TM

SCBL

*‡

�

BtmniritwwtucttoaiaassrccawswwrNTdTf

Ct

BA

SIC–

ALIM

ENTA

RY

TRA

CT

GASTROENTEROLOGY 2009;137:2084–2095

he Ion Channel TRPA1 Is Required for Normal Mechanosensation and Isodulated by Algesic Stimuli

TUART M. BRIERLEY,*,‡,§ PATRICK A. HUGHES,*,‡ AMANDA J. PAGE,*,‡,§ KELVIN Y. KWAN,�

HRISTOPHER M. MARTIN,* TRACEY A. O’DONNELL,* NICOLE J. COOPER,* ANDREA M. HARRINGTON,*IRGIT ADAM,* TOBIAS LIEBREGTS,* GERALD HOLTMANN,*,§ DAVID P. COREY,� GRIGORI Y. RYCHKOV,‡ and. ASHLEY BLACKSHAW*,‡,§

Nerve-Gut Research Laboratory, Department of Gastroenterology and Hepatology, Hanson Institute, Royal Adelaide Hospital, Adelaide, South Australia, Australia;Discipline of Physiology, School of Molecular and Biomedical Sciences, §Discipline of Medicine, The University of Adelaide, Adelaide, South Australia, Australia; and

Department of Neurobiology and Howard Hughes Medical Institute, Harvard Medical School, Boston, Massachusetts

ocTnNmrtn

wabssgtmtmcrmp(foasaans

lccn

ACKGROUND & AIMS: The transient receptor po-ential (TRP) channel family includes transducers of

echanical and chemical stimuli for visceral sensoryeurons. TRP ankyrin 1 (TRPA1) is implicated in

nflammatory pain; it interacts with G-protein-coupledeceptors, but little is known about its role in the gastro-ntestinal (GI) tract. Sensory information from the GIract is conducted via 5 afferent subtypes along 3 path-ays. METHODS: Nodose and dorsal root gangliahose neurons innnervate 3 different regions of the GI

ract were analyzed from wild-type and TRPA1�/� micesing quantitative reverse-transcription polymerasehain reaction, retrograde labeling, and in situ hybridiza-ion. Distal colon sections were analyzed by immunohis-ochemistry. In vitro electrophysiology and pharmacol-gy studies were performed, and colorectal distensionnd visceromotor responses were measured. Colitis wasnduced by administration of trinitrobenzene sulphoniccid. RESULTS: TRPA1 is required for normal mechano-nd chemosensory function in specific subsets of vagal,planchnic, and pelvic afferents. The behavioral re-ponses to noxious colonic distension were substantiallyeduced in TRPA1�/� mice. TRPA1 agonists caused me-hanical hypersensitivity, which increased in mice witholitis. Colonic afferents were activated by bradykininnd capsaicin, which mimic effects of tissue damage;ild-type and TRPA1�/� mice had similar direct re-

ponses to these 2 stimuli. After activation by bradykinin,ild-type afferents had increased mechanosensitivity,hereas, after capsaicin exposure, mechanosensitivity was

educed: these changes were absent in TRPA1�/� mice.o interaction between protease-activated receptor-2 andRPA1 was evident. CONCLUSIONS: These findingsemonstrate a previously unrecognized role forRPA1 in normal and inflamed mechanosensory

unction and nociception within the viscera.

hronic pain and discomfort in functional gastroin-testinal disorders represent a major unmet need for

reatment and consequent economic impact. A hallmark

f these disorders is allodynia and hyperalgesia to me-hanical events1–3 and low-grade inflammatory status.4 – 6

herefore, therapies are needed that reduce signaling ofociceptive mechanosensory and inflammatory events.ormally, there is a constant stream of subliminal infor-ation from the gut, which is involved in autonomic

eflexes controlling motor and secretory function. It isherefore important to distinguish this information fromociceptive signals in targeting visceral pain.Gastrointestinal sensory nerves follow 3 main path-

ays to the central nervous system: the vagal, splanchnic,nd pelvic nerves. Vagal afferent fibers have neuronal cellodies in the nodose and jugular ganglia, whereas theplanchnic and pelvic innervations have cell bodies inpinal thoracolumbar and lumbosacral dorsal root gan-lia (DRG), respectively. Sensory afferent fibers withinhese pathways can be classified into 5 subtypes in the

ouse gastrointestinal tract according to the location ofheir mechanoreceptive fields.7,8 These are as follows:

ucosal, muscular (or tension receptor), muscular-mu-osal, serosal, and mesenteric afferents. Mucosal afferentsespond exclusively to fine tactile stimulation of the lu-

inal surface. All others respond to distension, either athysiologic levels (muscular afferents) or noxious levels

serosal and mesenteric afferents). Muscular-mucosal af-erents respond to both types of stimulus at low thresh-lds.7–11 In general, vagal pathways are typically associ-ted with sensations such as satiety and nausea, whereaspinal pathways also innervate pelvic viscera and aressociated with sensations of pain, discomfort, bloating,nd urgency to void.12 The pelvic pathway contains bothon-nociceptive and nociceptive afferents, whereasplanchnic afferents have generally higher mechanical

Abbreviations used in this paper: DRG, dorsal root ganglia; LS,umbosacral; QRT-PCR, quantitative reverse transcription polymerasehain reaction; TL, thoracolumbar; TRPA1, transient receptor potentialhannel ankyrin 1; TRPV, transient receptor potential channel va-illoid.

© 2009 by the AGA Institute0016-5085/09/$36.00

doi:10.1053/j.gastro.2009.07.048

tcsmld

tclpdtTueieaiitfltds

nshMflfnov

adsefrwTsetvaaTsuv

tie

gbSms

cwwqteoEpRomtmptt

gtsiwaaaRsluc(caia

BA

SIC–

ALI

MEN

TARY

TRA

CT

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2085

hresholds, with fewer mucosal and muscular afferents,onstituting primarily a nociceptive pathway.7 The rea-ons why these different types of afferents signal different

echanical events are, first, because they end in differentayers of the gut wall and, second, because they utilizeifferent mechanosensory ion channels.It was recently shown that the transient receptor po-

ential (TRP) channel vanilloid (TRPV) 4 is required ex-lusively for mechanotransduction by high-threshold co-onic afferents,9 for their responses to inflammatoryroteases,13 and for visceral pain behavior.9,14 TRPV4oes not account for all aspects of visceral pain becausehere are residual mechanonociceptive responses inRPV4 knockout mice and other inflammatory stimulinlikely to act via TRPV4. Interest has therefore broad-ned to other TRPs such as TRP ankyrin (TRPA) 1, whichs expressed in sensory neurons, primarily in subsetsxpressing the nociceptive marker TRPV1.15–18 TRPA1 isctivated by noxious cold, pungent natural chemicals,ncluding mustard oil,19 and by several environmentalrritants.17 Numerous endogenous proalgesic factors in-eract directly or indirectly with TRPA1 to augment in-ammatory pain, such as bradykinin via B2 receptor ac-ivation.19 Conversely, TRPA1 can undergo functionalesensitization through modulation by the classical cap-aicin receptor TRPV1.20

TRPA1�/� mice are deficient in behavioral responses tooxious cold, and cutaneous mechanical and chemicaltimuli.17,18 TRPA1 contributes to the development ofyperalgesia in numerous inflammatory models.17,18,21

any of these conclusions are based on indirect evidencerom behavioral models, recombinant systems, and iso-ated neurons. Knowledge is currently lacking on theunction of TRPA1 specifically within sensory afferenterve fiber endings in their native tissue and on the rolesf TRPA1 in mechanosensation and chemosensation iniscera.

