Upload
others
View
19
Download
0
Embed Size (px)
Citation preview
The Immunopathogenesis of drug
hypersensitivity
Craig Michael Rive – Bsc (Hons), Bforensics.
PhD candidate
This thesis is presented for the degree of
Doctor of Philosophy of Murdoch University.
November, 2016
i
Declaration
I declare that this thesis is my own account of my research and contains as its main
content work which has not previously been submitted for a degree at any tertiary
education institution.
Signed:
_________________________________________
Craig M. Rive
Date submitted for review: 30th of June, 2016
Date submitted after revisions: 21th of November, 2016
ii
iii
Acknowledgments
I would like to acknowledge Professor Elizabeth J. Phillips not only for her insight into
immunology and disease, but for the great work being done under her guidance and
for the opportunity to partake in the research being conducted here at The Institute
for Immunology and Infectious Diseases, Murdoch University, Perth, Australia. I
would also like to thank Professor Simon Mallal for the care and support he has given
my mother, over the past 20 years in her battle with Systemic Lupus Erythematous,
my family and I will always be grateful. I would also like to thank Dr Abha Chopra of
The Institute for Immunology and Infectious Diseases, Murdoch University, Perth,
Australia for her guidance, wisdom, motivating, and encouragement.
A special mention goes to colleagues at The Institute for Immunology and Infectious
Diseases, Murdoch University, Perth, Australia, Dr Elizabeth McKinnon and Dr
Rebecca Pavlos, for their contribution to the nevirapine associated HLA allele
analysis of Chapter 3. Also, thanks to Shay Leary at The Institute for Immunology
and Infectious Diseases, Murdoch University, Perth, Australia who performed the in-
silico analysis of the human herpesvirus, which provided the list of HLA-restricted
predicted peptides to target in the ex-vivo assays used in Chapter 4 and Dr David
Ostrov and colleagues, University of Florida College of Medicine, Gainsville, Florida,
USA for providing the virtual modelling data.
I have learned so much through the insight, knowledge and patience of those
mentioned above and others at The Institute for Immunology and Infectious
Diseases, Murdoch University, Perth, Australia, including Dr Andrew Lucas, Dr Alec
Redwood, Dr Niamh Keene, Dr Monika Tschochner, Associate professor Mark
Watson, and all the staff and students.
Lastly, I would like to thank my ever extending family for putting up with me and for
their continued support throughout the years. This is, in part, dedicated to all my
family and those whom I love.
iv
v
Table of Contents Declaration i
Acknowledgments iii
Abstract ix
List of Abbreviations xi
List of Tables xv
List of Figures xvii
Chapter 1 Introduction: Immunopathogenesis of Drug
Hypersensitivity 1
1.1 Adverse Drug Reactions 3
1.2 Adaptive, Cell-Mediated Immune Response 3
1.3 Immunopathogenesis of Delayed Immunologically Mediated-
Adverse Drug Reactions 11
1.4 Established Models of HLA-driven delayed Immunologically
Mediated-Adverse Drug Reactions 21
1.5 Scope of this Thesis 24
Chapter 2 Methods and Materials 29
2.1 Samples, Ethics and Limitations 31
2.2 Cellular Assays 37
2.3 Virtual Modelling and in-silico Peptide Design 48
2.4 Molecular Assays 49
Chapter 3 Nevirapine-Induced Hypersensitivity 57
3.1 Introduction 59
3.2 Hypothesis and Aims 60
3.3 Methods 61
3.4 Results 63
3.5 Discussion 80
vi
Chapter 4 Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis: Predicted HLA-Restricted Peptide
Screening 85
4.1 Introduction 87
4.2 Hypothesis and Aims 88
4.3 Methods 88
4.4 Results 92
4.5 Discussion 115
Chapter 5 Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis: Specific T-cell Clonotype and
Detection by Digital Droplet PCR 119
5.1 Introduction 121
5.2 Hypothesis and Aims 122
5.3 Methods 122
5.4 Results 123
5.5 Discussion 129
Chapter 6 Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis: Granulysin Expression 133
6.1 Introduction 135
6.2 Hypothesis and Aims 135
6.3 Methods 135
6.4 Results 137
6.5 Discussion 148
Chapter 7 Summary and Conclusion 151
7.1 Introduction 153
7.2 Nevirapine Induced Hypersensitivity 153
7.3 Carbamazepine-Induced Stevens-Johnson Syndrome and
Toxic Epidermal Necrolysis 156
7.4 Final Conclusions 161
vii
8 Bibliography 165
9 Appendix 181
9.1 Nevirapine isolation from Viramune tablets 181
9.2 Chapter 5 Specific T-cell clonotype and detection by ddPCR 182
9.3 Future experimentation for HLA-15:02-restricted CBZ-SJS/TEN 186
9.4 Publication and Conference Abstracts 188
viii
ix
Abstract
Introduction: Immunologically mediated-adverse drug reactions threaten the
viability of drugs and the health of patients (1, 2). The mechanistic basis for abacavir
hypersensitivity is understood and preventable through HLA-B*57:01 screening. The
immunopathogenesis of most immunologically mediated-adverse drug reaction
remain unsolved, representing an opportunity to improve drug safety.
Methods: Using a repository of clinically phenotyped and HLA typed human
Donors and Controls, this work aimed to shed light on the immunopathogenesis of
nevirapine and carbamazepine severe cutaneous adverse reactions. Cellular and
molecular, techniques were employed including ex-vivo/in-vitro immunophenotyping,
detection, stimulation and expansion of drug-specific responses, and characterisation
of the specific T-cell receptor using droplet digital PCR. Virtual and Bioinformatics
approaches were used to define potential interactions between nevirapine and
class-I HLA
Results and discussion: In carbamazepine associated Steven-Johnson’s
Syndrome / toxic epidermal necrolysis, increased expression of granulysin was seen
ex-vivo in CD8+ T cells exposed to carbamazepine. To explore the hypothesis that
this is related to a cross-reactive memory cytotoxic T-cell response, we examined
responses to human simplex virus 1 / 2 responses in HLA-B*15:02 carbamazepine
associated Steven-Johnson’s Syndrome / toxic epidermal necrolysis patients and
identified a shared epitope. Common T-cell receptor clonotypes were identified using
droplet digital PCR in HLA-B*15:02 carbamazepine associated Steven-Johnson’s
Syndrome / toxic epidermal necrolysis patients.
Nevirapine severe cutaneous adverse reactions are associated with multiple class-I
HLA alleles across differing ethnicities. The hypothesis that this relates to shared
peptide-binding specificities between these alleles was confirmed using
bioinformatics, statistical, and virtual approaches. This showed the strongest
association across European, Asian and African-American ethnicities to be with two
HLA class C alleles HLA-C*04:01 and C*05:01 defined by a unique F-binding pocket.
Conclusion: Continuing work should build on the results presented and the unique
techniques used, to further understand the underlying immunopathogenesis and the
mechanistic basis for these adverse reactions, leading to the development of
screening strategies to improve drug and patient safety.
x
xi
List of Abbreviations Abacavir…………………………………………………………............................... ABC
Adverse drug reactions………………………………………....…….……............ ADR
Alpha………………………………………………………….…............................... α
Analysis of variance………………………………………………….…..………..... ANOVA
Antigen-presenting cell..………………………………………............................... APC
Antiretroviral……………………………………………………............................... ARV
Basic Local Alignment Search Tool.................................................................... BLAST
Beta 2-Microglobulin ……...……………………………………............................. β2M
Beta…………………………………………………................................................ β
Carbamazepine………………………………………………….............................. CBZ
Cluster of differentiation…………………………………………............................ CD
Comma-separated values……………………………………………………........... CSV
Complementarity-determining region…………………………............................. CDR
Complementary DNA……………………………………………………….............. cDNA
Constant TCR region…………………………………………................................ C
Cross-reactive group.......................................................................................... CREG
Cytomegalovirus………………………………………........................................... CMV
Cytometric Bead Array…………………………………………………....…............ CBA
Cytotoxic T-lymphocyte-associated protein 4..................................................... CTLA4
Dendritic cell……………………………………………………............................... DC
Deoxyribonucleic acid…………………………………………............................... DNA
Deoxyribonucleotide triphosphates………………………………………..…........ dNTP
Dimethyl sulfoxide…………………………………………………………............... DMSO
Dimethylformamide……………………………………………..…….…….............. DMF
Diverse TCR region…………………………………………................................... D
Droplet digital Polymerase Chain Reaction ……………………..……................. ddPCR
xii
Drug reaction with eosinophilia and systemic symptoms………….………........ DRESS
Drug-Induced Liver Injury................................................................................... DILI
Enzyme-Linked ImmunoSpot……………………………………….………........... ELISpot
Epstein-Barr virus………………………………………......................................... EBV
Ethylenediaminetetraacetic acid……………………………………...…................ EDTA
Foetal calf serum……………………………………………...……………….......... FCS
Gamma Interferon……………………………………………………......……......... IFN-γ
Genome-wide association studies…………………………………...…………..... GWAS
Helper T cells…………………………………………………….............................. Th
Herpes simplex viruses type 1…………………………………………..……........ HSV-1
Herpes simplex viruses type 2………………………………………….................. HSV-2
Herpes Zoster..................................................................................................... HZ
Highly active antiretroviral therapy..................................................................... HAART
Human herpesvirus.………………………………………...................................... HHV
Human immunodeficiency virus………………………………………….….......... HIV
Human leukocyte antigen………………………………………............................. HLA
Hypersensitivity reaction………………......……….............................................. HSR
Hypersensitivity syndrome…………………………………….…........................... HSS
Immunoglobulin……………………………………………..................................... Ig
Immunologically mediated-adverse drug reactions............................................ IM-ADR
Interleukin………………………………………..;;………………………………...... IL
Intracellular cytokine staining ……………………………;;…………………..….... ICS
Joining TCR region……………………………………......…................................. J
Lymphoblastic cell lines……………………………;.………………….....……...... LCL
Maculopapular eruption...................................................................................... MPE
Major histocompatiblity complex………………………………............................. MHC
Natural killer cell…………………………………………………...……………........ NK cell
xiii
Natural killer T cell………………………………………………….......………........ NK-T cell
N-Ethylmaleimide…………………………………………………...…....………..... NEM
Nevirapine………………………………………………………............................... NVP
Non-steroidal anti-inflammatory.......................................................................... NSAID
Peptide-binding................................................................................................... pb-
Peripheral blood mononuclear cell………………………………..…………......... PBMC
Pharmological interaction………………………………………...……..………...... P-I
Phenylmethanesulfonylfluoride……………….………………………………........ PMSF
Phosphate-buffered saline.................................................................................. PBS
Post-herpetic neuralgia………………………………………………...………….... PHN
Programmed Death 1......................................................................................... PD-1
Programmed Death Ligand 1.............................................................................. PD-L1
Prospective Randomised Evaluation of DNA Screening in a Clinical Trail....... PREDICT-1
Regulatory T cell.………………………………………………............................... Treg
Relative centrifugal force.................................................................................... RPM
Revolutions per minute....................................................................................... RCF
Ribonuclease P RNA component H1……………………….........………………... RPPH1
Ribonucleic acid……………………….....................................………………....... RNA
Severe cutaneous adverse reaction……………………………..……....…........... SCAR
Staphylococcal enterotoxin B............................................................................. SEB
Stevens-Johnson syndrome……………………………………............................ SJS
Study of Hypersensitivity to ABC and Pharmacogenetic Evaluation……......... SHAPE
T-cell receptor.…………………………………………………............................... TCR
Tosyl-L-lysine chloromethyl ketone………………………………………….......... TLCK
Tosyl-L-phenylalanine chloromethyl ketone…………………………………........ TPCK
Toxic epidermal necrolysis……………………………………............................... TEN
Tris-EDTA buffer................................................................................................. TE buffer
xiv
Variable TCR DNA region…………………………………….…........................... V
Varicella zoster virus.......................................................................................... VZV
Amino acids........................................................................................................ AA
Alanine…………………………………………………………………...................... A
Arginine………………………………………………………………….................... R
Asparagine…………………………………………………………………............... N
Aspartic acid…………………………………………………………………............ D
Cysteine…………………………………………………………………................... C
Glutamic acid……………………………………………………………….….......... E
Glutamine…………………………………………………………………................. Q
Glycine…............................................................................................................ G
Histidine………………………………………………..……………….................... H
Isoleucine………………………………………………………………..….............. I
Leucine…………………………………………………………………..................... L
Lysine…………………………………………………………………...................... K
Methionine……………………………………………………………….…............. M
Phenylalanine………………………………………………………………...…..... F
Proline…………………………………………………………………..................... P
Serine…………………………………………………………………...................... S
Threonine…………………………………………………………………............... T
Tryptophan………………………………………………………………….…........ W
Tyrosine.…………………………………………………………………................. Y
Valine…………………………………………………………………....................... V
xv
List of Tables Table 1.1: Delayed IM-ADR and their significant features. Adapted from Rive C et al.
2013, Phillips EJ et al. 2010, and Pavlos R et al. 2012 (2, 67, 74) ............................ 13
Table 1.2: Genetic (HLA alleles) and tissue specificity variation seen in different
ethnic groups associated with the NVP-HSRs. Table adapted from Rive C et al. 2013
and Phillips EJ et al. 2011(2, 150) ............................................................................. 21
Table 2.1: List of samples used in Diminishing ex-vivo PBMC’s responses and NVP-
HSR Immunopathogenesis ....................................................................................... 34
Table 2.2: List of samples used in CBZ-HSR immunopathogenesis associated
studies. ...................................................................................................................... 36
Table 2.3 List of reagents used in Stimulation and Expansion, flow cytometry, and
Lymphoblastic cell lines (LCL) generation assays. Flow cytometry antibodies are
included on Table 2.4, tetramer reagents included in Tables 2.5-2.7 and ELISpot
associated reagents and materials are included in Table 2.8 ................................... 37
Table 2.4: Flow cytometry Fluorochrome conjugated antibodies. ............................. 41
Table 2.5: Tetramer folding mix. ................................................................................ 43
Table 2.6: Protease inhibitor mix. .............................................................................. 43
Table 2.7: Addition of streptavidin-PE labelled to peptide/HLA class-I complex. ...... 44
Table 2.8 List of reagents and materials used in ELISpot assay. ............................. 45
Table 2.9 List of reagents and materials used in molecular assays. Specific PCR
associated reagents and concentrations are listed in the relevant tables. ................ 49
Table 2.10: complementary DNA (cDNA) conversion reagents and Master mix. ...... 50
Table 2.11: Cycling conditions for complementary DNA (cDNA) conversion ............ 50
Table 2.12: M13F and M13R primers used to amplify the reference sequence to use
the amplicons to as a positive control. ...................................................................... 51
Table 2.13: Reference sequence amplification reagent Mastermix to amplify the
reference sequence to use the amplicons to as a positive control. ........................... 52
Table 2.14: Reference sequence amplification PCR cycling conditions for the
amplification of the reference sequence to use the amplicons to as a positive control.
.................................................................................................................................. 52
xvi
Table 2.15: Reagent mastermix for EvaGreen ddPCR. ............................................ 54
Table 2.16: Digital droplet PCR (ddPCR) cycling conditions for the amplification of
Variable beta (vβ)-25-1*01 and -12-3/4*01 CDR3 specific sequences, constant beta
(Cβ), and ribonuclease P RNA component H1 (RPPH1) reference gene sequences.
.................................................................................................................................. 55
Table 2.17: vβ 25 and 12 CDR3 specific, and reference gene primers. .................... 55
Table 3.1 HLA cross-reactive group (CREG) supertypes and MHC Cluster peptide-
binding (pb-) groups .................................................................................................. 60
Table 3.2 Distribution of the work within Chapter 3 and accreditation to those who
contributed ................................................................................................................ 63
Table 3.3: NVP-HSR with hepatitis and statistically significant HLA CREG supertype
and pb-groups ........................................................................................................... 64
Table 3.4: HLA-B, B-pocket key amino acid residues YYAVAENIYQY at positions 7,
9, 24, 34, 41, 45, 63, 66, 67, 70, and 99 respectively for the CREG B*07 and pb-B*78
alleles HLA-B*55:(01/02), B*56:(01/03/04), compared to the amino acid sequence of
other HLA-B alleles. .................................................................................................. 67
Table 3.5: NVP-SCAR statistically significant HLA-C alleles. .................................... 68
Table 3.6: HLA-C F-pocket key amino acid residues, DNKLYLRNFYWTKW at
positions 74, 77, 80, 81, 84, 95, 97, 114, 116, 123, 133, 143, 146, and 147,
respectively for the HLA-C*04:(01/03/06/07), HLA-C*05:(01/09) and HLA-C*18:01
alleles, compared to the amino acid sequence of other HLA-C allele. ...................... 71
Table 3.7: HLA-C, B-pocket key amino acid residues YSAVGEKYQF at the B-pocket
positions 7, 9, 24, 34, 41, 45, 63, 66, 67, and 70 respectively for the HLA-
C*04:(01/03/06/07), HLA-C*05:(01/09) and HLA-C*18:01 alleles, compared to the
amino acid sequence of other HLA-C alleles. ........................................................... 72
Table 3.8: Multivariate model of predictive and protective NVP-rash associated
SCARs HLA alleles, adjusted for ethnicity. ............................................................... 73
Table 3.9: Positive and negative predictive values for carriage of the identified
predicted and/or protective NVP-SCAR associated HLA class-I alleles, adjusted for
5% prevalence. ......................................................................................................... 74
Table 4.1: In-silico predicted HSV-1 and HSV-2, HLA-B*15:02-restricted peptides
which were synthesised and analysed ex-vivo (169, 170, 188, 189). ........................ 89
xvii
Table 4.2: In-silico predicted HSV-1 and HSV-2 shared, HLA-B*15:02-restricted
peptides and variants of the HSV-1 and HSV-2 shared peptide, YAHGHSLRLPY
which were synthesised and analysed, ex-vivo (169, 170, 188, 189). ....................... 90
Table 4.3: Distribution of the work within Chapter 4 and accreditation to those who
contributed. ............................................................................................................... 91
Table 5.1: Distribution of the work within this chapter and accreditation to those who
contributed .............................................................................................................. 123
Table 5.2: Summary of the ddPCR amplification and analysis of target Vβ CDR3
sequences as a percentage (%) of expression in Donor 1 (CBZ-TEN), Donor 2 (CBZ-
SJS), and Donor 3 (CBZ-SJS) pre-stimulation cells, CBZ, control drug stimulated and
expanded cells, and the unstimulated expanded cells............................................. 129
Table 6.1: Distribution of the work within this chapter and accreditation to those who
contributed .............................................................................................................. 136
List of Figures Figure 1.1: Human chromosome 6, the location of Major histocompatiblity complex
(MHC 6p21.1-21.3) and the Human leukocyte antigen (HLA) class-I, class-II, and
class-III genes. Adapted from Urayama KY et al. 2013 (13) ....................................... 4
Figure 1.2: Side view of (A) HLA class-I and (B) HLA class-II molecules. Also
represented are the top view of the (C) HLA class-I peptide-binding cleft pockets A-F
and (D) HLA class-II peptide-binding groove pockets 1-9. Adapted from Cole DK,
2013 (17). .................................................................................................................... 6
Figure 1.3: Human leukocyte antigen (HLA) and the processing and presentation of
antigens. (A) Endogenous antigen processing and HLA class-I presentation. (B)
Exogenous antigen processing and HLA class-II presentation. (C) HLA class-I cross-
presentation of exogenous antigens derived via endocytosis. β2M, Beta 2-
Microglobulin; TCR, T- cell Receptor; ER, endoplasmic reticulum; TAP 1 and TAP 2,
transporter associated with antigen processing 1 and 2; CLIP, Class-II-associated
invariant chain peptide. Adapted from, Guermonprez P, et al. 2002, Heath WR and
Carbone FR, 2001, Braciale et al. 1987, Boesteanu A et al. 1998, and Kobayashi KS
et al. 2012 (18, 20-22, 25) ........................................................................................... 6
xviii
Figure 1.4: Germline DNA T-cell receptor (TCR) rearrangement, translation, splicing
and transcription. Variable alpha (Vα), Variable beta (Vβ), Joining alpha (Jα), Joining
beta (Jβ), diverse beta (Dβ), Constant alpha (Cα) and Constant beta (Cβ) DNA
chains, adapted from Janeway CA et al. 2001 (26) ..................................................... 8
Figure 1.5: Peptide-loaded human leukocyte antigen (HLA) molecule (A) class-I and
(B) class-II complexes and T-cell receptor (TCR) complementarity-determining region
(CDR) loop interactions. CDR3 (Orange α3 and β3), CDR1 and CDR2 β-chains
(Green β1 and β2) CDR1 and CDR2 α-chains (Blue α1 and α2). Figure adapted from
Cole DK, 2013 (17). .................................................................................................... 8
Figure 1.6: Naive CD8+ T-cell activation, proliferation and clonal expansion. Tcm,
central memory T cells; Tem, effector memory T cells; Trm, resident memory T cells;
DC, dendritic cells. Adapted from Kaech S and Weiguo C, 2012 (51) ...................... 10
Figure 1.7: Abacavir (ABC) translational roadmap Showing how the discovery of the
association between HLA-B*57:01 carriage and ABC- HSS lead to the incorporation
of HLA-B*57:01 genetic screening into clinical practice. Figure adapted from Rive C
et al. 2013 and Phillips EJ et al. 2011(2, 78). ............................................................ 15
Figure 1.8: The frequency of HLA-B*15:02 allele carriage most prevalent in those of
South and South-east Asian ethnic groups. (2, 67, 100) ........................................... 17
Figure 1.9: Graphical representation published by White et al., 2015 of the
heterologous immunity model with the three neo-antigen generating, HLA-drug
binding models (A) hapten/prohapten model, the (B) P-I model, and the (C) altered
peptide repertoire model.(167) .................................................................................. 24
Figure 2.1: Timeline of the stimulation and cellular expansion culture protocol for
analysis of CBZ-specific polyclonal T cells. ............................................................... 40
Figure 2.2: General overview of digital droplet PCR (ddPCR) assay workflow from
PCR mastermix generation through to droplet generation, amplification, QX100/200
plate reading and analysis. ....................................................................................... 54
Figure 3.1: MHCcluster tree created for the functional clustering of HLA-B alleles.
Depicted are the peptide-binding groups, pb-B*78 (red), pb-B*35 (orange), pb-B*46,
and pb-B*18. (blue), with representative predicted peptide-binding motifs (168). ..... 65
xix
Figure 3.2: MHCcluster heatmap representation for the functional clustering of HLA-B
alleles, Depicted are the peptide-binding groups, pb-B*78 (red), pb-B*35 (orange),
pb-B*46, and pb-B*18 using the MHCcluster algorithm (168). .................................. 65
Figure 3.3: MHCcluster tree created for the functional clustering of HLA-C alleles.
Depicted are the various predicted peptide-binding groups, pb-C*05 and pb-C*18
(blue), with representative peptide-binding motifs (168). ........................................... 69
Figure 3.4: MHCcluster heatmap representation for the functional clustering of HLA-C
alleles. Depicted are the various predicted peptide-binding groups, including pb-C*05
and pb-C*18 (blue), using the MHCcluster algorithm (168). ...................................... 69
Figure 3.5: Virtual modelling of NVP and HLA-C*04:01 potential interaction, which
indicates the preferential docking or binding of NVP near the B-pocket of the HLA-
C*04:01 molecule. ..................................................................................................... 72
Figure 3.6 Timeline of diminishing IFN-γ responses SFU/million cells in Donor 1
(NVP-HSR), Donor 2 (NVP-HSR), and Donor 3 (NVP-HSR) Figure from Keane et al.
2014 (138) ................................................................................................................. 75
Figure 3.7: Regulatory T cells expressed at a % of CD4 T cells are shown in the plot
where clear symbols indicates samples from Donor 1 (NVP-HSR) and the time after
NVP cessation. The filled in symbols indicate samples from controls (black, blue) and
HIV patient not on medication (red symbol). Figure from Keane et al. 2014 (138). ... 75
Figure 3.8: Cytokine plasma profile of Donor 1 (NVP-HSR), plasma obtained pre-
NVP-HSR to day 102 post NVP-HSR. Concentrations were determined by using the
CBA kit internal standard controls and normalised against the NVP-tolerant and NVP-
naive healthy controls. Statistical significance was determined using an analysis of
variance (ANOVA) statistical analysis (p < 0.0001) and multiple comparison tests
(***p < 0.0001) to compare the concentration of each cytokine in Donor 1 (NVP-HSR)
to the concentration of the responding cytokine in the NVP-tolerant and NVP-naive
healthy controls. ........................................................................................................ 76
xx
Figure 3.9: Cytokine plasma profile of Donor 2 (NVP-HSR) plasma obtained pre-
NVP-DRESS to day 330 post NVP-DRESS. Concentrations were determined by
using the CBA kit internal standard controls and normalised against the NVP-tolerant
and NVP-naive healthy controls. Statistical significance was determined using an
analysis of variance (ANOVA) statistical analysis (p < 0.0001) and multiple
comparison tests (***p < 0.0001) to compare the concentration of each cytokine in
Donor 2 (NVP-HSR) to the concentration of the responding cytokine in the NVP-
tolerant and NVP-naive healthy controls. .................................................................. 77
Figure 3.10: Cytokine plasma profile of Donor 3 (NVP-HSR) plasma obtained day 7
to day 727 post NVP-HSR. Concentrations were determined by using the CBA kit
internal standard controls and normalised against the NVP-tolerant and NVP-naive
healthy controls. ........................................................................................................ 78
Figure 3.11: Plasma IL-6 cytokine profile of Donor 1 (NVP-HSR) and Donor 2 (NVP-
HSR) (Donor 3 (NVP-HSR) not included), highlighting the potential of IL-6 having a
role in NVP-HSR. Concentrations were determined by using the CBA kit internal
standard controls and normalised against the NVP-tolerant and NVP-naive healthy
controls. Statistical significance was determined using an analysis of variance
(ANOVA) statistical analysis (p < 0.0001) and multiple comparison tests to compare
the concentration of each cytokine to their respective pre-NVP plasma cytokine
concentration (***p < 0.0001). .................................................................................. 80
Figure 4.1: Example IFN-γ ELISpot raw data. The unstimulated background and
solvent controls (DMSO/DMF at 1μL/mL), positive controls anti-CD3 antibody (wells
B1 and B2 0.1μg/mL) and SEB (wells B3 and B4 1μg/mL) responses at 200,000 cells
per well. The test positive and test negative responses highlight the typical positive
and negative response to the test stimulant (drug or peptide 10μg/mL) with an input
of 50,000 and 200,000 cell per well. .......................................................................... 91
Figure 4.2 The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 1 (CBZ-
TEN) were determined using ELISpot, described in Chapter 2, Enzyme-Linked
ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line).
