Distinct Phosphorylation Events Regulate p130- and p107-mediatedRepression of E2F-4*

Received for publication, January 14, 2002, and in revised form, April 29, 2002Published, JBC Papers in Press, May 2, 2002, DOI 10.1074/jbc.M200381200

Thomas Farkas, Klaus Hansen‡, Karin Holm, Jiri Lukas, and Jiri Bartek

From the Danish Cancer Society, Institute of Cancer Biology, Strandboulevarden 49, Copenhagen DK-2100, Denmark

The “pocket proteins” pRb (retinoblastoma tumorsuppressor protein), p107, and p130 regulate cell prolif-eration via phosphorylation-sensitive interactions withE2F transcription factors and other proteins. We previ-ously identified 22 in vivo phosphorylation sites in hu-man p130, including three sites selectively targeted bycyclin D-Cdk4(6) kinases. Here we assessed the effects ofalanine substitution at the individual or combinedCdk4(6)-specific sites in p130, compared with homolo-gous sites in p107 (Thr369/Ser650/Ser964). In U-2-OS cells,the triple p107�Cdk4* mutant strongly inhibited E2F-4activity and imposed a G1 arrest resistant to cyclin D1coexpression. In contrast, the p130�Cdk4 mutant still re-sponded to cyclin D1, suggesting the existence of addi-tional phosphorylation sites critical for E2F-4 regula-tion. Extensive mutagenesis, sensitive E2F reporterassays, and cell cycle analyses allowed the identificationof six such residues (serines 413, 639, 662, 1044, 1080, and1112) that, in addition to the Cdk4-specific sites, arenecessary and sufficient for the regulation of E2F-4 andthe cell cycle by p130. Surprisingly, 12 of the in vivophosphorylation sites seem dispensable for E2F regula-tion and probably modulate other functions of p130.These results further elucidate the complex regulationof p130 and provide a molecular mechanism to explainthe differential control of p107 and p130 by cyclin-de-pendent kinases.

The retinoblastoma protein (pRb)1 and the related proteinsp107 and p130, collectively known as pocket proteins, are in-volved in regulation of the cell cycle, differentiation, cellularsenescence, and cell death (1–4). Whereas pRb is a tumorsuppressor, a potentially analogous role of p107 and p130 inpreventing tumorigenesis is still a matter of debate (5). Never-theless, evidence for essential functions of p107 and p130 innegative control of cell cycle progression has recently emerged(2, 6–8).

pRb, p107, and p130 exert their functions through interac-tions with a large number of cellular proteins via multipleindependent binding sites (3, 9). The so-called A/B pocket issuch a binding site, originally defined in pRb. This pocketstructure encompasses an A- and a B-domain, separated by an

insert sequence (10–13). The A/B pocket is necessary for bind-ing to viral oncoproteins and other proteins containing themotif LXCXE and is conserved in p107 and p130 (14–17).

Many of the known effects of pocket proteins depend on theirability to repress gene expression by binding members of theE2F family of transcription factors. The direct targets of E2Fsinclude genes whose products are critical for embryonic devel-opment and tissue homeostasis (18, 19). The high affinity DNAbinding form of E2F is a dimer consisting of one subunit fromthe DP protein family (DP-1 or DP-2) and one of six E2Fs(E2F-1 to E2F-6). The carboxyl terminus of the E2F subunitbinds directly to the so-called “large A/B pocket” of pRb, p107,and p130 in a manner compatible with simultaneous binding ofthe pocket with LXCXE containing proteins (20). Whereas p130and p107 preferentially bind E2F-4 and E2F-5, pRb can inter-act with all E2Fs except for E2F-6, which lacks the transacti-vating domain. p130 is highly expressed in quiescent cells,where it forms the predominant E2F complex. When cells enterthe cell cycle and pass the so-called restriction point in middleto late G1 (21), p107 is induced and becomes the major E2Fbinding partner at the G1/S transition. Complexes of pRb aremainly found in G1, but they also exist in quiescence (G0) andin S phase (22, 23). p107 and p130 redundantly repress asubset of E2F targets distinct from the subset of genes con-trolled by pRb (24). The pocket proteins repress transcriptionby direct inhibition of the transactivating domain of E2Fs(25–27) and by recruitment of nucleosome-remodeling enzymesto the E2F-pocket protein complex, thereby changing chroma-tin into a transcriptionally less active state (28). A character-istic difference distinguishing p107 and p130 from pRb is theirbinding to cyclin E-Cdk2 and cyclin A-Cdk2, a function thatcooperates with repression of E2Fs to inhibit the cell cycle(29–32).

The regulation of pRb function by cell cycle-dependent phos-phorylation has provided a framework for the understanding ofthe regulation of the other two pocket proteins. The inactiva-tion of pRb is carried out in middle to late G1 by phosphoryla-tion of serine and threonine residues, mediated by the sequen-tially activated cyclin D-Cdk4(6) and cyclin E-Cdk2 kinasecomplexes. When hyperphosphorylated, pRb loses its bindingpotential, and induction of E2F target gene transcription is oneof the downstream effects (3). p107 and p130 are also phospho-rylated in a cell cycle-dependent manner (33, 34), and G1 phasecyclin-Cdk-mediated phosphorylations are required to dissoci-ate the E2F-4(5)-p130 complex (35). The importance of p107and p130 phosphorylation for cell cycle progression is sug-gested by the growth arrest imposed by overexpression of phos-phorylation-deficient mutants of p107 and p130 in tumor celllines resistant to the corresponding wild-type proteins (31, 36).

Although the cell cycle regulation of p130 and p107 by phos-phorylation is broadly reminiscent of the control over pRb,some important differences exist in the ways phosphorylation

* This work was supported by grants from the Danish Cancer Society,the Danish Medical Research Council, and the European Union. Thecosts of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked “adver-tisement” in accordance with 18 U.S.C. Section 1734 solely to indicatethis fact.

‡ To whom correspondence should be addressed: Institute of CancerBiology, Danish Cancer Society, Strandboulevarden 49, DK-2100 Co-penhagen, Denmark. Tel.: 45-35-25-73-34; Fax: 45-35-25-77-21; E-mail:KHH@biobase.dk.

1 The abbreviations used are: pRb, retinoblastoma protein; Cdk, cyclin-dependent kinase; HA, hemagglutinin; GST, glutathione S-transferase.

THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 277, No. 30, Issue of July 26, pp. 26741–26752, 2002© 2002 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

This paper is available on line at http://www.jbc.org 26741

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

affects the individual pocket proteins. First, cyclins A and E arenot dissociated by hyperphosphorylation of p107 and p130,thereby providing a phosphorylation-insensitive function (31).Second, p130 harbors a unique region in the B-domain, withseveral phosphorylation sites targeted by non-Cdk kinases (31,37). Third, p107 and p130 can be mutually distinguishedthrough their differential responses to G1 cyclin-Cdks in vivo.Thus, phosphorylation of p130 and dissociation of E2F-4 can beachieved by either Cdk4(6) or Cdk2, and it occurs even in cellsdeficient in cyclin D-associated kinase activity. In contrast,Cdk2 activity is insufficient to release E2F-4 from p107, andthis process requires the activity of Cdk4(6) (33, 38, 39).Fourth, SV40 virus T-antigen binds to hyperphosphorylatedforms of p107 and p130 but not of pRb, indicating a nonequiva-lent regulation of LXCXE-mediated protein interactions byphosphorylation (40). Other LXCXE-mediated interactions,however, are controlled by phosphorylation, as exemplified bythe reduced affinity of phosphorylated p107 for histonedeacetylase (41). Fifth, the fact that only three out of 22 in vivophosphorylation sites in p130 are conserved in pRb (31) sug-gests that p130 is subject to unique modes of regulation.

There is a growing appreciation of the involvement of p107and p130 in cell cycle regulation, and better understanding ofhow their activities are controlled is needed. In this study, weidentify a distinct subset of in vivo phosphorylation sites inp130 necessary for regulation of E2F-4 and the cell cycle. Inaddition, a complementary subset of phosphorylation sites ofp130 has only a minor influence on E2F-4-mediated transcrip-tion and cell cycle control. The latter phosphorylation sites maybe involved in regulating processes distinct from E2F-4 bind-ing. Comparative analysis of p130 with p107 suggests a func-tional conservation of the Cdk4-specific phosphorylation sitesbut also a striking difference in phosphorylation site usagebetween p107 and p130, providing an explanation for the dif-ferential kinase sensitivities of the two proteins.