We hypothesized that TRPA1 contributes to mech-nosensory function in visceral afferent endings and un-erlies alteration of mechanosensory function by algesictimuli. We show enrichment of TRPA1 in visceral affer-nts and, correspondingly, alteration of mechanosensoryunction in specific classes of visceral afferents after dis-upting TRPA1, which translate to sensory deficits inhole animals. We also demonstrate that activation ofRPA1 by specific agonists induces mechanical hypersen-

itivity in these specific afferent subtypes and that this isxacerbated in inflammatory conditions. We determinedhe role of TRPA1 in visceral afferent responses to acti-ation of bradykinin, capsaicin, and protease receptorsnd its role in altered mechanosensory function afterctivation of these receptors. Our data indicate thatRPA1 is critical in the viscera for normal mechanosen-

ory function, the signaling of noxious mechanical stim-li, and the alteration of mechanical responsiveness of

isceral afferent endings by algesic chemical stimuli. m

Materials and MethodsAll experiments were performed with approval of

he Animal Ethics Committees of the Institute for Med-cal and Veterinary Science and the University of Ad-laide, Adelaide, Australia.

Targeted Deletion of TRPA1Mice with disruption to the TRPA1 gene were

enerated by homologous recombination on a C57/BL6ackground as we have described previously in detail.18

ubsequently, separate lines of knockout and wild-typeice were bred and maintained, and animals of both

exes were used for experiments at 12–16 weeks of age.

Quantitative Reverse-TranscriptionPolymerase Chain ReactionNodose ganglia and DRG (T10-L1 and L6-S1),

orresponding to the 3 different innervations of the gut,ere removed from TRPA1�/� and TRPA1�/� mice. RNAas isolated from these 3 groups of whole ganglia, anduantitative reverse-transcription polymerase chain reac-ion (QRT-PCR) performed using methods describedlsewhere22 with specific primers for TRPA1 and a rangef other channels and receptors (Supplementary Table 1).ach assay was run in at least triplicate in separate ex-eriments. Control PCRs were performed by substitutingNA template with distilled RNAse-free water or bymitting the RT step. The comparative cycle thresholdethod was used to quantify the abundance of target

ranscripts in whole DRG from TRPA1�/� or TRPA1�/�

ice as previously described.22 Quantitative data are ex-ressed as mean � SD, and significant differences inranscript expression determined by a Mann–Whitneyest.

Retrograde Labeling and Fluorescent in SituHybridizationAs described previously,9,22 the fluorescent retro-

rade neuronal tracer cholera toxin subunit B conjugatedo fluorescein isothiocyanate was injected at several sitesubserosally and within the muscle layers of the descend-ng colon or proximal stomach. After 3 days, animalsere perfuse fixed, and nodose ganglia or DRG (T10-L1nd L6-S1) was removed, and sections (12 �m) were cutnd postfixed. Digoxigenin-labeled oligonucleotide probenti-sense to 1571–1618 of murine TRPA1 messengerNA (mRNA) was used to target TRPA1. Complementary

ense probe was used as a negative control revealing noabeling above background. Digoxigenin was detectedsing CARD amplification (Perkin–Elmer, Waltham, MA)ombined with streptavidin-conjugated AlexaFluor 546SAF546) (Invitrogen, Mt Waverly, VIC, Australia). Onlyells with intact nuclei were included; data are expresseds percentage of neurons in the DRG or nodose sectionn 4 – 8 DRG or nodose sections per mouse averagedcross 5 or 6 mice. Unpaired t tests were used to deter-

ine differences.

stmA1oAucfaf

emp

1crnpuc

dia1s

TnsDtppTfidvgwipnbiirla2tsswi2aigt

™F(tf(ssblvdgmewn

BA

SIC–

ALIM

ENTA

RY

TRA

CT

2086 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

ImmunohistochemistryDistal colon was removed from mice after tran-

cardial perfusion with 4% paraformaldehyde. Eitherransverse sections (20 �m) of whole colon or whole

ounts of mucosa-stripped preparations were examined.goat anti-calcitonin gene-related peptide (CGRP;

/200; No. ab36001; Abcam, Cambridge, MA) was usedvernight at 4°C for sections or 37°C for whole mounts.9

rabbit anti-TRPA1 (1/1000; No. AB58844; Abcam) wassed under the same conditions. Secondary antibodiesoupled to AlexaFluor 488 and AlexaFluor 546 were usedor visualization. Negative controls were prepared asbove with the primary antibody omitted or in tissuerom TRPA1�/� mice.

In Vitro Electrophysiology and ParmacologyRecordings of vagal, splanchnic, and pelvic affer-

nts were made from TRPA1�/� and TRPA1�/� mutantice using standard protocols (Brierley et al7 and Sup-

lementary Information).

Inflammatory ModelTrinitrobenzene-sulphonic acid (TNBS; 0.1 mL

30 �L/mL 30% ethanol) was administered intracoloni-ally to TRPA1�/� mice.10 The mice were allowed toecover for 7 days before the colon and attached splanch-ic nerves were removed and used for in vitro electro-hysiologic experiments. Histologic assessment indicatedlceration, crypt destruction, infiltration, and edema inolon, as reported previously.10

Colorectal Distension and VisceromotorResponseTo record the visceromotor response to colorectal

istension, electromyographic electrodes were surgicallymplanted in the abdominal musculature (Brierley et al9

nd Supplementary Information). Each distension lasted0 seconds and was tested 10 times, with 30 secondseparating each distension.

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™igure 1. Expression of TRPA1 in visceral sensory pathways. (A) Agaro

�/�) and null-mutant (�/�) mice using primers specific for TRPA1 andhoracolumbar (TL; T10-L1) and lumbosacral (LS; L6-S1) dorsal root garom TRPA1�/� mice, whereas �-actin was present. (no, no RNA templared) in TRPA1�/� nodose ganglia (i), thoracolumbar (ii), and lumbosacraltomach (i), and distal colon (ii and iii) with cholera toxin subunit B/fluorehowing retrograde labeling from the gut: blue arrows indicate those poar, 25 �m). (C) Quantitative RT-PCR analysis indicated a similar level

umbosacral DRG. (D) Neuronal counts of the proportion of neurons expiscera. Graphs indicate that a similar proportion of neurons in the geifferent ganglia. However, significantly more neurons innervating the stut neurons vs general population, t test). (E) We have previously shechanosensory function. To determine whether compensatory change

xplain the changes observed in TRPA1�/� mechanosensory function, were no significant changes in ASIC1, 2, 3 or TRPV4 expression betwe

o significant changes in TRPV1, Bradykinin 2, TRPV2, TREK-1, or NaV1.8

ResultsTRPA1 Is Expressed in Visceral AfferentPathwaysWe used QRT-PCR to determine expression of

RPA1 in extrinsic gastrointestinal sensory neurons—inodose ganglia, and from 2 different levels of DRG,pecifically the thoracolumbar (T10-L1) and lumbosacralRG (L6-S1), corresponding to the vagal innervation of

he gastroesophageal region and to the splanchnic andelvic innervations of the colon. TRPA1 transcript ex-ression was detected in all 3 groups of ganglia fromRPA1�/� mice, whereas TRPA1 transcripts were absent

rom TRPA1�/� mice (Figure 1A). Quantitative analysisndicated similar levels of TRPA1 expression between theifferent sensory ganglia (Figure 1C). However, the inner-ation of the gut represents �5% of neurons in theseanglia. To specifically identify gut-projecting neurons,e injected the tracer cholera toxin subunit B/fluorescein

sothiocyanate conjugate,22 which is retrogradely trans-orted from afferent endings to the cell body. Vagaleurons in nodose ganglia (Figure 1B, i) were identifiedy tracer injected into the wall of the stomach. Neurons

n the thoracolumbar and lumbosacral DRG (Figure 1B,i and iii) were identified by colonic injections. Combinedetrograde tracing/fluorescence in situ hybridization al-owed us to compare TRPA1 expression in gut-projectingnd unlabeled neurons. TRPA1 was expressed in 36% �% of unlabeled neurons in nodose ganglia, 42% � 2% inhe thoracolumbar DRG, and 40% � 2% in the lumbo-acral DRG. Immunohistochemistry for TRPA1 proteinhowed similar proportions (not shown). In comparison,e found that a significantly higher proportion of gut

nnervating neurons expressed TRPA1, specifically 55.1% �% of gastric neurons, 54% � 2% of splanchnic neurons,nd 58% � 2% of pelvic neurons (Figure 1D), indicat-ng abundant expression of TRPA1 transcript withinut innervating neurons in all 3 pathways (P � .001;test).