Error bars represent intra-sample variation (n=3). .................................................... 93
Figure 4.3: The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 2 (CBZ-
SJS) were determined using ELISpot, described in Chapter 2, Enzyme-Linked
ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line).
Error bars represent intra-sample variation (n=3). .................................................... 94
xxi
Figure 4.4: The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 3 (CBZ-
SJS) were determined using ELISpot, described in Chapter 2, Enzyme-Linked
ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line).
Error bars represent intra-sample variation (n=3). .................................................... 95
Figure 4.5: Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 4 (CBZ-SJS
non- B*15:02) were determined using ELISpot, described in Chapter 2, Enzyme-
Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red
line). Error bars represent intra-sample variation (n=3). ............................................ 96
Figure 4.6: Mean (+/- SD) IFN-γ responses SFU/million cells in Control 1 (CBZ-naive)
were determined using ELISpot, described in Chapter 2, Enzyme-Linked
ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line).
Error bars represent intra-sample variation (n=3). .................................................... 97
Figure 4.7: Mean (+/- SD) IFN-γ responses SFU/million cells in Control 2 (CBZ-naive
non-B*15:02) were determined using ELISpot, described in Chapter 2, Enzyme-
Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red
line). Error bars represent intra-sample variation (n=3). ............................................ 98
Figure 4.8: Mean (+/- SD) IFN-γ responses SFU/million cells to CBZ and predicted
HLA-B*15:02-restricted peptides identified in Figure 4.2 to Figure 4.7, determined
using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample
variation (n=3). .......................................................................................................... 99
Figure 4.9: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing
concentrations of the predicted HLA-B*15:02-restricted peptide, YAHGHSLRLPY in
the three HLA-B*15:02 positive Donors were determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1
μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3) and the p
values were determined using the Pearson correlation test (*p < 0.05). ................. 100
Figure 4.10: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing
concentrations of the predicted HLA-B*15:02-restricted peptide, LAFVLDSPSAY in
the three HLA-B*15:02 positive Donors were determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1
μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3) and the p
values were determined using the Pearson correlation test (*p < 0.05). ................. 101
xxii
Figure 4.11: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing
concentrations of the predicted HLA-B*15:02-restricted peptide, NIRQAGVQY in the
three HLA-B*15:02 positive Donors were determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1
μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3) and the p
values were determined using the Pearson correlation test (*p < 0.05) .................. 102
Figure 4.12 Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing
concentrations of the predicted HLA-B*15:02-restricted peptide, FAFTINTAAY in the
three HLA-B*15:02 positive Donors were determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1
μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3). ................. 103
Figure 4.13 MS/MS analysis of YAHGHSLRLPY, original responsive peptide (left)
and pure form for tetramer folding (right). A Spectrum was obtained in de novo
peptide analysis via the MALDI TOF MS (4800 Proteomics analyser). ................... 104
Figure 4.14 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 1 (CBZ-TEN)
to the YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50
SFU/million cells (red line). Error bars represent intra-sample variation (n=3). ....... 106
Figure 4.15 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 2 (CBZ-SJS)
to the YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50
SFU/million cells (red line). Error bars represent intra-sample variation (n=3). ....... 107
Figure 4.16 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 3 (CBZ-SJS)
to the YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50
SFU/million cells (red line). Error bars represent intra-sample variation (n=3). ....... 108
xxiii
Figure 4.17 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 4 (CBZ-SJS
non- B*15:02) to the YAHGHSLRLPY peptide and the missing histidine variants,
YAHG_SLRLPY, YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot,
described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive
responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3). ....................................................................................................................... 109
Figure 4.18 Mean (+/- SD) IFN-γ responses SFU/million cells in Control 1 (CBZ-
naive) to the YAHGHSLRLPY peptide and the missing histidine variants,
YAHG_SLRLPY, YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot,
described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive
responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3). ....................................................................................................................... 110
Figure 4.19 Mean (+/- SD) IFN-γ responses SFU/million cells in Control 2 (CBZ-naive
non- B*15:02) to the YAHGHSLRLPY peptide and the missing histidine variants,
YAHG_SLRLPY, YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot,
described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive
responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3). ....................................................................................................................... 111
Figure 4.20 Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing
concentrations of the predicted HLA-B*15:02-restricted variant peptide,
YAHG_SLRLPY in the three HLA-B*15:02 positive CBZ-SJS/TEN Donors and Donor
4 (CBZ-SJS non-B*15:02) were determined using ELISpot, described in Chapter 2,
Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1 μg/ml, and
10 μg/ml. Error bars represent intra-sample variation (n=3) and the p values were
determined using the Pearson correlation test (*p < 0.05) and r2 values non-linear
regression analysis (n=4) ........................................................................................ 112
Figure 4.21: Donor 1 CBZ-TEN, B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and
NIRQAGVQY tetramer stain, performed as outlined in Chapter 2, Tetramers 2.2.2.3.
Samples were compared to negative control which consisted of unstained sample
spiked with PE and washed out as per the Tetramer staining protocol. Error bars
represent intra-sample variation (n=5). ................................................................... 113
xxiv
Figure 4.22: Donor 2 (CBZ-SJS), B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and
NIRQAGVQY tetramer stain performed as outlined in Chapter 2, Tetramers 2.2.2.3.
Samples were compared to negative control which consisted of unstained sample
spiked with PE and washed out as per the Tetramer staining protocol. Error bars
represent intra-sample variation (n=5). ................................................................... 114
Figure 4.23: Donor 3 (CBZ-SJS), B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and
NIRQAGVQY tetramer stain performed as outlined in Chapter 2, Tetramers 2.2.2.3.
Samples were compared to negative control which consisted of unstained sample
spiked with PE and washed out as per the Tetramer staining protocol. Error bars
represent intra-sample variation (n=5). ................................................................... 114
Figure 4.24: Control 2 (CBZ-naive non-B*15:02), B*15:02-YAHG_SLRLPY,
LAFVLDSPSAY, and NIRQAGVQY tetramer stain performed as outlined in Chapter
2, Tetramers 2.2.2.3. Samples were compared to negative control which consisted of
unstained sample spiked with PE and washed out as per the Tetramer staining
protocol. Error bars represent intra-sample variation (n=5). .................................... 115
Figure 5.1: Left: Example IFN-γ ELISpot raw data. The unstimulated background and
solvent controls (DMSO/DMF at 1μL/mL), positive controls anti-CD3 antibody (wells
B1 and B2, 0.1μg/mL) and SEB (wells B3 and B4, 1μg/mL) responses at 200,000
cells per well. The test positive and test negative responses highlight the typical
positive and negative response to the test stimulant (drug or peptide 10μg/mL) with
an input of 50,000 and 200,000 cell per well. Right: Mean (+/- SD) IFN-γ responses
SFU/million cells in CBZ-SJS/TEN Donors and Controls, both pre- and post-CBZ
stimulation and culture, were determined using ELISpot, described in Chapter 2,
Enzyme-Linked ImmunoSpot 2.2.3. Error bars represent intra-sample variation (n=3)
................................................................................................................................ 124
Figure 5.2: Left: Example ICS raw data plots showing the CBZ-associated cellular
IFN-γ responses both pre- and post-stimulation (CBZ 10μg/mL) in Donor 1 (CBZ-
TEN). Right: Mean (+/- SD) IFN-γ ICS flow cytometry analysis for CBZ-SJS/TEN
Donor and controls cells both pre- and post- stimulation and culture were determined
using the ICS method outlined in Chapter 2, Intracellular cytokine staining 2.2.2.1.
Error bars represent intra-sample variation (n=3). ................................................. 124
Figure 5.3: TCR Vβ CDR3 sequence profile of Donor 1 CBZ-TEN. Raw data
analysed using Bio-Rad QuantaSoft software, results normalised against RPHH1
expression, and calculated as a percentage (%) of normalised Cβ expression.
xxv
Statistical significance was determined using analysis of variance (ANOVA) statistical
analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value <
0.0001, *p value < 0.05). ......................................................................................... 126
Figure 5.4: Vβ TCR CDR3 sequence profile of Donor 2 (CBZ-SJS). Raw data
analysed using Bio-Rad QuantaSoft software, results normalised against RPHH1
expression, and calculated as a percentage (%) of normalised Cβ expression.
Statistical significance was determined using analysis of variance (ANOVA) statistical
analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value <
0.0001). ................................................................................................................... 127
Figure 5.5: Vβ TCR CDR3 sequence profile of Donor 3 (CBZ-SJS). Raw data
analysed using Bio-Rad QuantaSoft software, results normalised against RPHH1
expression, and calculated as a percentage (%) of normalised Cβ expression.
Statistical significance was determined using analysis of variance (ANOVA) statistical
analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value <
0.0001). ................................................................................................................... 128
Figure 6.1: Left: Example immunophenotyping and ICS raw data plots showing the
gating procedure used to isolate the cellular subpopulations and determine their
cytokine expression under the relevant conditions. Top Right: Example of negative to
low Granulysin expression. Bottom Right: Example of positive granulysin expression.
................................................................................................................................ 137
Figure 6.2: Mean (+/- SD) Granulysin expression in CD8+ cytotoxic T cells from
Donor and Control PBMC’s incubated ex-vivo with CBZ, control drug, or left
unstimulated. Statistical significance was determined using ANOVA analysis (p <
0.0001). Multiple comparison tests showed significance between unstimulated and
CBZ-stimulated donor PBMC’s (* p value < 0.05), CBZ and control drug-stimulated
donor PBMC’s (*** p value < 0.0001), CBZ and the unstimulated, CBZ and control
drug-stimulated donor PBMC’s (*** p value < 0.0001). The error bars represent inter-
sample variation (n=4). ............................................................................................ 138
xxvi
Figure 6.3: Mean (+/- SD) Granulysin expression in CD8+ cytotoxic T cells in Donor
and Control PBMC’s incubated ex-vivo with CBZ versus unstimulated PBMC’s.
Statistical significance between unstimulated and CBZ-stimulated for each set of
donors (***p value of < 0.0001), using the paired two-tailed T-test, compared to the
controls (not significant (ns)). The error bars represent intra-sample variation (n=4).
................................................................................................................................ 139
Figure 6.4: Mean (+/- SD) INF-γ expression in CD8+ cytotoxic T cells from Donor and
Control PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated.
Statistical significance was determined using ANOVA analysis (p < 0.0001). Multiple
comparison tests showed significance between, unstimulated and CBZ-stimulated
donor PBMC’s (*** p value < 0.0001), CBZ and Control drug-stimulated donor
PBMC’s (*** p value < 0.0001), CBZ and the unstimulated, CBZ and Control drug-
stimulated donor PBMC’s (*** p value < 0.0001). The error bars represent inter-
sample variation (n=4). ............................................................................................ 140
Figure 6.5: Mean (+/- SD) IFN-γ expression in CD8+ cytotoxic T cells in Donor and
Control PBMC’s incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical
significance between unstimulated and CBZ-stimulated Donor 1 (CBZ-TEN) (***p
value of < 0.0001), Donor 2 (CBZ- SJS) (*p value of < 0.05) and Donor 4 (CBZ-SJS
non- B*15:02) (*p value of < 0.05) using the paired two-tailed T-test. Donor 3 (CBZ-
SJS) and Controls CBZ-naive (both HLA-B*15:02 positive and negative) were not
significant (ns)). The error bars represent intra-sample variation (n=4)................... 141
Figure 6.6: Mean (+/- SD) Granulysin expression in CD3+ CD4+ CD56- T cells in
Donor and Control PBMC’s incubated ex-vivo with CBZ, control drug, or left
unstimulated. No statistical significance was determined between the means of the
various conditions. (ANOVA analysis and multiple comparison tests).The error bars
represent inter-sample variation (n=4). ................................................................... 143
Figure 6.7: Mean (+/- SD) Granulysin expression in CD4+ T cells in Donor and
Control PBMC’s incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical
significance was found between Donor 4 (CBZ-SJS non- B*15:02) unstimulated and
CBZ-stimulated PBMC’s (*** p value < 0.0001). HLA-B*15:02 positive Donors 1
(CBZ-TEN), Donor 2 (CBZ-SJS), and Donor 3 (CBZ-SJS) unstimulated versus CBZ-
stimulated PBMC’s, and the Controls were found to be not significant using a paired
two-tailed T-test. The error bars represent intra-sample variation (n=4). ................ 144
xxvii
Figure 6.8: Mean (+/- SD) IFN-γ expression in CD4+ T cells in Donor and Control
PBMC’s incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical
significance was found between Donor 4 (CBZ-SJS non- B*15:02) unstimulated and
CBZ-stimulated PBMC’s (*** p value < 0.0001). HLA-B*15:02 positive Donors 1
(CBZ-TEN), Donor 2 (CBZ-SJS), and Donor 3 (CBZ-SJS) unstimulated versus CBZ-
stimulated PBMC’s, and the Controls were found to be not significant using a paired
two-tailed T-test. The error bars represent intra-sample variation (n=4). ................ 145
Figure 6.9: Mean (+/- SD) Granulysin expression in CD56+ NK cells in Donor and
Control PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated. The
error bars represent variation within the same sample on multiple test (N tests per
sample in each condition = 4). ................................................................................ 146
Figure 6.10: Mean (+/- SD) Granulysin expression in CD3+ CD8+ CD56+ NK-T cells in
Donor and Control PBMC’s incubated ex-vivo with CBZ, control drug, or left
unstimulated. The error bars represent intra-sample variation (n=4). ..................... 147
Figure 6.11: Mean (+/- SD) Granulysin expression in CD3+ CD4+ CD56+ NK-T cells in
Donor and Control PBMC’s incubated ex-vivo with CBZ, control drug, or left
unstimulated. The error bars represent inter-sample variation (n=4). ..................... 148
Figure 9.1: Analysis of specific Vβ CDR3 primers using serial dilutions of the
reference sequence amplicons, with the annealing temperature set at 58◦C .......... 182
Figure 9.2: Analysis of specific Vβ CDR3 primers using serial dilutions of the
reference sequence amplicons, with the annealing temperature set at and 60◦C. .. 183
Figure 9.3: the QuantaSoft raw digital droplet PCR plots. Reference sequence
amplicons, serially diluted to test the sensitivity of the digital droplet PCR and
qualifying the assay parameters. ............................................................................. 184
Figure 9.4: the QuantaSoft digital droplet PCR output of positive and total events
recorded for the raw plots outlined in Figure 9.10 Reference sequence amplicons,
serially diluted to test the sensitivity of the digital droplet PCR and qualifying the
assay parameters. ................................................................................................... 185
Figure 9.5: Digital droplet PCR Reference sequence amplicons serial dilution result
and QuantaSoft output (copies/μL). Reference sequence amplicons, serially diluted
to test the sensitivity of the digital droplet PCR and qualifying the assay parameters.
................................................................................................................................ 185
xxviii
Figure 9.6: Mean (+/- SD) Granulysin expression by CD8+ T cells, stimulated by the
epitopes discovered in Chapter 4 Predicted HLA-Restricted Peptide Screening
(10μg/mL) and CBZ (10μg/mL). .............................................................................. 186
Figure 9.7: TCR Vβ-12 CDR3 LAGELF and Vβ-11 CDR3 ISGSY sequence profile of
Donor 1 (CBZ-TEN) when stimulated with stimulated by the epitopes discovered in
Chapter 4 Predicted HLA-Restricted Peptide Screening (10μg/mL) and CBZ
(10μg/mL). Raw data analysed using Bio-Rad QuantaSoft software, results
normalised against RPHH1 expression, and calculated as a percentage (%) of
normalised Cβ expression. ...................................................................................... 187
Figure 9.8: Abstract of HLA Class-I restricted CD8 (+) and Class-II restricted CD4 (+)
T cells are implicated in the Pathogenesis of Nevirapine Hypersensitivity paper.
Published in AIDS, London, 24 August 2014 - Volume 28 - Issue 13 - p 1891–1901.
DOI:10.1097/QAD.0000000000000345 (138). ........................................................ 188
Figure 9.9: Abstract of Testing for Drug Hypersensitivity Syndromes. Published in
The Clinical biochemist. Reviews / Australian Association of Clinical Biochemists
02/2013; 34(1):15-38. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3626363/ (2).
................................................................................................................................ 189
Figure 9.10: Poster presented at Science on the Swan, April 2015.
https://www.researchgate.net/publication/281661878_HLA_Class_I-drug-T-
cell_receptor_interaction_and_cytokine_expression_in_SJSTEN DOI:
10.13140/RG.2.1.4937.5207 .................................................................................. 190
Figure 9.11: Poster presented at Conference on Retroviruses and Opportunistic
Infections (CROI), Boston, Massachusetts; 2014.
https://www.researchgate.net/publication/275332026_Specific_Binding_
Characterstics_of_HLA_Alleles_Associate_with_Nevirapine_Hypersensitivity DOI:
10.13140/RG.2.1.1206.1287. (241) ......................................................................... 191
Figure 9.12: Abstract for talk presented at Drug hypersensitivity meeting 6 (DHM6),
Bern Switzerland April, 2014. .................................................................................. 192
Figure 9.12: Abstract for talk presented at Drug hypersensitivity meeting 6 (DHM6),
Bern Switzerland April, 2014. .................................................................................. 193
1
Chapter 1
Introduction: Immunopathogenesis of Drug Hypersensitivity
2
3
1 1.1 Adverse Drug Reactions
Adverse drug reactions (ADR) represent a major cause of iatrogenic and preventable
disease and death (1, 2). A meta-analysis covering 39 different studies from 1966 to
1996 estimates that 2.2 million serious ADR occur every year in the US alone, with
over 100 thousand (4.5%) resulting in death (3-6). ADR are a common cause of
mortality in the developed world (2). ADR place high demands on hospitals, healthcare
facilities, and auxiliary healthcare services. The enormous burden and cost of ADR are
incompletely captured and underestimated (1, 5, 7).
Even with the stringency and oversight governing drug patents, development, and
licensing an estimated 1500 patients are likely to be exposed to a newly developed
drug during pre-clinical, pre-marketing testing phases (8-10). Only those ADR which
show a frequency of 1 in 500 or greater are identified during the pre-marketing phases
of drug development (8-10). The burden of ADR are likely to increase over time due to
new medication development, the discovery of new uses for already marketed
medications, and an ageing population in many developed countries. There are no
effective strategies to determine the propensity for a drug to cause severe
immunologically mediated-adverse drug reactions (IM-ADR) during development
(1, 3).
The different ADR classifications have been covered in the literature including the
paper by Rive et al. 2013 entitled Testing for Drug Hypersensitivity Syndromes
(Appendix 9, Journal Publications 9.4.1) (2). This paper reviewed IM-ADR or
hypersensitivity reactions (HSR), in particular, the well-known immediate
immunoglobulin (Ig) E and IgE-like HSR and the T-cell mediated, delayed IM-ADR.
Here we focus on the latter, looking at the severe cutaneous adverse drug reactions
(SCARs) that are mediated through adaptive, T cell-mediated immune responses
(2, 11).
1.2 Adaptive, Cell-Mediated Immune Response
Delayed IM-ADR are driven through adaptive, cell-mediated immune responses.
Adaptive, cell-mediated immunity involves T-cell activation through the T-cell receptor
(TCR) recognition of antigenic molecules, presented by the major histocompatiblity
complex (MHC) or human leukocyte antigen (HLA) cell-surface molecules.
4
1.2.1 Human Leukocyte Antigen
The antigen-presenting cell-surface HLA proteins are encoded by HLA genes in the
MHC chromosomal region, a 3.6 megabase pair section of deoxyribonucleic acid
(DNA) on the short arm of chromosome number 6 in humans (6q21.3). HLA class-I
proteins are encoded by three major loci: HLA-A, HLA-B, and HLA-C and three minor
loci: HLA-E, HLA-F, and HLA-G while the HLA class-II proteins are encoded by three
major loci: HLA-DR, HLA-DP, and HLA-DQ and two minor loci; HLA-DM and HLA-DO
(Figure 1.1) (2, 12). The HLA class-III region includes both immune and non-immune
associated genes like the tumour necrosis factor gene and heat shock proteins' genes
(Figure 1.1) (13, 14).
HLA class-I and class-II genes are highly variable, with polymorphic changes resulting
in amino acid changes within the HLA peptide-binding cleft/groove of the specific HLA
protein it encodes, influencing the peptide-binding capabilities of each HLA allotype
and therefore altering the repertoire of peptides that each HLA allotype can present
(15, 16).
Figure 1.1: Human chromosome 6, the location of Major histocompatiblity complex (MHC 6p21.1-21.3)
and the Human leukocyte antigen (HLA) class-I, class-II, and class-III genes. Adapted from Urayama
KY et al. 2013 (13)
1.2.2 Antigen Processing and Presentation
1.2.2.1 HLA class-I endogenous antigen processing
HLA class-I molecules are expressed by all nucleated cells and are composed of a
conserved Beta 2-Microglobulin (β2M) and a polymorphic alpha (α) chain, made of
5
three domains, α1 to α3 (Figure 1.2a) (17, 18). The peptide-binding cleft consists of
two antiparallel α-helices, formed by the α1 and α2 domains of the α chain and eight
antiparallel beta (β) sheets, which provides a binding cleft with specific peptide-binding
cleft pockets, identified as pockets A to F, at its base (Figure 1.2c) (17-19). The
chemical characteristics and size of each binding cleft pocket define the repertoire of
peptides that can be accommodated by the different HLA allotypes.
As highlighted in Figure 1.3a antigenic peptide presentation by HLA class-I
cell-surface protein to the TCR of T cells co-expressing the cluster of differentiation
(CD) 8 molecule, requires the endogenous processing of foreign or abnormal antigens
present in the cytoplasm (18, 20-22). HLA class-I bind and express antigenic peptides
8-9 amino acids in length, however, longer antigenic peptides of ten or more amino
acids can be accommodated by HLA class-I (17, 18).
1.2.2.2 HLA Class-II exogenous antigen processing
HLA class-II molecules differ from HLA class-I molecules in that, under normal
circumstances, HLA class-II are only expressed by specialised professional antigen-
presenting cells (APCs), including dendritic cells (DC), macrophages,
B cells, and certain activated epithelial cells. HLA class-II molecules are consists of
two α chain and two β chain domains (Figure 1.2b) (17, 18). The peptide-binding
groove is made by the interaction between the α1 and β1 domains which provides a
binding groove with specific peptide-binding groove pockets, P1 to P9 (Figure 1.2d)
(17-19). The binding groove pockets accommodate the amino acids residues of a
bound peptide.
As highlighted in Figure 1.3b, antigenic peptide presentation by HLA class-II
molecules, to the TCR of CD4 expressing (CD4+) T cells, requires the exogenous
processing of phagocytised antigens (18, 20-22). Unlike HLA class-I, HLA class-II
molecules present peptides 12 to 25 amino acids in length (17, 18).
1.2.2.3 Cross-presentation
Cross-presentation of antigenic peptides differs from the classical antigen presentation
models as it involves exogenous derived antigenic peptides being presented on HLA
class-I molecules (Figure 1.2c) (20, 23-25). Cross-presentation plays an essential role
in the defence against several viruses, bacteria; and tumours which have shown an
ability to use immune evasion methods, like antigen processing suppression. (20, 23-
25)
6
Figure 1.2: Side view of (A) HLA class-I and (B) HLA class-II molecules. Also represented are the top
view of the (C) HLA class-I peptide-binding cleft pockets A-F and (D) HLA class-II peptide-binding
groove pockets 1-9. Adapted from Cole DK, 2013 (17).
Figure 1.3: Human leukocyte antigen (HLA) and the processing and presentation of antigens. (A)
Endogenous antigen processing and HLA class-I presentation. (B) Exogenous antigen processing and
HLA class-II presentation. (C) HLA class-I cross-presentation of exogenous antigens derived via
endocytosis. β2M, Beta 2-Microglobulin; TCR, T- cell Receptor; ER, endoplasmic reticulum; TAP 1 and
TAP 2, transporter associated with antigen processing 1 and 2; CLIP, Class-II-associated invariant
chain peptide. Adapted from, Guermonprez P, et al. 2002, Heath WR and Carbone FR, 2001, Braciale
et al. 1987, Boesteanu A et al. 1998, and Kobayashi KS et al. 2012 (18, 20-22, 25)
7
1.2.3 T Cells
The generation and regulation of T-cell immune responses is directed by the HLA-
associated antigen processing and presentation, and recognition by the TCR. The
TCR plays an essential role in the development and selection of T cells with enough
TCR diversity while eliminating any TCR which may interact with self-peptides leading
to autoimmune and unwanted responses. Here we will concentrate on the α- and
β-chain derived TCR (αβTCR) development.
1.2.3.1 Thymic development
The lymphoid precursor cells move from the bone marrow to the thymus, where the
TCR is formed by the rearrangement of variable (V) segments with the joining (J)
and/or diverse (D) TCR gene segments (Figure 1.4) (26-28). This process of
recombination, transcription, splicing and translation, protein folding, and the formation
of the TCR heterodimer produces three unique variable regions within the TCR
molecule, the complementarity determining region (CDR) loops (26).
The three hypervariable CDR loops of both the α- and β-chains within the αβTCR are
essential in the interaction with the peptide-HLA complex. The CDR3 loop interacts
with the peptide in the peptide-HLA complex and its variability come from the D and/or
J gene segments rearrangement during recombination (Figure 1.4) (17, 28, 29). As
highlighted in Figure 1.5, the TCR CDR3 α-chain (Orange α3) interacts with the N-
terminus and the TCR CDR3 β-chain (Orange β3) with the C-terminus of a bound
peptide (17). The other variable regions within the TCR, the CDR1 and CDR2 loops,
are encoded within the V gene segments and interact with the HLA molecule in the
peptide-HLA complex, next to the peptide interacting CDR3 loops, with the CDR1 and
CDR2 loops on the TCR α-chain (blue α1 and α2) interacting with the HLA class-I α2
domain and the HLA class-II β1 domain and the CDR1 and CDR2 loops on the TCR β-
chain (Green β1 and β2) interacting with the HLA class-I and HLA class-II α1 domain
(Figure 1.5) (17, 30, 31). This rearrangement of TCR DNA and the variability in the
CDR regions allows for 1 x 1018 or greater different combinations for the αβTCR (17,
30, 31).
