 28, 61). Thus, the interaction of the receptorwith a noncanonical recognition sequence might induce analternative structure that would then be incapable of activat-ing transcription, but has also gained a repressive function,possibly by precluding the binding of another, unrelated posi-tive factor, such as Fos and Jun.

FIG. 6. VDR binds the GM550 element as a monomer. A, bindinganalysis of the VDR DBD (VDRdbd) resolves a single complex on theGM550 element. In each series, a concentration range of VDR DBD (5,10, 20, 50, and 75 ng) was incubated with DR3, GM550 probes, or anoligonucleotide probe comprising a single hexameric AGGTCA half-site(DR-1/2) and resolved by EMSA. B, mixing VDR and VDR DBD yieldsa VDRzDBD heterodimeric species (dbd/VDR) only when it is bound tothe DR3 element. Lanes 1–7, binding to the DR3 probe, using 25 or 50ng of VDR DBD (lanes 2 and 3), 30 ng or 60 ng of VDR (lanes 4 and 5),25 ng of VDR DBD co-incubated with 30 ng of VDR (lane 6), and 50 ngof VDR DBD co-incubated with 30 ng of VDR (lane 7). Lanes 8–12,binding to the GM550 probe, using 50 ng of VDR DBD or VDR (lanes 9and 10), 40 ng of VDR DBD co-incubated with 40 ng of VDR (lane 11),or 80 ng of VDR DBD co-incubated with 40 ng of VDR (lane 12). In alllanes, 10 fmol of probe was used. In both A and B, dbd1 refers tomonomeric and dbd2 to dimeric species, respectively.

Repression of GMCSF Transcription by VDR 10345

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

Four key pieces of data presented in this work are consistentwith DNA acting as an allosteric effector as an explanation forhow VDR represses the activated transcription of the GMCSFgene. First, we clearly observe specific receptor binding to anelement we have defined to 7 bp at 22758 to 22765 consistingof the sequence GCTTTCC in the GMCSF enhancer. Second,VDR binding to this element induces a conformation in thereceptor that is distinct from its apparent conformation when itbinds a positive DR3 VDRE, as deduced from both limitedprotease digestion and from DNA binding and dimerization

mutants that are unable to bind and activate from the DR3 butcan bind and repress from the GMCSF negative element withnear or equal affinity and potency as wild-type receptor. Third,whereas VDR binds to and activates transcription from theDR3 as a VDRzRXR heterodimer, RXR is completely excludedfrom the VDR binding species at the negative element. Fourth,VDR appears to bind the negative element as a monomer. Thelast two observations are consistent with what we have previ-ously demonstrated concerning how 1,25-(OH)2D3 affects thedimerization state of VDR (9). In the presence of RXR, 1,25-

FIG. 7. A VDR dimerization mutant retains the ability to repress GMCSF-activated transcription and to bind with wild-typeaffinity to the GMCSF element. A, transient transfections of COS and Jurkat cells with the VDR dimerization mutant L262G from luciferasereporters regulated by DR3 and GM550 elements, respectively. Left panel, a COS transfection using an E1B-TATA-Luc reporter regulated by thepositive mouse osteopontin DR3 VDRE, together with CMV plasmids expressing vector alone (CMV), wild-type VDR (CMV-VDR), or theVDR-L262G mutant. Cells were treated with or without 1028 M 1,25-(OH)2D3. Right panel, Jurkat cell transfections with the same series of VDRoverexpressors but using the N3GMCSF-LUC reporter. Cells were treated with activating agents PMA and PHA plus (lanes 2, 4, 6, 8, and 10) orminus (lanes 1, 3, 5, 7, and 9) 5 3 1028 M 1,25-(OH)2D3. The insets below each graph show immunoblots of 30 mg of whole cell extract from eachtransfection, indicating expression of wild-type and mutant VDRs from both cell lines. Note that expression of VDR-L262G is significantly lowerin Jurkat cells, but nevertheless is still able to confer repression. 50 ng of overexpressed purified VDR is shown in lane 11. B, DNA binding of theL262G mutant to DR3 and GM550 elements. The experiment and protein amounts are essentially as described for Fig. 3B. For the DR3 shifts(lanes 1–10), VDR refers to a homodimeric complex; for the GM550 shifts (lanes 11–20), VDR refers to a putative monomeric complex. A schematicof the relative location of the L262G mutation is shown below the gels. The weak, slow migrating species in lanes 9 and 10 most likely correspondsto a RXRzRXR homodimer (15); this species tends to bind with low affinity to a number of direct repeats.