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™3l electrophoresis of amplified RT-PCR products from TRPA1 wild-type

tin. Amplified TRPA1 transcripts were detected in nodose ganglia (NG),(DRG) from TRPA1�/� mice. TRPA1 transcripts were absent in gangliaded). (B) Fluorescence in situ hybridization of TRPA1 mRNA expression(iii), combined with retrograde labeling of visceral sensory neurons fromisothiocyanate conjugate (CTB-FITC) (green). Arrows indicate neuronsfor TRPA1, and yellow arrows denote TRPA1-negative neurons. (ScalePA1 transcript expression between whole NG and thoracolumbar andg TRPA1 in either whole ganglia or in retrogradely labeled neurons froml population (non-labeled neurons, open bars) express TRPA1 in theh and colon (filled bars) express TRPA1. (P � .001 retrogradely labeledthat ASIC1, 2, 3 and TRPV4 contribute in various ways to colonic

he expression of these transcripts occurs in TRPA1�/� mice, which mayrformed quantitative RT-PCR analysis. This analysis revealed that therehole TL DRG in TRPA1�/� and TRPA1�/� mice. Moreover, there were

™™™se ge�-acngliate adDRGsceinsitiveof TRressinnera

omacowns in te peen w

receptor expression.

BA

SIC–

ALI

MEN

TARY

TRA

CT

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2087

witswip

wfCwofimTuTfm

faosnrtsblsmac(c

FmmocCc ut no

BA

SIC–

ALIM

ENTA

RY

TRA

CT

2088 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

To determine whether the TRPA1 mutation interferesith the expression of other receptors and channels

mplicated in visceral sensory function, we comparedheir expression in TRPA1�/� and TRPA1�/� ganglia. Ashown in Figure 1E, the expression levels of these genesere not altered, suggesting that compensatory changes

n alternative transcript expression do not confound ourhysiologic findings reported below.Immunoreactivity for TRPA1 protein was colocalized

ith the sensory neuropeptide CGRP in endings in dif-erent layers of the gut from TRPA1�/� mice (Figure 2).ollaterals of afferent endings within the colonic wallere also immunoreactive for CGRP and TRPA1, butccasionally each label was expressed alone in separatebers, notably CGRP in the absence of TRPA1 in intra-ural endings. There was no TRPA1 immunoreactivity inRPA1�/� mice, whereas patterns of CGRP labeling werenchanged (Figure 2D). Overall, these data indicate thatRPA1 is well placed to participate in visceral afferent

unction and appears to be located preferentially in both

igure 2. Expression of TRPA1 protein in peripheral fibers in mouse coouse showing colocalization of the sensory marker TRPA1 exclusivelesenteric blood vessels from a TRPA1�/� mouse also showing colocaf colonic wall from a TRPA1�/� mouse showing colocalization of CGonsistent with serosal afferents. (D) Whole mount of colonic wall fromwas also observed, whereas TRPA1 expression was absent. (E) Wh

olocalization of CGRP and TRPA1 in mesenteric blood vessels (BV) b

ucosal and serosal/mesenteric afferent fibers. e

TRPA1 Is Required for NormalMechanosensory Function in Specific Subsetsof Visceral Afferents

To test the hypothesis that TRPA1 is requiredor visceral sensory mechanotransduction in specificfferent subtypes, we investigated all 5 major subtypesf mechanoreceptors in different regions of gut usingtandardized in vitro single fiber recording tech-iques.7,8 Splanchnic colonic mechanoreceptors witheceptive fields on the mesentery and serosa respondedo high intensities of mechanical stimulation withtatic von Frey hairs. Mechanosensory responses ofoth populations were dramatically reduced in mice

acking TRPA1 (Figure 3A), whereas their mechanosen-ory thresholds were significantly increased (Supple-

entary Figure 1). However, the conduction velocitiesnd electrical activation thresholds of both afferentlasses were identical in TRPA1�/� and TRPA1�/� miceSupplementary Figure 1), indicating no significanthange in the electrical properties of TRPA1�/� affer-

) Immunohistochemical analysis of a colonic section from a TRPA1�/�

CGRP in a nerve fiber within the colonic mucosa. (B) Whole mount ofn of CGRP and TRPA1 in dense nerve fiber networks. (C) Whole mountnd TRPA1 in a single colonic afferent with morphology and locationA1�/� mouse showing that the pattern of CGRP expression shown inount of colonic wall from a TRPA1�/� mouse showing an example of

t in endings within muscle.

lon. (Ay withlizatioRP a

a TRPole m

nts.

pmTbraTsms

iptfsstveciea

iaaas(wh

pestcct

4FfscaA(ssTbpAfT(ebTcrc

BA

SIC–

ALI

MEN

TARY

TRA

CT

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2089

Deletion of TRPA1 also reduced mechanosensitivity ofelvic serosal afferents (Figure 3B, i) and increased theirechanosensory thresholds (Supplementary Figure 1).wo other populations of pelvic afferents were affectedy loss of TRPA1: significant deficits were seen in theesponses to mucosal stroking of pelvic mucosal afferentsnd muscular/mucosal afferents (Figure 3B). By contrast,RPA1 deletion did not affect the response to muscle

tretch in pelvic muscular/mucosal afferents or in pelvicuscular afferents, suggesting that TRPA1 is involved in

ignaling-specific modalities.

f

Because TRPA1�/� colonic afferents displayed deficitsn mechanosensory function, we used a model of colonicain to determine whether changes at the cellular level ofhe afferent ending translated to alterations in sensoryunction in the intact animal. The abdominal EMG re-ponse to noxious colorectal distension (Figure 3C) wasignificantly reduced in mice lacking TRPA1, indicatinghat these mice have a reduced ability to detect noxiousisceral mechanosensory stimuli. In the stomach andsophagus, TRPA1 deletion caused modest but signifi-ant deficits in mucosal receptor function but no changen tension receptor function (Figure 3D), mirroring theffects observed in pelvic colonic mucosal and muscularfferents.