8
Figure 1.4: Germline DNA T-cell receptor (TCR) rearrangement, translation, splicing and transcription.
Variable alpha (Vα), Variable beta (Vβ), Joining alpha (Jα), Joining beta (Jβ), diverse beta (Dβ),
Constant alpha (Cα) and Constant beta (Cβ) DNA chains, adapted from Janeway CA et al. 2001 (26)
Figure 1.5: Peptide-loaded human leukocyte antigen (HLA) molecule (A) class-I and (B) class-II
complexes and T-cell receptor (TCR) complementarity-determining region (CDR) loop interactions.
CDR3 (Orange α3 and β3), CDR1 and CDR2 β-chains (Green β1 and β2) CDR1 and CDR2 α-chains
(Blue α1 and α2). Figure adapted from Cole DK, 2013 (17).
9
In the thymus, T-cell development leads to CD8+ / CD4+ double positive T cells which
express a mature αβTCR that interacts with the self-peptides presented by HLA class-I
or HLA class-II being expressed on the surface of the thymus cortical epithelial cells
(32-35). A double positive T cell which expresses a TCR that has either a high or low
affinity for the self-peptide being presented in a peptide-HLA complex undergoes
apoptosis. A TCR exhibiting an appropriate affinity for self-peptides presented on
either the HLA class-I or HLA class-II molecules, become single positive, naive CD8+
or CD4+ T cells, respectively. These single positive naive T cells then migrate out of
the medulla of the thymus to secondary lymphoid tissues such as the lymph nodes,
tonsils, spleen, Peyer’s patches and mucosa-associated lymphoid tissue (32-35).
1.2.3.2 Activation
Once in the secondary lymphoid tissue, a naive T cell becomes activated once it
interacts with the appropriate HLA-antigen presented by an APC, which has moved to
the secondary lymphoid tissue after encountering an antigen (Figure 1.6) (36-38).
Following activation, T cells undergo clonal expansion which produces numerous
activated effector T cells, expressing cell-surface molecules that allow them to leave
secondary lymphoid tissues and move to the site of inflammation (Figure 1.6). The
differentiation and effector functions of both, CD8+ T cells and CD4+ T cells, differ (39,
40). Effector CD4+ T cell or helper T (Th) cells direct immune responses by regulating
macrophages and B-cell antibody production, maintaining CD8+ T-cell responses, and
the recruitment and direction of innate response cells like neutrophils, eosinophils and
basophils to sites of infection and inflammation (41-43). The cytokine environment and
the initial antigen interaction dictates how the naive CD4+ T cell will differentiate into
one of several CD4+ Th cells, including Th1, Th2, Th17, regulatory T cells (Tregs),
Th22 or Follicular Th cells (41, 42, 44).
Effector CD8+ cytotoxic T cells migrate out of the secondary lymphoid organs and
move to the site of infection, interacting with cells expressing HLA class-I molecules
presenting specific antigen-peptides (41-43). Once an infected cell(s) is identified,
apoptosis is induced eliminating the infected cell. Effector T cells then undergo
apoptosis-dependent programmed contraction, an important phase in immune
homeostasis (41-43, 45). A small proportion of pathogen-specific T cells not
programmed for apoptosis will populate a pool of memory T cells, whose numbers are
sustained by low-level homeostatic proliferation (46, 47).
10
1.2.3.3 Memory
Memory T cells continue to act in a surveying manner, reacting when exposed to the
same specific antigen. Understanding into CD4+ memory T cell remains elusive when
compared to CD8+ memory T cells. CD8+ memory T cells are composed of central
memory T cells which remain in the secondary lymphoid organs, effector memory
T cells which circulate through non-lymphoid tissue, and the resident memory T cells
which remain in the tissue of the primary infection (Figure 1.6) (34, 48-50). Memory
T cells require a lowered activation threshold and do not require the same co-
stimulator signals governing naive T-cell activation (34).
Figure 1.6: Naive CD8+ T-cell activation, proliferation and clonal expansion. Tcm, central memory T
cells; Tem, effector memory T cells; Trm, resident memory T cells; DC, dendritic cells. Adapted from
Kaech S and Weiguo C, 2012 (51)
1.2.4 Heterologous Immunity
Heterologous immunity describes the immune response by antigen-specific memory
T cells from a previously encountered pathogen, cross-recognising, and influence the
immune response to a new or neo-antigen (52). Heterologous immunity uses a
restricted TCR repertoire directed at cross-reactive derived, subdominant epitopes
compared to homologous immunity in which a diverse TCR repertoire is directed at
specific epitopes maintained from primary infection (52). Heterologous immunity is
considered not as efficient and effective as homologous immunity, yet the severity and
course of infection may be reduced because of heterologous immunity (13, 14).
Diverging from normal immunity to a partial and non-protective immune response can
also result in altered immunopathology and even increased morbidity and mortality
(52, 53).
11
A considerable amount of evidence supports the heterologous immune model as a
mediator of organ transplant rejection (9, 10, 12, 16-19). Organ transplant offers the
unique circumstance where an abundance of neo-antigens, for which the host has no
tolerance to, are presented to the immune system and cross-recognised by pre-
existing HLA-restricted memory T cells, derived in response to and maintained by
prevalent viral infections, like those of the human herpesvirus (HHV) family, including
Herpes Simplex Virus-1 and Herpes Simplex Virus-2 (HSV-1 and HSV-2,
respectively), Epstein-Barr virus (EBV), and cytomegalovirus (CMV) (54-60).
1.3 Immunopathogenesis of Delayed
Immunologically Mediated-Adverse Drug
Reactions
Delayed IM-ADR involves a range of phenotypes of differing severity that are defined
by their clinical presentation. T cell-mediated reactions can often be defined by their
immunopathogenesis at a tissue level and by the effector cell involved. Stevens -
Johnson syndrome (SJS) / Toxic Epidermal Necrolysis (TEN) and drug reaction with
eosinophilia and systemic symptoms (DRESS) are among the severest of IM-ADR
with the former having up to 50% mortality (Table 1.1) (1, 2, 61, 62).
In SJS/TEN patients develop a widespread erythematous rash with flat or macular
atypical targets and bullae blisters with sections or sheets of the epidermis separating
from the dermis (2, 62-64). The spectrum of severity includes the percentage of body
surface epidermal detachment associated with bullae blister development. SJS
involves extensive small blisters with less than 10% epidermal detachment, SJS-TEN
overlap 10–30% epidermal detachment, and TEN involves greater than 30%
epidermal detachment (Table 1.1) (2, 62-65). In SJS/TEN short-term complications
include organ involvement and sepsis and longer-term complications involve the eyes
(adhesions or blindness), loss of nails, adhesions and structures throughout the
respiratory, gastrointestinal and urogenital tract and neuropsychiatric complications
including post-traumatic stress disorder and depression (Table 1.1) While only 0.4-6
incidences of SJS/TEN occur per million persons per year, SJS/TEN is a severe, life-
threatening ADR, with mortality rates ranging from 5 to 12.5% for SJS and 30 to 50%
for TEN and is associated with over 200 different drugs including several antiepileptic
drugs like carbamazepine (CBZ) (Table 1.1) (2, 63, 65, 66).
12
DRESS has a longer latency period than SJS/TEN with the first manifestation being
fever, followed by a rash of varying severity and involvement of organs such as the
liver. Besides fever, rash and organ involvement, other symptoms include
lymphadenopathy and haematological abnormalities including eosinophilia and/or
lymphocytosis (Table 1.1). Up to 80% of DRESS cases involve the liver. However,
DRESS can also include kidney damage (40%), and/or the lungs, heart, and the
pancreas (67). Symptoms appear within a two- to eight-week window after starting the
culprit drug and can persist after drug discontinuation or withdrawal (2, 68-70). Like
SJS/TEN, DRESS is associated with numerous drugs including the antiretroviral
(ARV) medication, nevirapine (NVP) (Table 1.1)
Despite not being a SCAR, delayed rash or maculopapular eruption (MPE) deserves a
brief mention (Table 1.1). Delayed rash often presents as macules or papules
erythematous, without other systemic features, appearing on the face and torso,
before becoming generalised (71, 72). Delayed rash has been associated with many
drugs, including NVP and CBZ, and symptoms appear at the end of the first week or
beginning of the second week of treatment with the culprit drug (Table 1.1) (71, 72).
Delayed drug-rash reactions have been associated with drug-viral interactions, for
example, the interaction between aminopenicillins and EBV (73).
In the last decade, the association between HLA alleles and severe delayed
IM-ADR has led to a greater understanding into the immunopathogenesis of these
diseases and the ability to use these specific HLA alleles as biomarkers. This began
with the association between HLA-B*57:01 and abacavir (ABC) associated
hypersensitivity syndrome (HSS) (Table 1.1).
13
Table 1.1: Delayed IM-ADR and their significant features. Adapted from Rive C et al. 2013, Phillips EJ
et al. 2010, and Pavlos R et al. 2012 (2, 67, 74)
HSR / IM-ADR
Time onset
Symptoms/features Associated drugs
Delayed Rash / MPE
end of first week or beginning of second week of treatment
Maculopapular rash appears on the face / torso, becoming generalised. No associated fever or systemic symptoms.
Antiepileptic drugs (including CBZ), aminopenicillins. antibacterial sulphonamides, ARV (NVP), Allopurinol
DRESS
2-8 weeks
Fever, rash, lymphocytosis (eosinophilia), lymphadenopathy, Liver / organ involvement. Viral reactivation of HHV6/7, EBV or CMV, 2 weeks or more. Possible delayed autoimmune disease.
Antiepileptic drugs (including CBZ),beta-lactam antibiotics, vancomycin, antibacterial sulphonamides, NSAIDs, and ARV’s (NVP)
ABC-HSS median 8 days
Fever, malaise, Gastrointestinal symptoms, 70% develop late mild to moderate rash. ABC rechallenge results in Hypotension, shock and even death.
ABC patients now screened for HLA-B*57:01
SJS/TEN 4-28 days (majority)
Skin detachment: SJS 1–10% body surface area SJS/TEN overlap 10–30% body surface area TEN >30% body surface area Fever and mucosal tissue involvement (precede rash), Hepatitis, jaundice, increased liver transaminases Eye involvement (post reaction complications), Gastrointestinal and respiratory manifestations, anaemia, lymphocytosis (neutropenia).
> 200 drugs Antiepileptic drugs (including CBZ, antibacterial sulphonamides, NSAID’s, ARV’s (NVP), and Allopurinol.
HSR, hypersensitivity reaction; MPE, maculopapular eruption; DRESS, drug reaction with eosinophilia and systemic symptoms; HSS, hypersensitivity syndrome; SJS, Stevens-Johnson syndrome; TEN, toxic epidermal necrolysis, HHV, human herpesvirus; EBV, Epstein-Barr virus; CMV, cytomegalovirus;, CBZ, carbamazepine; ARV, antiretroviral; NVP, nevirapine; NSAID, non-steroidal anti-inflammatory drugs.
1.3.1 Abacavir
ABC is a guanosine analogue ARV agent used in combination treatment of human
immunodeficiency virus (HIV). ABC is a nucleoside that inhibits the reverse
transcriptase enzyme, resulting in chain termination. Since the approval of ABC in
1998, 4-8% of patients receiving ABC would also experience the delayed IM-ADR,
now identified as ABC-HSS (67, 74, 75). The clinical presentation of ABC-HSS
includes symptoms such as fever, malaise, as well as respiratory and gastrointestinal
14
symptoms. (Table 1.1) (67, 68, 74, 76). A mild to moderate rash develops in 70% of
cases, which appears late in disease (Table 1.1) (67, 74, 76). White cell count
abnormalities like eosinophilia and hepatitis are uncommon (67, 68, 74). ABC-HSS
symptoms can appear within 36 hours to 6 weeks of ABC initiation, although most
cases occur within 2 weeks of first ABC exposure (74) The majority of ABC-HSS
symptoms are resolved within 72 hours of ABC discontinuation, when rechallenged
with ABC, patients experience extreme hypotension, shock and, even death (Table
1.1) (67, 68, 74, 76).
A genetic link to ABC-HSS was hypothesised with reports of a lowered frequency of
ABC-HSS in Asian and African populations. The report of ABC-HSS occurring in two
members of the same family added to this idea of a genetic association (67, 74, 76,
77). The association between HLA-B*57:01 carriage and ABC-HSS was reported by
two separate research groups. False positive clinical diagnosis minimised “true ABC-
HSS” in non-Caucasian patients where the carriage of HLA-B*57:01 is low (74, 76-78).
The specificity of ABC skin patch testing increased the negative predictive value of
HLA-B*57:01 in ABC-HSS to 100% (74, 79, 80). Further validation of the 100%
negative predictive value was seen in a case-controlled study called the Study of
Hypersensitivity to ABC and Pharmacogenetic Evaluation (SHAPE) (81). SHAPE
showed that both African (African-American) and Caucasian patients who tested
positive in patch tests all carried HLA-B*57:01 (74, 76-78). In a randomised clinical
trial, the Prospective Randomised Evaluation of DNA Screening in a Clinical Trail
(PREDICT-1), showed that screening for HLA-B*57:01 eliminated patch test positive
ABC-HSS patients and HLA-B*57:01 carriage has a 55% positive predictive value for
ABC-HSS (74, 76-79).
Figure 1.7 denotes how the genetic association of the HLA-B*57:01 allele with
ABC-HSS, lead to HLA-B*57:01 genetic screening in clinical practice and improved
treatment guidelines (Figure 1.7) (2, 78). The 100% negative predictive value
associated with HLA-B*57:01 in ABC-HSS showed that the underlying
immunopathogenesis of ABC-HSS is HLA-driven. The incomplete positive predictive
value of 55% associated with HLA-B*57:01 in ABC-HSS, suggests that
immunopathogenesis is driven by other factors, besides HLA-B*57:01 carriage.
A large body of experimental work supports the model that ABC-HSS is driven by
HLA-B*57:01-restricted, CD8+ T-cell response (2, 67, 82). CD8+ T-cell responses can
be seen in the peripheral blood mononuclear cells (PBMC’s) of HLA-B*57:01 positive,
15
ABC-naive Donors by culturing the cells and stimulating them with ABC-pulsed
HLA-B*57:01 transfected APCs (67, 82, 83). Changing a single amino acid in the
peptide-binding domain, like changing the serine at position 116 of the HLA-B*57:01
molecule, to a tyrosine, abolishes ABC-CD8+ T-cell recognition (67, 82, 83).
Virtual modelling data have provided insight into the underlying pathogenesis of HLA-
B*57:01-restricted ABC-HSS, by providing evidence that ABC binds non-covalently to
the peptide-binding cleft of HLA-B*57:01, altering its chemistry and shape (2, 68, 83-
85). The alteration of the peptide-binding cleft changes the repertoire of self-peptides
presented by HLA-B*57:01, from peptides with a tryptophan (W) or a phenylalanine (F)
at the C-terminus, to small aliphatic residue such as valine (V), alanine (A) or
isoleucine (I) at the carboxyl terminus (2, 68, 83-85). These altered peptides presented
when ABC is non-covalently bound to the peptide-binding cleft of HLA-B*57:01, were
not presented during T-cell thymic development and therefore a proportion of these
self-peptides are recognised by T cells of hypersensitive patients (2, 21, 87-89).
Figure 1.7: Abacavir (ABC) translational roadmap Showing how the discovery of the association
between HLA-B*57:01 carriage and ABC- HSS lead to the incorporation of HLA-B*57:01 genetic
screening into clinical practice. Figure adapted from Rive C et al. 2013 and Phillips EJ et al. 2011(2, 78).
16
1.3.2 Carbamazepine
An iminodibenzyl derivative, CBZ was developed in 1960 to treat trigeminal neuralgia
before the discovery of its antiepileptic properties (86). Besides its antiepileptic
properties and its ability to ease neuropathic pain accompanying diseases such as
Herpes Zoster (HZ), CBZ is used to treat a variety of “off-label” disease and conditions
including attention deficit hyperactive disorder, schizophrenia, bipolar disorder,
borderline personality disorder, phantom limb syndrome, and post-traumatic stress
disorder (87-91). The World Health Organization has placed CBZ on the essential
medication list due to its relative costs and multiple uses (92). CBZ-HSR include
maculopapular eruption and DRESS restricted to HLA-A*31:01 in Caucasian and other
ethnicities, however this body of research will concentrate on HLA-B*15:02-restricted
CBZ-SJS/TEN.
1.3.2.1 CBZ-SJS/TEN HLA associations
SJS/TEN is a rare disease with less than 10 in 10 thousand people experiencing the
disease. CBZ-specific SJS/TEN was found to have a strong association with the HLA-
B*15:02 allele in Han Chinese populations (19% of the world’s total population), where
the prevalence of the allele is approximately 10.2% (Figure 1.8) (2, 67). Similar to
ABC-HSS, studies have shown a negative predictive value of 99-100% for HLA-
B*15:02-restricted CBZ-SJS/TEN in Han Chinese populations (93-96). Unlike HLA-
B*57:01 and ABC-HSS, the positive predictive value of HLA-B*15:02 in CBZ-SJS/TEN
is lower (3.0-7.7%) (2). Given that 10.2% of Han Chinese carry the HLA-B*15:02 and
that 19% of the total world’s population (7.125 billion as of 2013) is of Han Chinese
ancestry, this places upwards of 4 to 9 million people worldwide at risk of experiencing
SJS/TEN reaction if given CBZ (97-99).
The CBZ-SJS/TEN-HLA-B*15:02 association has is significant in South and South-
east Asian populations where the HLA-B*15:02 allele frequency is high, with highest
incidence in Han Chinese (10.2%) and Taiwanese (10%) populations, while the
frequency of HLA-B*15:02 carriage in Hong Kong, Thailand, Malaysia, Vietnam,
Philippines, India, and Indonesia is 5% (2, 67, 100). The frequency of HLA-B*15:02 is
low in other populations, including African Americans (0.1-1%) and Caucasians (0.1%)
(2, 67, 100). There is an identified association with other derivatives of CBZ like
oxcarbazepine, and a weaker association between HLA-B*15:02-SJS/TEN and other
Antiepileptic drugs like phenytoin, and lamotrigine.
17
Figure 1.8: The frequency of HLA-B*15:02 allele carriage most prevalent in those of South and South-
east Asian ethnic groups. (2, 67, 100)
Based on the strong negative predictive value associated with CBZ-SJS/TEN and the
carriage of HLA-B*15:02 in South and Southeast Asians, the Food and Drug
Administration (USA) and similar regulatory agencies of different countries have
recommended that genetic screening for HLA-B*15:02 in those of South and South-
east Asian ancestry before CBZ therapy and that all HLA-B*15:02 carriers, should not
be administered CBZ, unless the benefits outweigh the risks (101).
Besides the HLA-B*15:02 allele association, other B75 serotype HLA alleles, including
HLA-B*15:08, -B*15:11, and -B*15:21, have been associated with CBZ-SJS/TEN, in
different populations, with the rationale being that the B75 serotype alleles share high
amino acid sequence homology that may resemble structural features of HLA-B∗15:02
and therefore may trigger a similar cutaneous adverse reaction to CBZ (102). Other
associations also include HLA-B*15:18, -B*59:01 and -C*07:04 (103-106).
Studies involving European and Japanese populations have suggested an association
between the HLA-A*31:01 allele and CBZ-SJS/TEN (107, 108). However, subsequent
studies involving both Taiwanese and European populations have shown a stronger
association between the HLA-A*31:01 allele and CBZ-DRESS / CBZ-MPE reactions
and only a weak to insignificant association with CBZ-SJS/TEN (107-110). This
inconsistency with HLA-A*31:01 might be due to several factors and stresses how
important it is to define the clinical presentation of delayed IM-ADR phenotypes and
eliminating false positive clinical diagnosis, which was clear in the association between
HLA-B*57:01 and “true” ABC-HSS (75).
18
The high negative predictive and incomplete/low positive predictive values associated
with carrying an at-risk HLA allele, like HLA-B*15:02 shows that while specific HLA
allele carriage is a necessary factor, it alone does not explain drug-SJS/TEN
immunopathogenesis.
1.3.2.2 Other factors driving CBZ-SJS/TEN
immunopathogenesis
Immune cells
Multiple studies have emphasised the prominence of T cells found in the blister fluid of
SJS/TEN patients (111-114). In early stages, CD8+ cytotoxic T cells are found in blister
fluid and epidermal layers of the skin, while CD4+ T cells are found in the dermal
layers of the skin (115). This contradicts the common finding that CD4+ T cells are
commonly found early in allergic reactions involving the epidermis, and not CD8+ T
cells (115). An increase in the interleukin (IL)-2 associated, soluble IL-2 receptors
within patient blister fluid and serum further support the role of CD8+ T cells in
SJS/TEN, as they are a marker for activated T cells and levels correlate to disease
activity (111, 113). Activated T cells expressing the cutaneous lymphocyte antigen skin
homing receptor, are elevated in the peripheral blood of patients with SJS/TEN, which
also correlates to disease activity and returns to normal with disease resolution (111,
113, 114).
Other immune cells found in the epidermis of SJS/TEN patients include natural killer
(NK) cells and natural killer T (NK-T) cells which can be identified in the blister fluid of
SJS/TEN patients (111, 116). Several pathogenic models highlighting the role of CD8+
cytotoxic T cells, NK, and NK-T cells in inducing the keratinocyte death seen in
SJS/TEN have been published (63, 111, 117). These models have theorised that the
death of keratinocytes is triggered through the various cellular apoptotic mechanisms.
More recent evidence suggests the cytotoxic effector molecule granulysin is involved
in the disseminated keratinocyte death in SJS/TEN (117).
Granulysin
Granulysin is a novel effector molecule that exhibits cytotoxic activity against several
pathogens and tumours, while also possessing chemoattractant and proinflammatory
abilities. (118-125). The cytotoxic effector molecule granulysin can be expressed by
several cells, including CD8+ cytotoxic T cells, CD4+ cytotoxic-like T cells, NK cells and
NK-T cells (2, 119, 125-127). Granulysin is a useful transplantation biomarker as
granulysin expression in-situ is a marker for acute rejection and steroid resistance
19
(128). Granulysin is also an important cytotoxicity mediator in several skin diseases
besides SJS/TEN including acne, psoriasis and folliculitis (119, 125, 129-132). CD4+
memory T cells that express granulysin are candidate marker in Mycobacterium
tuberculosis infection (119, 133).
Studies have shown that the 15kDa form of granulysin, found within the epidermal
blister fluid of SJS/TEN patients, show a similar cytotoxicity to the 9kDa form secreted
by both NK cells and CD8+ T cells (93, 103, 117). Exposing a mouse model to the
15kDa form of granulysin induces considerable cutaneous blistering and necrosis in
the mouse. These findings show that higher levels of extracellular secretory 15kDa
granulysin can lead to a rapid development of epidermal necrosis. It has also been
shown that the lower granulysin concentrations found in SJS lesions is due to an
increase in mononuclear cell infiltration when compared to the granulysin
concentrations of TEN lesions (93, 103, 117). This observation would explain the
observations in SJS/TEN histopathology, showing that infiltration of sparse dermal
mononuclear cells results in extensive epidermal necrosis (93, 103, 117).
In 2014, a case study of one patient with lamotrigine-induced TEN, HLA types
unknown, showed an increase CD56+ NK cell granulysin expression, when the
patients PBMC’s were exposed to lamotrigine ex-vivo over a four-day period (134).
Another finding by Porebski et al. 2013 showed an increase in granulysin expression
by CD4+ memory T cells from patients with lamotrigine-induced SJS/TEN when
exposed to lamotrigine ex-vivo (135). Chung et al. 2015 produced evidence that
besides HLA-B*58:01 carriage, oxypurinol-induced granulysin expression in T cells
contribute to the immunopathogenesis in allopurinol-SJS/TEN (116)
Granulysin is an important biomarker in the diagnosis and progression of SJS/TEN. A
robust granulysin-specific assay would offer further insight into drug-SJS/TEN
immunopathogenesis, which could be translated into clinical practice helping to better
predict and reduce incidences of drug-SJS/TEN.
1.3.3 Nevirapine
The ARV drug NVP is a non-competitive reverse transcriptase inhibitor that has been
effective in HIV treatment. The use of NVP as a prophylactic has proven to be
successful in reducing mother to child vertical transmission rates of HIV-1 in lower
socio-economical populations (136, 137). NVP is also effective in salvage regimens
after virological failure, especially in those who have not taken non-nucleoside reverse
transcriptase inhibitors. Approved for use in combination with dual nucleoside reverse
20
transcriptase inhibitors, NVP is listed on the List of Essential Medications by the World
Health Organization (92).
1.3.3.1 NVP-SCAR and HLA allele associations
NVP has been associated with inducing several IM-ADR, including delayed rash, the
more severe cutaneous reactions DRESS and SJS/TEN. NVP-SCAR
immunopathogenesis is driven by both CD8+ T-cell / HLA class-I responses and CD4+
T-cell /HLA class-II responses. Studies have shown that the response to NVP, ex-vivo
can be abrogated by removing CD8+ or CD4+ T cells (138). The ex-vivo NVP-
stimulated responses diminish over time after first in-vivo reaction/exposure. The
primary focus of this work will be on the diversity and complexity of HLA alleles
associated with NVP-SCAR phenotypes while exploring this diminished ex-vivo
responses associated with NVP-DRESS.
Up to 5% of patients who start NVP will experience a DRESS reaction (138-141). An
increased risk of NVP-DRESS has been associated with the HLA-DRB1*01:01
coupled with CD4+ T cells greater than 25% (CD4+ T-cells counts > 250 cells/μL in
women and > 400 cells/μL in men) (Table 1.2) (74, 142). While not a SCAR, NVP and
efavirenz delayed rash was observed in French patients who carried the HLA class-II
allele, HLA-DRB1*01 (Table 1.2) (143, 144). A study involving a South African cohort,
found that carriage of the HLA class-II allele HLA-DRB1*01:02 and the HLA class-I
allele HLA-B*58:01 was associated NVP-hepatotoxicity (Table 1.2) (145).