EXPERIMENTAL PROCEDURES

Cell Culture and Transfection—The human cell lines U-2-OS andT98G were grown in Dulbecco’s modified Eagle’s medium supplementedwith 10% fetal calf serum, penicillin, and streptomycin. Except for invivo labeling experiments, transfections were performed by the calciumphosphate precipitation method (42) in dishes of cells grown to 30–50%confluence.

Plasmid Construction—The plasmid used for expressionof HA-tagged wild-type p130 (HAp130wt) in eukaryotic cells,pcDNA.1-HAp130wt, was reported previously (31). The expression plas-mid for HA-tagged p107 was created by digesting a synthetic double-stranded DNA encoding the HA-tag with NsiI and HpaI (sense strand,GCATAAAATGCATACCCCTACGACGTGCCCGACTACGCCTGTT-AACTGCAGT) and inserting it downstream of the last sense codon ina previously described p107 expression plasmid (43). The NsiI andHpaI sites were introduced using a pair of complementary mutagen-esis primers (sense strand, GAAAGAGCAAATCATGCATGTTGTT-GTTAACTCTATGATAAAAGCAC) as described (31). Other point mu-tations in the p130 and p107 genes were created similarly. Mutantswith more than one of the four clusters of phosphorylation sites com-pletely substituted with alanines were created by joining regions usingrestriction enzymes as follows: p1303600 was made by joining HindIII-Eco81I fragments from p1303000 and p1300600; p1303006 by joiningHindIII-Eco81I fragments from p1303000 and p1300006; p1300670 byjoining HindIII-PaeI fragments from p1300600 and p1300070; p1300606

by joining HindIII-PaeI fragments from p1300600 and p1300006;p1303606 by joining HindIII-Eco81I fragments from p1303000 andp1300606; p1303670 by joining HindIII-PaeI fragments from p1303606

and p1300070; p1303676 by joining HindIII-ScaI fragments fromp1303670 (completely digested) and p1300006 (partial digestion withScaI). HAp130PM9A was constructed by joining the HindIII-PaeI frag-ments of a plasmid with mutations in codons 401, 413, 639, 662, 672and a plasmid with mutations in codons 1035, 1044, 1080, 1112.HAp130PM12A was made similarly from a plasmid mutated in codons642, 688, and 694 and a plasmid mutated in codons 948, 952, 962, 966,973, 982, 986, 1068, and 1097. A Gal4-E2F-4 fusion protein expres-

sion plasmid was created by inserting a PCR product encoding full-length E2F-4 in the plasmid pM (CLONTECH) in the EcoRI andBamHI sites. The PCR primers contained these sites as 5�-extensions.The reporter construct 5�GAL-luc was created by PCR amplificationof the region in pG5CAT (CLONTECH) containing the five GAL4binding sites and the minimal promoter of the adenovirus E1b geneand insertion into the SacI and HindIII sites of pGL3-basic (Pro-mega). The PCR primers contained these sites as 5�-extensions. Aplasmid for expression of GSTp130wt fusion protein in bacteria(pGEX-2tp130wt) was created by joining a BamHI-XbaI fragment(partial digestion with XbaI) of pcDNA.1-HAp130wt to the vectorpGEX-2t opened with BamHI and XbaI. The plasmid for expression ofGSTp130PM22A was made similarly from pcDNA.1-HAp130PM22A.

Antibodies and Immunochemical Methods—Immunoblotting and im-munoprecipitation were performed as in Ref. 31. Antibodies 12CA5 andSC805 or SC7392 against the HA tag (Santa Cruz Biotechnology, Inc.,Santa Cruz, CA) were used in immunoprecipitation and immunoblot-ting, respectively. Antibodies to p130 (SC317), E2F-4 (SC866), andcyclin A (SC751) were purchased from Santa Cruz Biotechnology.

GST Fusion Protein and Pull-down Assay—GST-p130wt and GST-p130PM22A were expressed in the Escherichia coli strain Bl21pLys frompGEX-2t. The E. coli cells were grown to A600 � 1 and harvested.Isopropyl-�-D-thiogalactopyranoside induction was omitted to avoid theappearance of incomplete fusion proteins. Cell extract was prepared asdescribed (44) in E. coli lysis buffer (20 mM Hepes, pH 7.2, 1 mM

dithiothreitol, aprotinin (2.5 �g/ml), and leupeptin (2.5 �g/ml)). Onepull-down reaction contained an amount of fusion protein derived from10 ml of E. coli culture, precoupled to glutathione-Sepharose beads, and250 �g of protein from U-2-OS. The reaction was incubated at 4 °C for90 min with gentle end-over-end mixing. Beads were washed threetimes in immunoprecipitation lysis buffer (50 mM Hepes, pH 7.5, 150mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 0.1% Tween 20) supplementedwith aprotinin (2.5 �g/ml), leupeptin (2.5 �g/ml), and dithiothreitol (1mM) and boiled in 40 �l of 2� Laemmli sample buffer; 20 �l wasanalyzed by immunoblotting.

Reporter Assay—U-2-OS cells were seeded in 6-cm dishes and trans-fected with the indicated type and amount of plasmid DNA. Sonicatedsalmon sperm DNA was added to a total of 8 �g of DNA per transfec-tion. Forty hours after transfection, the cells were harvested and pro-cessed for reporter assays as described (31). Briefly, luciferase activitywas measured using the Luciferase Assay System (Promega) and aBerthold Lumat LB95d instrument. The �-galactosidase assay wasperformed in 300 �l as follows: 30 �l of cleared lysate in 270 �l ofreaction buffer (67 mM phosphate buffer, pH 7.5, 1.5 mg/ml o-nitrophe-nyl-�-D-galactopyranoside (Sigma), 1 mM MgCl2, 0.25% �-mercaptoeth-anol). The reaction was stopped by adding 500 �l of Na2CO3 (1 M).Optical density at 420 nM was measured. Relative luciferase activitywas obtained by normalizing to �-galactosidase activity. Each transfec-tion was performed in duplicate and repeated independently at leastthree times. Within one experiment, the fluctuation of the measuredvalues did not exceed 10%. All measurements were performed so thatthe light intensities and optical densities were recorded within theirrespective linear ranges. The presented data were calculated as ratiosbetween the activities of the pocket protein containing samples to thoseobtained from control transfected cells (transfected with either emptyvector or with wild type p130 plasmid (see legends in Figs. 1B, 3, and4B)). The latter control had been included repeatedly in each separateexperiment. Because its value differs in separate measurements due tovarying transfection efficiencies, it was arbitrarily set to 100 to allowcomparison of multiple independent experiments.

Flow Cytometry—U-2-OS cells were seeded in 10-cm dishes andtransfected with 5 �g of pCMV-CD20 and the indicated amounts andtypes of pocket protein expression plasmids. Empty vector was added toa total of 15 �g of DNA per transfection. Occasionally 0.1 �g of pCMV-Luc was cotransfected as transfection control; in that case, one-third ofthe cells were analyzed for luciferase activity, as described above, andtwo-thirds were processed for flow cytometry, essentially as described(45).

Phosphopeptide Mapping—T98G cells were electroporated in thepresence of the indicated plasmid DNA and labeled 42 h later for 4 hwith [32P]orthophosphate (2 mCi/ml) in phosphate-free medium con-taining 10% dialyzed fetal calf serum. Phosphopeptide maps were madeas described previously (31).

RESULTS

Roles of Cdk4-specific Phosphorylation Sites in p107 andp130 in E2F-4 Regulation—Previously, we identified 22 in vivo

Phosphorylation of p107 and p13026742

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

phosphorylation sites in p130 (31). Among those, three werespecifically targeted by Cdk4(6) (referred to here as Cdk4-specific), whereas most of the other phosphorylation sites weremore general Cdk sites targeted by both Cdk4(6) and Cdk2. Invivo phosphorylation sites in p107, on the other hand, have notyet been systematically studied. Sequence alignments revealedconservation of 10 of the in vivo phosphorylation sites betweenp130 and p107, including all three Cdk4-specific sites (Fig. 1A,top). A strict dependence on cyclin D-Cdk4(6) kinase activity fordissociation of p107 from E2F-4 has been described (33, 38),whereas Cdk2-associated kinase activity alone is sufficient todissociate p130 from E2F-4 (39). This difference between thetwo related pocket proteins prompted us to compare the influ-ence of the Cdk4-specific sites in p107 and p130 on E2F-4activity, using the mutant p130�Cdk4 with the three Cdk4-specific sites substituted with alanine (31) and the homologoustriple-alanine mutant p107�Cdk4* made in this study (the as-terisk indicates that the notion of Cdk4 specificity here is basedon homology to p130).