TRPA1 Channel Agonists Evoke MechanicalHypersensitivity in Specific Visceral AfferentsTo test the hypothesis that activation of TRPA1

ncreases mechanosensory function, we used the TRPA1gonists allyl isothiocyanate (AITC; 0.4 – 400 �mol/L)19

nd trans-cinnamaldehyde (TCA; 1–1000 �mol/L).19 Bothgonists caused sensitization of the mechanosensory re-ponse of splanchnic serosal afferents of TRPA1�/� miceFigure 4A, example in Supplementary Figure 2), whichas dose dependent (data not shown). TRPA1 agonistsad no effect on TRPA1�/� serosal afferents.A key function of TRPA1 is in inflammatory

ain.17,18,21 To determine whether TRPA1 function wasnhanced in a model of colonic inflammatory hypersen-itivity,10 we used TRPA1 agonists in tissue from micereated with TNBS. TRPA1 agonists caused greater me-hanical hypersensitivity in afferents from TNBS-treatedompared with untreated mice (Figure 4A, Supplemen-ary Figure 2), indicating a larger role for TRPA1 in

™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™igure 3. TRPA1�/� mice display selective deficits in visceral afferent

unction. (A) Splanchnic (i) mesenteric and (ii) serosal colonic afferentshowed dramatically reduced stimulus response functions to focalompression of mechanoreceptive fields with static von Frey hair (vfh)pplication (70 mg–2000 mg) in TRPA1�/� mice (P � .0001, 2-wayNOVA). This was also significant at most individual stimulus intensities

*P � .05, **P � .01, ***P � .001, Bonferroni post hoc test). (B) (i) Pelvicerosal colonic afferents were hyposensitive TRPA1�/� mice. (ii) Muco-al afferents also displayed reduced stimulus response functions inRPA1�/� mice. (iii) Muscular/mucosal afferents, which respond tooth low-intensity mucosal stroking and low-intensity stretch, only dis-layed significant deficits in the mucosal component (P � .001, 2-wayNOVA; *P � .05, ***P � .001, Bonferroni test). (iv) Mechanosensory

unction of stretch sensitive muscular afferents was unaltered inRPA1�/� mice. Changes in length of tissue in response to stretch

1–15 g) were similar in both genotypes (not shown). (C) Abdominallectromyography (EMG) responses of conscious mice to colorectalalloon distensions (5 � 80 mm Hg) were significantly reduced inRPA1�/� mice (**n � 5, P � .01), implicating TRPA1 in the signaling ofolonic pain. (D) Two classes of gastroesophageal vagal afferents wereecorded: mucosal and tension receptors. The deletion of TRPA1aused modest but significant deficits in (i) mucosal mechanosensory

unction (P � .01, 2-way ANOVA).

ieamai

vmure

5fifisdmvnTdsdt

ditstTsTT(ss6srmsr

vdawvrSTksaps

Fua12shailsssm

BA

SIC–

ALIM

ENTA

RY

TRA

CT

2090 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

nflammation. Mechanical hypersensitivity was alsovoked by these agonists in pelvic serosal and mucosalfferents (Figure 4B). Overall, TRPA1 agonists inducedechanical hypersensitivity only in the corresponding

fferent subtype that displayed mechanosensory deficitsn TRPA1�/� mice.

Bradykinin-Induced MechanicalHypersensitivity of Colonic SplanchnicAfferents Is Mediated via TRPA1Bradykinin induces mechanical hypersensitivity in

isceral afferents via a bradykinin receptor 2-mediatedechanism.23,24 We hypothesized that TRPA1 contrib-

tes to this process. Bradykinin elicited a rapid andobust excitation in 50%– 60% of splanchnic serosal affer-

igure 4. TRPA1 agonists induce mechanical hypersensitivity. (A) (i) Inntreated TRPA1�/� splanchnic colonic afferents, the TRPA1 agonistsllyl-isothiocyanate (AITC; 40 �mol/L) or trans-cinnamaldehyde (TCA;00 �mol/L) induced mechanical hypersensitivity of serosal fibers to a000-mg von Frey hair (vfh), typically by 25%. (ii) Mechanical hypersen-itivity was absent in TRPA1�/� serosal afferents. (iii) The mechanicalypersensitivity evoked by both agonists is significantly enhanced incute TNBS inflammation. (iv) Change in mechanosensory response in

nflammation compared with control (calculated from i and iii). The se-ective TRPA1 antagonist HC-030031 (10 �mol/L for 10 minutes) hadimilar effects on mechanosensory responses to gene deletion (nothown). (B) In pelvic colonic afferents, 100 �mol/L TCA also inducedignificant mechanical hypersensitivity of TRPA1�/� (i) serosal and (iii)ucosal colonic afferents, which was lost in TRPA1�/� mice (ii and iv).

nt fibers in both TRPA1�/� and TRPA1�/� mice (Figure P

A, B, D, and E). After bradykinin responses, TRPA1�/�

bers became mechanically hypersensitive, but TRPA1�/�

bers did not (Figure 5C, i). Bradykinin-induced hypersen-itivity occurred only in fibers that were responsive to bra-ykinin, not in unresponsive fibers (Figure 5C, ii). Thisechanism, therefore, requires bradykinin receptor 2 acti-

ation and action potential generation. The direct bradyki-in response was almost identical in TRPA1�/� andRPA1�/� fibers (Figure 5D) as was the proportion of bra-ykinin-responsive afferents (Figure 5E). Overall, these re-ults indicate that TRPA1 is required for bradykinin-in-uced mechanical hypersensitivity but does not contributeo the actual chemosensory response elicited by bradykinin.

TRPA1 Mediates the Capsaicin-InducedMechanical Desensitization of ColonicSplanchnic AfferentsSplanchnic serosal afferents display mechanical

esensitization after TRPV1 activation.23 Previous workndicates cross interactions between TRPA1 and TRPV1hat may underlie desensitization.20 We found that cap-aicin elicited rapid and robust excitation in 35%– 40% ofhe splanchnic fibers tested from both TRPA1�/� andRPA1�/� mice (Figure 6A and B). TRPA1�/� fibers were

ubsequently desensitized to mechanical stimuli, whereasRPA1�/� fibers were unaffected (Figure 6C, i), as wereRPA1�/� fibers that were unresponsive to capsaicin

Figure 6C, ii). Although there was a slightly larger re-ponse to capsaicin in TRPA1�/� afferents, this was notignificant compared with TRPA1�/� afferents (FigureD), and the proportion of afferents responsive to cap-aicin was similar between genotypes (Figure 6E). Theseesults indicate a requirement for TRPA1 in TRPV1-

ediated mechanical desensitization. However, it alsouggests that TRPA1 does not contribute to the directesponse to capsaicin.

Protease-Activated Receptor-2 ActivatesColonic Splanchnic Afferent Fibers via aTRPA1 Independent MechanismProtease-activated receptor-2 (PAR2)-induced acti-

ation of visceral13 and somatosensory25 pathways is me-iated via opening of TRPV4 ion channels. There is alsoputative link between PAR2 and TRPA1.26 We asked

hether TRPA1 was also involved in PAR2 activation ofisceral afferents. We first confirmed that splanchnic se-osal fibers respond to the PAR2-activating peptide (AP)LIGRL (Supplementary Figure 3); this was similar inRPA1�/� and TRPA1�/� afferents. However, unlike brady-inin or capsaicin, PAR2-AP did not change mechanosen-ory function in either TRPA1�/� or TRPA1�/� afferents. Inddition, TRPA1�/� mice had similar magnitudes and pro-ortions of afferent response to PAR2-AP. Therefore, in ourystem, there is no evident interaction between TRPA1 and

AR2 in splanchnic colonic serosal afferents.