HLA class-I allele associations to NVP-DRESS include HLA-Cw*8 in an Italian cohort
and the HLA-Cw*8 / B*14 haplotype among the Japanese (Table 1.2) (146, 147). The
HLA-C*04 allele was shown to increase the risk of NVP-DRESS in the Han Chinese.
The HLA-B*35:01 and HLA-B*35:05 alleles were a significant risk factor for NVP-
DRESS in Caucasian and Asian populations, respectively (Table 1.2) (138, 148-150).
Again, the NVP-delayed rash, while not a SCAR reaction has also been linked to the
carriage of, HLA-C*04 and HLA-B*35:05, in Asian populations (Table 1.2). (144, 151-
153) NVP-SJS/TEN accounts for less than 1.5% of NVP-HSR (67, 76, 154). In terms
of SJS/TEN, a recent study has shown that carriage of the HLA-C*04:01 allele
increased the risk of NVP-SJS/TEN in a Malawian cohort (Table 1.2) (155).
Table 1.2: Genetic (HLA alleles) and tissue specificity variation seen in different ethnic groups
associated with the NVP-HSRs. Table adapted from Rive C et al. 2013 and Phillips EJ et al. 2011(2,
150)
21
IM-ADR Ethnic association Genetic association (HLA)
DRESS
Rash associated hepatitis CD4+ > 25% in Caucasians
DRB1*01:01 and DRB1*01:02
Italian (Sardinian) Cw8-B*14 haplotype
Japanese Cw8
Han Chinese Cw*4 and DRB1*15
Asian B*35:05
Australian (Caucasian)
B*35:01, B*15-DRB1*15
Delayed rash
French population DRB1*01
African, Asian, European and Thai Cw*04
Thai B*35:05, rs1756*G CCHCR1 (GWAS)
DILI South African B*58:01
SJS/TEN African HLA-C*04:01(needs confirmation)
IM-ADR; Immunologically mediated-adverse drug reaction, DRESS, drug reaction with eosinophilia and systemic symptoms; DILI; drug-induced liver injury, SJS, Stevens-Johnson syndrome; TEN, toxic epidermal necrolysis, GWAS; genome-wide association study.
1.4 Established Models of HLA-driven delayed
Immunologically Mediated-Adverse Drug
Reactions
As highlighted earlier, specific HLA alleles, like HLA-B*15:02 in
CBZ-SJS/TEN in Southeast Asians and HLA-B*57:01 in ABC-HSS have a negative
predictive value of 100%. How these specific HLA alleles and drugs interact to elicit
T cell-mediated immune responses, leading to the associated IM-ADR phenotypes
described above is still an area of debate. Three hypotheses or models have been
proposed to explain HLA-driven delayed IM-ADR and possible that no single
hypothesised model is mutually exclusive. These three HLA-drug-binding models
proposed include the hapten/prohapten model, the pharmacological interaction (P-I)
model, and the altered peptide repertoire model (67, 74, 76, 156).
22
1.4.1 The Hapten / Prohapten Model
The hapten/prohapten model involves drug (or a metabolite) modifying host proteins to
creating a neo-antigen (Figure 1.9). The hapten model features chemically reactive
drugs covalently binding to high molecular weight proteins, forming a hapten-protein
complex (67, 157, 158). This modification can affect any autologous protein, including
extracellular, intracellular, and membrane-bound proteins. The hapten-protein
complexes are then processed and presented by the HLA molecule on the surface of
the cell forming a stable HLA-hapten-peptide complex (67, 157, 158). The location,
nature, and amount of the proteins modified influence the IM-ADR, leading to several
immune responses. The prohapten extension to the hapten model was used to explain
how chemically inert drugs can still elicit a delayed IM-ADR. The prohapten model
involves the metabolism of the inert parent drug into a reactive metabolite which then
becomes antigenic through the process mentioned.
1.4.2 The Pharmacological Interaction Model
The Pharmacological Interaction (P-I) model proposes that a non-covalent interaction
between the culprit drug and TCR / HLA molecules can activate certain T cells (Figure
1.9) (67, 74, 76, 156). This reversible reaction is comparable to the interaction of a
ligand with its receptor. Evidence of this P-I model exists in observations of aldehyde-
fixed APCs which cannot process or present any peptides but still have the ability to
activate specific T-cell clones (159-161).
1.4.3 The Altered Peptide Repertoire Model
The altered peptide repertoire model can be considered a refinement of the P-I model.
In-silico modelling has shown how certain drugs can to fit into an “empty” HLA
molecule, through a non-covalent bond to key residues and the occupation of anchor
sights within the HLA peptide-binding groove (2, 83-85, 162). This non-covalently
binding and occupation of anchor sites within an “empty” HLA protein, alters the
repertoire of peptides capable of binding within the drug-modified HLA (2, 83-85, 162).
Memory CD8+ T-cell responses derived from HLA-B*57:01-restricted EBV epitopes,
can also recognise endogenous ABC-HLA-B*57:01-restricted endotopes (83).
Evidence supporting this model comes from three independent studies that put
23
forward that the altered peptide repertoire model is the underlying mechanism in
ABC-HSS (83-85).
1.4.4 The Heterologous Immunity Model
The interactions of drugs with specific HLA alleles can be explained by neo-antigen
generation through the hapten/prohapten, the P-I and/or the altered peptide repertoire
models (Figure 1.9). These off-target interactions with specific HLA molecules or HLA-
presented peptides are not enough to explain several factors identified with various
delayed IM-ADR. For example, these models fail to explain how reactions can
sometimes manifest within days after the first drug exposure or the long-lasting
memory T-cell responses in drug-induced SJS/TEN and ABC-HSS reactions, for
example. The models fail to explain why different drug-HLA allele combinations can
produce different IM-ADR phenotypes, for example, why ABC-HLA-B57:01-HSS
differs from CBZ-HLA-B*15:02-SJS/TEN which differs again from the varied IM-ADR
phenotypes associated with NVP.(68)
The hapten/prohapten, the P-I and/or the altered peptide repertoire models fail to
account for the complete negative predictive value and low or incomplete positive
predictive values associated with carrying an at-risk HLA allele. This suggests that
while carrying an at-risk HLA allele is necessary, it alone does not explain the
immunopathogenesis. The heterologous immune model attempts to explain the
shortcomings.
Similar to organ transplantation, IM-ADR presents a novel situation in which neo-
antigens are created through one of the three HLA-drug-binding models, as described
earlier. Organ rejection is mediated by pre-existing HLA class-I–restricted effector
memory T-cell responses to prevalent viral infections (24, 54, 56, 59, 163-166). In this
setting memory T cells that interact with persistent viruses, for example, HHV
epitopes, may cross-react with neo-antigens are created through one of the three
HLA-drug-binding models (Figure 1.9) (68). Therefore, a pre-existing heterologous
immune response could decide whether an individual with a high-risk HLA allele
develops an IM-ADR. Heterologous immunity could also explain why IM-ADR can
manifest within days after the first drug exposure, and the variation in tissue specificity
and the long-lasting memory T-cell responses in drug-induced SJS/TEN and ABC-
HSS reactions, for example (68).
24
Figure 1.9: Graphical representation published by White et al., 2015 of the heterologous immunity
model with the three neo-antigen generating, HLA-drug binding models (A) hapten/prohapten model,
the (B) P-I model, and the (C) altered peptide repertoire model.(167)
1.5 Scope of this Thesis
A goal of IM-ADR research includes the ability to identify patients or specific
population(s) who is at risk of experiencing a drug-specific IM-ADR, before
administering the drug to prevent the resultant morbidity or mortality that could ensue.
To achieve this, an understanding of the immunopathogenesis underlying these
reactions is required. Both CBZ-SJS/TEN and NVP-SCAR are distinct clinical and
immunological syndromes, but they share are several significant similarities which
suggest that the underlying immunopathogenesis driving SCARs may share
commonalities. Both CBZ-SJS/TEN and NVP-SCAR offer important examples for the
immunopathogenesis of severe T cell-mediated drug reactions.
Chapter 1 has summarised ADR and delayed IM-ADR, a smaller subset of ADR,
driven by T cell-mediated immune responses. This chapter further explained the
reactions and interactions of T cell-mediated immunity before moving into what is now
known about immunopathogenesis of delayed IM-ADR. This chapter highlighted the
ABC-HSS example, before leading into the two drugs of interest, CBZ and NVP.
25
Following this, Chapter 2 will focus on the Materials and Methods utilised to discuss
the limitations to the established models of HLA-driven delayed drug hypersensitivity
and answer the hypotheses proposed in the following Chapters.
1.5.1 NVP-Induced HSR
NVP-HSR has been associated with a variety of HLA alleles. To understand the
immunopathogenesis driving NVP-HSRs, the question of varied tissue specificity and
HLA alleles are associated with NVP-HSR, needs answering. Chapter 3 will look at
examining two aspects of NVP-SCAR immunopathogenesis. HLA class-I alleles and
their binding cleft characteristics associated with NVP-SCAR and the diminishing
Gamma Interferon (IFN-γ) responses in NVP-stimulated, PBMC’s from NVP-DRESS
patients.
1.5.1.1 NVP-HSR and the shared HLA binding cleft specificities
The tissue specificity and varied HLA allele associations related to NVP-HSR might
be explained by the similarities in the HLA peptide-binding cleft structure and predicted
peptide/NVP-binding capabilities. Chapter 3 will analyse HLA class-I alleles identified
as statistically significant in NVP-SCAR and NVP-SCAR with hepatitis, within a cohort
of ethnically diverse, defined NVP-HSR cases and matched controls. HLA alleles will
be analysed to see if they share similarities in peptide-binding cleft structures by
grouping HLA alleles according to; shared key amino acid residues which make up the
HLA class-I binding cleft pockets (A-F), validated cross-reactive group (CREG) HLA
supertypes which groups HLA alleles based on similarities in cross-reactivity of public
epitopes among HLA class-I alleles and binding cleft pocket chemistry, and the
MHCcluster algorithm, which seeks to group HLA molecules based on their peptide-
binding (pb-) specificity as predicted by NetMHCpan 2.8 (168-172). Confirmation of the
HLA shared binding cleft specificities would explain many outstanding observations
regarding T cell-mediated delayed NVP-HSR including the low or incomplete
negative/positive predictive values for the various HLA alleles already associated. This
approach could apply to other delayed IM-ADR which exhibits an association to a
varied number of HLA alleles.
26
1.5.1.2 Diminishing ex-vivo PBMC’s responses and NVP-HSR
Immunopathogenesis
Unlike several well characterised delayed IM-ADR, ex-vivo NVP-stimulated, PBMC’s
IFN-γ responses diminish over time after first in-vivo reaction/exposure. Keane et al.
2014 explored the hypothesis that in cases of the NVP-SCAR DRESS phenotype, the
diminishing NVP-stimulated, PBMC IFN-γ responses was due to an increase in CD4+
Tregs levels, during the recovery period of NVP- DRESS. This increase in CD4+ Tregs
levels has been reported in other drug-induced IM-ADR (173). In the paper by Keane
et al. 2014, one patient exhibited an increase in Tregs that corresponded with the
waning IFN-γ, Enzyme-Linked ImmunoSpot (ELISpot) responses (138). In this section
of the chapter, we will expand on this hypothesis. However, as most of the NVP-
DRESS patient PBMC’s samples had been used in the initial study by Keane et al.
2014, cytokine plasma profiles of the same NVP-DRESS patients, used in the Keane
et al. 2014, were analysed. It is expected that the cytokine environment within the
donor’s plasma, over the time course of a NVP-DRESS reaction and recovery period,
alongside the Keane et al. 2014 data, might show changes in specific T-cell
subpopulations further explaining the diminishing NVP-stimulated, PBMC IFN-γ
responses
1.5.2 Carbamazepine-Induced SJS/TEN
Toxic Epidermal Necrolysis unlike NVP-SCAR and their varied HLA allele
associations, a 100% negative predictive value has been linked with HLA-B*15:02
carriage among those of Han Chinese and South-east Asian ancestry and CBZ-
SJS/TEN (174). Chapter 4, Chapter 5, and Chapter 6 will look at CBZ-SJS/TEN
immunopathogenesis. Chapter 4 and 5 will explore the hypothesis which states that
HLA-B*15:02-restricted CBZ-SJS/TEN is driven by memory T cells which expresses
the specific cross-reactive TCR, in a heterologous immune response, explaining the
tissue distribution of the clinical symptoms and the low or incomplete positive
predictive value associated with HLA-B*15:02-restricted CBZ-SJS/TEN.
1.5.2.1 CBZ-SJS/TEN and Herpes simplex virus
Chapter 4 involves assessing several in-silico derived HSV-1 and/or HSV-2, HLA-
B*15:02-restricted peptides, ex-vivo (186-190). Identifying HLA-B*15:02-restricted
peptides, shared and restricted to CBZ-SJS/TEN patients, is an essential step in
assessing the heterologous immune model as it relates to HLA-B*15:02-restricted
CBZ- SJS/TEN.
27
If a HHV-specific memory T cell is cross-recognising a neo-antigen created by one of
the three proposed HLA-drug-binding models, then it would stand to reason that the
immune response to the persistent pathogen should share similarities to the clinical
presentation of CBZ-SJS/TEN. Reactivation of HSV-1 and HSV-2 involve skin and
mucosal tissues. The skin and mucous membrane phenotype associated with HLA-
restricted CBZ-SJS/TEN might result from cross-reactive memory T cells primed for a
specific HSV epitope(s) and activated by the neo-antigen created by one of the HLA-
drug-binding models; the subsequent drug-related immune response becomes widely
distributed, resulting in expansive tissue involvement as seen in SJS/TEN. Besides the
persistent pathogen immune response sharing similarities to the clinical presentation
of SJS/TEN, the seroprevalence of the persistent pathogen within HLA-B*15:02
positive CBZ-SJS/TEN cases should differ from HLA-B*15:02 positive CBZ-tolerant
and naive populations.
1.5.2.2 CBZ-SJS/TEN and T-cell receptor clonotype
The highly variable TCR repertoire is defined through TCR gene rearrangement and
selection in the thymus also governed by HLA molecules, self-peptide repertoires, and
earlier exposure to pathogenic derived epitopes. Potentially dangerous TCR repertoire
may be selected in those with at-risk HLA alleles (175).
Ko et al. 2011 examined the CD8+ TCR repertoire in patients with CBZ-SJS/TEN
(176). The authors showed a T-cell repertoire containing the public sequences Vβ 25-
1*01 (Vβ 11s1) CDR3 CASSISGSY and CASSGLADVDN within the PBMC’s and
blister fluid of CBZ-SJS and CBZ-SJS-TEN overlap patients. Cellular based assays
have shown anti-Vβ-11 antibodies can block CBZ-associated cytotoxicity and both a T-
cell clonotype and transfectants, expressing a TCR with the Vβ 25-1*01 CDR3
CASSISGSY sequence and Vβ 25-1*01 CDR3 CASSISGSY, displayed cytotoxicity
against HLA-B*15:02 expressing APCs in the presence of CBZ (139). The authors
concluded that besides HLA-B*15:02 carriage, Vβ 25-1*01 CDR3 CASSISGSY and
CASSGLADVDN TCR expression could be another factor in HLA-B*15:02-specific
CBZ-SJS/TEN development (176).
Chapter 5 will involve developing methods and assays to assess before identified
specific Vβ CDR3 TCR sequence expression (161). The primary aim is to expand
CBZ-specific T cells and identify the expression of specific vβ CDR3 sequences using
the new and sensitive droplet digital (dd) polymerase chain reaction assay (PCR) (Bio-
Rad QX100/200 ddPCR system) (176).
28
1.5.2.3 Granulysin expression
Chapter 6 will look granulysin expression, another established factor in CBZ-SJS/TEN
immunopathogenesis and analysis granulysin expression in PBMC’s from patient
donors that had experienced a SJS/TEN reaction to CBZ. Cell-based assays have
shown that CBZ-SJS/TEN patient PBMC’s responses can be detected in PBMC’s
acquired years after CBZ withdrawal, further supporting the responses seen in-vivo
when a patient is rechallenged with CBZ. The overall aim is to characterise the cell
type that is expressing granulysin when re-exposed to pharmacological relevant doses
of CBZ ex-vivo to better understand CBZ-SJS/TEN immunopathogenesis.
1.5.3 Final Summary and Conclusion
Chapter 7 will summarise the findings within this body of work, highlighting the main
findings and offering recommendations and considerations for future research into the
underlying mechanisms governing both CBZ-SJS/TEN and NVP-HSR
immunopathogenesis. Chapter 8 includes the bibliography highlighting the associated
sources and references and the appendix is attached as Chapter 9.
29
Chapter 2
Methods and Materials
30
31
2 2.1 Samples, Ethics and Limitations
2.1.1 Nevirapine-Induced HSR
2.1.1.1 NVP-SCAR associated HLA class-I binding cleft
characteristics
Samples
Consenting participants from 11 countries (Argentina, Australia, Canada, France,
Germany, Netherlands, Spain, Taiwan, Thailand, United Kingdom and The United
States of America) were recruited for this study in collaboration with colleagues at
Vanderbilt University, School of Medicine and Boehringer Ingelheim. (ClinicalTrials.gov
NCT00310843). Cases were selected based on donors experiencing cutaneous and/or
hepatic symptoms 8 weeks after beginning NVP. Symptoms include:
1. NVP-induced severe cutaneous toxicity, characterised as a grade III or IV rash
(National Institute of Allergy and Infectious Disease, Division of acquired
immunodeficiency syndrome criteria) (149).
2. Acute hepatic failure or symptomatic grade 3 or higher hepatic transaminase
elevation (including aspartate transaminase and alanine transaminase) 5 times
or more upper limit of normal (149).
Cases and controls were excluded if donors had experience:
3. A CD4+ T-cell count of 150 cells/μL or lower 6 months prior to beginning NVP.
An acute viral hepatitis and/or no record of hepatic transaminase data 6 months
leading up to NVP initiation.
4. Received immunomodulatory drugs within the first 8 weeks of starting NVP
and/or was part of the two nucleoside analogue reverse transcriptase inhibitor
long-term study; Participants were given stavudine and lamivudine along with
either NVP and/or Efavirenz depending on test parameters (149, 177).
32
Ethical considerations and approvals
Project Title: The immunopathogenetic basis of nevirapine
hypersensitivity
Project No.: 2012/163 Murdoch University Human Research
Ethics Committee
Dates: 28 August, 2012 renewed until August 2015
Listed as: Student researcher
Limitations
Limitations included the incomplete nature of the initial demographic, phenotypic, and
sample information. Due to the study design, it was not possible to clarify any
ambiguous or unclear information. Prior to any analysis, the demographic, phenotypic,
and sample information for each donor was examined, organised, and confirmed
before being included. Several samples were excluded because; no sample was
available for HLA typing or issues with sample identity were identified (n=101) and
either no clinical data was reported (n=22) or ambiguous clinical data was reported
(n=62). The final analysis included 210 NVP-HSR cases (152 cutaneous adverse
events, 58 hepatic adverse events) with 468 controls.
2.1.1.2 Diminishing ex-vivo PBMC’s responses and NVP-HSR
Immunopathogenesis
Samples
Donor 1 (NVP-HSR), Donor 2 (NVP-HSR), and Donor 3 (NVP-HSR) were kindly
provided by The Institute for Immunology and Infectious Diseases, Murdoch
University, Perth, Australia. Patient 2, Patient 3 and Patient 4 used in HLA Class-I
Restricted CD8+ and Class-II Restricted CD4+ T Cells Implicated in the Pathogenesis
of Nevirapine Hypersensitivity, by Keane et al. 2014 (Appendix 9, Section 9.2
Publications Highlights), were renamed Donor 1 (NVP-HSR), Donor 2 (NVP-HSR),
and Donor 3 (NVP-HSR), respectively for this body of work (138).
Donor 1 (NVP-HSR), a Caucasian male (HLA-A*29:02, -A*31, -B*14:01, -B*44:03,
-C*08:02, -C*16:01, -DR*07:01:01) carried the HLA-B*14 / HLA-C*08 haplotype and
presented with rash, fever and eosinophilia two weeks after beginning a highly active
antiretroviral therapy (HAART) regime that included NVP, ABC, and lamivudine. Donor
1 (NVP-HSR) was positive for IgG to Varicella zoster virus (VZV), EBV, CMV, and
HHV-6 but showed no evidence of viral reactivation (no IgM).
Donor 2 (NVP-HSR), a 5-month-old infant with Asian ancestry (HLA-A*02:06,
-A*34:01, -B*1521, -B*5601, -C*04:03, -C*07:01, -DR*04:06, -DR*15:02), carried the
33
HLA-B*56:01 and HLA-C*04:03 alleles and experienced fever, rash, eosinophilia and
hepatitis on day 7 of a HAART regime containing NVP, ABC, and lamivudine. Donor 2
(NVP-HSR) at the time of NVP-HSR was only 2 months of age and was positive for
IgG to EBV, CMV and HHV-6 however, at 14 months of age only remained positive for
IgG to HHV-6, consistent with waning of passive immunity and lack of infection with
EBV and CMV. Donor 2 (NVP-HSR) showed tested negative for IgM and showed no
signs of an activated virus.
Donor 3 (NVP-HSR), Female of Asian ancestry (HLA-A*11, -A*24, -B*13:01,
-B*35, -C*03, -C*04, -DR*11, -DR*16), carried the HLA-B*35 and HLA-C*04 allele, and
presented with fever, rash, altered liver function and eosinophilia 14-15 days after
starting NVP and was immediately taken off NVP. Donor 3 (NVP-HSR) was positive
for IgG to EBV, CMV and HHV-6 but showed no evidence of viral reactivation (no
IgM). Donor 3 (NVP-HSR) also experienced a trimethoprim-sulfmethoxazole related
HSR, 2-3 months prior to the NVP HSR and showed evidence of elevated and
activated CD4+ and CD8+ T cells in a sample tested 1 month post NVP HSR compared
to a sample tested 4 months later.
Controls included several NVP-tolerant and NVP-naive donors.
Ethical considerations and approvals
Project Title: Pharmacogenomics and mechanistic basis of
drug hypersensitivity
Project No.: 2014/20 Murdoch University Human Research
Ethics Committee
Dates: 22 January, 2014 until December 2016
Listed as: Student researcher
Limitations
Limitations included sample size, an issue in much of research involving delayed IM-
ADR. Another limitation includes obtaining enough patient PBMC’s/plasma samples
from various time points pre, during and post NVP-HSR. The initial study by Keane et
al. 2014, required the majority of the NVP-DRESS patient PBMC’s, therefore we
decided to assess the cytokine plasma profiles of the same NVP-DRESS patients,
used in the Keane et al. 2014, to see if they show changes in specific T-cell
subpopulations further explaining the diminishing NVP-stimulated, PBMC IFN-γ
responses.
34
Table 2.1: List of samples used in Diminishing ex-vivo PBMC’s responses and NVP-HSR
Immunopathogenesis
Samples Drug HSR phenotype HHV serology HLA
Donor 1 (NVP-HSR)
NVP DRESS
VZV IgG+ EBV IgG+ CMV IgG+ HHV-6 IgG+
A*29:02, -A*31, -B*14:01, -B*44:03, -C*08:02, -C*16:01, -DR*07:01:01
Donor 2 (NVP-HSR)
NVP DRESS
At two months old EBV IgG+ CMV IgG+ HHV-6 IgG+ After 14 months of age HHV-6 IgG+ only
A*02:06, -A*34:01, -B*1521, -B*5601, -C*04:03, -C*07:01, -DR*04:06, -DR*15:02
Donor 3 (NVP-HSR)
NVP DRESS
EBV IgG+ CMV IgG+ HHV-6 IgG+
A*11, -A*24, -B*13:01, -B*35, -C*03, -C*04, -DR*11, -DR*16
Naive NVP controls
NVP-naive
- - -
NVP tolerant Controls NVP - - -
HSR, hypersensitivity reaction; NVP, nevirapine; DRESS, Drug rash with eosinophilia and systemic
symptoms; HHV, Human herpesvirus; VZV, Varicella zoster virus; EBV, Epstein-Barr virus; CMV, ; HLA,
Human leukocyte antigen.
2.1.2 Carbamazepine - Induced SJS/TEN
Carbamazepine SJS/TEN samples
Patients, who had experienced a CBZ-SJS/TEN reaction, gave informed consent to
use their blood and products within in this study. The Controls and Donors are listed in
Table 2.2, briefly: Donor 1 (CBZ-TEN), a female with South-east Asian ancestry (HLA-
A*11:01, -B*15:02, -B*58:01, -C*08:01, -C*03:01, -DRB1*12:02, -DRB1*03:01), carried
the HLA-B*15:02 allele and experienced a TEN reaction to CBZ.
Donor 1 (CBZ-TEN), diagnosed with HIV-1 infection, had also experienced an acute
HZ with post-herpetic neuralgia, which was managed with CBZ along with other
regular pain medications and NSAIDs. Within 9-14 days of CBZ initiation, Donor 1
(CBZ-TEN) developed symptoms including fever, elevated transaminase levels, and
cutaneous symptoms consistent with TEN. Donor 1 (CBZ-TEN) tested positive for IgG
to HSV-2 and negative to HSV-1 while produced a positive CBZ cutaneous patch test
35
response 9.5 years after the original CBZ-TEN reaction, and produces positive CBZ-
stimulated, ex-vivo responses 17 years after the original CBZ-TEN reaction.
Donor 2 (CBZ-SJS), a female of South-east Asian ancestry (HLA-A*11:01 -B*15:02, -
C*08:01, -DRB1*12:02 common haplotype with 11.6-19.7% frequency in Han Chinese
populations), carried the HLA-B*15:02 allele, tested positive for IgG to HSV-1 and
negative to HSV-2 and experienced a SJS reaction to CBZ (144).
Donor 3 (CBZ-SJS), a female of Caucasian ancestry (HLA-A*26:12, -A*02:05,
-B*15:02, -B*41:01 -C*08:01, -C*07:01, -DRB1*12:02, -DRB1*01:01), carried the HLA-
B*15:02 allele, tested positive for IgG to HSV-1 and HSV-2, and experienced a SJS
reaction to CBZ.