Our assay measured repression of a luciferase reporter withfive Gal4 binding sites in front of a minimal promoter. Coex-pressing the fusion protein Gal4-E2F-4, which contains theDNA binding domain of Gal4 fused to full-length E2F-4, in-duces transcription 250-fold higher than the Gal4 domain alone(data not shown). We refer to this activity as E2F-4-induced.This reporter type was chosen for its high sensitivity andability to assess the E2F-4 pocket protein interaction.

Before activity measurements, we estimated the impact ofthe triple-alanine substitution (T369A,S650A,S964A) on theglobal phosphorylation status of p107 by tryptic phosphopep-tide mapping of in vivo 32P-labeled p107 versus p130 as areference. The four phosphopeptides representing the Cdk4-specific sites are, as previously published (31), specifically lostin the 130�Cdk4 map, including the double spot arising fromSer672 (Fig. 1A, bottom). The tryptic phosphopeptide map ofp107 revealed at least 12 spots, indicating that p107, like pRband p130, is phosphorylated on multiple sites. In thep107�Cdk4* map, we observed the absence of three phosphopep-tides. Further investigation using single substitution mutantsand estimation of the migration of predicted tryptic cleavageproducts2 suggested that phosphorylation of Ser650 in p107,like the homologous Ser672 in p130, gives rise to a double spot.Similar analysis suggested that one of the hydrophobic phos-phopeptides in the top of the map originates from phosphoryl-ation of Thr369. The spot marked by a dashed arrow in thep107�Cdk4* map represents an unidentified phosphopeptide,which sometimes, like in the p107wt map, separates into twospots (marked by double dashed arrows). The charge of thisphosphopeptide is �1, and it does not represent the phos-phopeptide containing a phosphorylation on Ser964 (predictedcharge of �3). We have so far not been able to positively showphosphorylation at Ser964 in our experimental set-up. Thisappears analogous to p130 with respect to the Ser1035 phospho-rylation, which often has been difficult to detect. We concludethat alanine substitutions in three potential Cdk4-specific sitesof p107 do not impair phosphorylation on other sites and thatat least two of the sites, Thr369 and Ser650, are phosphorylatedin vivo.

In U-2-OS cells, p130wt and p107wt repressed the E2F-4activity down to 52 and 29%, respectively (Fig. 1B, top). Theimpact of p107�Cdk4* and p130�Cdk4 was 9.3- and 2.3-foldgreater, respectively, compared with their wild-type counter-parts. The greater effect on p107 than on p130 of removing theCdk4-specific sites supports the above mentioned differential

kinase dependences of the two proteins and also a functionalconservation of the Cdk4-specific sites in p107. The repressionof E2F-4 even by ectopic wild-type p107 and p130 suggests thatthey are partially active and therefore not fully phosphoryl-ated. This indicates, in turn, that at least under conditions ofpocket protein overexpression, endogenous cyclin D-Cdk4(6)kinase activity is limiting. We found that cyclin D1 overexpres-sion reverted the effect of p130wt almost to the basal, unre-pressed level (empty vector coexpressed with cyclin D1) (Fig.1B, top). Furthermore, repression by p130�Cdk4 was reduced bycoexpressing cyclin D1, resulting in a 2.4-fold reduced activitycompared with p130wt with cyclin D1. Repression mediated viap107wt was also partially inactivated by cyclin D1 coexpres-sion. In contrast, the p107�Cdk4* did not respond to cyclin D1and had a 34.8-fold stronger repressor activity compared withp107wt coexpressed with cyclin D1. The levels of pocket pro-teins were similar with or without ectopic cyclin D1, excludingdifferential expression levels as a mechanism by which cyclinD1 affects pocket protein activity under our experimental con-ditions (Fig. 1B, bottom).

The data suggest that p107 and p130 have distinct subsets ofphosphorylation sites involved in E2F-4 regulation. One subsetis shared by p107 and p130 and comprises one or more of theCdk4-specific sites. The second subset consists of sites that canbe phosphorylated in the absence of Cdk4(6) activity and has asignificant regulatory impact on p130 but not on p107. Toelucidate the more complex regulation of p130, we undertookan investigation of an extensive set of alanine substitutionmutants to determine the identity and impact of in vivo phos-phorylation sites in p130 essential for E2F-4 regulation.

Phosphorylation Sites in p130 Important for E2F-4 Regula-tion Are Distributed in the A-domain Proximal Region, Spacer,and C-domain—Previously, we have shown that a mutant ofp130 with 19 of 22 in vivo phosphorylation sites changed toalanine mirrors the effects of unphosphorylated p130, for ex-ample by increased co-immunoprecipitation of E2F-4 comparedwith wild-type p130 (31). To assess which of the 22 residues areimportant for regulation of E2F-4, we constructed GST fusionproteins of p130wt and a mutant p130PM22A with alanine sub-stitutions in all previously identified in vivo phosphorylationsites (Fig. 1A, top). Since bacteria are unlikely to harbor kinaseactivities that effectively phosphorylate p130, we assume thatthe p130wt fusion protein produced in E. coli is unphosphoryl-ated. This prediction was supported by the identical migrationof the two proteins in SDS-polyacrylamide gel electrophoresis(Fig. 2). Importantly, the GST fusion proteins bound similaramounts of E2F-4 and cyclin A in a pull-down assay fromU-2-OS cell extracts, indicating that protein conformation ispreserved, and none of the 22 substitutions resulted in a majoralteration of the protein. The preserved binding capacity forE2F-4 further shows that the alanine-substituted p130 resem-bles the unphosphorylated p130wt with respect to E2F-4affinity.

Given the large number of in vivo phosphorylation sites inp130, we first wished to estimate the location of sites importantfor E2F-4 regulation, relative to the four regions in which theycluster (Fig. 1A, top). Four corresponding mutants, each havingall phosphorylation sites within one cluster completely substi-tuted with alanine, were made and were tested in the Gal4-E2F-4-based reporter assay. When compared with p130wt,each of these mutants, p1303000, p1300600, p1300070, andp1300006, showed increased ability to repress E2F-4-inducedtranscription (Table I). The spacer and C-domain cluster sub-stitutions had the strongest effect, decreasing the reporteractivity from 88% down to 54 and 58%, respectively, followed by67% achieved by the A-domain proximal cluster mutant. Mu-2 K. Hansen and T. Farkas, unpublished data.

Phosphorylation of p107 and p130 26743

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

tation of the seven phosphorylation sites in the B-domain clus-ter had the least pronounced effect, reducing the reporter ac-tivity only to 73%. When combined, the cluster mutants showedcooperative effects, generally in agreement with their individ-

ual effects. This is demonstrated by comparing the effect of theC- and the B-domain mutations in combination with the spacermutant. Whereas p1300606 reduces reporter activity to 16%,p1300670 reduces the activity only to 44%, which is nearly

FIG. 1. Distinct effects of Cdk4(6)-specific phosphorylation sites in p130 and p107. A, top, diagram of p130 and p107 showing the locationof the in vivo phosphorylation sites in p130 and all of the 17 SP/TP sites in p107; conservations are underlined. Asterisks indicate those residuesin p107 that are homologous to the three Cdk4-specific phosphorylation sites in p130. Bottom, phosphopeptide maps of the indicated pocketproteins. The spots arising from phosphorylation of Cdk4-specific sites are indicated in the p130wt map, and tryptic phosphopeptides representingthe two phosphorylation sites in p107, which are homologous to Thr401 (Thr369) and Ser672 (Ser650) in p130 are marked by arrows in the p107wtmap. The specific lack of phosphopeptides in the p130�Cdk4 and the p107�Cdk4* maps are indicated by arrowheads. The dashed arrow in thep107�Cdk4* map points to a phosphopeptide, which sometimes separates into two species as seen in the p107wt map (dashed double arrow). B, top,U-2-OS cells were transfected with empty vector or the indicated pocket protein expression plasmids (500 ng) to repress the activity of cotransfected5�Gal-luc (1 �g) and Gal4-E2F-4 (25 ng). Either 1 �g of pX-cyclin D1 or pX empty vector was cotransfected. A CMV-LacZ construct (500 ng) wasused to normalize for transfection efficiency. The reporter activity was related to the empty vector sample, which was thereby defined as 100. Theresults are mean values and S.D. values of three independent experiments. Bottom, expression level of p130 and p107. U-2-OS cells weretransfected as above, and the p130 and p107 derivatives were immunoprecipitated with one anti-HA antibody (12CA5) and immunoblotted usinganother anti-HA antibody (Y-11). The input volumes of cell lysate in immunoprecipitations were normalized for transfection efficiency bymeasuring the �-galactosidase activity.