raiwwasfiaintfiinaiTt

istswcnP

iuauccTsua

FbpacimamckrktuTsqptirbstakstsT(pdT(

BA

SIC–

ALI

MEN

TARY

TRA

CT

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2091

DiscussionOur findings indicate that TRPA1 plays a critical

ole in the detection of mechanical stimuli by visceralfferent fibers. We found that TRPA1 mRNA expressions enriched within gastrointestinal sensory neurons,hereas, in the periphery, TRPA1 protein is localizedithin nerve endings at sites where mechanical stimulire transduced. Deletion of TRPA1 resulted in highlypecific changes in afferent mechanosensory function:rst, TRPA1 contributed to the tactile function of vagalnd pelvic mucosal afferents. This was somewhat surpris-ng given the putative role of TRPA1 as a detector ofoxious stimuli.18 However, we observed, secondly, thathere were significant deficits in the mechanosensoryunction of nociceptors from the splanchnic and pelvicnnervation of the colon and rectum, which translatednto a reduced behavioral response of TRPA1�/� mice tooxious visceral mechanosensory stimuli. Our resultslso show that activation of TRPA1 by selective agonistsnduces mechanical hypersensitivity of afferent endings.his role of TRPA1 is enhanced in inflammatory condi-

igure 5. TRPA1 mediates theradykinin-induced mechanical hy-ersensitivity of splanchnic colonicfferents. (A) TRPA1�/� splanchnicolonic serosal afferent respond-

ng to bradykinin (1 �mol/L; for 2inutes). Note increased mech-

nosensory response to a 2000-g von Frey hair (vfh) after the

hemosensory response to brady-inin. (B) TRPA1�/� splanchnic se-osal afferent responding to brady-inin (1 �mol/L; for 2 minutes). Notehat mechanosensory response isnchanged after bradykinin. (C) (i)RPA1�/� serosal fibers that re-ponded to bradykinin subse-uently displayed mechanical hy-ersensitivity (*P � .05, paired test). This effect was not observedn the corresponding TRPA1�/� se-osal afferents that responded toradykinin. (ii) Mechanical hyper-ensitivity after bradykinin applica-ion only occurred in TRPA1�/�

fferents that responded to brady-inin and was not observed in unre-ponsive fibers (NS, P � .05, pairedtest). (D) The chemosensory re-ponse bradykinin was similar inRPA1�/� and TRPA1�/� fibers

NS, P � .05, t test). (E) The pro-ortion of serosal afferents respon-ing to bradykinin was similar inRPA1�/� and TRPA1�/� mice

NS, P � .05, Fisher exact test).

ions associated with visceral hyperalgesia. Our data also m

ndicate that the sensitivity of TRPA1 to mechanicaltimuli can be tuned by algesic stimuli in certain sub-ypes of afferents. Specifically, bradykinin functionallyensitizes TRPA1 to increase mechanosensory function,hereas capsaicin functionally desensitizes TRPA1 to de-

rease mechanosensory function. By contrast, we foundo evidence to support an interaction of TRPA1 andAR2 in splanchnic colonic afferents.

TRPA1 Involvement in MechanosensationTRPA1-deficient mice display significant deficits

n sensing noxious punctate cutaneous mechanical stim-li. They also had higher thresholds than TRPA1�/� micend reduced responses to a series of suprathreshold stim-li,18 but the site of the deficit was not determined. In theurrent study, we determined mechanosensitivity of vis-eral afferents in their natural environment. Deletion ofRPA1 significantly reduced the mechanosensory re-

ponses in 4 afferent subtypes: mucosal afferents in bothpper and lower gut, mesenteric afferents and serosalfferents in colon, and mucosal responses of muscular/

ucosal afferents in colon. We also found higher me-

cisdoeirdtpWTa

TcacoaesssTtA

FacmdtopF

BA

SIC–

ALIM

ENTA

RY

TRA

CT

2092 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

hanical thresholds on deletion of TRPA1. Correspond-ngly, TRPA1 agonists induced mechanical hypersen-itivity in the same subtypes that were affected by geneeletion, in agreement with recent data showing mustardil sensitization mainly in higher threshold colonic affer-nts.27 Overall, these alterations implicate TRPA1 directlyn the transduction of mechanical stimuli. Our findingsepresent the most conclusive evidence in mammals toate and indicate that TRPA1 contributes to the detec-ion of low- and high-intensity mechanical stimuli de-ending on the afferent ending in which it is expressed.e investigated the possibility that a broader role of

RPA1 in the regulation of the general excitability of

igure 6. TRPA1 mediates the capsaicin-induced mechanical desenfferent responding to capsaicin (3 �mol/L; for 2 minutes). Note dehemosensory response to capsaicin. (B) TRPA1�/� splanchnic seroechanosensory response is unchanged after capsaicin. (C) (i) TRPA1�

esensitization (*P � .05; paired t test). This effect was not observed in Ttest). (ii) Mechanical desensitization after capsaicin application only observed in unresponsive fibers. (D) Magnitude of chemosensory respoaired t test). (E) The proportion of serosal afferents responding to capisher exact test).

fferent endings could explain our findings. However, in v

RPA1�/� and TRPA1�/� mice, we observed identicalonduction velocities and electrical activation thresholds,nd we observed almost identical responses to varioushemical stimuli, indicating that the general excitabilityf the afferent endings remains extensively unalteredfter TRPA1 deletion. Although TRPA1 makes a consid-rable impact towards the mechanosensory function ofpecific classes of visceral afferents, residual mechanosen-ory responses were apparent, and, notably, some otherubtypes were totally unaffected by TRPA1 deletion.herefore, other channels must contribute additionally

o visceral mechanosensory function. In this regard,SIC1, 2, and 3 and TRPV4 have select roles as sensors of

tion of splanchnic colonic afferents. (A) TRPA1�/� splanchnic serosaled mechanosensory response to 2000-mg von Frey hair (vfh) afterfferent responding to capsaicin (3 �mol/L; for 2 minutes). Note thatosal fibers responding to capsaicin subsequently displayed mechanical1�/� serosal afferents that responded to capsaicin (NS, P � .05; pairedred in TRPA1�/� afferents that responded to capsaicin and was notcapsaicin was similar in TRPA1�/� and TRPA1�/� fibers (NS, P � .05,in either TRPA1�/� or TRPA1�/� mice was unchanged (NS, P � .05,

sitizacreassal a/� serRPAccur

nse tosaicin

isceral mechanical stimuli9,28; however, each channel

civeniTrspecstTnv

nisorusTaili

ptSoTonaTmiHbcetpapap

adncrcaicpvattaote

owtnaTiseaolsTptoTlsiplcsgw

BA

SIC–

ALI

MEN

TARY

TRA

CT

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2093

ontributes differently to mechanosensory function inndividual subtypes of visceral afferents innervating eachisceral organ. The roles of these channels differ mark-dly to that of TRPA1 in aspects of physiologic andoxious mechanosensation in different regions, but there

s overlap in the contribution of ASIC3, TRPV4, andRPA1 in colonic high-threshold afferents and, possibly,

edundancy. Such redundancy is to be expected in aystem important to signalling of injury or disease. Theicture emerging from these investigations is that differ-nt classes of sensory neuron have unique signatures ofhannel expression conferring their unique mechanosen-ory properties, which may vary among different parts ofhe body and differ among species.29 The ability ofRPA1 to act as a mechanosensor and to be tuned byumerous chemical stimuli makes it a key player inisceral allodynia and hyperalgesia.

Augmentation of mechanosensitivity by TRPA1 ago-ists was greater during colonic inflammation, suggest-

ng a more prominent role of TRPA1 in pathophysiologictates. Whether this is due to pharmacologic potentiationf TRPA1 by endogenous mediators (see below) or up-egulation of TRPA1 expression is the subject of contin-ed investigation. We were struck by the fact that theame afferent subtypes that showed reduced function inRPA1�/� mice here also showed increased function incute and delayed inflammatory models in our recentnvestigation.10 Together, these findings provide a strongink between TRPA1 and alteration of afferent functionn pathophysiologic states.