Donor 4 (CBZ-SJS non-B*15:02), a female of Caucasian ancestry (HLA-A*01:01
-A*32:01/24, -B*35:03, -B*51:01 -C*01:02, -C*04:01, -DRB1*01:01, -DRB1*13:02),
tested positive for IgG to HSV-1 and was retroactively diagnosed with an earlier SJS
reaction to CBZ. Donor 4 (CBZ-SJS non-B*15:02) did not carry the HLA-B*15:02
allele, but carried several delayed IM-ADR alleles including the NVP-SCAR associated
HLA-C*04:01 allele and other IM-ADR associated alleles.
Whole blood samples from healthy donors were obtained through the Australian Bone
Marrow Donor Registry. The donors had given informed consent. CBZ-naive donors
included;
Control 1 (CBZ-naive) carried the HLA-B*15:02 allele (HLA-A*02:03:01, -A*24:07,
-B*15:02, -B*56:01, -DRB1*04, -DRB1*09), was serologically positive for HSV-1 and
negative for HSV-2, and was CBZ-naive.
Control 2 (CBZ-naive non-B*15:02) did not carry the HLA-B*15:02 allele (HLA-A*02,
-B*15:11, -B*38, -DRB1*11, -DRB1*16:02:01), was serologically positive for HSV-1
and negative for HSV-2, and was CBZ-naive.
Control 3 (CBZ-naive) carried the HLA-B*15:02 allele (HLA-A*11, -A*33:03:01,
-B*15:02, -B*58, -DRB1*03, -DRB1*15) and was CBZ-naive. Control 3 (CBZ-naive)
was also serologically negative for HSV-1 and HSV-2.
Control 4 (CBZ-naive non-B*15:02) did not carry the HLA-B*15:02 allele (HLA-A*02 -
A*322012, -B*35:01, -B*51, -C*04:01, -DRB1*01:01, -DRB1*03:02) and was CBZ-
naive. The HSV serological status for Control 4 (CBZ-naive non-B*15:02), was
unknown.
36
Ethical considerations and approvals
Project
Title:
Pharmacogenomics and mechanistic basis of drug
hypersensitivity
Project No.: 2014/20 Murdoch University Human Research Ethics
Committee
Dates: 22 January, 2014 until December 2016
Listed as: Student researcher
Limitations
The limitations associated with sample size listed previously (Materials and Methods,
Section 2.1.1.2) also apply to CBZ-associated studies. A unique limitation with CBZ-
HSR samples includes the inability to get follow-up samples. Once a patient has
recovered from an SJS/TEN reaction, they are not required to return for ongoing
medical attention and as long as they avoid the culprit drug. This makes retaining
multiple Donor samples problematic. CBZ-tolerant, HLA-B*15:02 positive patients
have also been hard to obtain.
Table 2.2: List of samples used in CBZ-HSR immunopathogenesis associated studies.
Samples Drug HSR
phenotype HHV serology Other
Donor 1 (CBZ-TEN) CBZ TEN HSV-2 IgG +
Acute HZ and PHN
Patch test +
HLA-B*15:02 +
Donor 2 (CBZ-SJS) CBZ SJS HSV-1 IgG + HLA-B*15:02 +
Donor 3 (CBZ-SJS) CBZ SJS HSV-1 IgG + HSV-2 IgG +
HLA-B*15:02+
Donor 4 (CBZ-SJS
non-B*15:02) CBZ SJS HSV-1 IgG + Non-HLA-B*15:02
Control 1 (CBZ-naive)
CBZ-naive - HSV-1 IgG + HLA-B*15:02 +
Control 2 (CBZ-
naive non-B*15:02) CBZ-naive - HSV-1 IgG + Non-HLA-B*15:02
Control 3 (CBZ-naive)
CBZ-naive - Negative HLA-B*15:02+
Control 4 (CBZ-
naive non-B*15:02) CBZ-naive - Unknown Non-HLA-B*15:02
CBZ, carbamazepine; SJS, Stevens-Jonson syndrome; TEN, toxic epidermal necrolysis; HSR, hypersensitivity reaction; HHV, human herpesvirus; HZ, Herpes Zoster, PHN, post-herpetic neuralgia; HSV-1, Herpes simplex virus-1; HSV-2, Herpes simplex virus-2;
37
2.2 Cellular Assays
Table 2.3 List of reagents used in Stimulation and Expansion, flow cytometry, and Lymphoblastic cell
lines (LCL) generation assays. Flow cytometry antibodies are included on Table 2.4, tetramer reagents
included in Tables 2.5-2.7 and ELISpot associated reagents and materials are included in Table 2.8
Reagent Manufacture Catalogue Number
RPMI-1640 with phenol red Gibco 21-870-076
Foetal calf serum Invitrogen
Serana
C8056
S-FBS-AU-015
DNase Promega RQ1
L-glutamine Gibco 25030-081
Penicillin / Streptomycin Gibco 15-140-148
Sodium pyruvate Gibco 25030-081
Invitrogen Countess Invitrogen C10227
RNAlater stabilisation solution Life technologies AM2070
Recombinant human (rh) IL-2 R&D systems
Recombinant human (rh) IL-7 R&D systems 207-IL
Recombinant human (rh) IL-15 R&D systems 247-IL
Carbamazepine (CBZ) Sigma C4024
NVP Sigma
Boehringer Ingelheim
SML0097
Extracted from Viramune
Phosphate-buffered saline
(1 x PBS) Gibco 70013032
6-well flat-bottom culture plates BD Falcon 353046
12-well flat-bottom culture plates BD Falcon 353043
96-well U-bottom plate BD Falcon 353077
Brefelden A Sigma B7651
IsoFLOW Sheath fluid Beckman Coulter 8546859
IntraPrep Reagent kit Beckman Coulter A07802
Safe-Lock 1.5mL Eppendorf Tubes Crown Scientific 0030.120.086
Cryotubes Nunc Bank-It 374078
PE-streptavidin BD Biosciences 554061
BD Cytokine Bead Array (CBA) BD Scientific 560484
T-25 and T-75 culture flasks BD Falcon 353108 and 353136
0.45μm sterile filter with plunger Sigma CLS431225
Mycoplasma plus PCR primer kit Agilent 302008
Lectin Phytohemagglutinin (PHA-P) Sigma L8754
38
2.2.1 Drug Stimulation and Cellular Expansion
Day 0 - Cryopreserved PBMC’s were thawed and washed with RPMI-1640 media
(Gibco; Cat. No. 21-870-076) medium containing 10% heat-inactivated foetal calf
serum (FCS) (Invitrogen and Serana; Cat. No. C8056 and S-FBS-AU-015,
respectively) and 10U/mL DNase (Promega; Cat. No. RQ1) being added between the
first and second washes, as highlighted by Garcia-Piñeres et al. 2006) (178, 179).
PBMC’s were then resuspended in R10 media, which contained RPMI-1640 media,
10% heat-inactivated FCS, 1μM L-glutamine (Gibco; Cat. No. 25030-081), 50 U/mL of
penicillin, 50 μg/mL of streptomycin (1% v/v Gibco; Cat. No. 15-140-148), and 1μM
sodium pyruvate (Gibco; Cat. No. 25030-081) and incubated at 37°C overnight (Figure
2.1) (83).
Day 1 – recovery and viability of PBMC’s was determined by staining a 10μL aliquot of
PBMC’s with 0.4% Trypan Blue solution and counting cells via the Invitrogen Countess
method (Invitrogen; Cat. No. C10227). An appropriate aliquot of cells were removed
for pre-stimulation IFN-γ ELISpot, intracellular cytokine staining (ICS) and
immunophenotyping flow cytometry assays or stored in RNAlater stabilisation solution
(Life technologies; Cat. No. AM2070) until the Ribonucleic acid (RNA) extraction could
be performed.
10 million cells per mL (1 x 107 cells/mL) were resuspended in R10 media (Section
2.2.1, Drug Stimulation and Cellular Expansion) containing 50 μg/mL of recombinant
human (rh) IL-7 (R&D systems; Cat. No. 207-IL) (Figure 2.1). The cells were split into
three aliquots for control and test assays. R10 media (Section 2.2.1, Drug Stimulation
and Cellular Expansion), supplemented with 50 μg/mL of rhIL-7 containing and either
the control drug stimulant, or test stimulant (CBZ [Sigma; Cat. No. C4024]) was added
to the aliquots, giving a final stimulant concentration of 10 μg/mL, (unless otherwise
stated). For the unstimulated control, additional R10 media (Section 2.2.1, Drug
Stimulation and Cellular Expansion), supplemented with 50 μg/mL of rhIL-7 containing
was added to give the same final volume across all three aliquots (Figure 2.1). Cells
were than incubated at 37°C for 1-2 hours.
After stimulation, the cells were washed with a volume of cold RPMI-1640 media and
resuspended in R10 media (Section 2.2.1, Drug Stimulation and Cellular Expansion)
supplemented with 50 μg/mL of rhIL-7, giving a final concentration of 5 million cells per
mL (5 x 106 cells/mL). Cells were seeded into labelled wells of a 6- or 12-well flat-
39
bottom culture plates (BD Falcon; Cat. No. 353046 and 353043, respectively) and
incubated at 37°C for up to 48 hours.
Day 3 - 50% of the culture supernatant was removed and replaced with new R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion) supplemented with 50
μg/mL of rhIL-7 and with 50 μg/mL rhIL-15 (R&D systems; Cat. No. 247-IL). The
cultures were incubated at 37°C for another 48 hours.
Day 5 - Cultures were split, and cultures made up to the first volume by new R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion) containing rhIL-7 and
rhIL-15 as previously stated (Figure 2.1). The cultures were incubated at 37°C for
another 5 days.
Day 10 - cells were transferred to labelled 15 mL falcon tubes, washed and
resuspended in R10 media (Section 2.2.1, Drug Stimulation and Cellular Expansion).
The cultures were incubated at 37°C for another 4 days so they could stabilise.
Day 14 - cell viability and counts were performed and cells washed in RPMI-1640
media, centrifuged, and resuspended in the appropriate media for IFN-γ ELISpot, ICS
and immunophenotyping flow cytometry assays or stored in RNAlater stabilisation
solution until the RNA extraction could be performed (Figure 2.1).
40
Drug stimulation and cellular expansion protocol
Figure 2.1: Timeline of the stimulation and cellular expansion culture protocol for analysis of CBZ-
specific polyclonal T cells.
2.2.2 Flow Cytometry
The mutlicolour flow assays and reagent panel combinations were carefully selected
using spectralviewer anaylsis provided online by BD Biosciences (180). Instrament set
up controls inculded BD CompBeads (BD Biosciences, Cat. No. 644204). The
fluorescence minus one, single colour stained controls and unstained control methods
were also employed for compensation and adjusting photomultiplier tube voltages. All
flow cytometry experiments were analysed with specific biological controls like
unstimulated samples.
Removed cells from Liquid N2. Cells were thawed, washed, and resuspend in F10 media. Cells were rested overnight in the cellular incubator (37˚C with 5% CO2)
Cells were counted, washed, and aliquoted appropriately for -ICS, -ELISpot, -Storage in RNAlater stabilising solution for later RNA extraction and TCR analysis Remaining cells were aliquoted appropriately, washed and resuspended in rhIL-7-F10 media with the 10μg/mL of CBZ, control drug, or left unstimulated. After 1-2 hours of test/control stimulation, cells were washed, resuspended in rhIL-7-F10 media and incubated for 48 hours.
50% of the culture media was removed and replaced with rhIL-7-F10 media further supplemented with rhIL-15.
Cultures were split into 2 and the culture media replenished with rhIL-7-F10 media further supplemented with rhIL-15.
1 aliquot was stored in RNAlater stabilising solution. Remaining cells were washed, resuspended in F10 media, and rested in the cellular incubator for 48 hours. On day 12 this was repeated.
Cells were washed, counted, and resuspended in the appropriate media for ELISpot and ICS analysis.
41
Table 2.4: Flow cytometry Fluorochrome conjugated antibodies.
Immunogen Fluorochrome Exmax /Emmax
(nm)
Laser (nm)
Filter (nm) Cat. No
Anti – Human CD3
V450 405/448 405 450 BP *50 #560373
Anti – Human CD4
PE 496/578
488
575 BP *30 #340419
Anti – Human CD4
FITC 494/520
488
525 BP #340422
Anti – Human CD8
APC – H7 640/785
638
775 LP #641400
Anti – Human CD19
PE 496/578
488
575 BP *30 #555413
Anti – Human CD56
APC 650/660
638
660 BP *20 #555518
Anti – Human TCR α/β
APC 650/660
638
660 BP *20 +306718
Anti – Human IFN-γ
Alexa – 488 495/519
488
525 BP #557718
Anti – Human Granulysin (15- and 9 kDa)
Alexa – 488 495/519
488
525 BP #558254
BD Biosciences
CompBeads Multiple fluorochrome - Ig
κ anti-human Ab - - - #644204
*The number after the filter represents band width in nanometres (nm). #BD Bioscience and +Bio Legend Cat. No., catalogue numbers. BP, band pass filter; LP, long pass filter; EXmax, excitation maximum; Emmax, emission maximum.
2.2.2.1 Intracellular cytokine staining
Cryopreserved PBMC’s were thawed, washed, and resuspended in R10 media
(Section 2.2.1, Drug Stimulation and Cellular Expansion). Cells were incubated
overnight and viability and cell number determined. Cells were resuspended in R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion) giving a final
concentration of 0.5-1.0 x 107 cells/mL. Unlike the ELISpot and the Drug Stimulation
and Cellular Expansion protocols, R10 media (Section 2.2.1, Drug Stimulation and
Cellular Expansion) was not supplemented with cytokines as rhIL-2 and rhIL-15 have
been associated with the activation of granulysin expression within CD8+ T cells (181).
100 μL of cells were seeded into labelled wells of a sterile 96-well U-bottom plate (BD
Falcon; Cat. No. 353077). A further 80 μL of R10 media (Section 2.2.1, Drug
Stimulation and Cellular Expansion), either containing the appropriate test drug (CBZ)
or control drug was added to the 100 μL of cells, to obtain a final stimulant
concentration higher than 10 μg/mL, which would be rectified with the addition of
42
Brefelden A (Sigma; Cat. No. B7651). For the unstimulated control cells, 80 μL of R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion) was added. Cells were
incubated at 37°C for 2 hours, before adding 20 μL of Brefelden A giving a final
concentration 10 μg/mL. The cells were incubated at 37°C for 6 hours (unless
otherwise stated)
After incubation, the cells were washed with 200 μL of IsoFLOW Sheath fluid
(Beckman Coulter; Cat. No. 8546859) and the supernatant removed. The appropriate
cell-surface fluorochrome-conjugated antibodies, listed in Table 2.3 was added to the
cells and incubated in the dark (plate wrapped in aluminium foil) at 4˚C for 15 minutes.
Cells were then fixed and permeabilized using the IntraPrep Reagent kit, following the
protocol outlined by the manufacture (Beckman Coulter; Cat. No. A07802) (182).The
appropriate fluorochrome labelled cytokine antibody, was added and the cells
incubated at 24○C, in the dark (plate wrapped in aluminium foil) for 15 minutes (Table
2.3). Cells were washed and resuspended in 200 μL of IsoFLOW. Flow cytometry was
performed on the stained cells using the Gallios Flow Cytometer and the raw data
analysed using the Kaluza flow cytometry software.
2.2.2.2 Surface Marker staining and Immunophenotyping
Similar to the ICS flow cytometry assay (Section 2.2.2.1) The multicolour flow assays
and reagent panel combinations were carefully selected using spectralviewer anaylsis
provided online by BD Biosciences. Instrament set up controls inculded BD
CompBeads (BD Biosciences, Cat. No. 644204), fluorescence minus one and
unstained controls, and specific biological controls like unstimulated samples. Cells
were seeded into labelled wells, stained with cell-surface marker fluorochrome-
conjugated antibodies, listed in Table 2.3 and incubated on ice in the dark for 25-30
minutes. After incubation, the cells were washed and resuspended in 200 μL of
IsoFLOW reagent. Flow cytometry was performed on the stained cells using the
Gallios Flow Cytometer and the raw data analysed using the Kaluza flow cytometry
software.
2.2.2.3 Tetramers
Tetramer folding and construction
HLA class-I complex folding mixture was made as outlined in Table 2.4 and by Leisner
et al. and Svitek et al. (183, 184). The β2M and B*1502 reagents were supplied by our
colleagues and made as outlined in Leisner et al. and Svitek et al. (183, 184). After
incubating the HLA class-I complex folding mixture for 48 hours at 18-24 C, it was
43
filtered through a 0.5 mL 100kD membrane spin filter by centrifuging at 15,000 relative
centrifugal force (RCF) or 14245 revolutions per minute (RPM) (FX241.5P rotor in
Microfuge 16) for 2 minutes at 4-6◦C.
The folded peptide/HLA class-I complex was taken through tetramer production
process. 100 μL of the peptide/HLA class-I complex was added to separate labelled
sterile Safe-Lock 1.5mL Eppendorf Tubes (Crown Scientific; Cat. No. 0030.120.086)
and streptavidin-PE (1.85 μM BD Bioscience; Cat. No. 554061) was added in
sequential aliquots as highlighted Table 2.6 with a final concentration of streptavidin-
PE being 4.10% of the starting peptide/HLA class-I complex volume. The PE-
tetramers were aliquoted into labelled cryotubes (1 mL, Nunc Bank-It; Cat. No.
374078) at a smaller working volume of 10-20 μL to limit the amount of freeze/thawing
and stored at -80’C until required.
Table 2.5: Tetramer folding mix.
Reagents Stock Conc. (μM) Final Conc. (μM) Volume (μL) x1 reaction
Sterile deionised H2O - - 294
Tris/maleate (pH 6.6)
6 1 67
Lutrol (F68) 1 0.03 12
*Protease inhibitors 100 1 4
Peptide 500 6 5
β2M (FN345-346) 80.6 3 15
B1502 (FN286) 32.7 0.3 37
Total - - 400
*Outlined in Table 2.4 μM, micromolar; μL, microliter; β2M, Beta 2-2-Microglobulin; B1502, light chain B*15:02 sequence
Table 2.6: Protease inhibitor mix.
Protease inhibitor mix (100x concentration) Volume (μL)
Sterile deionised H2O 37.50
EDTA 14.80
Pepstatin A 4.80
1,10- phenantroline 4.80 NEM 7.40 TLCK 1.30
TPCK 1.30
PMSF 2.10
Total volume 74.00
EDTA, Ethylenediaminetetraacetic acid; NEM, N-Ethylmaleimide; TLCK, Tosyl-L-lysine chloromethyl ketone; TPCK, Tosyl-L-phenylalanine chloromethyl ketone; PMSF, Phenylmethanesulfonylfluoride; μL, microliter.
44
Table 2.7: Addition of streptavidin-PE labelled to peptide/HLA class-I complex.
Time (minutes) Volume of streptavidin-PE (1.85 μM) added to 100 μL of peptide/HLA class-I complex
0 1.2 μL
15 0.60 μL
25 0.60 μL
35 0.60 μL
45 0.60 μL
55 0.60 μL
Total streptavidin-PE 4.10 μL
μM, micromolar; μL, microliter; PE, phycoerythrin; HLA, human leukocyte antigen
Tetramer staining
Tetramer staining followed the same basic flow cytometry protocol seen in Section
2.2.2.2 Surface Marker staining and Immunophenotyping, with the exception that 5 μL
of the PE-tetramer was added and the cells incubated in the dark (plate wrapped in
aluminium foil) at 24 C for 20 minutes before the cells were stained with appropriate
cell-surface fluorochrome-conjugated antibodies, listed in Table 2.3 to the appropriate
samples. Once stained, cells were washed and resuspended in 200 μL of IsoFLOW
reagent. Flow cytometry was performed on the stained cells using the Gallios Flow
Cytometer and the raw data analysed using the Kaluza flow cytometry software.
2.2.2.4 Cytometric Bead Array cytokine assay
The Cytometric Bead Array (CBA) Th1/Th2/Th17 kit (BD Scientific; Cat No. 560484)
included capture beads for the cytokines; IL-2, IL-4, IL-6, IL-10, TNF, IFN-γ, and IL-
17A, each of which has a unique fluorescence intensity so that beads can be mixed
and the assay performed in a single tube. This assay was performed on plasma
samples, as outlined by the manufacture. Plasma samples were serial diluted with the
supplied assay diluent, to find the optimal plasma to assay diluent ratio. The optimal
dilution factor was 1:4; also the manufactures recommended dilution factor for serum
based samples.
45
2.2.3 Enzyme-Linked ImmunoSpot
Table 2.8 List of reagents and materials used in ELISpot assay.
Reagent Manufacture Catalogue Number
MutliScreen-IP Hydrophobic PVDF
sterile Filter ELISpot Plate(s) Mabtech
MAIPS4510
anti–IFN-γ antibody Mabtech 1-D1k
Dimethyl sulfoxide (DMSO) Sigma 472301
N-N-Dimethylformamide (DMF) Sigma 140732
Anti-human CD3 monoclonal
antibodies Mabtech 3605-1-50
CEF peptide pool Mabtech 3615-1
Staphylococcal enterotoxin B (SEB) Sigma S4881-1MG
anti–IFN-γ biotinylated antibody Mabtech 7-B6-1
streptavidin-HRP Mabtech 3310-9
3’, 3’, 5’, 5’-tetramethylbenzidine (TMB) Mabtech 3652-R10
AID automated microplate ELISpot
reader and associated software AID V 5.0 - B7337
2.2.3.1 ELISpot assay
IFN-γ ELISpot assay was performed following the manufacturer’s instructions (R&D
Systems). Cells were resuspended in R10 media (Section 2.2.1, Drug Stimulation and
Cellular Expansion) supplemented with 10U/mL of rhIL-2 at 2x106 cells/mL. The 2x105
cells (100 μL), in duplicate/triplicate, were seeded into the appropriate wells of a
MultiScreen-IP, Hydrophobic PVDF Sterile Filter ELISpot Plate(s) (Mabtech; Cat No.
MAIPS4510), coated with 2 μg/mL of anti–IFN-γ antibody (Mabtech; Cat. No. 1-D1k),
then incubated overnight or for a minimum of 18 hours, at 4°C and blocked with R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion).
Negative controls included the unstimulated controls in which 100 μL of R10 media
(Section 2.2.1, Drug Stimulation and Cellular Expansion) supplemented with 10U/mL
of rhIL-2 was added to the seeded cells. The solvent controls included adding 100 μL
of R10 media (Section 2.2.1, Drug Stimulation and Cellular Expansion) supplemented
46
with 10U/mL of rhIL-2 media containing Dimethyl sulfoxide (DMSO) /
Dimethylformamide (DMF) (Sigma; Cat No. 472301 and 140732, respectively), giving
a final concentration 0.1 μL/200 μL. The negative controls were performed in triplicate
(unless otherwise stated).
The positive controls (duplicate) included, adding 100 μL R10 media (Section 2.2.1,
Drug Stimulation and Cellular Expansion) supplemented with 10U/mL of rhIL-2 with
Anti-human CD3 monoclonal antibodies (Mabtech; Cat. No. 3605-1-50), giving a final
concentration of 0.1 μg/mL per well. Secondary positive controls included 100 μL R10
media (Section 2.2.1, Drug Stimulation and Cellular Expansion) supplemented with
10U/mL of rhIL-2 with 1 μg/mL of either CEF peptide pool (Mabtech; Cat. No. 3615-1)
or Staphylococcal enterotoxin B (SEB) (Sigma; Cat No. S4881-1MG).
Drug-stimulated IFN-γ ELISpot assays involved control drugs (acyclovir) and the drugs
being analysed, CBZ or NVP (Sigma; Cat. No. SML0097 or Boehringer Ingelheim;
VIRAMUNE 200mg immediate release tablets (Appendix 9, Section 9.1 Nevirapine
isolation from Viramune tablets)). Drugs and synthesised peptides were stored in
DMSO or DMF at a stock concentration of 10 mg/mL were diluted with R10 media
(Section 2.2.1, Drug Stimulation and Cellular Expansion) supplemented with 10U/mL
of rhIL-2 and added (in triplicate) to seeded cells, to give a final concentration of 10
μg/mL (unless otherwise stated).
After incubation, ELISpot plates were washed with sterile Phosphate-buffered saline (1
x PBS) solution (Gibco, Cat. No. 70013032) and incubated with anti–IFN-γ biotinylated
antibody (Mabtech, Cat. No. 7-B6-1) for 2 hours. After incubation with the anti–IFN-γ
biotinylated antibody, ELISpot plates were washed, and incubated for 1 hour with
streptavidin-HRP (Mabtech, Cat. No. 3310-9), and then washed again. Plates were
substrated for 8-12 minutes using the 3’, 3’, 5, 5’-Tetramethylbenzidine substrate
(Mabtech, Cat. No.3652-R10). Once the plates were air-dried, counts were evaluated
with an AID automated microplate ELISpot reader and associated software (AID
ELISpot Version 5.0, B7337). The AID reader was staged, calibrated, and set to the
manufactures default settings. Files were saved as raw images and a PDF file was
created using the Nitro PDF created with the details of the time, date, cytokine being
analysed, media used, and the sample(s) identifying number.
47
2.2.4 Lymphoblastic Cell Lines
2.2.4.1 EBV supernatant
Lymphoblastic cell lines (LCL) were generated from patient peripheral B cells using
EBV B95-8 strain. EBV supernatant was generated from cryopreserved EBV B95-8
cells. Each vial was thawed and resuspended in RPMI-1640 media, which was added
in a drop wise fashion to make a final volume of 10 mL. EBV cells were centrifuged,
the supernatant removed, and cells resuspended in 10 mL of RPMI-1640 media
supplemented with sterile filtered, non-heat inactivated FCS (v/v 20%), sodium
pyruvate (1μM), and L-glutamine (1μM) (185).