Phosphorylation of p107 and p13026744

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

identical to the effect of p1300600. The impact of the A-domainproximal cluster on transcription is intermediate, as shown bythe inhibitions to 34 and 33% obtained by p1303600 andp1303006, respectively. The relatively small influence of theB-domain is also seen by comparing p1303606 and p1303670 withp130PM22A. The available B-domain phosphorylations inp1303606 result in only a minor loss of repression capacity ofp130PM22A, increasing transcription from 7.5 to 10%, whereasavailability of C-domain phosphorylations in p1303670 resultedin an increase in E2F-4 activity to 32%, similar to the effect ofp1303600. All p130 mutants were detectable and localized to thenucleus (data not shown), and, as previously observed by othersand us, increasing the number of alanine substitutions in p130tends to lower the expression level (31, 36). We consistently

observed 3–4-fold less expression of p130PM22A than of p130wt(see below; Fig. 4C). Hence, the relative capacity of p130PM22A

to repress E2F-4 is likely to be underestimated. We conclude

FIG. 2. Comparison of in vitro binding abilities of unphospho-rylated p130wt and p130PM22A. Shown is a pull-down experiment asdescribed under “Experimental Procedures.” Lane 1, U-2-OS total celllysate (20 �g of total protein); lanes 2–4, pull-down from total U-2-OScell lysate via the indicated GST fusion proteins. The samples wereimmunoblotted using antibodies against p130, E2F-4 and cyclin A asindicated. The protein bands of endogenous p130 represent phosphoiso-forms 1, 2, and 3 (31, 34).

FIG. 3. Functional mapping of individual phosphorylationsites in p130 important for E2F-4 regulation. Plasmids expressingthe indicated p130 constructs (500 ng) were tested for repression ofcotransfected 5�Gal-luc (1 �g) and Gal4-E2F-4 (25 ng) in U-2-OS cells.A CMV-LacZ construct (500 ng) was cotransfected and used to normal-ize for transfection efficiency. The diagrams in the top, middle, andbottom show repression data for alanine substitutions made in theA-domain proximal cluster of phosphorylation sites, the spacer domain,and the C-domain, respectively. The phosphorylation sites substitutedfor alanine in the mutants are indicated below each lane. The resultsare mean and S.D. values of three independent experiments. Effects ofsubstitutions on reporter activity were related directly to p130wt,thereby defining the activity of Gal4-E2F-4 in the presence of p130wt as100. The immunoblots below the diagrams were made as follows.U-2-OS cells were transfected with 1 �g of the indicated p130 expres-sion plasmid and 0.1 �g of the luciferase expression plasmid pCMV-luc.The p130 derivatives were immunoprecipitated with one anti-HA anti-body (12CA5) and immunoblotted using another anti-HA antibody (Y-11). The input volumes of cell lysate in immunoprecipitations werenormalized for transfection efficiency by measuring the luciferaseactivity.

TABLE INomenclature of p130 mutants with clustered alanine substitutions

and their repression of Gal4-E2F-4 transactivationFor each construct, the amino acids substituted with alanine are

indicated. Plasmids expressing the p130 constructs (100 ng) were testedfor repression of cotransfected 5 � Gal-luc (1 �g) and Gal4-E2F-4 (25ng) in U-2-OS cells. A CMV-LacZ construct (500 ng) was cotransfectedand used to normalize for transfection efficiency. The results, presentedas relative luciferase activity, are mean values and S.D. of three inde-pendent experiments. 100 was defined by use of empty vector. In controlsamples, protein levels of all of the p130 mutants were monitored byimmunoblotting with anti-HA antibody (F-7).

Phosphorylation of p107 and p130 26745

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

FIG. 4. p130PM9A and p130PM12A have strong and weak ability, respectively, to regulate and bind E2F-4 and show specific loss ofphosphopeptides corresponding to mutated residues. A, the diagram indicates the alanine substituted residues in p130PM9A and p130PM12A.Phosphopeptides in the maps are numbered according to their appearance in the primary amino acid sequence; identical numbers are used for

Phosphorylation of p107 and p13026746

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

that the phosphorylation sites in p130 most important forE2F-4 regulation are distributed in the A-domain proximalcluster, the spacer, and the C-domain, with only very limitedinfluence of sites in the B-domain. The clusters of substitutionsfurthermore seem to function independently, as revealed bytheir additive effects when combined.

Identification of Individual Phosphorylation Sites of p130Essential for Regulation of E2F-4—Because the regulatoryfunction provided by each cluster of phosphorylation sites inp130 seems to contribute independently to the formation of themost potent E2F-4 repressor, we were encouraged to furtherpinpoint the sites important for E2F-4 regulation within theclusters. Our aim was, for the A-domain proximal cluster, thespacer, and C-domain, respectively, to identify the most impor-tant residues by creating a phosphorylation site mutant withas few substitutions as possible but having full capacity forrepression. In the A-domain proximal region, the Cdk4-specificsite Thr401 played a central role, since the double substitution(S413A,T417A) did not have any significant effect over p130wt(Fig. 3, top). Substitution of Thr401 alone, however, was insuf-ficient for full repression, and further substitution of either ofthe two remaining sites was required, with S413A having amore pronounced effect than T417A when combined withT401A (Fig. 3, top).

Due to the high number of phosphorylation sites, the spacerand the C-domain were analyzed by creating a selection ofsubstitution mutants. The six phosphorylation sites in thespacer are distributed in three pairs of closely spaced residues.A mutant with substitution of the central pair (S662A,S672A)repressed E2F-4 more than p130wt (Fig. 3, middle), whereasnone of the two corresponding single substitutions repressedthe reporter as efficiently (data not shown). The importance ofSer662 and Ser672 was confirmed by the poor repression whenonly the other four sites were selectively mutated. AddingS639A to the mutant (S662A,S672A) resulted in a triple mu-tant repressing as well as the one with a fully substitutedcluster. In contrast, the repression imposed by the reciprocalsubstitution mutant (T642A,S688A,T694A) was almost identi-cal with p130wt. In summary, the in vivo phosphorylation sitesin the spacer can be divided into two groups of three residues,one group having strong and the other weak effect on E2F-4repression.

Single substitution mutants of phosphorylation sites in theC-domain did not improve the repression capacity of p130 (datanot shown). The double substitution mutant (S1044A,S1112A),however, did (Fig. 3, bottom). Thr1097, Ser1080, and Ser1035 werethen substituted sequentially. An increase in repression wasseen by mutation of the Cdk4-specific site Ser1035, and it wasfurther enhanced in the quadruple mutant (S1035A,S1044A,S1080,S1112A). Consistently, the reciprocal mutant (S1068A,T1097A) was not an improved repressor compared withp130wt. We conclude that the six in vivo phosphorylation sites

in the C-domain can be divided into groups of four and tworesidues, with strong and weak influence on E2F-4 repression,respectively.

Characterization of p130PM9A and p130PM12A Mutants withStrong and Weak Ability to Regulate E2F-4, Respectively—Tocreate a p130 mutant with a strong ability to repress E2F-4, yetwith a minimal number of substitutions, we combined thosemutants of the A-domain proximal region, spacer, and C-do-main that showed the highest repression potential. The result-ing mutant p130PM9A is shown in the diagram in Fig. 4A, alongwith the reciprocal mutant p130PM12A, created by combiningthe phosphorylation site mutations with no or minor effect onE2F-4 repression (note that Thr417 is kept wild-type in bothmutants). Comparative phosphopeptide mapping of p130wt,p130PM9A, and p130PM12A revealed that both mutants showspecific losses of only the phosphopeptides corresponding to themutated residues (Fig. 4A). Thus, the two groups of reciprocalsites are phosphorylated independently, and any phenotypesthese mutants may evoke in transfected cells would be causedby the specific inability to phosphorylate the mutated residues,rather than a consequence of a more widespread phosphoryla-tion deficiency.