Repression of GMCSF Transcription by VDR10346

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

(OH)2D3 promotes heterodimerization with VDR, but in theabsence of RXR, the ligand actually inhibits homodimerizationand can in fact dissociate a preformed VDR homodimer tomonomers. Thus, as depicted in Fig. 8, we propose that theGM550 element allosterically induces VDR into a conformationthat precludes dimerization with RXR. Preformed VDR-RXRheterodimers would not be able to bind this element, as wehave shown in vitro, or the element itself would actually inducethe dimeric complex to dissociate to monomers. 1,25-(OH)2D3

would enhance DNA binding by preventing homodimerizationand stabilizing monomers, since it is the monomeric speciesthat is the high affinity binding form on the GM550 negativeelement.

As stated earlier, the GM550 negative element does notcontain a canonical VDRE. It does, however, include bindingsites for the activating factors NFAT-1 and AP-1 family mem-bers. Cockerill et al. (42) showed previously that occupancy atboth of these sites is absolutely required for maximal activationof the GMCSF gene, in addition to occupancy at three otherNFAT/AP-1 sites within the defined enhancer region. Since thenegative element we have described here at position 550 over-laps an NFAT binding site, one possible mechanism for VDR-mediated transrepression is simple steric hindrance, in which atranscriptionally inert VDR monomer blocks the association ofNFAT-1 protein to one half of the NFAT-1/AP-1 site. We arealso interested in addressing the possibility that a similarantagonistic effect on NFAT binding to the additional NFAT/AP-1 sites within this enhancer may also contribute to the1,25-(OH)2D3 effect on this gene. The overall inability ofNFAT-1 to bind one or more of these sites would effectivelyblock transcriptional activation of GMCSF (42). TargetingNFAT is also a strategy important immunosuppressive drugssuch as cyclosporin A utilize, but at the level of NFAT dephos-phorylation and nuclear localization (63–66). Moreover, theapparent allosteric changes the negative element is impingingon VDR may be translated into the creation of new proteinsurfaces. New surfaces normally inaccessible could then recruita distinct set of interacting factors. Such factors might also benecessary for antagonizing the positive effects of AP-1 proteinsand/or NFAT-1. Co-occupancy of VDR and the positive trans-activating factors on the GM550 site is also a possible mecha-nism we cannot rule out. However, in this model, VDR wouldsomehow have to lock NFAT-1 or AP-1 into an “off” state suchthat they could no longer transactivate, perhaps by directlyinteracting with one or both and precluding a productive inter-action with a coactivator or basal factor. In this case, thesimultaneous binding of VDR and NFAT proteins at theGM500 site is unlikely since their binding sites appear tooverlap. Nonetheless, this model must be considered along withothers; we are currently addressing the nature of VDR’s inter-action with AP-1 and NFAT proteins at the GM550 site todetermine the molecular mechanism of this repression. Prelim-inary data from nuclear extracts prepared from Jurkat cellstreated with activating agents and 1,25-(OH)2D3 show a dis-ruption of a PMA/PHA-inducible DNA binding complex. How-ever, we have yet to show occupancy of this element by VDRfrom these extracts and are currently working to address this.

Previous work from our laboratory identified the IL-2 geneas a direct target of 1,25-(OH)2D3-mediated repression. Webelieve this begins to explain the molecular basis of the immu-nosuppressive effects of 1,25-(OH)2D3 at the level of the acti-vated T cell, but not completely. The present study extends thiswork by identifying the GMCSF locus as an additional directtarget of 1,25-(OH)2D3, and suggests a more diverse role ofvitamin D action in the immune system. The primary role ofGMCSF is to activate mature granulocytes and macrophages,thereby eliciting the body’s response to infection and initiatinginflammatory responses (67, 68). This response clearly must betightly regulated such that activation occurs only at appropri-ate times, and that a gradual down-modulation of the responseis initiated. We believe that the data presented here is consist-ent with the role of 1,25-(OH)2D3 contributing directly to thisgradual decline of the inflammatory response at the level ofrepressing the transcription of GMCSF in activated T cells.This would lead to a decrease in the levels of GMCSF protein inthe tissue periphery. It is also likely that a similar regulatoryprocess is occurring directly in macrophages, although we haveyet to test this. In fact, the role of 1,25-(OH)2D3 at the level ofGMCSF and in macrophages is further linked by the inferenceof a 1,25-(OH)2D3 feedback loop in this cell type. Activatedmacrophages have been shown to produce the enzyme 1-a-hydroxylase (69, 70). This enzyme is the critical regulatoryenzyme required to convert the inactive vitamin D metabolite25-(OH)D3 to the biologically active ligand 1,25-(OH)2D3. Theability of activated macrophages to promote an increase in1,25-(OH)2D3 levels would in essence lead to the deactivation ofmacrophages via repression of GMCSF expression. There arepotentially important clinical implications to this autoregula-tory loop. Dysregulation of GMCSF leads to pathological con-ditions in diseases such as juvenile chronic myeloid leukemia(37), acute myeloid leukemia (36), and rheumatoid arthritis. Inthese scenarios, it is conceivable that the regulatory actions of1,25-(OH)2D3 may not be operating normally, or the feedbackloop may be inactive. The close association of 1,25-(OH)2D3 andGMCSF as demonstrated here suggests that the role of thisligand be evaluated carefully in these and other diseases.