The EBV cells were transferred to a labelled, sterile, T-25 culture flask (BD Falcon;
Cat. No. 353108) and incubated at 37°C, until an appropriate amount of cells were
acquired and/or a change in the phenol red pH indicator from red to yellow, indicating
the change of phenol to phenolic acid, (7-10 days). The supernatant was collected,
and filtered through a 0.45μm sterile filter (Sigma; Cat. No. CLS431225). The sterile
supernatant was then aliquoted into sterile 1.8 mL cryotubes and frozen to -80◦C
before transfer into liquid nitrogen storage. The EBV cells were also resuspended in
cryopreservation media (heat-inactivated FCS with 10% DMSO) and stored in liquid
nitrogen. Up to 5 million (5x106) cells were used to for Mycoplasma testing using the
Mycoplasma plus PCR primer kit (Agilent; Cat. No. 302008). (186, 187)
2.2.4.2 Lymphoblastic cell line generation
PBMC’s were thawed and washed with non-heat inactivated FCS based F20 media
(Section 2.2.4.1, EBV supernatant) and incubated at 37°C overnight (185). The
following day cell viability and counts were performed using 0.4% Trypan Blue solution
and the Invitrogen Countess method (Chapter 2, Section 2.2.1 Drug Stimulation and
Cellular Expansion). Cells were resuspended in non-HI serum based F20 media at 0.5
to 1 million (0.5x106 to 1x106) cell per mL
2.5 mL of PBMC’s / F20 were aliquoted into labelled wells of a 6-well flat-bottom
culture plate and a further 0.5 mL of EBV supernatant was added to make a final
volume of 3 mL15 μL of the Lectin Phytohemagglutinin from Phaseolus vulgaris
or PHA-P (Sigma; Cat No. L8754) at a concentration of 2.5 mg/mL was then added to
the 3 mL of PBMC’s / EBV supernatant sample. The cells were incubated at 37°C, for
up to 14 days, with an extra 1 mL of in non-heat inactivated FCS F20 media being
added at day 4 and 12 (185).
48
After 14 days the cells were counted, centrifuged, and resuspended in F20 media
made with components as mentioned in Section 2.2.4 Lymphoblastic Cell Lines
Lymphoblastic Cell Lines, except for the addition of sterile filtered, heat-inactivated
FCS (20% v/v) and Penicillin-Streptomycin (1% v/v). Cells were transferred to a T-25
culture flask and monitored as they grew, with cell counts being performed and the
appropriate amount of F20 (with heat-inactivated FCS and Penicillin-Streptomycin)
being added to keep a concentration of 1 million (1 x 106) cells per mL. Cultures were
transferred to sterile T-75 culture flasks (BD Falcon; Cat. No. 353136) when required
and once the suitable numbers of LCLs were generated, they were cryopreserved until
required. A 5 million (5x106) cells aliquot was used for Mycoplasma testing and a
further 1-2 million (1-2 x 106) cells were used to determine the B-cell and T-cell
frequencies in the flow cytometry LCL cultures at various stages (186, 187).
2.3 Virtual Modelling and in-silico Peptide Design
The virtual modelling of HLA molecules and drug/peptide interactions was performed
by Dr David Ostrov and colleagues, University of Florida College of Medicine,
Gainsville, Florida, USA Several 9-11mer, HLA-B*15:02-restricted HSV-1 (strain 17)
and HSV-2 (strain HG52) peptides were synthesised based on the in-silico epitope
mapping predictions performed by colleagues at The Institute for Immunology and
Infectious Diseases, Murdoch University, Perth, Australia using Net-MHC3.2 based
algorithms, combined with a novel measure of “targeting efficiency” developed in
collaboration with Microsoft research. (169, 170, 188-190)
49
2.4 Molecular Assays
Table 2.9 List of reagents and materials used in molecular assays. Specific PCR associated reagents
and concentrations are listed in the relevant tables.
Reagent Manufacture Catalogue Number
Maxwell 16 Total RNA purification kit Promega 1050
RNeasy mini-kit QIAGEN 74104
Tris-EDTA (TE) buffer Sigma 93283
4% E-gel Invitrogen G700892
QIAGEN MinElute PCR purification kit QIAGEN 28604
NanoDrop DNA quantification Thermo Fisher ND-1000 with v3.2.1
software
Axygen 96-well PCR Half Skirt plate VWR PCR-96-HS-C
DG8 Cartridge and gaskets Bio-Rad 186-4007
DG8 Cartridge holder Bio-Rad 186-3051
QX100/200 ddPCR Droplet Generator Bio-Rad 186-4002
VIAFLOW Electronic pipette
(50-1250 μL) and tips (1250 μL)
INTEGRA
Biosciences
4623
(replacement tips 4445)
Hard-Shell 96-Well PCR plate Bio-Rad HSP 9601
Peirceable foil heat seal Bio-Rad 181-4040
ddPCR Droplet reader oil Bio-Rad 186-3004
C1000 Thermal Cycler 96-Deep Well Bio-Rad 185-1197
QuantaSoft, QX100/200 ddPCR reader Bio-Rad 186-4003
QuantaSoft, QX100/200 ddPCR
analysing software
Bio-Rad Version 1.5.38.1118
2.4.1 RNA isolation and complementary DNA conversion
Cells isolated from cell culturing assay’s (Section 2.2.1 Drug Stimulation and Cellular
Expansion) were stored in RNAlater stabilisation solution, following the manufactures
instructions. When ready for RNA extraction, the cells were removed from RNAlater
suspension and resuspended in the appropriate amount of 1 x PBS. RNA was
50
extracted from the cells using either the Maxwell 16 Total RNA purification kit
(Promega; Cat. No. 1050) or the RNeasy mini-kit (QIAGEN; Cat. No. 74104) and
following the appropriate protocol outlined by the manufacture. For the ddPCR, a two-
step reserve transcriptase PCR approach was used to assess RNA expression. RNA
conversion to complementary DNA (cDNA) was performed by preparing the reagent
mix and following the protocol outlined in Table 2.10 while following the thermocycling
conditions outlined in Table 2.11
Table 2.10: complementary DNA (cDNA) conversion reagents and Master mix.
Reagent Final concentration
x1 Reaction volumes (µL)
Oligo d(T) 20mer (50 µM) (Invitrogen; Cat. No. N8080128)
2.5 µM 1
RNA - 10
Samples incubated at 65◦C for 5 minutes
5x first strand buffer (Invitrogen; Cat. No. 18080-093)
1x 4
dNTPs (40mM) (Invitrogen; Cat. No. 10297-117)
4 mM 2
dithiothreitol (0.1mM) (Invitrogen; Cat. No.15508-013)
5 μM 1
Sterile deionised Water (Sigma; Cat. No. W3500-1L)
- 0.5
RNase out (40 U / μL) (Invitrogen, Cat. No.10777-019)
20 U 0.5
Samples then incubated at 37◦C for 5 minutes
SSIII Reverse Transcriptase (200 U / μL) (Invitrogen; Cat. No. 18080-093)
200 U 1
dNTPs, Deoxyribonucleotide triphosphates (dATP, dCTP, dGTP, and dTTP); μM, micromolar; μL, microliter.
Table 2.11: Cycling conditions for complementary DNA (cDNA) conversion
Cycle Temperature (°C) Time
Cycle 1 x 42 5 minutes
Post cycle 10 infinite
51
2.4.2 Digital Droplet PCR
2.4.2.1 Reference sequence Amplification, Purification, and
Quantitation
As TCRs are highly variable and it is difficult to have a positive control for all the TCR
combinations. A synthetic construct was designed as a positive control and for the
assay workup. The g-Blocks gene fragment reference sequence incorporated the
various primer sequences to be used in the amplification and identification Vβ TCR
clonotype mRNA using the ddPCR method.
Reference sequence.
5’-ATCGACA..(M13Fw)…TGTAAAACGACGGCCAGT..ATGGGCTCCAGGCTGCTCTGTTG
GGTAGCAGGTGAGTCCCTGCAGACAGGATAGCGTGACATCTACCAGACCCCAAGATACC
TTGTTTTATAGGGACAGGAAAGAAGATCACTCTGGAAATGTGAGTTCTCAGCTAAGATGC
CTAATGCAGGCTTT...(Vβ12Fw1)…TGAAGATCCAGCCCTC..GGGTC AAG...(CβFw1)…
TCCAGTTCTACGGGCTCTCG...GAGA...(Cβ-Fw2)…ATGACGAGTGGACCCAGGATAGGG
...TATATGCCAGGCCCTCACATACCTCTCAGTC...(Vβ25ISGSY-CDR3-Fw1)…TTGTAGGA
ACCTGAGATGGAA...AGTC...(Vβ25-GLAGVDN-CDR3)…TTGTTGTCAACTCCCGCTAACC
CACT...GGCCCG...(Vβ12Re1)…TTTAGCCGGGGAGCTGTTT..CCCCAA...(CβRe2)…ACCC
GTCACCCAGATCGTC...AGCGTGTTCTCAAACCATGGGCCAACGC…(Vβ25-Re)…GAAGC
AGAGATCTCCCACACC…ATCCCGCAGTAAAGGCTGGAGTCACTCAAACTAC...
(M13-Rw)…GGTCATAGCTGTTTCCTG..CAGAA TCCG-3’
Table 2.12: M13F and M13R primers used to amplify the reference sequence to use the amplicons to
as a positive control.
Primer Primer Sequence (5’-3’) Length GC% Tm (°C)
M13-Fw
(Forward)
TGTAAAACGACGGCCAGT 18 50 63.59
M13-Re
(Reverse)
CAGGAAACAGCTATGACC 18 50 63.59
GC%, percentage of cytosine and guanine within primer; Tm (°C), calculated melt temperature; and bp, base pairs.
The reference cDNA sequence was resuspended in Tris-EDTA (TE) buffer (Sigma;
Cat no. 93283) giving at 10 ng / μL. The M13 primers listed in Table 2.12 and the
mastermix reagents and concentrations highlighted in Table 2.13 were used, along
with the PCR thermocycling conditions, highlighted in Table 2.14, to amplify the
reference gene. Amplified products were then analysed via electrophoresis on either a
4% E-gel run for 20 minutes (Invitrogen; Cat No.G700892) and purified using the
52
QIAGEN MinElute PCR purification kit (QIAGEN; Cat. No. 28604) following the
manufacture protocols.
Table 2.13: Reference sequence amplification reagent Mastermix to amplify the reference sequence to
use the amplicons to as a positive control.
Reagent Final
concentration
x1 reaction volumes
(µL)
*PCR buffer (10x)
(Invitrogen; Cat. No. 18067-017)
*1x *2
MgCl2 (50 mM)
(Invitrogen; Cat. No. 18067-017
1.5 mM 0.6
dNTP (40 mM)
(Invitrogen; Cat. No. 10297-117)
2 mM 1
Forward primer (25 µM) 0.625 nM 0.5
Reverse primer (25 µM) 0.625 nM 0.5
*Platinum Taq (5U / µL)
(Invitrogen; Cat. No. 10966-026)
*2.5 Units *0.5
Sterile deionised H2O - 13.2
Ref sequence cDNA (10 ng / µL) 10 ng / μL 1 *1-2.5 Units recommended by Invitrogen for use of Platinum Taq DNA polymerase #Reference sequence was resuspended in TE buffer at 10ng/μL. IDT, the manufacture recommends using 0.1-10 ng for amplification. mM, millimolar; µM, micromolar; nM, nanomolar; U, units; cDNA, complementary DNA; PCR, polymerase chain reaction.
Table 2.14: Reference sequence amplification PCR cycling conditions for the amplification of the
reference sequence to use the amplicons to as a positive control.
Cycle Temperature (°C) Time
Pre-cycle 94 6 minutes
Cycle (40x)
95
60
72
30 seconds 30 seconds 45 seconds
Extension 72 5 minutes
Post cycle 15 Infinite
Quantification of the reference sequence amplicons was done using NanoDrop DNA
quantification (Thermo Fisher; Cat. No. ND-1000 with v3.2.1 software) and the DNA
copy number calculated using the following equation; The amplicons were diluted with
TE buffer to obtain a range of copy number concentrations ranging from 7.48 x 1011
copies per μL to 7.48 copies per μL.
53
Copy No. = Amount of DNA (ng) x 6.022x1023
((length (bp) x 1x109(ng/g) x 650 (g/mole of bp))
2.4.2.2 Digital droplet PCR protocol
The forward and reverse primers listed in Table 2.17 were validated using the
reference cDNA sequence (Appendix 9, Section 9.2). The validated primers were
added to into labelled sterile Safe-Lock 1.5mL Eppendorf Tubes, to give a final
concentration of 100 nM per primer, along with the 2x EvaGreen supermix for ddPCR
and sterile deionised water (Table 2.15). To automate the addition of mastermix and
samples, to an Axygen 96-well PCR Half Skirt plate (VWR: Cat. No. PCR-96-HS-C),
the Beckman Coulter Biomek FXP automated workstation requires the relevant
position, size, and volumes data, be saved into a comma-separated values (CSV) file,
which the robot can read and perform accordingly. This CSV file is simple file format
used to store tabular data which can be converted and saved in plain text.
For each sample, 22.5 μL of the mastermix was added to each well of an along with
2.5 μL of sample cDNA, or the appropriate control. The positive control reference
sequence amplicons were added manually in the designated Post-PCR Laboratory or
the laboratory designated for all samples that have already undergone PCR
amplification in order to prevent cross contamination of amplified PCR products in
samples being prepared in the designated Pre-PCR Laboratory or the laboratory
designated for all samples which have not undergone PCR amplification. Once
complete, plates were sealed using adhesive PCR film samples centrifuged
(Eppendorf Centrifuge) and droplet generation was performed in the Post-PCR
Laboratory.
The DG8 cartridge was placed into the ddPCR cartridge holder and 20 μL of the 25 μL
PCR was loaded into the middle sample well section of the DG8 Cartridge, in the
appropriate order. Then 70 μL of the ddPCR Droplet Reader Oil was loaded into the
first, reader oil well and the DG8 gasket added to the ddPCR cartridge holder with the
loaded ddPCR cartridge (Figure 2.2). The cartridge was then placed into the
QX100/200 ddPCR Droplet Generator and droplet generated (Figure 2.2).
After droplet formation, 40 μL of the sample droplets were transferred to the Hard-
Shell 96-Well PCR plate (Bio-Rad, Cat. No. HSP9601), in the same order as
highlighted in the CSV file generated for the automated process. The plates were
sealed with a peirceable foil heat seal, then plates placed into C1000 Thermal Cycler
54
96-Deep Well and exposed to the thermocycling conditions outlined in Table 2.16.
After thermocycling the plate was placed into the ddPCR droplet reader and the raw
data analysed using the QuantaSoft, QX100/200 ddPCR analysing software (Figure
2.2).
Figure 2.2: General overview of digital droplet PCR (ddPCR) assay workflow from PCR mastermix
generation through to droplet generation, amplification, QX100/200 plate reading and analysis.
Table 2.15: Reagent mastermix for EvaGreen ddPCR.
Reagent Final concentration x1 reaction volumes (µL)
ddPCR EvaGreen supermix (2x) (Bio-Rad Cat No. 186-4033)
*1x *12.5
Forward primer (25 µM) 100 nM 0.1
Reverse primer (25 µM) 100 nM 0.1
Sterile deionised H2O - 13.2
Ref sequence cDNA - 2.5
µM, micromolar; nM, nanomolar; µL microliters; cDNA, complementary DNA; ddPCR, digital droplet polymerase chain reaction.
55
Table 2.16: Digital droplet PCR (ddPCR) cycling conditions for the amplification of Variable beta (vβ)-
25-1*01 and -12-3/4*01 CDR3 specific sequences, constant beta (Cβ), and ribonuclease P RNA
component H1 (RPPH1) reference gene sequences.
Cycle Temperature (°C) Time Pre-cycle 95
5 minutes
95 30 seconds Cycle (40x) 58 30 seconds
60 30 seconds
Signal Stabilisation
4 5 minutes
90 5 minutes
Post cycle
10
Infinite
Table 2.17: vβ 25 and 12 CDR3 specific, and reference gene primers.
Primer Primer Sequence (5’-3’) Length
(bp)
GC% Tm (°C)
Vβ25– ISGSY fwd. CDR3 Specific primer
TTGTAGGAACCTGAGATGGAA 21 57.1 63.65
Vβ25 – GLAGVDN fwd. CDR3 Specific primer
TTGTTGTCAACTCCCGCTAACCCACT 26 50.0 63.87
Vβ25 – ISGSY and GLAGVDN rev
GGTGTGGGAGATCTCTGCTTC 21 57.1 63.79
Vβ12 Fwd. Primer TGAAGATCCAGCCCTC 16 56.3 63.53
Vβ12 CDR3 specific rev AAACAGCTCCCCGGCTAAA 19 52.6 63.66
Cβ fwd TCCAGTTCTACGGGCTCTCG 20 60.0 63.78
Cβ rev GACGATCTGGGTGACGGGT 19 63.2 63.77
RPPH1 F AGTGAGTTCAATGGCTGAGG 20 50.0 63.68
RPPH1 R GGCGGAGGAGAGTAGTCT 18 61.1 63.70
Vβ, Variable beta; Cβ, constant beta; and RPPH1, ribonuclease P RNA component H1 gene primers. GC%,
percentage of cytosine and guanine within primer; Tm (°C), calculated melt temperature; and bp,
2.4.2.3 QX100/200 ddPCR raw data analysis
The analysis of the QX100/200 raw data output and statistical parameters of the
ddPCR system is dependent on the partitioning of the template DNA/cDNA into
uniform droplets. The QuantaSoft software (Version 1.5.38.1118) measures the
amount of positive and negative droplets based upon the fluorophore in each sample.
56
The fraction of positive droplets is then fitted into a Poisson distribution algorithm to
determine the starting concentration of the Target DNA/cDNA template as copies per
μL and copies per reaction (copies per 20 μL). For accurate quantitation with a 95%
confidence level, a minimum of 14,000-15,000 total droplets are required when using
the EvaGreen ddPCR method. For the ddPCR specific Vβ CDR3 TCR mRNA analysis,
TCR mRNA expression levels were normalised using the expression of the
ribonuclease P RNA component H1 (RPPH1) gene and reporting Vβ CDR3 TCR
mRNA expression levels as a percentage of normalised Cβ mRNA expression levels.
57
Chapter 3
Nevirapine-Induced Hypersensitivity
58
59
3 3.1 Introduction
Based on established drug-HSR models, which illustrates the importance of the HLA
peptide-binding cleft in specific drug interactions, this chapter will explore the notion
that NVP-HSR tissue specificity and varied HLA allele associations explained in
Chapter 1, Section 1.3.3 Nevirapine, Table 1.2, can be explained by similarities in HLA
peptide-binding cleft structures and predicted peptide specificity and chemistry. We
sought to compare significant NVP-HSR HLA alleles across ethnic groups by grouping
NVP-HSR significant HLA alleles according to shared key amino acid residues which
make up the HLA class-I binding cleft pockets (A-F), based on similarities in cross-
reactivity of public epitopes among HLA class-I alleles and binding cleft pocket
chemistry (CREG HLA supertypes), and based on MHCcluster algorithm grouping
(pb), which groups HLA molecules on their peptide-binding specificity as predicted by
NetMHCpan 2.8, (Table 3.1) (168-172, 191).
This chapter will also explore the characteristic unique to NVP-SCARs, the diminishing
ex-vivo NVP-stimulated, PBMC’s IFN-γ responses in patients as they recover from
DRESS. As identified by Keane et al. 2014, the NVP-stimulated IFN-γ responses in
NVP-DRESS patient PBMC’s, diminish over time, becoming undetectable after
recovery. Keane et al. 2014 explored the hypothesis that these diminishing responses
were due to an increase in CD4+ Tregs levels after NVP withdrawal and during the
recovery period. In the paper by Keane et al. 2014, one patient exhibited an increase
in Tregs that corresponded with the waning IFN-γ ELISpot responses (138).
In this section of the chapter, this hypothesis will be investigated further. However, as
most of the NVP-DRESS patient PBMC’s samples had been used in the first study by
Keane et al. 2014, we analysed the cytokine plasma profiles of the same NVP-DRESS
patients, used in the Keane et al. 2014. We expected that the cytokine environment
within the donor’s plasma, over the time course of a NVP-DRESS reaction and
recovery period, alongside the Keane et al. 2014 data, might show changes in specific
T-cell subpopulations further explaining the diminishing NVP-stimulated, PBMC IFN-γ
responses.
60
Table 3.1 HLA cross-reactive group (CREG) supertypes and MHC Cluster peptide-binding (pb-) groups
HLA grouping HLA alleles (HLA-) Grouping characteristics
CREG B*07 supertype
B*07, B*08, B*13, B*54, B*55, B*56,
B*27, B*60, B*61, B*41, B*42, B*47,
B*48, B*59, B*67, B*81, and B*82 Grouped based on similarities in
cross-reactivity of public epitopes
among HLA class-I alleles and
binding cleft pocket chemistry
(171, 172, 191) CREG B*05
supertype
B*18, B*35, B*46, B*49, B*50, B*51,
B*52, B*53, B*57, B*58, B*62,-B*63,
B*71, B*72, B*73,B*75, B*76, B*77
and B*78
pb-B*35 B*35:(01/05/08), -B*53:01
Grouped based on their peptide-
binding specificity as predicted by
NetMHCpan 2.8 (160-162)
pb-B*78 B*78:01, B*55:01, B*56:01
pb-C*05 C*04:(03/06) C*05:(01/09)
C*08:(01/02) C*17:01
pb-C*18 C*04:(01/05/07), C*18:01
3.2 Hypothesis and Aims
Hypothesis 1
The predicted peptide-binding properties, the structure of the HLA class-I molecule
peptide-binding cleft, in particular, the B- and F-pockets, and predicted NVP-binding
properties may be shared between the various HLA alleles associated with
NVP-SCAR with hepatitis and NVP-SCAR without hepatitis.
Aim 1
Retroactively analysing the patient and demographic data from a NVP-HSR
associated cohort with controls (ClinicalTrials.gov NCT00310843 Chapter 2,
Nevirapine-Induced HSR 2.1.1) and the NVP-SCAR and NVP-SCAR with hepatitis
DNA samples will be sequenced and HLA typed. The data will then be analysed to
identify significant HLA alleles and grouping associations, their predicted peptide-
binding properties, the structure of the HLA class-I molecule peptide-binding cleft, in
particular, the B- and F-pockets, and predicted NVP-binding properties.
Hypothesis 2
The cytokine plasma profiles of NVP-SCAR patients over the time course of the
reaction represents the changes in T-cell subpopulations, explaining the diminishing
NVP-stimulated, PBMC IFN-γ responses.
61
Aim 2
The CBA Th1/Th2/Th17 kit (BD Scientific; Cat No. 560484) and the method outlined in
Chapter 2 Materials and Methods, Section 2.2.2.4 Cytometric Bead Array cytokine
assay will be used to analyse the cytokine profiles of the Plasma from NVP-DRESS
patents obtained over the time course of their NVP-DRESS reaction.
3.3 Methods
3.3.1 NVP-SCAR Associated HLA Class-I Binding Cleft
Characteristics
3.3.1.1 HLA four digit typing and Samples
On the samples highlighted in Chapter 2 Materials and Methods Section 2.1.1.1 NVP-
SCAR associated HLA class-I binding cleft characteristics, HLA-A, HLA-B,
HLA-C, and HLA-DR PCR amplification was performed by myself in conjunction with
staff at The Institute for Immunology and Infectious Diseases, Murdoch University,
Perth, Australia. Using the next generation sequencing 454 FLX+ sequencer platform,
the amplified products were sequenced and the raw data analysed using accredited
HLA allele caller software that uses the latest IMGT HLA allele database as the allele
reference library by colleagues at The Institute for Immunology and Infectious
Diseases, Murdoch University, Perth, Australia (Table 3.2).
3.3.1.2 Statistical analysis and virtual modelling
Both univariate and multivariate analyses were performed and stratified for race
according to HLA class-I alleles, HLA CREG supertypes, and peptide-binding groups
assigned from MHC Cluster binding specificities (Table 3.1) (168, 169, 171) In this
study, clinical notes were re-evaluated by and myself, Dr Rebecca Pavlos, and
Professor Elizabeth Phillips (Table 3.2). Samples were excluded from this analysis
because no sample was available for HLA typing or issues with sample identity were
identified (n=101) and either no clinical data was reported (n=22) or ambiguous clinical
data was reported (n=62). The final analysis included 210 clinically defined NVP-HSR
cases (152 SCAR, 58 HSR with hepatitis) with 468 controls. The statistical analysis
was performed in conjunction with colleagues at The Institute for Immunology and
Infectious Diseases, Murdoch University, Perth, Australia and Vanderbilt University,
Nashville Tennessee, USA in particular Dr Elizabeth McKinnon, Dr Rebecca Pavlos
and Professor Elizabeth Phillips (Table 3.2). Virtual modelling of NVP-binding in the
62
HLA-C*04:01 allele, was performed by Dr David Ostrov and colleagues, University of
Florida College of Medicine, Gainsville, Florida, USA (Table 3.2).
3.3.2 Diminishing IFN-γ Responses in NVP-stimulated,
PBMC’s from NVP-DRESS Patients
A complete description of the Controls and Donors is given in Chapter 2 Materials and
Methods, Section 2.1.1.2 Diminishing ex-vivo PBMC’s responses and NVP-HSR
Immunopathogenesis. The CBA flow cytometry methods, outlined in Chapter 2,
Materials and Methods, Section 2.2.2.4 Cytokine Bead Array, were used to assess the
cytokine plasma profiles of NVP-DRESS patients. This study was part of a larger
retrospective cohort study that involved the analysis of HLA class-I and class-II alleles
association and examined NVP specific CD4+ and CD8+ T-cell responses by IFN-γ
ELISpot assay and flow cytometry. The results of this larger study were published in
AIDS: HLA Class-I Restricted CD8+ and Class-II Restricted CD4+ T Cells Implicated in
the Pathogenesis of Nevirapine Hypersensitivity by Keane et al. 2014 (Appendix 9,
Section 9.2 Publications Highlights) (138). Statistical analysis and graphical
representations were calculated using GraphPad Prism software Version 5.02
(GraphPad Software Inc., California USA).