Enhanced Mechanosensory Function ofTRPA1 Induced by BradykininTRPA1�/� mice show reduced behavioral res-

onses to cutaneous bradykinin injection,18 suggestinghat TRPA1 contributes to bradykinin-induced pain.17,18

omewhat unexpectedly, we observed that the magnitudef direct afferent responses to bradykinin was similar inRPA1�/� and TRPA1�/� mice, as were the proportionsf responders and nonresponders. Therefore, TRPA1 isot required for the direct excitatory response of visceralfferents to bradykinin (mediated via the B2 receptor23).his, therefore, contrasts with other studies of TRPA1�/�

ice in vivo or in isolated trigeminal neuron recordingsnvestigating interactions of bradykinin and TRPA1.17,18

owever, our data do show that TRPA1 is essential forradykinin-induced mechanical hypersensitivity, as is thease in the guinea-pig esophagus.24 The apparent differ-nces between somatic and visceral pathways may be dueo the varying methodologies, but these data raise theossibility that there is differential expression and link-ge of channels and receptors among different neuronalopulations. Considerable differences are also apparentmong different pathways: it is clear from our data that

elvic colonic serosal afferents require TRPA1 as a mech- n

nosensor, yet virtually none of these afferents respondirectly to bradykinin, and those that are responsive doot develop mechanical hypersensitivity.23 This obviouslyontrasts with splanchnic colonic serosal afferents, whichespond to bradykinin, and subsequently develop me-hanical hypersensitivity. This suggests that, whereas B2

nd TRPA1 interact closely in splanchnic afferents, thisnteraction is lacking in pelvic afferents. Bradykinin re-eptors may couple via different G�-proteins to phos-holipase C and protein kinase A pathways, which acti-ate divergent intracellular pathways to evoke directfferent excitation, but they may also sensitize TRPA1 viahese pathways with indirect effects.30 We suggest thathis “optional extra” is perhaps not included in pelvicfferents because they are tuned more towards detectionf non-noxious than noxious stimuli.7 This exemplifieshe great biologic diversity among afferent populations,ven those innervating the same organ.

Reduced Mechanosensory Function of TRPA1Induced by Capsaicin

We found pronounced mechanical desensitizationf splanchnic afferents after responses to capsaicin,hich was lost in TRPA1�/� mice. However, the magni-

ude of direct chemosensory response to capsaicin didot significantly differ between TRPA1�/� and TRPA1�/�

fferents. We also observed identical proportions ofRPA1�/� and TRPA1�/� afferents responding to capsa-

cin, and there was no change in TRPV1 mRNA expres-ion in TPRA1�/� mice. Correspondingly, capsaicin-voked calcium influx into isolated trigeminal neuronsppears unaltered in TRPA1-deficient mice.17 However,ther data indicate that TRPA1 can undergo pharmaco-

ogic desensitization that is modulated by TRPV1.20 Thattudy proposed a mechanism whereby capsaicin binds toRPV1; causes channel opening; and a rapid, substantial,rolonged rise in intracellular Ca2�, which, in conjunc-ion with phospholipase C activation, results in depletionf phosphatidyl 4,5 bisphosphate (PIP2). PIP2 bound toRPA1 is crucial in maintaining its function.20,31 This

eads us to suggest that the mechanical desensitization ofplanchnic afferents by capsaicin is the result of a closenteraction of TRPV1 desensitizing TRPA1 via PIP2 de-letion. Capsaicin desensitization is absent in pelvic co-

onic serosal afferents, even though their responses toapsaicin are larger than splanchnic afferents,32 but theytill require TRPA1 for normal mechanosensation, sug-esting that TRPA1 and TRPV1 do not interact the sameay in pelvic afferents.

TRPA1 Does Not Participate in the PAR2-APExcitation of Visceral Afferents

Activation of PAR2 sensitizes TRPV4 in somatic

eurons to cause somatic mechanical hyperalgesia.25 We

fnTptcAtTfeetTnsPwTa

maastais

aG1

1

1

1

1

1

1

1

1

1

1

2

2

2

2

2

2

2

2

BA

SIC–

ALIM

ENTA

RY

TRA

CT

2094 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

ound, correspondingly, that direct responses of splanch-ic colonic afferents to PAR2 activation are totally lost inRPV4�/� mice.13 A similar mechanism has been pro-osed by which PAR2 sensitization of TRPA1 contributeso inflammatory pain.26 However, here, we observed nohange in afferent mechanosensory function after PAR2-P. In addition, loss of TRPA1 did not affect the magni-

ude or proportion of direct responses to PAR2-AP.herefore, it would appear that there is little if any role

or TRPA1 in PAR2 activation of colonic afferents. How-ver, because PAR2 activates protein kinases A and C, itngages the same type of transduction mechanisms ashe B2 receptor and would thus be expected to sensitizeRPA1. Therefore, the question arises as to why we didot see involvement of TRPA1 in PAR2 responses. Weuggest that the strong interaction between TRPV4 andAR2 in these neurons is due to tight colocalization,hereas TRPA1 and PAR2 are localized discretely so thatRPA1 is not accessible by downstream products of PAR2

ctivation.In conclusion, TRPA1 contributes substantially toechanosensory function in gastrointestinal afferents,

nd tuning of this channel by chemical mediators canlter mechanosensory function. Because altered visceralensory function is a hallmark of functional gastrointes-inal disorders, TRPA1 represents a novel target for ther-pies that reduce signaling of specific mechanical andnflammatory stimuli from the gut to the central nervousystem and a key target for the reduction of visceral pain.

Supplementary Data

Note: To access the supplementary materialccompanying this article, visit the online version ofastroenterology at www.gastrojournal.org, and at doi:0.1053/j.gastro.2009.07.048.

References

1. Lembo T, Munakata J, Mertz H, et al. Evidence for the hypersen-sitivity of lumbar splanchnic afferents in irritable bowel syndrome.Gastroenterology 1994;107:1686–1696.

2. Ritchie J. Pain from distention of the pelvic colon by inflating aballoon in the irritable bowel syndrome. Gut 1973;6:105–112.

3. Azpiroz F, Bouin M, Camilleri M, et al. Mechanisms of hypersen-sitivity in IBS and functional disorders. Neurogastroenterol Motil2007;19:62–88.

4. Barbara G, Stanghellini V, De Giorgio R, et al. Activated mast cellsin proximity to colonic nerves correlate with abdominal pain inirritable bowel syndrome. Gastroenterology 2004;126:693–702.

5. Dunlop SP, Jenkins D, Spiller RC. Distinctive clinical, psycholog-ical, and histological features of postinfective irritable bowelsyndrome. Am J Gastroenterol 2003;98:1578–1583.

6. Spiller RC, Jenkins D, Thornley JP, et al. Increased rectal mucosalenteroendocrine cells, T lymphocytes, and increased gut perme-ability following acute Campylobacter enteritis and in post-dysen-teric irritable bowel syndrome. Gut 2000;47:804–811.

7. Brierley SM, Jones RCW III, Gebhart GF, et al. Splanchnic andpelvic mechanosensory afferents signal different qualities of co-

lonic stimuli in mice. Gastroenterology 2004;127:166–178.

8. Page AJ, Martin CM, Blackshaw LA. Vagal mechanoreceptors andchemoreceptors in mouse stomach and esophagus. J Neuro-physiol 2002;87:2095–2103.

9. Brierley SM, Page AJ, Hughes PA, et al. Selective role for TRPV4ion channels in visceral sensory pathways. Gastroenterology2008;134:2059–2069.

0. Hughes PA, Brierley SM, Martin CM et al. Post-inflammatorycolonic afferent sensitization: different subtypes, different path-ways, and different time-courses. Gut 2009. Epub ahead of Print.