Acknowledgments—We thank Peter Cockerill for originalGMCSF plasmids, Amy Wolven for providing the FYN mono-clonal antibody, and Ben Luisi and Mercy Devasahayam forcritically reading this manuscript. We are also grateful toChristophe Rachez, Bryan D. Lemon, and Robert Benezra forhelpful discussions and insights.

REFERENCES

1. Lowe, K. E., Maiyar, A. C., and Norman, A. W. (1992) Crit. Rev. Eukaryot.Gene. Exp. 2, 65–109

2. Christakos, S., Raval-Pandya, M., Wernyj, R. P., and Yang, W. (1996) Biochem.J. 316, 361–371

3. Reichel, H., Koeffler, H. P., and Norman, A. (1989) N. Engl. J. Med. 320,980–991

4. Abe, E., Miyaura, C., Sakagami, H., Takeda, M., Konno, K., Yamazaki, T.,Yoshiki, S., and Suda, T. (1981) Proc. Natl. Acad. Sci. U. S. A. 78,4990–4994

5. Mangelsdorf, D. J., Pike, J. W., and Haussler, M. R. (1984) J. Cell Biol. 98,391–398

6. Bar-Shavit, Z., Teitelbaum, S. L., Reitsma, P., Hall, A., Pegg, L. E., Trial, J.,

FIG. 8. VDR binds the GM550 ele-ment as a monomer and in alteredprotein conformation relative to thepositive DR3 VDRE. See “Discussion”for details.

Repression of GMCSF Transcription by VDR 10347

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

and Kahn, A. J. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 5907–59117. Liu, M., Lee, M. H., Cohen, M., Bommakanti, M., and Freedman, L. P. (1996)

Genes Dev. 10, 142–1538. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992)

Nature 355, 446–4499. Cheskis, B., and Freedman, L. P. (1994) Mol. Cell. Biol. 14, 3329–3338

10. Cheskis, B., and Freedman, L. P. (1996) Biochemistry 35, 3309–331811. Lemon, B. D., and Freedman, L. P. (1996) Mol. Cell. Biol. 16, 1006–101612. Koszewski, N. J., Reinhardt, T. A., and Horst, R. L. (1996) J. Steroid Biochem.

Mol. Biol. 59, 377–38813. Towers, T. L., Luisi, B. L., Asianov, A., and Freedman, L. P. (1993) Proc. Natl.

Acad. Sci. U. S. A. 90, 6310–631414. Noda, M., Vogel, R. L., Craig, A. M., Prahl, J., DeLuca, H. F., and Denhardt,

D. T. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9995–999915. Lemon, B. D., Fondell, J. D., and Freedman, L. P. (1997) Mol. Cell. Biol. 17,

1923–193716. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell

65, 1255–126617. Horwitz, K. B., Jackson, T. A., Bain, D. L., Richer, J. K., Takimoto, G. S., and

Tung, L. (1996) Mol. Endocrinol. 10, 1167–117718. Miner, J. N., and Yamamoto, K. R. (1991) Trends Biochem. Sci. 16, 423–42619. Miner, J. N., and Yamamoto, K. R. (1992) Genes Dev. 6, 2491–250120. Salbert, G., Fanjul, A., Piedrafita, F. J., Lu, X. P., Kim, S. J., Tran, P., and

Pfahl, M. (1993) Mol. Endocrinol. 7, 1347–135621. Drouin, J., Sun, Y. L., Chamberland, M., Gauthier, Y., De Lean, A., Nemer, M.,

and Schmidt, T. J. (1993) EMBO J. 12, 145–15622. Schule, R., Rangarajan, P., Kllewer, S., Ransone, L. J., Bolado, J., Yang, N.,

Verma, I. M., and Evans, R. M. (1990) Cell 62, 1217–122623. Liu, S. M., Koszewski, N., Lapuz, M., Malluche, H. H., Olivera, A., and Russel,

J. (1995) Mol. Endocrinol. 10, 206–21524. Demay. M. B., K., M. S., DeLuca, H. F., and Kronenberg, H. M. (1992) Proc.

Natl. Acad. Sci. U. S. A. 89, 8097–810125. Lichtler, A., Stover, M. L., Angilly, J., Kream, B., and Rowe, D. W. (1989)

J. Biol. Chem. 264, 3072–307726. Li, Q., and Gardner, D. (1994) J. Biol. Chem. 269, 4934–493927. Alroy, I., Towers, T. L., and Freedman, L. P. (1995) Mol. Cell. Biol. 15,

5789–579928. Kim, R. H., Li, J. J., Ogata, Y., Yamauchi, M., Freedman, L. P., and Sodek, J.