Next we tested p130PM9A and p130PM12A for their ability torepress E2F-4 activity. Analogous to data obtained with muta-tions within individual domains, a strong cooperative effect ofalanine substitutions in the mutant p130PM9A is seen. Thismutant has an effect on E2F-4 activity resembling that ofp130PM22A, showing 25.6- and 34.5-fold stronger repressionthan p130wt, respectively (Fig. 4B, left). Mutating the residueThr417, which was the only site not included in either thep130PM9A or the p130PM12A mutant, to alanine in the p130PM9A

background did not improve its repression of E2F-4 further(data not shown). In contrast, p130PM12A is a relatively weakrepressor, allowing for 84% of the E2F-4 activity comparedwith p130wt. To estimate the relative expression levels of thevarious p130 constructs, we adjusted the amount of proteinlysate in immunoprecipitations according to transfection effi-ciency. The number of relative transfection units used to obtainan equal amount of pocket proteins was estimated by immuno-blotting against the HA tag on transfected p130. The levels ofp130PM9A and p130PM22A were similar, both �3.5-fold lowerthan the level of p130wt (Fig. 4C, left). This shows that thestrong E2F-4 repressor activity mediated by p130PM9A is not aconsequence of a fortuitous high expression level. On the otherhand, the level of p130PM12A was similar to p130wt, showingthat the inefficient repression by the protein is not a conse-quence of its low abundance. Because of the lack of any regu-latory element in 5�Gal-luc other than Gal4 binding sites andthe requirement for Gal4-E2F-4 coexpression for activation ofthe reporter, we speculate that the inhibition of transcriptionimposed by pocket proteins most likely is the result of directshielding of the activation domain of E2F-4 and mainly meas-

residues located on the same tryptic phosphopeptide. An asterisk indicates sample application point. The arrows indicate the location ofphosphopeptides giving rise to only a weak signal at the selected exposure. The arrowhead indicates the location of a phosphopeptide of unknownidentity (The “B2” spot described by Hansen et al. (31)). We cannot explain the specific loss of B2 in the p130PM12A map. The existence of twophosphopeptides numbered 3 is due to a single and a double phosphorylation on the peptide containing Ser639 and Thr642. The existence of twophosphopeptides numbered 8 is due to an incomplete tryptic digest of the most positively charged peptide (the spot 8 migrating outermost right).B, repression of E2F-4 transactivation. Left part, U-2-OS cells were transfected with the indicated p130 constructs (0.5 �g), 5�Gal-luc (1 �g),Gal4-E2F-4 (25 ng), and CMV-LacZ (0.5 �g). The results are mean and S.D. values of three independent experiments. The effects of mutants onreporter activity were related directly to the effect of p130wt, defined as 100. Right part, same as left but cotransfected with either 2 �g of pX-p16expression vector or pX empty vector as indicated. C, expression level of p130 mutants and coimmunoprecipitation of endogenous E2F-4. Left part,expression plasmids (1 �g) for the indicated HA-tagged p130 constructs were transfected into U-2-OS cells together with pCMV-luc (0.1 �g).HA-tagged p130 was immunoprecipitated with the anti-HA antibody, 12CA5, and immunoblotted for the HA-tag or E2F-4. To obtain equal signalsin the p130wt, p130PM12A, p130PM9A, and p130PM22A lanes, volumes of extract with the following predetermined relative amounts of luciferaseactivity were immunoprecipitated: 1; 1.2; 3.5; 3.5, respectively. The total protein input in immunoprecipitations was kept constant by supple-menting with U-2-OS lysate from untransfected cells. Right part, same as left part but cotransfected with 2 �g of pX-p16 expression vector; theinput ratios of transfection units in immunoprecipitations were all equal to 1.

Phosphorylation of p107 and p130 26747

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

ures the ability of the pocket proteins to bind E2F-4 itself. Suchan interpretation is supported by the amount of endogenousE2F-4 co-immunoprecipitated by p130wt and the mutants; theamount of E2F-4 in the immunoprecipitates correlates withtheir ability to repress E2F-4 (Fig. 4C, left).

An alternative interpretation of the weak E2F-4 repressionand binding ability of p130PM12A is that the alanine substitu-tions themselves reduce the affinity for E2F-4 in vivo. Weaddressed this potential caveat by repeating the assays, butthis time with ectopic p16ink4a, a Cdk inhibitor previouslyshown to prevent most of the in vivo phosphorylations on p130(31). p16ink4a is a direct inhibitor of Cdk4(6) and indirectly alsoinhibits Cdk2 through redistributions of p21 from cyclin D-Cdkcomplexes. Initially, we established that efficient repression ofthe Gal4-E2F-4 reporter depended on coexpression of p16ink4a

and p130wt, since they only reduced reporter activity 2-foldwhen expressed separately, whereas coexpression led to a 47-fold reduction (Fig. 4B, right). In the presence of p16ink4a,p130wt, p130PM12A, p130PM9A, and p130PM22A all have a sim-ilar impact on E2F-4 repression. Furthermore, the four pro-teins, when hypophosphorylated, are equally expressed andco-immunoprecipitate similar amounts of E2F-4 (Fig. 4C,right). These results are in good agreement with the in vitrobinding data described above (Fig. 2) and exclude nonspecificeffects of alanine substitutions on the ability of p130 to interactwith and repress transcription through E2F-4. Additionally,coexpression of p16ink4a with p130wt and mutants lead to theidentical amount of coimmunoprecipitated cyclin A as com-pared with samples in which p16ink4a coexpression was omit-ted. This indicates that the cyclin A binding, which is largelyphosphorylation-insensitive, binds equally well to all p130 mu-tants (data not shown and Fig. 2).

Mutation of Nine Phosphorylation Sites Is Necessary andSufficient for p130 to Impose a Robust G1 Block—The strongE2F-4 repressor p130PM9A has alanine substitutions in thethree Cdk4-specific phosphorylation sites, in addition to sub-stitution of six non-Cdk4-specific sites. The p130�Cdk4 protein,which is expressed to a level comparable with p130wt, imposesa G1 arrest in human cells (31). To reveal the influence of thesix additional mutations on the ability of p130 to block G1, wetransfected exponentially growing U-2-OS cells with either in-creasing amounts of the p130�Cdk4 plasmid or with a constantamount of plasmids expressing the various mutants. Flow cy-tometry analysis was performed on a fraction of the cells,whereas another fraction was analyzed for the level of p130expression. As predicted, we saw an increase in the number ofcells blocked in G1 as a consequence of increasing p130�Cdk4

expression (Fig. 5). Importantly, at a comparable level of ex-pression, p130PM9A (lane 7) imposed a more pronounced G1

block than p130�Cdk4 (lane 3). The p130PM9A-mediated G1 ar-rest was as strong as the effect obtained with p130PM22A (lane8). These data suggest that in cases of inefficient or absentphosphorylation of the three Cdk4-specific sites, phosphoryla-tion of six non-Cdk4-specific sites in p130 relieves the cell cycleinhibition imposed by p130. The six non-Cdk4-specific siteswere then substituted alone. The resulting mutant, p130PM6A,had an inhibitory effect on G1 progression (lane 5) larger thanthe effect of p130wt. However, the p130PM6A-induced G1 block-ade was significantly weaker than that imposed by p130PM9A.Together, our data show that the additive effect of mutating thethree Cdk4-specific sites and six non-Cdk4-specific sites is es-sential for the strong G1-inhibitory impact of p130PM9A. Fi-nally, we found that p130PM12A gave rise to only a minorincrease in the G1 population, correlating well with its weakrepression of E2F-4.