63
Table 3.2 Distribution of the work within Chapter 3 and accreditation to those who contributed
Work performed Accreditation
PCR amplification of HLA target sequences
from DNA
Craig Rive and staff at IIID
(NATA and ASHI accredited)
Sequencing of HLA amplicons Staff at IIID
(NATA and ASHI accredited)
Analysis of sequencing data and assigning of
HLA 4-digt types
Staff at IIID
(NATA and ASHI accredited)
Evaluation of clinical data Craig Rive
Rebecca Pavlos
Elizabeth Philips
NVP-SCAR analysis Rebecca Pavlos
Elizabeth McKinnon
NVP-HSR with Hepatitis analysis Craig Rive
Rebecca Pavlos
Elizabeth McKinnon
Virtual modelling of HLA-C*04:01 and NVP-
binding
David Ostrov, University of
Florida College of Medicine,
Gainsville, Florida, USA
NVP associated ELISpot, Treg flow cytometry,
and clinical data associated with
Donor 1 (NVP-HSR)
Niamh Keane and contributors
to the publication by
Keane et. al 2014 (138)
Cytokine analysis of NVP-DRESS patient
plasma
Craig Rive
PCR, Polymerase Chain Reaction; HLA, Human Leukocyte Antigen; DNA, deoxyribonucleic acid; NVP, nevirapine; SCAR, Severe cutaneous adverse reaction, IIID, Institute for Immunology and Infectious Diseases; NATA, National Association of Testing Authorities; ASHI, American Society for Histocompatibility and Immunogenetics.
3.4 Results
3.4.1 NVP-HSR Associated HLA Class-I Binding Cleft
Characteristics
3.4.1.1 NVP-HSR with hepatitis
The CREG B*07 and pb-B*78 groupings of HLA alleles as highlighted in Table 3.3
were both found to be significant in predicting NVP-HSR with hepatitis in Caucasians
(OR 2.18, p value 0.040 and OR 2.15, p value 0.016, respectively (Table 3.3). (168-
172, 191).
64
Table 3.3: NVP-HSR with hepatitis and statistically significant HLA CREG supertype and pb-groups
Phenotype Race Group P Value OR
Hepatitis Caucasian CREG B*07 0.016 2.150
pb-B*78 0.040 2.180
CREG, cross-reactive group; pb-, peptide-binding.
Associated HLA-B peptide-binding properties and MHC Cluster analysis
The MHCcluster analysis of the pb-B*78 group was compared to other common HLA
alleles identified within this cohort. Several HLA alleles belonged to the MHC Cluster
assigned pb-B*46 and pb-B*18 groups, as well as the pb-B*35 group (Table 3.1).The
MHCcluster analysis shows the pb-B*78 group alleles HLA-B*55:01,
-B*56:01, and -B*78:01 share close predicted peptide-binding capabilities (HLA-
B*55:01 to -B*56:01 distance = 0.093, HLA-B*55:01 to -B*78:01 distance = 0.111).
The pb-B*35 group alleles are represented by the HLA-B*35:01, -B*35:05, and -
B*53:01 alleles also share close predicted peptide-binding capabilities with (HLA-
B*35:01 to -B*35:05 distance = 0.039, HLA-B*35:01 and HLA-B*35:05 to HLA-B*53:01
distance = 0.254 and 0.273, respectively) (Figure 3.1 and Figure 3.2).
The MHCcluster tree and heatmap both show the pb-B*78 and pb-B*35 groups are
distinctly separate in terms of their predicted peptide-binding capabilities (distances
ranging from 0.361 to 0.539) (Figure 3.1 and Figure 3.2). The peptide-binding motifs in
Figure 3.1 shows how the pb-B*78 and pb-B*35 grouped alleles prefer to bind 9mer
peptides with a proline (P) or an alanine (A) at position 2 (P2 from the NH2 terminus of
the peptide) (168). We hypothesised that the HLA alleles within the pb-B*78 and pb-
B*35 groups would share structurally similar B-pockets.
65
Figure 3.1: MHCcluster tree created for the functional clustering of HLA-B alleles. Depicted are the
peptide-binding groups, pb-B*78 (red), pb-B*35 (orange), pb-B*46, and pb-B*18. (blue), with
representative predicted peptide-binding motifs (168).
Figure 3.2: MHCcluster heatmap representation for the functional clustering of HLA-B alleles, Depicted
are the peptide-binding groups, pb-B*78 (red), pb-B*35 (orange), pb-B*46, and pb-B*18 using the
MHCcluster algorithm (168).
66
Associated HLA-B binding cleft B-pocket.
While the MHCcluster analysis shows the pb-B*78 and pb-B*35 allele grouping are
distinctly different in their predicted peptide-binding capabilities, they both show a
tendency to bind a 9mer with a proline (P) or an alanine (A) at P2. The amino acid at
P2 of a HLA class-I bound peptide interacts with the HLA class-I binding cleft
B-pocket. An analysis of the binding cleft B-pocket structure was performed by
analysing the particular amino acids present in key positions that make up the binding
cleft B-pocket and therefore interact with the P2 amino acid of a bound peptide.
Multiple virtual modelling studies have shown that the amino acids at positions 7, 9,
24, 34, 41, 45, 63, 66, 67, 70, and 99 in the binding cleft B-pocket of the HLA-B
molecule are essential in the interaction with the P2 amino acid of a bound peptide
(171, 192-195). The HLA-B*55:(01/02), -B*56:(01/03/04) alleles of the MHCcluster
assigned pb-B*78 group, share the same amino acids sequence YYAVAENIYQY at
the binding cleft B-pocket positions 7, 9, 24, 34, 41, 45, 63, 66, 67, 70, and 99,
respectively. However, HLA-B*78:01 also grouped into pb-B*78 by MHCcluster, does
not share the same B-pocket amino acid sequence as the other pb-B*78 grouped
alleles but shares the same amino acid sequence as the MHCcluster pb-B*35 grouped
alleles (Table 3.4). The pb-B*78 alleles, HLA-B*55:01 and HLA-B*56:01 (minus HLA-
B*78:01) also belong to the validated HLA supertype CREG B*07 group, which was
also identified as significant in Table 3.1. This analysis has highlighted the potential for
the association of both HLA-B*55:01 and HLA-B*56:01 with NVP-HSR with hepatitis.
67
Table 3.4: HLA-B, B-pocket key amino acid residues YYAVAENIYQY at positions 7, 9, 24, 34, 41, 45,
63, 66, 67, 70, and 99 respectively for the CREG B*07 and pb-B*78 alleles HLA-B*55:(01/02),
B*56:(01/03/04), compared to the amino acid sequence of other HLA-B alleles.
HLA-B* Amino acid position B-pocket
7 9 24 34 41 45 63 66 67 70 99
55:(01/02),56:(01/03/04) YY Y A V A E N I Y Q Y
78:01,53:01,51:(01/02/04/08), 35:(01/02/03/04/05/08/43)
- - - - - T - - F - -
18:(01/02) - H S - - T - - S N -
44:(02/03/05) - - T - T K E I S N -
57:(01/02/03/04) - - - - - M E N M S -
58:(01/02) - - - - - T E N M S -
15:(01/12/24/25/35) - - - - - M E I S N -
15:02 - - - - - M - I S N -
15:03 - - S - - E - - - - -
46:(01/02) - - - - - M E K - - -
3.4.1.2 NVP-SCAR
The HLA-C*04:01 allele was significant in predicting NVP-SCAR, across all the broad
ethnic groups within this study, Asian (OR 5.73, p value < 0.0001), Caucasian (OR
1.92, p value 0.048) and, African (OR 4.00, p value 0.02) ancestry (Table 3.5). Ethnic-
specific analysis showed several HLA-C alleles to be significant in predicting NVP-
SCAR. These included HLA-C*05:01 in Caucasians/Hispanics when compared to non-
HLA-C*04:01 / non-HLA-C*05:01 carriers (OR 2.55, p value 0.004) and HLA-C*18:01
in African descendants, compared to non-HLA-C*04:01 / non-HLA-C*18:01 carriers
(OR 5.70, p value 0.007) (Table 3.5).
68
Table 3.5: NVP-SCAR statistically significant HLA-C alleles.
Phenotype Race/ethnicity Allele (HLA-) P Value OR
Rash Caucasian C*04:01 0.048 1.92
C*05:01 0.004 2.55
Rash African C*04:01 0.020 4.00
C*18:01 0.007 5.70
Rash Asian C*04:01 <0.0001 5.73
HLA-C peptide-binding properties and MHC Cluster analysis
The HLA-C*04:01, -C*05:01, and -C*18:01 alleles, and other common HLA-C alleles
identified within the cohort were analysed and assigned to specific peptide-binding
groups by the MHC Cluster program based on the NetMHCpan 2.8 (176, 177, 181). As
shown in Figure 3.3, the HLA-C*04:(01/05/07) alleles shared predicted peptide-binding
capabilities (distance < 0.0001). (168) The HLA-C*04:(01/05/07) alleles also shared
closely related predicted peptide-binding capabilities to the HLA-C*18:01 allele
(distance = 0.277). For this study, the HLA-C*04:(01/05/07) and HLA-C*18:01 alleles
were assigned to one peptide-binding group pb-C*18 (Figure 3.3 and Figure 3.4)
(168). The peptide-binding group pb-C*05 included the HLA-C*04:03, -C*05:(01/09)
alleles (HLA-C*04:03 to C*05:(01/09) distance = 0.0046). (168) Also identified in the
pb-C*05 group was HLA-C*08:(01/02) (in relation to HLA- C*05:(01/09) distance =
0.129), HLA-C*04:06 (in relation to HLA-C*05:(01/09) distance = 0.276), and HLA-
C*17:01 (in relation to HLA-C*05:(01/09) distance = 0.246) (Figure 3.3 and Figure 3.4)
(168). The peptide-binding motifs in Figure 3.3 show the predicted peptide-binding
capabilities of the MHCcluster assigned pb-C*18 and pb-C*05 HLA alleles. Both
MHCcluster assigned pb-C*18 and pb-C*05 group HLA alleles prefer to bind 9mer
peptides with either a leucine (L), phenylalanine (F), valine (V), isoleucine (I), or a
methionine (M) at P9 of the peptide which interacts with the binding cleft F-pocket of
the HLA class-I molecule (168). Given that the MHCcluster assigned pb-C*18 and pb-
C*05 HLA alleles are predicted to bind a 9mer similar amino acids at P2, we
hypothesised that the HLA alleles within these MHCcluster groups share structurally
similar F-pockets.
69
Figure 3.3: MHCcluster tree created for the functional clustering of HLA-C alleles. Depicted are the
various predicted peptide-binding groups, pb-C*05 and pb-C*18 (blue), with representative peptide-
binding motifs (168).
Figure 3.4: MHCcluster heatmap representation for the functional clustering of HLA-C alleles. Depicted
are the various predicted peptide-binding groups, including pb-C*05 and pb-C*18 (blue), using the
MHCcluster algorithm (168).
70
Associated HLA-C binding cleft F- and B-pocket
While the MHCcluster analysis showed that the HLA alleles assigned to the
pb-C*05 and pb-C*18 allele groups are different in their predicted peptide-binding
capabilities, they have the tendency to bind 9mer peptides with either a leucine (L),
phenylalanine (F), valine (V), isoleucine (I), or a methionine (M) at P9 of the peptide
which interacts with the binding cleft F-pocket of the HLA class-I molecule. Therefore,
analysis of the binding groove F-pocket structure was performed by analysing the
particular the amino acids in key positions of the binding cleft F-pocket (Table 3.6).
Multiple virtual modelling studies have shown that the amino acids at positions 74, 77,
80, 81, 84, 95, 97, 114, 116, 123, 133, 143, 146, and 147 in the F-pocket of the HLA-C
molecule, are essential in the interaction with the amino acid at P9 of a HLA class-I
bound peptide (171, 192-195). Table 3.4 shows the HLA alleles within the MHCcluster
assigned pb-C*18 and pb-C*05 groups share the same F-pocket amino acid sequence
DNKLYLRNFYWTKW at positions 74, 77, 80, 81, 84, 95, 97, 114, 116, 123, 133, 143,
146, and 147, respectively (171, 192-195). This analysis also looked at the key amino
acid residues of the binding cleft B-pocket amino acid residues positions 7, 9, 24, 34,
41, 45, 63, 66, 67, and 70. The B-pocket residue sequences of the MHCcluster
defined pb-C*18 and pb-C*05 grouped HLA alleles shared no significant similarities
(Table 3.6). The B-pocket residue sequences of the MHCcluster defined pb-C*18 and
pb-C*05 grouped HLA alleles are shared with by other HLA alleles identified in this
cohort, but not significant in NVP-SCAR. For example, the pb-C*18 alleles HLA-
C*04:(01/07) share the same B-pocket residues as HLA-C*14:(02/04) and the pb-C*05
alleles HLA-C*05:(01/09), share the same B-pocket residues as HLA-C*03:(03/04) and
HLA-C*08:(01/02/03) (Table 3.7).
71
Table 3.6: HLA-C F-pocket key amino acid residues, DNKLYLRNFYWTKW at positions 74, 77, 80, 81,
84, 95, 97, 114, 116, 123, 133, 143, 146, and 147, respectively for the HLA-C*04:(01/03/06/07), HLA-
C*05:(01/09) and HLA-C*18:01 alleles, compared to the amino acid sequence of other HLA-C allele.
HLA-C*
Amino acid position F-pocket
74 77 80 81 84 95 97 114 116 123 133 143 146 147
04:(01/03/06/07), 05:(01/09),18:01
D N K L Y L R N F Y W T K W
02:(02/10) - - - - - - - D S - - - - -
06:02, 16:02 - - - - - - W D S - - - - -
17:01 - - - - - I - - - - - S - L
15:02 - - - - - I - D L - - - - -
15:05 - - - - - I - D - - - - - -
15:06 - - - - - I - D Y - - - - -
01:(02/08) - S N - - - W D Y - - - - -
3:05 - S N - - - S D Y - - - - -
12:03,14:02, 16:(01/04)
- S N - - - W D S - - - - -
14:04 - - N - - - W D S - - - - -
03:02, 12:02 - S N - - - - D S - - - - -
07:(01/02) - S N - - - - D S - - - - L
7:04 - S N - - F - D - - - - - L
7:12 - S N - - F - D - - - - - -
03:(04/02) - S N - - I - D Y - - - - -
1:03 - S N - - - W - - - - - - -
08:(01/02/03) - S N - - - - - - - - - - -
72
Table 3.7: HLA-C, B-pocket key amino acid residues YSAVGEKYQF at the B-pocket positions 7, 9, 24,
34, 41, 45, 63, 66, 67, and 70 respectively for the HLA-C*04:(01/03/06/07), HLA-C*05:(01/09) and HLA-
C*18:01 alleles, compared to the amino acid sequence of other HLA-C alleles.
HLA-C*
Amino acid position B-pocket
7 9 24 34 41 45 63 66 67 70
04:(01/07), 14:(02/04) Y S A V G E K Y Q F
05:(01/09), 03:(03/04),
08:( 01/02/03) - Y - - - - - - - Y
04:(03/06) - Y - - - - - - - -
18:01 - D S - - - - - - -
Virtual modelling
The MHCcluster and HLA class-I binding cleft F- and B- pocket structure analysis
showed that the NVP-SCAR associated HLA-C alleles share the same binding cleft F-
pocket, but different B-pockets. Virtual modelling analysis performed and analysed by
colleagues at the University of Florida, showed that NVP preferentially interacts near
the binding cleft B-pocket of the HLA-C*04:01 molecule and not the F-pocket (Figure
3.5).
Figure 3.5: Virtual modelling of NVP and HLA-C*04:01 potential interaction, which indicates the
preferential docking or binding of NVP near the B-pocket of the HLA-C*04:01 molecule.
73
Multivariate analysis and HLA predictive values
The HLA-C*04:01 allele was significant in NVP-SCAR, when analysing the whole
cohort and remaining significant in all populations (Table 3.8). The MHCcluster pb-
C*18 and pb-C*05 grouped HLA alleles, which share the same binding groove
F-pocket amino acid residues, were also significant in predicting NVP-SCAR, when
analysing the whole cohort (OR 2.73, p value 0.0003) but only remained significant in
Caucasians, when each race was analysed separately (OR 3.35, p value 0.002)
(Table 3.8) (171).
Table 3.8: Multivariate model of predictive and protective NVP-rash associated SCARs HLA alleles,
adjusted for ethnicity.
MULTIVARIATE (+ adjusted for race)
ALL CAUCASIAN ASIAN BLACK
OR P OR P OR P OR P
HLA-C*04:01 4.28 <0.0001 3.00 0.002 8.23 <0.0001 6.38 0.006
pb-C*18 and pb-C*05 group sharing the same F-pocket
2.73 0.0003 3.35 0.002 1.51 0.4 3.27 0.1
Table 3.9 shows the positive and negative predictive values calculated based on
sample prevalence of NVP-SCAR and the conserved estimates of 5% prevalence
cited in the literature (138-141). HLA-C*04:01 allele possessed a positive predictive
value ranging from 4.6% in Taiwanese to 26.7% in Southeast Asians, and a negative
predictive value ranging from 94.7% in Taiwanese to 96.4% Africans, adjusted for a
prevalence of 5% NVP-SCAR (Table 3.9) (138-141). Carriage of a HLA allele that
shares the same key binding cleft F-pocket residues as HLA-C*04:01, possessed a
positive predictive value between 2.7% and 11.0% and a negative predictive value
between 94.5% and 97.4% was determined, depending on ethnicity and adjusted for
5% prevalence of NVP-SCAR (Table 3.9) (138-141).
74
Table 3.9: Positive and negative predictive values for carriage of the identified predicted and/or
protective NVP-SCAR associated HLA class-I alleles, adjusted for 5% prevalence.
Controls NVP- rash
HSR Sample
prevalence 5 % prevalence
Ethnicity Neg (N)
Pos (N)
Neg (N)
Pos (N)
Sensitivity (%)
Specificity (%)
PPV (%)
NVP (%)
PPV (%)
NVP (%)
HLA-C*04:01
African 44 8 11 8 42.1 84.6 50.0 80.0 12.6 96.5 European 115 29 26 16 38.1 79.9 35.6 81.6 9.1 96.1 Hispanic 52 14 19 6 24.0 78.8 30.0 73.2 5.6 95.2 SEA 154 6 40 14 25.9 96.2 70.0 79.4 26.7 96.1 Taiwanese 36 4 10 1 9.1 90.0 20.0 78.3 4.6 95.0
Predictive HLA-C allele
African 38 14 7 12 63.2 73.1 46.2 84.4 11.0 97.4 European 95 49 15 27 64.3 66 35.5 86.4 9.0 97.2 Hispanic 43 23 12 13 52 65.2 36.1 78.2 7.3 96.3 SEA 132 28 34 20 37 82.5 41.7 79.5 10.0 96.1 Taiwanese 33 7 10 1 9.1 82.5 12.5 76.7 2.7 94.5
3.4.2 Diminishing Ex-vivo PBMC’s Responses and NVP-HSR
Immunopathogenesis
3.4.2.1 IFN-γ ELISpot and CBA flow cytometry analysis
Work performed by Niamh Keane et al. 2014 showed that NVP-restricted responses
were detected by IFN-γ ELISpot assay in PBMC’s from the three donors; but these
responses waned and diminished becoming undetectable in PBMC’s shortly after the
first presentation of NVP-SCAR, DRESS phenotype (Figure 3.6) (138). Looking at the
cytokine plasma profiles of the same NVP-DRESS patients, used in Keane et al. 2014,
we expected that the cytokine environment within the donor’s plasma, over the time
course of a NVP-DRESS reaction and recovery period, might show changes in specific
T-cell subpopulations, further explaining the diminishing NVP-stimulated, PBMC IFN-γ
responses. For example an increase in IL-10 during the recovery period might disrupt
the Treg/Th17 balance and add weight to the first hypothesis proposed by Keane et al.
2014, that the diminishing NVP-stimulated, PBMC IFN-γ responses were due to an
increase in CD4+ Tregs levels after NVP withdrawal and during the recovery period.
Keane et al. 2014 proposed this hypothesis, based on Figure 3.7 which shows the
percentage of Tregs 8 days after NVP cessation, which matched the non-HSR control
Treg percentages and NVP IFN-γ responses were still detectable in Donor 1 (NVP-
75
HSR). As the IFN-γ response diminished, the percentage of Tregs became elevated
(Figure 3.6 and Figure 3.7) (138).
Figure 3.6 Timeline of diminishing IFN-γ responses SFU/million cells in Donor 1 (NVP-HSR), Donor 2
(NVP-HSR), and Donor 3 (NVP-HSR) Figure from Keane et al. 2014 (138)
Figure 3.7: Regulatory T cells expressed at a % of CD4 T cells are shown in the plot where clear
symbols indicates samples from Donor 1 (NVP-HSR) and the time after NVP cessation. The filled in
symbols indicate samples from controls (black, blue) and HIV patient not on medication (red symbol).
Figure from Keane et al. 2014 (138).
76
Donor 1 (NVP-HSR) showed a reduced IFN-γ ELISpot response in NVP-exposed
PBMC’s acquired 18 days post NVP-DRESS. Donor 1 (NVP-HSR) showed an IFN-γ
ELISpot response to NVP in the order of 1600 SFU/million cells, in PBMC’s acquired 5
post NVP-DRESS which had reduced to 150 SFU/million cells in PBMC’s acquired day
8 post NVP-DRESS (138). PBMC’s from Donor 1 (NVP-HSR) acquired 18 days post
NVP-DRESS, showed no IFN-γ ELISpot response (138). The cytokine plasma profile
of Donor 1 (NVP-HSR) also showed detectable IFN-γ release at day 1 post NVP-
DRESS which then decreased. The cytokine IL-6 was detected at day 1 and day 5 in
the plasma of Donor 1 (NVP-HSR) which decreased to become undetectable by day 8
post NVP-DRESS (Figure 3.8) (138).
Figure 3.8: Cytokine plasma profile of Donor 1 (NVP-HSR), plasma obtained pre-NVP-HSR to day 102
post NVP-HSR. Concentrations were determined by using the CBA kit internal standard controls and
normalised against the NVP-tolerant and NVP-naive healthy controls. Statistical significance was
determined using an analysis of variance (ANOVA) statistical analysis (p < 0.0001) and multiple
comparison tests (***p < 0.0001) to compare the concentration of each cytokine in Donor 1 (NVP-HSR)
to the concentration of the responding cytokine in the NVP-tolerant and NVP-naive healthy controls.
77
Donor 2 (NVP-HSR) showed an IFN-γ ELISpot response in the order of 300
SFU/million cells in NVP-exposed PBMC’s acquired 2 days post NVP-DRESS.
PBMC’s acquired 62 days post NVP-DRESS showed no detectable IFN-γ ELISpot
response (138). The cytokine plasma profile of Donor 2 (NVP-HSR) also showed
significant IL-6 release at day 1 post NVP-HSR which increased day 2 post NVP-
DRESS (Figure 3.9).
Figure 3.9: Cytokine plasma profile of Donor 2 (NVP-HSR) plasma obtained pre-NVP-DRESS to day
330 post NVP-DRESS. Concentrations were determined by using the CBA kit internal standard controls
and normalised against the NVP-tolerant and NVP-naive healthy controls. Statistical significance was
determined using an analysis of variance (ANOVA) statistical analysis (p < 0.0001) and multiple
comparison tests (***p < 0.0001) to compare the concentration of each cytokine in Donor 2 (NVP-HSR)
to the concentration of the responding cytokine in the NVP-tolerant and NVP-naive healthy controls.
78
Donor 3 (NVP-HSR), showed an IFN-γ ELISpot response in the order of 400
SFU//million cells in PBMC’s collected 97 days post NVP-DRESS induced and by day
476 post NVP-DRESS, no IFN-γ ELISpot response was detected. The cytokine
plasma profile of Donor 3 (NVP-HSR) showed no significant release of the cytokines
being analysed (Figure 3.10).
Figure 3.10: Cytokine plasma profile of Donor 3 (NVP-HSR) plasma obtained day 7 to day 727 post
NVP-HSR. Concentrations were determined by using the CBA kit internal standard controls and
normalised against the NVP-tolerant and NVP-naive healthy controls.
79
Analysis of the IL-6 plasma profile over the time course of a NVP-DRESS is shown in
Figure 3.11. Detectable levels of IL-6 in the plasma of the Donors at day 1 decreased
to insignificant levels in the Donors' plasma by day 12, post NVP cessation.
Figure 3.11: Plasma IL-6 cytokine profile of Donor 1 (NVP-HSR) and Donor 2 (NVP-HSR) (Donor 3
(NVP-HSR) not included), highlighting the potential of IL-6 having a role in NVP-HSR. Concentrations
were determined by using the CBA kit internal standard controls and normalised against the NVP-
tolerant and NVP-naive healthy controls. Statistical significance was determined using an analysis of
variance (ANOVA) statistical analysis (p < 0.0001) and multiple comparison tests to compare the
concentration of each cytokine to their respective pre-NVP plasma cytokine concentration
(***p < 0.0001).
80
3.5 Discussion
3.5.1 NVP-SCAR Associated HLA Class-I Binding Cleft
Characteristics
3.5.1.1 NVP- SCAR with hepatitis
A larger proportion of NVP-HSR involve the liver, with 80% of DRESS cases
presenting with clinical hepatitis (67). The validated HLA CREG supertype B*07, which
consists of a group of HLA alleles that share similarities in cross-reactivity of public
epitopes and binding cleft pocket chemistry and the MHCcluster pb-B*78 grouped
alleles, which share similar peptide-binding specificity, as predicted by NetMHCpan
2.8, showed a significant predictive association with NVP-HSR with hepatitis. After the
MHCcluster and binding cleft B-pocket structural analysis of the pb-B*78 group, the
HLA-B*55:01 and HLA-B*56:01 alleles both belonging to the CREG B*07 and pb-B*78
groups were found to be significant
Donor 2 (NVP-HSR) from the cytokine profile analysis, also possessed the
HLA-B*56:01 along with the HLA-C*04:03 allele also significant in NVP-SCAR. Donor
2 (NVP-HSR), experienced a fever, rash, eosinophilia and hepatitis, typical of DRESS,
on day 7 of a HAART regime containing NVP. Further analysis of the HLA-B*55:01
and HLA-B*56:01 alleles is required and future studies should include virtual modelling
to highlight the NVP-binding characteristics of HLA-B*55:01 and HLA-B*56:01.
Following that, setting up a series of peptide elution experiments and analysing the
peptide sequence data to show the binding characteristics of peptides would further
our understand of any potential interaction between the drug and how it influences the
peptides being presented. This work will lead to designing a working model for how
NVP generates neo-antigens, which can then be tested ex-vivo.