(1996) Biochem. J. 318, 219–22629. Bhalla, A. K., Amento, E. P., and Krane, S. M. (1986) Cell. Immunol. 98,

311–32230. Rigby, W. F. C., Denome, S., and Fanger, M. W. (1987) J. Clin. Invest. 79,

1659–166431. Reichel, H., Koeffler, H. P., Tobler, A., and Norman, A. W. (1987) Proc. Natl.

Acad. Sci. U. S. A. 84, 3385–338932. Tobler, A., Gasson, J., Reichel, H., Norman, A. W., and Koeffler, H. P. (1987)

J. Clin. Invest. 79, 1700–170533. Yu, X. P., Mocharla, H., Hustmyer, F. G., and Manolagas, S. C. (1991) J. Biol.

Chem. 266, 7588–759534. Gasson, J. C. (1991) Blood 77, 1131–114535. Stanley, E., Lieschke, G. J., Grail, D., Metcalf, D., Hodgson, G., Gall, J. A. M.,

Maher, D. W., Cebon, J., Sinickas, V., and Dunn, A. R. (1994) Proc. Natl.Acad. Sci. U. S. A. 91, 5592–5596

36. Russell, N. H. (1992) Blood Rev. 6, 149–15637. Freedman, M. H., Cohen, A., Grunberger, T., Bunin, N., Luddy, R. E.,

Saunders, R. F., Shahidi, N., Lau, A., and Estrov, Z. (1992) Br. J. Haematol.80, 40–48

38. Freedman, L. P., and Towers, T. L. (1991) Mol. Endocrinol. 5, 1815–182639. Lemon, B. D. (1997) Molecular Mechanisms of Gene Transcription by the

Vitamin D3 Receptor, Ph.D. thesis, Cornell University Graduate School ofMedical Sciences, New York

40. Alroy, I. (1995) Repression of Interleukin-2 Gene Transcription by the Receptorfor 1,25-Dihydroxyvitamin D3, Ph.D. thesis, Cornell University GraduateSchool of Medical Sciences, New York

41. Cockerill, P. N., Bert, A. G., Jenkins, F., Ryan, G. R., Shannon, M. F., andVadas, M. A. (1995) Mol. Cell Biol. 15, 2071–2079

42. Cockerill, P. N., Shannon, M. F., Bert, A. G., Ryan, G. R., and Vadas, M. A.

(1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2466–247043. Jenkins, F., Cockerill, P., Bohmann, D., and Shannon, M. F. (1995) J. Immu-

nol. 155, 1240–125144. Luisi, B. F., Schwabe, J., and Freedman, L. P. (1994) in Steroids (Litwack, G.,

ed) Vol. 49, pp. 1–48, Academic Press, San Diego45. Patel, L., Abate, C., and Curran, T. (1990) Nature 347, 572–57546. Whitfield, G. K., Hsieh, J. C., Nakajima, S., MacDonald, P. N., Thompson,

P. D., Jurutka, P. W., Haussler, C. A., and Haussler, M. R. (1995) Mol.Endocrinol. 9, 1166–1179

47. Freedman, L. P., and Lemon, B. D. (1997) in Vitamin D (Feldman, D.,Glorieux, F. H., and Pike, J. W., eds) pp. 127–148, Academic Press, SanDiego

48. Blanco, J. C., Wang, I. M., Tsai, S. Y., Tsai, M. J., O’Malley, B. W., Jurutka,P. W., Haussler, M. R., and Ozato, K. (1995) Proc. Natl. Acad. Sci. U. S. A.92, 1535–1539

49. DiRenzo, J., Soderstrom, M., Kurokawa, R., Ogliastro, M.-H., Ricote, M.,Ingrey, S., Horlein, A., Rosenfeld, M. G., and Glass, C. K. (1997) Mol. Cell.Biol. 17, 2166–2176