Effect of Cyclin D1 on the G1 Block Imposed by p107 and p130Substitution Mutants—To further elucidate the involvement ofdifferent subsets of phosphorylation sites in p130 and p107regulation, we compared the influence of p130 and p107 sub-stitution mutants on cell cycle progression in the presence andabsence of cyclin D1 overexpression. We found that p107�Cdk4*,similarly to p130�Cdk4, caused an accumulation in G1 whentransfected into U-2-OS cells (Fig. 6). When cyclin D1 wascoexpressed, however, the G1 block imposed by p130�Cdk4 waslost, whereas the block imposed by p107�cdk4* persisted. Thesedata strengthen the notion that preventing phosphorylation ofmaximally three phosphorylation sites is enough to uncoupleimportant regulatory functions of p107 from Cdk control,whereas the homologous substitutions in p130 result in a pro-tein whose E2F-repressive ability is still under partial Cdkcontrol. The persistent G1 block imposed by p130PM9A, evenwhen cyclin D1 is overexpressed, suggests that six additionalsubstitutions are required in order to uncouple p130 from Cdkcontrol and that the nine substitutions in p130PM9A representa nearly optimal subset of phosphorylation sites sufficient forcell cycle regulation by p130, through interaction with E2F-4.

DISCUSSION

Work from several laboratories over the last decade hasshown that the phosphorylation-dependent release of proteinsinteracting with pRb is controlled in a complex manner (28, 47,48). Work by Knudsen and Wang (49, 50) has suggested that

FIG. 5. G1 block imposed by p130 mutants. U-2-OS cells weretransfected with the indicated amounts of p130 expression plasmids,together with CD20 expression plasmid (5 �g) and pCMV-luc (0.1 �g).Empty vector (pcDNA3.1) was added to a total of 15.1 �g of DNA pertransfection. Fluorescence-activated cell sorting analysis was per-formed with two-thirds of the cells. The last third of the cells wasextracted and tested for transfection efficiency. The normalized vol-umes of lysates were immunoprecipitated and immunoblotted as de-scribed in the legend to Fig. 3; a representative example is shown. Thecolumns represent an increase in the number of cells in G1 comparedwith empty vector control as a percentage point. The results are meanand S.D. values of at least three independent experiments.

Phosphorylation of p107 and p13026748

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

Cdks phosphorylate different combinations of SP/TP residuesin pRb in order to dissociate specific protein-protein interac-tions. They found that among 16 potential Cdk phosphorylationsites, the phosphorylation of Ser807 and Ser811 displaces c-Ablfrom the C-terminal domain of pRb, whereas phosphorylationof Thr821 and Thr826 displaces proteins containing LXCXE mo-tifs, such as the papilloma virus E7 protein, from the A/Bpocket. The E2F transcription factors do not contain a LXCXEmotif, and they can bind to pRb simultaneously with LXCXEcontaining proteins as well as c-Abl (51). Knudsen and Wang(49, 50) suggested a dual mechanism for the release of E2Ffrom pRb via Cdk-dependent phosphorylation, which involveseither the phosphorylation of the seven SP/TP sites in theC-domain or the phosphorylation of two SP sites in the insertdomain of pRb (the latter mechanism required an intact Nterminus of pRb). On the other hand, Dean and co-workers (52)suggested that phosphorylation of the C-terminal region of pRbby cyclin D-Cdk4(6) initiates a folding of the C-terminal region,which they believe interacts intramolecularly with the centralA/B-pocket and thereby displaces the LXCXE-containing his-tone deacetylase. Such a structural change was also proposedto facilitate the subsequent phosphorylation of residues in theA/B-pocket via cyclin E-Cdk2 and disrupt its conformation (52),eventually releasing E2F from pRb.

Compared with pRb, the p130 pocket protein contains ap-proximately twice as many in vivo phosphorylation sites (31),the majority of which are targeted by Cdks. We identified threeresidues of human p130, which are specifically targeted bycyclin D-Cdk4(6). By sequence alignment, all three Cdk4-spe-cific sites are conserved in p107, whereas only one of them isconserved in pRb (Ser1035, corresponding to Ser780 in pRb). Thephosphorylation of the Cdk4(6)-specific sites in p130 is impor-tant for the release of the growth-suppressive activity imposedby p130 through its interaction with E2F-4. The growth-inhib-itory function of p130 can largely be neutralized even in theabsence of measurable Cdk4(6) kinase activity (like in SAOS-2

cells), since cyclin E(A)-Cdk2 can phosphorylate p130 on themajority of Cdk-sites. In contrast, the growth-suppressive func-tion of p107, which is relevant in cycling cells, can only beinactivated by cyclin D-Cdk4(6) and not by cyclin E(A)-Cdk2(33, 38).2 We now present data suggesting that the threeCdk4(6)-specific phosphorylation sites play an even more dom-inant role in p107 than in p130, emphasized by the fact that themutant p107�Cdk4* completely prevents cyclin D1-Cdk4(6)from releasing the repression of E2F-4 in our reporter assayand the pronounced growth inhibition of U-2-OS cells caused byexpression of p107�Cdk4*. Whereas mutating the three sites inp107, homologous to the Cdk4(6)-specific sites in p130, is suf-ficient to prevent phosphorylation-dependent inactivation ofp107 in transient transfection experiments, even upon cyclinD1 overexpression, inactivation of p130�Cdk4 can still takeplace under such conditions. These data reveal another level ofcomplexity in the phosphorylation-dependent release of E2F-4from p130 as compared with p107 and predict the existence ofadditional phosphorylation sites in p130, which take part in theregulation of E2F-4 during cell cycle progression.

By studying the impact of alanine substitutions of individualin vivo phosphorylation sites in p130, within defined domainsseparately and in combinations, we have identified the essen-tial residues whose phosphorylation contributes to the dissoci-ation of the p130-E2F-4 complex. The potent repressor mutantresulting from this analysis, p130PM9A, contains eight serine-to-alanine substitutions and one threonine-to-alanine substitu-tion, distributed in the A-domain proximal region (two sites),the spacer domain (three sites), and the C-terminal domain(four sites). Like the three Cdk4-specific sites, the remainingsix phosphorylation sites mutated in p130PM9A also localizeoutside the B-domain. Among those six, one is specific for Cdk2:the most C-terminal phosphorylation site at Ser1112 (31). Theremaining five residues could potentially be targeted by bothcyclin D-Cdk4(6) and cyclin E(A)-Cdk2. Overall, our data showthat mutating three phosphorylation sites in p107, of which at

FIG. 6. Differential effect of cyclin D1 on the G1 block imposed by p107 and p130 substitution mutants. U-2-OS cells were transfectedwith the indicated pocket protein expression plasmids (7 �g) or empty vector (7 �g) in combination with a CD20 expression plasmid (5 �g),pX-cyclin D1 (3 �g), or pX empty vector. Cells were processed for fluorescence-activated cell sorting analysis, and the DNA content of CD20-positivecells was evaluated for cell cycle impact of p107 (left) or p130 (right).

Phosphorylation of p107 and p130 26749

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

least two (Thr369 and Ser650) are targeted in vivo, is sufficientto create a mutant that caused a G1 arrest insensitive to cyclinD1. On the other hand, the regulation of the p130/E2F-4 inter-action is more complex. In addition to the phosphorylation ofthe three Cdk4-specific sites, the efficient inactivation of p130involves phosphorylation on six additional sites by Cdks, asdepicted in Fig. 7.

Several models have been proposed to explain how cyclinD-Cdk4(6) and cyclin E-Cdk2 may contribute to the phospho-rylation-dependent inactivation of pRb at the G1/S transition(reviewed in Ref. 48). One model proposed that cyclin D-Cdk4(6) and cyclin E-Cdk2 can both independently fully inac-tivate pRb with respect to all protein interactions. Anothermodel suggested that the two kinase activities each inactivatea subset of interactions between pRb and downstream factors,whereas the last model favored a combined effect of cyclinD-Cdk4(6) and cyclin E-Cdk2 as a mechanism to jointly phos-phorylate the required number of pRb sites. Recent data (53)have shown that the cyclin E protein first accumulates 2–5 hafter cells have passed the G1 restriction point, indicating thatcyclin D-Cdk4(6) may be the only Cdk activity required for theinactivation of the pocket protein family members at this crit-ical commitment point in the cell cycle.