1. Song X, Chen BN, Zagorodnyuk VP et al. Identification of medi-um/high threshold extrinsic mechanosensitive afferent nerves tothe gastrointestinal tract. Gastroenterology 2009.

2. Blackshaw LA, Gebhart GF. The pharmacology of gastrointes-tinal nociceptive pathways. Curr Opin Pharmacol 2002;2:642–649.

3. Sipe W, Brierley SM, Martin CM, et al. Transient receptor poten-tial vanilloid 4 mediates protease activated receptor 2-inducedsensitization of colonic afferent nerves and visceral hyperalgesia.Am J Physiol Gastrointest Liver Physiol 2008;294:G1288–G1298.

4. Cenac N, Altier C, Chapman K, et al. Transient receptor potentialvanilloid-4 has a major role in visceral hypersensitivity symptoms.Gastroenterology 2008;135:937–946.

5. Nagata K, Duggan A, Kumar G, et al. Nociceptor and hair celltransducer properties of TRPA1, a channel for pain and hearing.J Neurosci 2005;25:4052–4061.

6. Story GM, Peier AM, Reeve AJ, et al. ANKTM1, a TRP-like channelexpressed in nociceptive neurons, is activated by cold tempera-tures. Cell 2003;112:819–829.

7. Bautista DM, Jordt S-E, Nikai T, et al. TRPA1 mediates theinflammatory actions of environmental irritants and proalgesicagents. Cell 2006;124:1269–1282.

8. Kwan KY, Allchorne AJ, Vollrath MA, et al. TRPA1 contributes tocold, mechanical, and chemical nociception but is not essentialfor hair-cell transduction. Neuron 2006;50:277–289.

9. Bandell M, Story GM, Hwang SW, et al. Noxious cold ion channelTRPA1 is activated by pungent compounds and bradykinin. Neu-ron 2004;41:849–857.

0. Akopian AN, Ruparel NB, Jeske NA, et al. Transient receptorpotential TRPA1 channel desensitization in sensory neurons isagonist dependent and regulated by TRPV1-directed internaliza-tion. J Physiol 2007;583:175–193.

1. Obata K, Katsura H, Mizushima T, et al. TRPA1 induced in sen-sory neurons contributes to cold hyperalgesia after inflammationand nerve injury. J Clin Invest 2005;115:2393–2401.

2. Hughes PA, Brierley SM, Young RL, et al. Localization and com-parative analysis of acid-sensing ion channel (ASIC1, 2, and 3)mRNA expression in mouse colonic sensory neurons within tho-racolumbar dorsal root ganglia. J Comp Neurol 2007;500:863–875.

3. Brierley SM, Jones RCW III, Xu L, et al. Activation of splanchnicand pelvic colonic afferents by bradykinin in mice. Neurogastro-enterol Motil 2005;17:854–862.

4. Yu S, Ouyang A. TRPA1 in bradykinin-induced mechanical hyper-sensitivity of vagal C fibers in guinea pig esophagus. Am J PhysiolGastrointest Liver Physiol 2009;296:G255–G265.

5. Grant AD, Cottrell GS, Amadesi S, et al. Protease-activated re-ceptor 2 sensitizes the transient receptor potential vanilloid 4 ionchannel to cause mechanical hyperalgesia. J Physiol 2006;578:715–733.

6. Dai Y, Wang S, T M, et al. Sensitization of TRPA1 by PAR2contributes to the sensation of inflammatory pain. J Clin Invest2007;117:1979–1987.

7. Malin SA, Christianson JA, Bielefeldt K, et al. TPRV1 expressiondefines functionally distinct pelvic colon afferents. J Neurosci

2009;29:743–752.

2

2

3

3

3

R

Re

A

C

F

Ag

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2095

8. Page AJ, Brierley SM, Martin CM, et al. Different contributions ofASIC channels 1a, 2 and 3 in gastrointestinal mechanosensoryfunction. Gut 2005;54:1408–1415.

9. Christensen AP, Corey DP. TRP channels in mechanosensa-tion: direct or indirect activation? Nat Rev Neurosci 2007;8:510–521.

0. Wang S, Dai Y, Fukuoka T, et al. Phospholipase C and proteinkinase A mediate bradykinin sensitization of TRPA1: a molec-ular mechanism of inflammatory pain. Brain 2008;131:1241–1251.

1. Karashima Y, Prenen J, Meseguer V, et al. Modulation of thetransient receptor potential channel TRPA1 by phosphatidyl-inositol 4,5-biphosphate manipulators. Pflugers Arch 2008;457:77–89.

2. Brierley SM, Jones RCW III, XU L, et al. Differential chemosensoryfunction and receptor expression of splanchnic and pelvic colonic

afferents in mice. J Physiol 2005;567:267–281. A

Received April 14, 2009. Accepted July 15, 2009.

eprint requestsAddress requests for reprints to: L. Ashley Blackshaw, Nerve-Gut

esearch Laboratory, Hanson Institute, Adelaide 5000, Australia.-mail: ashley.blackshaw@health.sa.gov.au; fax: (61) 8 8222 5934.

cknowledgmentsS.M.B., P.A.H., and A.J.P. contributed equally to this work.

onflicts of interestThe authors disclose no conflicts.

undingSupported by National Health and Medical Research Council of

ustralia Project Grants and Research Fellowships, NIH projectrant, Glaxo SmithKline Young Investigator Award, and University of

delaide Postgraduate Scholarship.

BA

SIC–

ALI

MEN

TARY

TRA

CT

S

TTTTTNBAAA�

2095.e1 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

upplementary Table 1. Nucleotide Primer Sequences UsedRT-PCR

Gene (Symbol) Forward primer (5=–3=)

RPA1 ACAAGAAGTACCAAACATTGACACARPV4 TGGATTCCTTGTTCGACTACGGRPV1 TTCCTGCAGAAGAGCAAGAAGCRPV2 CCAGCCATTCCCTCATCAAAAREK-1 GGACCTCGGAAGCTCTTTCTaV1.8 (Scn10a) AATCAGAGCGAGGAGAAGACGradykinin-R2 (BDKRB2) CCTCCTTTGGCATCGAAATGTSIC1 (ACCN2) CAACAGGTATGAGATACCGGSIC2 (ACCN1) TGACATTGGTGGTCAAATGGSIC3 (ACCN3) AGCCCTCCTTATAGCTTAATA-actin (ACTB) GACCTCTATGCCAACACAGT

elative Quantification of Transcripts Using Quantitative

Reverse primer (5=–3=) Product length (bp)

TTAACTGCGTTTAAGACAAAATTCC 243CACAATGTCAAAGAGGATGGGC 167CCCATTGTGCAGATTGAGCAT 123AAGTACCACAGCTGGCCCAGTA 113CTTTGGCAATTCCTTTTCCA 195CTAGTGAGCTAAGGATCGCAGA 197TGGATGGCATTGAGCCAAC 117AAGTGGCACGAGAGAAGCAT 208CTGATGGTTTCGGAGTGGTT 189ACAGACACAAGTGTCCTTTC 180GGAGCAATGATCTTGATCTT 118

for R

smtN1wt�t�etwa

ots4awf(oStrtcsrvvu

ccvsvafi5

asbht(1a

lrssdaw(dtatbodtavbgs

assitocstw(sBpsDdSeo

cemlloaTc

December 2009 TRPA1 CHANNELS AND MECHANOSENSATION 2095.e2

Supplementary Methods

In Vitro Electrophysiology and PharmacologyThe colon was opened and pinned flat mucosal

ide up in a specialized organ bath. The colonic compart-ent was superfused with a modified Krebs solution of

he following composition (mM): 117.9 NaCl, 4.7 KCl, 25aHCO3, 1.3 NaH2PO4, 1.2 MgSO4(H2O)7, 2.5 CaCl2,

1.1 D-Glucose, 2 NaButyrate, and 20 NaAcetate bubbledith carbogen (95% O2/5% CO2) at 34°C. In all prepara-

ions the L-type calcium channel antagonist nifedipine (1M) was added to suppress smooth muscle activity and

he prostaglandin synthesis inhibitor indomethacin (3M) added to suppress potential inhibitory actions of

ndogenous prostaglandins. The nerve bundle was ex-ended into the paraffin filled recording compartmenthere after fine dissection strands were laid onto a mirrornd single fibers recorded.