50. Mengus, G., May, M., Carre, L., Chambon, P., and Davidson, I. (1997) GenesDev. 11, 1381–1395

51. Le Douarin, B., Zechel, C., Garnier, J.-M., Lutz, Y., Tora, L., Pierrat, B., Heery,D., Gronemyer, H., Chambon, P., and Losson, R. (1995) EMBO J. 14,2020–2033

52. vom Baur, E., Zechel, C., Heery, D., Heine, M. J., Garnier, J. M., Vivat, V., LeDouarin, B., Gronemeyer, H., Chambon, P., and Losson, R. (1996) EMBO J.15, 110–124

53. MacDonald, P. N., Sherman, D. R., Dowd, D. R., Jefcoat, S. C., Jr, and DeLisle,R. K. (1995) J. Biol. Chem. 270, 4748–4752

54. MacDonald, P. N., Dowd, D. R., Nakajima, S., Galligan, M. A., Reeder, M. C.,Haussler, C. A., Ozato, K., and Haussler, M. R. (1993) Mol. Cell. Biol. 13,5907–5917

55. Bourguet, W., Ruff, M., Chambon, P., Gronemeyer, H., and Moras, D. (1995)Nature 375, 377–382

56. Renaud, J.-P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H.,and Moras, D. (1995) Nature 378, 681–689

57. Wagner, R. L., Apriletti, J. W., McGrath, M. E., West, B. L., Baxter, J. D., andFletterick, R. J. (1995) Nature 378, 690–697

58. Yang-Yen, H. F., Chambard, J. C., Sun, Y., Smeal, T., Schmidt, T. J., Drouin,J., and Karin, M. (1990) Cell 62, 1205–1215

59. Sakai, D. D., Helms, S., Carstedt-Duke, J., Gustafsson, J. A., Rottman, F. M.,and Yamamoto, K. R. (1988) Genes Dev. 2, 1144–1154

60. Schule, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans,R. M. (1990) Cell 61, 497–504

61. Okazaki, T., Igarashi, T., and Kronenberg, H. M. (1988) J. Biol. Chem. 263,2203–2208

62. Leftsin, J. A., Thomas, J. R., and Yamamoto, K. R. (1994) Genes Dev. 8,2842–2856

63. Beals, C. R., Clipstone, N. A., Ho, S. N., and Crabtree, G. R. (1997) Genes Dev.11, 824–834

64. Flanagan, W. M., Corthesy, B., Bram, R. J., and Crabtree, G. R. (1991) Nature352, 803–806

65. Jain, J., Miner, Z., and Rao, A. (1993) J. Immunol. 151, 837–84866. McCaffrey, P. G., Luo, C., Kerppola, T. K., Jain, J., Badalian, T. M., Ho, A. M.,

Burgeon, E., Lane, W. S., Lambert, J. N., Curran, T., Verdine, G. L., Rao, A.,and Hogan, P. G. (1993) Science 262, 750–754

67. Kato, M., Liu, M. C., Stealey, B. A., Friedman, B., Lichtenstein, L. M.,Permutt, S., and Schleimer, R. P. (1992) Lymphokine Cytokine Res. 11,287–292

68. Williamson, D. J., Begley, C. G., Vadas, M. A., and Metcalf, D. (1988) Clin. Exp.Immunol. 72, 67–73

69. Reichel, H., Koeffler, H. P., Barbers, R., and Norman, A. W. (1987) J. Clin.Endocrinol. Metab. 65, 1201–1209

70. Lawson-Matthew, P., Clayton, J., Guilland-Cummings, D., Yates, A., Preston,E., Greaves, M., and Kanis, J. A. (1989) Br. J. Haematol. 73, 57–60

71. Guo, B., Aslam, F., Van Wijnen, A. J., Roberts, S. G., Frenkel, B., Green, M.,DeLuca, H., Lian, J. B., Stein, G. S., Stein, J. L. (1997) Proc. Natl. Acad. Sci.U. S. A. 94, 121–126

Repression of GMCSF Transcription by VDR10348

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from

Terri L. Towers and Leonard P. FreedmanDNA ELEMENT

AINFLUENCES ON NUCLEAR RECEPTOR STRUCTURE AND FUNCTION BY Receptor: IMPLICATIONS FOR ALLOSTERIC3Repressed by the Vitamin D

Granulocyte-Macrophage Colony-stimulating Factor Gene Transcription Is Directly

doi: 10.1074/jbc.273.17.103381998, 273:10338-10348.J. Biol. Chem. 

  http://www.jbc.org/content/273/17/10338Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/273/17/10338.full.html#ref-list-1

This article cites 68 references, 35 of which can be accessed free at

by guest on Novem

ber 17, 2020http://w

ww

.jbc.org/D

ownloaded from