At least two mechanisms can be suggested for how phospho-rylation of p130 and p107 leads to dissociation of E2F-4. Phos-phorylation could directly reduce the affinity between pocketproteins and E2F by changing the electrostatic charge in thecontact interface. Alternatively, phosphorylation could inducea conformational change incompatible with E2F association. Inan attempt to better understand the phosphorylation-depend-ent regulation of p130 and p107, we have now identified thosein vivo phosphorylation sites in p130, which are essential forthe release of E2F-4 from the large A/B pocket. Based on ourdata obtained during our stepwise construction of p130PM9A,we suggest that a distinct subset of phosphorylation sites areinvolved in regulating the p130/E2F-4 interaction. How thisapplies to either of the two described mechanisms remains tobe elucidated. Interestingly, an example of combinatorial, ad-ditive effects of multiple phosphorylations on regulation of onefeature of a single protein, the turnover of the Sic1 inhibitor ofCdks in yeast, has recently been reported (54). This studyprovided the rationale for phosphorylation-mediated thresholdeffects in cell cycle control, and it is plausible to speculate thatthe conceptually analogous multisite phosphorylation on p130by Cdks might also ensure its timely inactivation in G1. Ourdata on the additive effects of the critical phosphorylationmutants from distinct domains of p130 (Table I) seem to sup-port the possibility of such a threshold-related mechanism ofE2F regulation. On the other hand, it should be noted that thecombinations of mutations within each domain were often notadditive. This phenomenon of intradomain mutant behaviorremains to be elucidated, yet one potential explanation is thatthe ability of some phosphorylations to facilitate release ofE2F-4 requires simultaneous phosphorylation(s) and/or func-tional “interactions” with other sites within the same domain.Such a scenario is plausible but so far not supported by ourphosphopeptide mapping analyses, which revealed no directdependence of any of the E2F-affecting p130 phosphorylationsites on prephosphorylation of any other site(s). Alternatively,the only moderate differences in impacts on E2F regulation bythe intradomain mutant combinations might reflect the limitsof the reporter assay, which preferentially identifies the overallmore pronounced differences of the interdomain mutant com-binations. The greater effects of interdomain phosphorylationsite mutant combinations appear consistent with the notion

that several domains contribute to the total E2F binding po-tential of the multidomain p130 protein. Importantly, the valueand relevance of the combinatorial mutagenesis to pinpoint thephosphorylations most critical for E2F regulation are apparentfrom the distinct properties of the p130PM9A versus p130PM12A

mutants. Thus, mutating the phosphorylation sites comple-mentary to those mutated in the very potent E2F repressor,p130PM9A (except Thr417), giving rise to the phosphorylation-deficient mutant p130PM12A, has an almost insignificant effecton the p130/E2F-4 interaction. Further work should help pro-vide a rational explanation for the observed behavior of theintradomain versus the interdomain mutant and establish to

FIG. 7. We suggest that the differential kinase sensitivities ofp130 and p107, for E2F-4 regulation, can be explained by over-lapping and nonoverlapping phosphorylation site dependences.For p107, phosphorylation of at least two (Thr369 and Ser650) of threepredicted Cdk4(6)-specific sites are essential for E2F-4 release. Forp130, all of the Cdk4(6)-specific sites are necessary but not sufficient forE2F-4 regulation. Six additional phosphorylation sites define a regula-tory level unique to p130, which have sufficient impact to inactivatep130 even in the absence of Cdk4(6) activity. The kinases phosphoryl-ating the six non-Cdk4-specific sites in p130 are Cdk2 and Cdk4(6).

Phosphorylation of p107 and p13026750

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

what extent the Cdk-mediated effect on p130/E2F-4 interplayreflects an additive, threshold-related mechanism as opposedto more complex phenomena including phosphorylation siteinteractions.

Furthermore, we speculate that at the exit from the cellcycle, an analogous yet reverse requirement of multisite de-phosphorylation may exist in order to activate p130. The lattermechanism might help to ensure that phosphorylated p130 isrelatively insensitive to small fluctuations in phosphatase ac-tivities and not activated before a threshold level of phospha-tase builds up at mitosis. Considering the E2F-bound and-unbound state of p130 separately, it is likely that a delicatebalance between the number of phosphorylated and unphos-phorylated residues exists and dictates the stability of both.Our observation that the mutant p107�Cdk4*, in contrast top130�Cdk4, is not inhibited by cyclin D coexpression despitebeing heavily phosphorylated suggests the interesting possibil-ity that such a balance might be different in p107.

The present data also indicate that the seven phosphoryla-tions in the B-domain are largely dispensable for the regulationof E2F-4 binding to p130, and since several proteins containingLXCXE motifs are expected to make contacts to residues in theB-domain (13, 55–57), we are currently investigating whetherphosphorylations in the B-domain of p130 regulate these typesof interactions. The B-domain is considerably extended in p130as compared with p107 and pRb, and none of the phosphoryl-ation sites in this domain are conserved among the familymembers, except for Thr986, which is conserved in p107(Thr915). The B-domain is furthermore the only region in p130where we identified phosphorylations, which are mediated bykinases other than Cdks. The Thr821 and Thr826 residues inpRb, which regulate interactions with LXCXE-containing pro-teins (49), are both nonconserved in p130 and p107. Togetherwith previous data on pRb (28, 47, 48), our present resultsindicate that despite the extensive sequence similarities andtheir analogous domain structure, the phosphorylation-dependent regulation of the interactions with cellular proteinsmay be rather specific for each pocket protein family member.

We believe that cyclin D-dependent kinases represent the ma-jor Cdk activity that phosphorylates pocket proteins at the re-striction point in middle to late G1. In such a scenario, the criticalrole of cyclin E(A)-Cdk2 complexes would more likely be to main-tain certain phosphorylations during S phase in order to preventunscheduled reassociation between E2F and the pocket proteins.Recent data from several laboratories demonstrated that suchmaintenance of pocket protein phosphorylation is critical forproper execution and coordination of the cell cycle events in S, G2,and M phases, well beyond the G1/S transition (58–60). It is alsoevident from previously published data that certain pocket pro-tein complexes bind to DNA even in S phase (61, 62). Although itis unclear how this can be tolerated by the cell, we can onlyspeculate that certain interactors, by steric hindrance, mightprevent the accessibility to Cdks of certain regulatory residues onthe pocket proteins, thereby preventing their efficient phospho-rylation. Whether the DNA-associated pocket protein complexesplay any biological role during S phase, perhaps by markingspecific subsets of E2F-regulated promoters or DNA replicationsites, needs to be established.

The significance of pRb as a tumor suppressor is now wellestablished (9, 63, 64), and recent data indicate that inactivat-ing mutations in p130 could also contribute to tumorigenesis(5). Since the p16ink4a-mediated G1 arrest depends not only onpRb, but also on p130 and p107 (6) through their interactionswith E2F-4 and -5 (46), we speculate that both p107 and p130may turn out to be tumor suppressors. Analysis of phosphoryl-ation-dependent regulation of interactions between the pocket

proteins and their ligands, along with genetic models, willdeepen our understanding of the emerging overlapping as wellas complementary roles played by pRb, p130, and p107, tocoordinate cell proliferation and differentiation and guardagainst oncogenic transformation. It is our hope that suchfuture studies may benefit from the tools and results presentedin this report.

Acknowledgments—We thank Steven Reed and Kristian Helin forreagents and Claes Lindeneg for excellent technical assistance.

REFERENCES

1. Wang, J. Y. (1997) Curr. Opin. Genet. Dev. 7, 39–452. Classon, M., and Dyson, N. (2001) Exp. Cell Res. 264, 135–1473. Grana, X., Garriga, J., and Mayol, X. (1998) Oncogene 17, 3365–33834. Lipinski, M. M., and Jacks, T. (1999) Oncogene 18, 7873–78825. Paggi, M. G., and Giordano, A. (2001) Cancer Res. 61, 4651–46546. Bruce, J. L., Hurford, R. K., Jr., Classon, M., Koh, J., and Dyson, N. (2000) Mol.

Cell 6, 737–7427. Sage, J., Mulligan, G. J., Attardi, L. D., Miller, A., Chen, S., Williams, B.,

Theodorou, E., and Jacks, T. (2000) Genes Dev. 14, 3037–30508. Dannenberg, J. H., van Rossum, A., Schuijff, L., and te Riele, H. (2000) Genes

Dev. 14, 3051–30649. Morris, E. J., and Dyson, N. J. (2001) Adv. Cancer Res. 82, 1–54

10. Hu, Q. J., Dyson, N., and Harlow, E. (1990) EMBO J. 9, 1147–115511. Huang, S., Wang, N. P., Tseng, B. Y., Lee, W. H., and Lee, E. H. (1990) EMBO

J. 9, 1815–182212. Kaelin, W. G., Jr., Ewen, M. E., and Livingston, D. M. (1990) Mol. Cell. Biol.

10, 3761–376913. Lee, J. O., Russo, A. A., and Pavletich, N. P. (1998) Nature 391, 859–86514. Ewen, M. E., Xing, Y. G., Lawrence, J. B., and Livingston, D. M. (1991) Cell 66,

1155–116415. Li, Y., Graham, C., Lacy, S., Duncan, A. M., and Whyte, P. (1993) Genes Dev.