Receptive fields were identified as described previ-usly.1 Once identified, receptive fields were tested withhree distinct mechanical stimuli to enable classification:tatic probing with calibrated von Frey hairs (70, 160,00, 600, 1000, 1400, and 2000 mg force; each forcepplied 3 times for a period of 3 sec), mucosal strokingith calibrated von Frey hairs (10, 200, 500, and 1000 mg

orce; each force applied 10 times) and circular stretch1–5 g, in 1 g increments; each weight applied for a periodf 1 min, with a 1 min interval between each application).tretch was applied using a claw made from bent dissec-ion pins attached to the tissue adjacent to the afferenteceptive field and connected to a cantilever system viahread. Weights were applied to the opposite side of theantilever system to initiate graded colonic stretch. Inome studies, length changes were monitored with aotation transducer built into the cantilever. Conductionelocities were determined by stimulation with ascendingoltages via a concentric electrode mounted on a manip-lator placed over the receptive field.Vagal gastroesophageal mechanoreceptors were re-

orded using a single fiber technique similar to that forolonic afferents, which has been described in detail pre-iously.2 They were then classified into mucosal and ten-ion receptors according to their responses to calibratedon Frey hairs (10 –1000 mg) stroked over the mucosand circumferential stretch applied across the receptiveeld using a small claw and pulley/cantilever system (0.5–g).Once the individual afferent fiber had been classified

nd its stimulus-response relationship established, one ofeveral different chemosensory protocols was tested inoth genotypes. To determine if TRPA1 activation en-ances mechanosensory function, increasing concen-rations of the TRPA1 agonists allyl isothiocyanateAITC; 0.4 – 400 �M)3 or trans-cinnamaldehyde (TCA;–1000 �M)3 were applied into a small metal ring placed

round the receptive field. Each concentration was al- l

owed to equilibrate for 2 min after which the ring wasemoved and mechanosensitivity to a limited range oftimuli was quickly re-tested. Vehicle (1:10,000 dimethylulphoxide) had no effect in control experiment). Toetermine if the mechanosensory role of TRPA1 wasltered during inflammatory conditions these agonistsere also assessed in a Trinitrobenzenesulfonic acid

TNBS) induced model of acute colitis (see below foretails). To determine if TRPA1 contributed to the al-ered mechanosensory function of colonic splanchnicfferents after Bradykinin 2 receptor4 or TRPV15 activa-ion, bradykinin (1 �M) or capsaicin (3 �M) was incu-ated for 2 min with splanchnic colonic serosal afferentsf each genotype and mechanosensitivity re-tested imme-iately after this period. To determine if PAR2 activateshese afferent fibers by a TRPA1-dependent mechanism,6

s is the case with TRPV1 and TRPV4,7,8 the PAR2 Acti-ating Peptide (PAR2-AP; SLIGRL, 300 �M)8 was incu-ated with colonic splanchnic serosal afferents of eachenotype for 5 min and chemosensitivity and mechano-ensitivity assessed.

In all cases stimulus response functions are expresseds spikes per second meaned over the full period oftimulus, or spikes evoked per stroke (for mucosal re-ponses) under control conditions. Effects of drugs werenvestigated at a sub-maximal mechanical stimulus, sohat responses were not saturated, allowing observationf increases or decreases in mechanosensitivity. Timeontrols were performed without drug addition, whichhowed no change in responsiveness over a similar dura-ion. Differences between stimulus response functionsere assessed using two-way analysis of variance

ANOVA). Differences between corresponding points oneparate stimulus-response curves were assessed by aonferroni post-hoc test. Differences between adjacentoints on the same stimulus-response curve were as-essed by one-way ANOVA for repeated measures with aunnett’s post-hoc test. Differences before and after ad-ition of a single drug dose were compared using a pairedtudent’s t test. Data are expressed as mean � standardrror of mean (number of animals [N] and number ofbservations [n]).

Colorectal Distension and VisceromotorResponseTo record the visceromotor response (VMR) to

olorectal distension (CRD), electromyographic (EMG)lectrodes were surgically implanted in the abdominalusculature during brief inhalation anesthesia.9 Muscu-

ature was exposed through an incision made on theower lateral abdomen, and the bare ends of two lengthsf Teflon-coated stainless steel wire were inserted into thebdominal muscles and secured in place with sutures.he CRD balloon consisted of a polyethylene plasticylinder (length, 1.5 cm; diameter, 0.9 cm) secured to a

ength of polyethylene tubing. The balloon was inserted

tctrrpbIacpls

1

2095.e3 BRIERLEY ET AL GASTROENTEROLOGY Vol. 137, No. 6

ransanally until the proximal end of the balloon was 0.5m from the anal verge. The wires along with the balloonubing were taped to the tail. The animal was allowed toecover fully from anesthesia; then EMG activity wasecorded using parameters described previously10 duringhasic balloon inflation. Balloon inflation was achievedy connecting the balloon to a compressed air cylinder.nflation pressures were adjusted via the tank regulator,nd gas flow through the system was controlled by austom-made distension control device to enable com-uter triggering of balloon inflation. Each distension

asted 10 seconds, and was tested ten times, with 30econds separating each distension.

References

1. Brierley SM, et al. Splanchnic and pelvic mechanosensory affer-ents signal different qualities of colonic stimuli in mice. Gastro-enterology 2004;127:166–178.

2. Page AJ, et al. Vagal mechanoreceptors and chemoreceptors inmouse stomach and esophagus. J Neurophysiol 2002;87:2095–

2103.

3. Bandell M, et al. Noxious cold ion channel TRPA1 is activated bypungent compounds and bradykinin. Neuron 2004;41:849–857.

4. Brierley SM, et al. Activation of splanchnic and pelvic colonicafferents by bradykinin in mice. Neurogastroenterol Motil 2005;17:854–862.

5. Brierley SM, et al. Differential chemosensory function and recep-tor expression of splanchnic and pelvic colonic afferents in mice.J Physiol 2005;567:267–281.

6. Dai Y, et al. Sensitization of TRPA1 by PAR2 contributes to thesensation of inflammatory pain. J Clin Invest 2007;117:1979–1987.

7. Grant AD, et al. Protease-activated receptor 2 sensitizes thetransient receptor potential vanilloid 4 ion channel to causemechanical hyperalgesia. J Physiol 2006;578:715–733.

8. Sipe W, et al. Transient Receptor Potential Vanilloid 4 MediatesProtease Activated Receptor 2-Induced Sensitization of ColonicAfferent Nerves and Visceral Hyperalgesia. Am J Physiol Gastroi-ntest Liver Physiol 2008;294:G1288–G1298.

9. Brierley SM, et al. Selective role for TRPV4 ion channels invisceral sensory pathways. Gastroenterology 2008;134:2059–2069.

0. Arvidsson S, et al. Assessment of Visceral Pain-Related Pseudo-Affective Responses to Colorectal Distension in Mice by Intraco-

lonic Manometric Recordings. J Pain 2006;7:108–118.