7, 2366–237716. Hannon, G. J., Demetrick, D., and Beach, D. (1993) Genes Dev. 7, 2378–239117. Mayol, X., Grana, X., Baldi, A., Sang, N., Hu, Q., and Giordano, A. (1993)

Oncogene 8, 2561–256618. Muller, H., Bracken, A. P., Vernell, R., Moroni, M. C., Christians, F., Grassilli,

E., Prosperini, E., Vigo, E., Oliner, J. D., and Helin, K. (2001) Genes Dev. 15,267–285

19. Ishida, S., Huang, E., Zuzan, H., Spang, R., Leone, G., West, M., and Nevins,J. R. (2001) Mol. Cell. Biol. 21, 4684–4699

20. Wang, J. Y., Knudsen, E. S., and Welch, P. J. (1994) Adv. Cancer Res. 64,25–85

21. Bartek, J., Bartkova, J., and Lukas, J. (1997) Exp. Cell Res. 237, 1–622. Nevins, J. R. (1998) Cell Growth Differ. 9, 585–59323. Helin, K. (1998) Curr. Opin. Genet. Dev. 8, 28–3524. Hurford, R. K., Jr., Cobrinik, D., Lee, M. H., and Dyson, N. (1997) Genes Dev.

11, 1447–146325. Flemington, E. K., Speck, S. H., and Kaelin, W. G., Jr. (1993) Proc. Natl. Acad.

Sci. U. S. A. 90, 6914–691826. Helin, K., Harlow, E., and Fattaey, A. (1993) Mol. Cell. Biol. 13, 6501–650827. Hiebert, S. W., Chellappan, S. P., Horowitz, J. M., and Nevins, J. R. (1992)

Genes Dev. 6, 177–18528. Harbour, J. W., and Dean, D. C. (2000) Genes Dev. 14, 2393–240929. Smith, E. J., and Nevins, J. R. (1995) Mol. Cell. Biol. 15, 338–34430. Zhu, L., Enders, G., Lees, J. A., Beijersbergen, R. L., Bernards, R., and Harlow,

E. (1995) EMBO J. 14, 1904–191331. Hansen, K., Farkas, T., Lukas, J., Holm, K., Ronnstrand, L., and Bartek, J.

(2001) EMBO J. 20, 422–43232. Woo, M. S., Sanchez, I., and Dynlacht, B. D. (1997) Mol. Cell. Biol. 17,

3566–357933. Beijersbergen, R. L., Carlee, L., Kerkhoven, R. M., and Bernards, R. (1995)

Genes Dev. 9, 1340–135334. Mayol, X., Garriga, J., and Grana, X. (1995) Oncogene 11, 801–80835. Smith, E. J., Leone, G., DeGregori, J., Jakoi, L., and Nevins, J. R. (1996) Mol.

Cell. Biol. 16, 6965–697636. Ashizawa, S., Nishizawa, H., Yamada, M., Higashi, H., Kondo, T., Ozawa, H.,

Kakita, A., and Hatakeyama, M. (2001) J. Biol. Chem. 276, 11362–1137037. Canhoto, A. J., Chestukhin, A., Litovchick, L., and DeCaprio, J. A. (2000)

Oncogene 19, 5116–512238. Xiao, Z. X., Ginsberg, D., Ewen, M., and Livingston, D. M. (1996) Proc. Natl.

Acad. Sci. U. S. A. 93, 4633–463739. Cheng, L., Rossi, F., Fang, W., Mori, T., and Cobrinik, D. (2000) J. Biol. Chem.

275, 30317–3032540. Knudsen, E. S., and Wang, J. Y. (1998) Oncogene 16, 1655–166341. Ferreira, R., Magnaghi-Jaulin, L., Robin, P., Harel-Bellan, A., and Trouche, D.

(1998) Proc. Natl. Acad. Sci. U. S. A. 95, 10493–1049842. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., and

Struhl, K. (1996) Current Protocols in Molecular Biology, pp. 9.1.4–9.1.6,John Wiley & Sons, Inc., New York

43. Zhu, L., van den Heuvel, S., Helin, K., Fattaey, A., Ewen, M., Livingston, D.,Dyson, N., and Harlow, E. (1993) Genes Dev. 7, 1111–1125

44. Farkas, T., Kutskova, Y. A., and Zimarino, V. (1998) Mol. Cell. Biol. 18,906–918

45. Sorensen, C. S., Lukas, C., Kramer, E. R., Peters, J. M., Bartek, J., and Lukas,J. (2001) Mol. Cell. Biol. 21, 3692–3703

46. Gaubatz, S., Lindeman, G. J., Ishida, S., Jakoi, L., Nevins, J. R., Livingston,

Phosphorylation of p107 and p130 26751

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

D. M., and Rempel, R. E. (2000) Mol. Cell 6, 729–73547. Beijersbergen, R. L., and Bernards, R. (1996) Biochim. Biophys. Acta 1287,

103–12048. Mittnacht, S. (1998) Curr. Opin. Genet. Dev. 8, 21–2749. Knudsen, E. S., and Wang, J. Y. (1996) J. Biol. Chem. 271, 8313–832050. Knudsen, E. S., and Wang, J. Y. (1997) Mol. Cell. Biol. 17, 5771–578351. Welch, P. J., and Wang, J. Y. (1995) Genes Dev. 9, 31–4652. Harbour, J. W., Luo, R. X., Dei Santi, A., Postigo, A. A., and Dean, D. C. (1999)

Cell 98, 859–86953. Ekholm, S. V., Zickert, P., Reed, S. I., and Zetterberg, A. (2001) Mol. Cell. Biol.

21, 3256–326554. Nash, P., Tang, X., Orlicky, S., Chen, Q., Gertler, F. B., Mendenhall, M. D.,

Sicheri, F., Pawson, T., and Tyers, M. (2001) Nature 414, 514–52155. Dick, F. A., Sailhamer, E., and Dyson, N. J. (2000) Mol. Cell. Biol. 20,

3715–3727

56. Chen, T. T., and Wang, J. Y. (2000) Mol. Cell. Biol. 20, 5571–558057. Dahiya, A., Gavin, M. R., Luo, R. X., and Dean, D. C. (2000) Mol. Cell. Biol. 20,

6799–680558. Chew, Y. P., Ellis, M., Wilkie, S., and Mittnacht, S. (1998) Oncogene 17,

2177–218659. Knudsen, E. S., Buckmaster, C., Chen, T. T., Feramisco, J. R., and Wang, J. Y.

(1998) Genes Dev. 12, 2278–229260. Lukas, C., Sorensen, C. S., Kramer, E., Santoni-Rugiu, E., Lindeneg, C.,

Peters, J. M., Bartek, J., and Lukas, J. (1999) Nature 401, 815–81861. Wells, J., Boyd, K. E., Fry, C. J., Bartley, S. M., and Farnham, P. J. (2000) Mol.

Cell. Biol. 20, 5797–580762. Kennedy, B. K., Barbie, D. A., Classon, M., Dyson, N., and Harlow, E. (2000)

Genes Dev. 14, 2855–286863. Nevins, J. R. (2001) Hum. Mol. Genet. 10, 699–70364. Bartek, J., and Lukas, J. (2001) FEBS Lett. 490, 117–122

Phosphorylation of p107 and p13026752

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from

Thomas Farkas, Klaus Hansen, Karin Holm, Jiri Lukas and Jiri BartekE2F-4

Distinct Phosphorylation Events Regulate p130- and p107-mediated Repression of

doi: 10.1074/jbc.M200381200 originally published online May 2, 20022002, 277:26741-26752.J. Biol. Chem. 

  10.1074/jbc.M200381200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/277/30/26741.full.html#ref-list-1

This article cites 63 references, 35 of which can be accessed free at

by guest on Decem

ber 15, 2020http://w

ww

.jbc.org/D

ownloaded from