3.5.1.2 NVP- SCAR
The HLA-C*04:01 was shown to have a significant predictive association to NVP-
SCAR across all the ethnic groups, despite the variations in allele frequency. The
unique F-pocket amino acid sequence possessed by HLA-C*04:01 is also shared by
HLA-C*05:01 and HLA-C*18:01 shown to be predictive in Caucasian and Africans,
respectively (Table 3.5). The HLA-C*04:01, -C*05:01 and -C*18:01 alleles, and other
common HLA-C alleles identified within the cohort were analysed and assigned to
specific peptide-binding groups, based on the binding specificities of the MHC Cluster
algorithm to see if they shared are similarities in their peptide-binding cleft structure
81
and/or peptide-binding capabilities which could then be translated back to increased
risk of NVP-rash associated SCAR.
The MHCcluster analysis the HLA-C*04:01, HLA-C*05:01, HLA-C*18:01, and other
related alleles prevalent in the cohort showed these alleles all preferred to bind 9mer
peptides with an Aspartic acid (D) at position 2 of the peptide (from the NH2 terminal
end) which interacts with binding cleft B-pocket (Figure 3.3 and Figure 3.4). Further
analysis of the MHCcluster assigned pb-C*18 and pb-C*05 groups, showed the alleles
within both groups shared the binding groove F-pocket residues (Table 3.6). A
multivariate analysis of the cohort showed the alleles which have a shared binding
cleft F-pocket were predictive in NVP-SCAR, but, when each individual race was
analysed, the F-pocket sequence remained significant only in Caucasians (Table 3.8).
While these pb-C*18 and pb-C*05 group alleles shared the same binding cleft
F-pocket, their binding cleft B-pocket varied. For example the pb-C*18 alleles HLA-
C*04:(01/07) share the same key B-pocket residues as HLA-C*14:(02/04) and the pb-
C*05 alleles HLA-C*05:(01/09) share the same key B-pocket residues as HLA-
C*03:(03/04) and HLA-C*08:(01/02/03) (Table 3.5). The shared binding cleft F-pocket
and variation in binding cleft B-pocket among these NVP-SCAR associated HLA-C
alleles would suggest the importance of the binding cleft F-pocket, in terms of NVP-
SCAR immunopathogenesis and the HLA-drug-TCR interaction. HLA-C*04:01 and the
other predictive HLA-B and HLA-C alleles should be used in future studies to explore
NVP-SCAR immunopathogenesis.
Virtual modelling analysis performed by colleagues at the University of Florida show a
preferential interaction between NVP and a region close to the B-pocket, and not the
F-pocket as one might have predicted based on shared binding cleft F-pocket (83-85).
Before proposing a working model for ex-vivo based analysis, more research into
peptide-binding within this HLA and how the drug may interact is needed. One method
includes setting up a series of peptide elution experiments and analysing the peptide
sequence data to find the binding characteristics of peptides. This work will lead to
designing a working model for how NVP generates neo-antigens, which can then be
tested ex-vivo.
3.5.2 Diminishing Ex-vivo PBMC’s Responses and NVP-HSR
Immunopathogenesis
This smaller study was part of a larger study involving NVP-SCAR
immunopathogenesis (138). While the first section of this chapter looked at the binding
82
characteristics of HLA class-I alleles, the second half looked to find the immunological
mechanism driving the NVP-DRESS by analysing the cytokine environment within the
donor’s plasma, over the time course of a NVP-DRESS reaction and recovery period.
We expected this might show changes in specific T-cell subpopulations, further
explaining the diminishing NVP-stimulated, PBMC IFN-γ responses supporting the
data presented in the paper by Keane et al. 2014 (138, 173).
As highlighted in Keane et al. 2014, Donor 1 (NVP-HSR) exhibited an increase in
Tregs cell numbers corresponded with diminishing IFN-γ ELISpot responses (138).
After this first analysis, PBMC’s samples were limiting. Therefore to discuss this
question and offer more data to complement the data published by Keane et al. 2014,
we assessed donor plasma over the time course of NVP-DRESS reaction to see if the
cytokine environment reflects the changes in specific T-cell subpopulations. If the
cytokine environment were to support the Tregs cell numbers corresponded with
diminishing IFN-γ ELISpot responses, we suspected to see an increase in cytokines
like IL-10, which can show changes in the IL-17/Treg balance. Several cytokines were
measured in patients over the time course of a NVP-DRESS reaction. Furthermore,
two of the Donors carried HLA allotypes that were identified as significant NVP-SCAR
predictors or potential predictors in Section 3.4 Results. Donor 2 (NVP-HSR) carried
both HLA-B*56:01 and HLA-C*04:03, and Donor 3 (NVP-HSR), HLA-C*04. Donor 1
(NVP-HSR) however, carried the previously identified HLA-B*14 / HLA-C*08 haplotype
alleles (146, 147)
Donor 1 (NVP-HSR) showed a detectable IFN-γ release at day 1 post
NVP-DRESS, which then decreased. Both Donor 1 (NVP-HSR) and Donor 2 (NVP-
HSR) both showed a significant IL-6 release within the first 8 days post NVP-DRESS.
Elevated IL-6 levels in plasma samples can be linked to numerous different
pathologies (196-198).
IL-6 is a proinflammatory and the elevated levels could result from the immune
reaction which is not particularly significant to NVP-DRESS and commonly
concentration of IL-6 are typically below 1pg/ml due to its short plasma half-life and
corticosteroids down regulate IL-6 expression (199). Elevated IL-6 plasma levels have
also been shown to proceed HHV-6 reactivation and has been associated with higher
HHV-6 viral load and progression to encephalitis and systemic inflammation in stem
cell transplantation patients who experience HHV-6 infection-related complications
(200, 201) This association to HHV-6 reactivation is significant as it has been
83
associated with some IM-ADR and has been linked to prolonged disease and severe
organ involvement, fever and, cutaneous symptoms plus hepatosplenomegaly, and
severe lymphocytopenia. The reactivation of HHV’s like HHV-6 and corresponding
virus-specific Tregs in patients with DRESS has been reported (202). The Donors in
this study showed no specific evidence of HSV-1, HSV-2, HHV-3 (VZV), CMV, EBV or
HHV-6 reactivation. However, all patients possessed IgG antibodies for HHV-6,
including Donor 2 (NVP-HSR), an infant at the time of NVP-DRESS.
The accelerated production of IL-6, especially by cytotoxic T cells in MS patients helps
these cytotoxic T cells to become more resistant to Tregs and is potent modifier of
early Tregs and cytotoxic T-cell interactions and communication (203, 204). Other
studies have also highlighted the importance of IL-6 and the balance between Tregs /
Th17 cells (208, 210). Given this increase in IL-6 and other studies that suggest
HHV-6 reactivation in DRESS, in particular before reactivation, and the importance of
IL-6 in Tregs/Th17 balance, IL-6 could be a cytokine important to NVP-DRESS
alongside other key factors like carriage specific HLA class-I alleles. One model we
propose is that the decrease in Tregs at the time of the reaction might be
driving NVP-DRESS and the return of Tregs during recovery, responsible for the NVP-
stimulated diminishing IFN-γ PBMC responses.
To further analyse this proposed model, future analysis should look at the expression
and quantification of inhibitory immune receptors; CTLA4, (cytotoxic T-lymphocyte-
associated protein 4 or CD152), PD-1 (Programmed Death 1), and/or PD-L1
(Programmed Death Ligand 1) (205-208). Ex-vivo experiments to assess this could
include monoclonal antibodies directed towards blocking these inhibitory immune
receptors, to see if the ex-vivo response can be recovered (205, 207, 208). While it
would have been preferential to perform this on the specific samples used in Keane et
al. 2014 and within this thesis, this could not be performed as samples were limited
and were used in the first study by Niamh Keane et al. 2014, hence the reason we
analysed the Donors' plasma cytokine environment.
84
85
Chapter 4
Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis:
Predicted HLA-Restricted Peptide Screening
86
87
4 4.1 Introduction
Chapter 1 (Section 1.3.2 Carbamazepine) highlighted the strong association between
HLA-B*15:02 and other B75 serotypes, including the HLA-B*15:08, -B*15:11, and -
B*15:21 alleles and CBZ-SJS/TEN (2, 209, 210). Based on a strong negative
predictive values associated with HLA-B*15:02 carriage (100% in Han Chinese), the
Food and Drug Administration (USA) and similar regulatory agencies of different
countries have recommended that genetic screening for HLA-B*15:02 for those of
South-east Asian ancestry, before CBZ therapy and that all HLA-B*15:02 carriers,
should not be administered CBZ, unless the benefits outweigh the risks (101).
However, the low/incomplete positive predictive value of HLA-B*15:02 carriage (3.3-
7% in Han Chinese) illustrates how carriage is necessary but not enough to explain
CBZ-SJS/TEN pathogenesis and other factors must also play a role in driving CBZ-
SJS/TEN.
As explained in Chapter 1 (Section 1.4 Established Models of HLA-driven delayed
Immunologically Mediated-Adverse Drug Reactions), a considerable amount of
evidence supports the heterologous immune model as a mediator of organ transplant
rejection (9, 10, 12, 16-19). In organ transplantation, an overabundance of neo-
antigens are presented to the hosts immune system, which can be cross-recognised
by pre-existing class-I memory T cells, created in response to prevalent viruses, like
those of the Herpesviridae family. (54-60) Similar to organ transplantation, IM-ADR
presents a novel situation, in which neo-antigens can be created by the off-target drug-
HLA interaction, which are then cross-recognised by epitope-specific class-I memory T
cells. Epitope-specific class-I memory T cells might determine CBZ-SJS/TEN
development in individuals who carry the at-risk HLA allele. Increasing the ability to
predict HLA-B*15:02-CBZ-SJS/TEN and further our understanding of the
immunopathogenic mechanisms driving these reactions.
88
4.2 Hypothesis and Aims
Hypothesis
A proportion of the HSV-1 and/or HSV-2 HLA-B*15:02-restricted peptides can induce a
specific HLA-B*15:02-epitope memory T-cell response shared in patients who
experience a CBZ-SJS/TEN reaction.
Aim
To identify several in-silico predicted HLA-B*15:02-restricted HSV-1/HSV-2 peptides
which may elicit responses in the CBZ-SJS/TEN patient’s ex-vivo. Once identified, the
aim is to isolate and expand the HSV-1/HSV-2 specific memory T cells in-vitro for
future analysis of the cross-reactivity model.
4.3 Methods
4.3.1 Samples and Controls
The Controls and Donors used in this chapter, with a complete description, are listed
in Table 2.2 Chapter 2 Materials and Methods, Section 2.1.2 Carbamazepine -
Induced Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis.
4.3.2 In-Silico HLA-B*15:02-restricted Peptide Predictions
Several HLA-B*15:02-restricted HSV-1 (strain 17) and HSV-2 (strain HG52) 9-11mer
peptides were predicted by Bioinformatics colleagues at The Institute for Immunology
and Infectious Diseases, Murdoch University, Perth, Australia using in-silico epitope
mapping methods which involved Net-MHC3.2 based algorithms, combined with a
novel measure of “targeting efficiency” developed in collaboration with Microsoft
research (Table 4.3) (169, 170, 188-190) Based on personal communications, 42
predicted HLA-B*15:02-restricted peptides were synthesised for ex-vivo analysis,
highlighted Table 4.1 and Table 4.2 (169, 170). Listed in Table 4.2, are variants of the
HSV-1/HSV-2 shared peptide, YAHGHSLRLPY and a control peptide, which were also
synthesised and analysed as the results dictated (211).
89
Table 4.1: In-silico predicted HSV-1 and HSV-2, HLA-B*15:02-restricted peptides which were
synthesised and analysed ex-vivo (169, 170, 188, 189).
HSV-1 PROTEIN SEQUENCE ID
POSITION (Amino acid)
FAFTINIAAY DNA packaging tegument protein UL17 ref|NP_044618.1 667-676
FTFGGGYVY envelope glycoprotein B UL27 ref|NP_044629.1 641-649
FVYTPSPY tegument protein UL21 ref|NP_044622.1 161-168
HMRTLSAF tegument protein UL37 ref|NP_044639.1 773-780
ISYSSGAIAAF capsid portal protein UL6 ref|NP_044607.1 555-565
LAFVLDSPSAY envelope glycoprotein H UL22 ref|NP_044623.1 476-486
LAYNGSAY envelope glycoprotein I US7 ref|NP_044669.1 172-179
MAIAAEGTLAY envelope glycoprotein I US7 ref|NP_044669.1 164-174
MLRRRGEAY large tegument protein UL36 ref|NP_044638.2 1926-1934
NMYAKLSGAF helicase-primase helicase subunit UL5 ref|NP_044606.1 128-137
SMVPTGQAF helicase-primase primase subunit UL52 ref|NP_044655.1 539-547
YANAASGAF envelope protein UL43 ref|NP_044645.2 59-67
YTYARVFAF helicase-primase helicase subunit UL5 ref|NP_044606.1 731-739
FPAAAGSVAY capsid scaffold protein UL26.5 / capsid maturation protease UL26
ref|NP_044628.1 ref|NP_044627.1
48-57 354-363
HMRARTSAPY capsid scaffold protein UL26.5 / capsid maturation protease UL26
ref|NP_044628.1 ref|NP_044627.1
188-197 494-503
HSV-2 PROTEIN SEQUENCE ID
POSITION (Amino acid)
AMFAGLCAF envelope glycoprotein B UL27 ref|NP_044497.1 727-735
FAFTINTAAY DNA packaging tegument protein UL17 ref|NP_044486.1 666-675
FTINTAAY DNA packaging tegument protein UL17 ref|NP_044486.1 668-675
FAREYTTLAF helicase-primase subunit UL8 ref|NP_044477.1 208-217
FAYTPSPY tegument protein UL21 ref|NP_044490.1 161-168
FLFYPDPTY nuclear egress lamina protein UL31 ref|NP_044501.1 201-209
FLVAACAAAY capsid triplex subunit 1 UL38 ref|NP_044508.1 189-198
FLWDRHAQRAY envelope glycoprotein L UL1 ref|NP_044470.1 82-92
FQHQYIPAY capsid portal protein UL6 ref|NP_044475.1 509-517
LAFVLDSPAAY Envelope glycoprotein H UL22 ref|NP_044491.1 476-486
FVLDSPAAY Envelope glycoprotein H UL22 ref|NP_044491.1 478-486
LLASSGFAF envelope glycoprotein H UL22 ref|NP_044491.1 385-393
MAFRASGPAY membrane protein UL45 ref|NP_044515.1 1-10
MARGAGLVF envelope glycoprotein E US8 ref|NP_044538.1 1-9
YAQYMSRAY envelope glycoprotein H UL22 ref|NP_044491.1 352-360
SMFAYVKPM DNA replication origin-binding helicase UL9 ref|NP_044478.1 380-388
DTAFAFNPY large tegument protein UL36 ref|NP_044506.1 1388-1396
TAFAFNPY large tegument protein UL36 ref|NP_044506.1 1389-1396
HMRARTHAPY capsid scaffold protein UL26.5 / capsid maturation protease UL26
ref|NP_044496.1 ref|NP_044495.1
188-197 496-505
HSV Herpes simplex virus; HLA-B, Human leukocyte antigen B.
90
Table 4.2: In-silico predicted HSV-1 and HSV-2 shared, HLA-B*15:02-restricted peptides and variants of
the HSV-1 and HSV-2 shared peptide, YAHGHSLRLPY which were synthesised and analysed, ex-vivo
(169, 170, 188, 189).
HSV-1/2 shared
PROTEIN SEQUENCE ID
POSITION (Amino acid)
ELFPGHPVY large tegument protein HSV 1 UL36 ref|NP_044638.2 2488-2496
large tegument protein HSV 2 UL36 ref|NP_044506.1 2486-2494
EQFSLSSY envelope protein HSV 1 UL20 ref|NP_044621.1 31-38
envelope protein HSV 2 UL20 ref|NP_044489.1 31-38
FAASFAAIAY ribonucleotide reductase subunit 2 HSV 1 UL40 ref|NP_044642.1 191-200
ribonucleotide reductase subunit 2 HSV 2 UL40 ref|NP_044510.1 188-197
FLMHAPAF envelope glycoprotein D HSV 1 US6 ref|NP_044668.1 176-183
envelope glycoprotein D HSV 2 US6 ref|NP_044536.1 176-183
YMAKLHAY helicase-primase helicase subunit HSV 1 UL5 ref|NP_044606.1 404-411
helicase-primase helicase subunit HSV 2 UL5 ref|NP_044474.1 403-410
YMALVSAM envelope glycoprotein B HSV 1 UL27 ref|NP_044629.1 849-856
envelope glycoprotein B HSV 2 UL27 ref|NP_044497.1 849-856
YTFKTYQVF DNA packaging protein HSV 1 UL32 ref|NP_044634.1 552-559
DNA packaging protein HSV 2 UL32 ref|NP_044502.1 555-562
YAHGHSLRLPY helicase-primase primase subunit HSV 1 UL52 ref|NP_044655.1 811-821
helicase-primase primase subunit HSV 2 UL52 ref|NP_044523.1 823-833
HSV-1/2 shared PROTEIN SEQUENCE ID
POSITION (Amino acid)
AHGHSLRLPY Variant of YAHGHSLRLPY UL52
HGHSLRLPY Variant of YAHGHSLRLPY UL52 ref|NP_044655.1 811-821
YA_G_SLRLPY Variant of YAHGHSLRLPY UL52 and
YAHG_SLRLPY Variant of YAHGHSLRLPY UL52 ref|NP_044523.1 823-833
YA_GHSLRLPY Variant of YAHGHSLRLPY UL52
VZV (HHV3)
YSHGHSLRLPF helicase-primase primase subunit ORF6 ref|NP_040129.1 855-865
M. tuberculosis
NIRQAGVQY ESAT-6-like protein EsxB (M. tuberculosis)
ref|WP_009937166.1 72-80
HSV Herpes simplex virus; HLA-B, Human leukocyte antigen B.
4.3.3 Ex-vivo analysis of in-silico derived
HLA-B*15:02-restricted peptides.
The IFN-γ ELISpot assays and tetramer based flow cytometry methods, outlined in
Chapter 2, Section 2.2. Cellular assays were used to assess the
in-silico predicted HLA-B*15:02-restricted HSV-1/HSV-2 peptides, ex-vivo. Figure 4.1
includes an example of the raw ELISpot results from which spot forming unit/per one
million cells (SFU/million cells) were derived. SFU/million cells were calculated based
on the original cell number input and the spots counted, minus the background
response determined by the negative or solvent control SFU/million result. The mean
SFU/million cells (+/- Standard Deviation (SD)) were calculated with a minimum of
91
three replications per peptide. De novo sequencing by mass spectrum analysis was
performed by Proteomics International (Perth, Western Australia), as the research
dictated. Statistical analysis and graphical representations were calculated using
GraphPad Prism software Version 5.02 (GraphPad Software Inc., California, USA).
Table 4.3: Distribution of the work within Chapter 4 and accreditation to those who contributed.
Work performed Accreditation
In-silico predictions of
HSV-1/HSV-2 HLA-B*15:02- restricted peptides
Bioinformatics staff at IIID
Patient clinical analysis Elizabeth Phillips
Peptide de novo Sequencing and Mass
spectrometry analysis
Proteomics International
Ex-vivo analysis of predicted HSV-1/HSV-2 HLA-
B*15:02- restricted peptides
Craig Rive
HSV-1, HSV-2; herpes simplex virus type 1 and 2, HLA, human leukocyte antigen
Figure 4.1: Example IFN-γ ELISpot raw data. The unstimulated background and solvent controls
(DMSO/DMF at 1μL/mL), positive controls anti-CD3 antibody (wells B1 and B2 0.1μg/mL) and SEB
(wells B3 and B4 1μg/mL) responses at 200,000 cells per well. The test positive and test negative
responses highlight the typical positive and negative response to the test stimulant (drug or peptide
10μg/mL) with an input of 50,000 and 200,000 cell per well.
92
4.4 Results
4.4.1 Ex-vivo analysis of in-silico derived
HLA-B*15:02-restricted peptides.
4.4.1.1 IFN-γ ELISpot.
Figure 4.2 to Figure 4.7 shows the predicted HLA-15:02-restricted peptides which
elicited immune responses in CBZ-SJS/TEN Donor, and CBZ-naive control PBMC
samples. Figure 4.8 emphasises the key predicted HLA-15:02-restricted peptides
which elicited immune responses in more than one of the CBZ-SJS/TEN Donors.
These include the YAHGHSLRLPY HSV-1/2 shared peptide (Table 4.2) and the
LAFVLDSPSAY HSV-1 peptide (Table 4.1), compared to previously identified HLA-
B*15:(01:02)-restricted M. tuberculosis peptide, NIRQAGVQY initially used as a
control and the FAFTINITY HSV-2 peptide which only elicited an immune response in
Donor 2 (SJS) (211). Given the HSV-1 positive serological status for Control 1 (CBZ-
naive) (Table 2.2), the HSV-1 and shared HSV-1/HSV-2 predicted HLA-15:02-
restricted peptides could also elicit immune responses as seen in the shared
ELFGHPVY HSV-1/2 epitope response. No responses were predicted to occur in both
Donor 4 (CBZ-SJS non-B*15:02) (Figure 4.5) and Control 2 (CBZ-naive non-B*15:02)
(Figure 4.7), unless the predicted HLA-B*15:02-restricted peptides exhibited HLA
class-I allele promiscuity (212, 213). Figure 4.5 shows a response to the already
mentioned LAFVLDSPSAY HSV-1 peptide in Donor 4 (CBZ-SJS non-B*15:02). The
cut-off for positive response was determined to be 50 SFU/million cells.
93
Figure 4.2 The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 1 (CBZ-TEN) were
determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
94
Figure 4.3: The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 2 (CBZ-SJS) were
determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
95
Figure 4.4: The Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 3 (CBZ-SJS) were
determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
96
Figure 4.5: Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 4 (CBZ-SJS non- B*15:02) were
determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
97
Figure 4.6: Mean (+/- SD) IFN-γ responses SFU/million cells in Control 1 (CBZ-naive) were determined
using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive
responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
98
Figure 4.7: Mean (+/- SD) IFN-γ responses SFU/million cells in Control 2 (CBZ-naive non-B*15:02) were
determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for
positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation (n=3).
99
Figure 4.8: Mean (+/- SD) IFN-γ responses SFU/million cells to CBZ and predicted HLA-B*15:02-
restricted peptides identified in Figure 4.2 to Figure 4.7, determined using ELISpot, described in
Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red
line). Error bars represent intra-sample variation (n=3).
4.4.1.2 IFN-γ ELISpot dose-dependent responses
The affinity of cellular responses to decreasing peptide concentrations (10, 1, and
0.1 μg/mL) was assessed through the IFN-γ ELISpot assay. The cellular immune
responses to the of the predicted HSV-1/2 peptide YAHGHSLRLPY and the predicted
HSV-1 peptide LAFVLDSPSAY showed a significant decrease in SFU/million cells in
relationship to the concentration of the peptide in all three CBZ-SJS/TEN, HLA-
B*15:02 positive Donors (Figure 4.9 and Figure 4.10). The TB peptide NIRQAGVQY
100
show a decrease in SFU/million cells in Donor 1 (CBZ-TEN) and Donor 2 (CBZ-SJS);
but in Donor 3 (CBZ-SJS) no statistical significance was determined (Figure 4.11). No
significant decrease was seen in SFU/million cells in relationship to the HSV-2 peptide
FAFTINTAAY concentration in the CBZ-SJS/TEN, HLA-B*15:02 positive Donors
(Figure 4.12).
Figure 4.9: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing concentrations of the
predicted HLA-B*15:02-restricted peptide, YAHGHSLRLPY in the three HLA-B*15:02 positive Donors
were determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a
concentrations of 0.1 μg/ml, 1 μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3)
and the p values were determined using the Pearson correlation test (*p < 0.05).
101
Figure 4.10: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing concentrations of the
predicted HLA-B*15:02-restricted peptide, LAFVLDSPSAY in the three HLA-B*15:02 positive Donors
were determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a
concentrations of 0.1 μg/ml, 1 μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3)
and the p values were determined using the Pearson correlation test (*p < 0.05).
102
Figure 4.11: Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing concentrations of the
predicted HLA-B*15:02-restricted peptide, NIRQAGVQY in the three HLA-B*15:02 positive Donors
were determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a
concentrations of 0.1 μg/ml, 1 μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3)
and the p values were determined using the Pearson correlation test (*p < 0.05)
103
Figure 4.12 Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing concentrations of the
predicted HLA-B*15:02-restricted peptide, FAFTINTAAY in the three HLA-B*15:02 positive Donors
were determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a
concentrations of 0.1 μg/ml, 1 μg/ml, and 10 μg/ml. Error bars represent intra-sample variation (n=3).
104
4.4.1.3 Variant YAHG_SLRLPY peptide analysis
Purified versions of the responsive peptides were used to make B*15:02 tetramers.
Tetramer grade peptides were tested ex-vivo to confirm the newly synthesised peptide
before tetramer folding and staining. The tetramer grade HSV-1/2-restricted
YAHGHSLRLPY peptide, failed to replicate the responses seen in the original IFN-γ
ELISpot analysis. The original and tetramer folding YAHGHSLRLPY peptides were
analysed independently by Proteomics International and through personal
correspondence, it was determined that the original YAHGHSLRLPY peptide product
contained several potential variants which may be responsible for the original
response (Figure 4.15). The MS analysis highlighted the original YAHGHSLRLPY
product contained variants of the original peptide in which one or both the Histidine (H)
residues were missing, as highlighted by the peaks with a mass of approximately 1176
(>60% intensity) and 1040 (>40% intensity).
Figure 4.13 MS/MS analysis of YAHGHSLRLPY, original responsive peptide (left) and pure form for
tetramer folding (right). A Spectrum was obtained in de novo peptide analysis via the MALDI TOF MS
(4800 Proteomics analyser).
105
A series of variant were synthesised following the same IFN-γ ELISpot analysis used
above, it was determined the variant peptide YAHG_SLRLPY missing the 5th amino
acid, (Histidine) was responsible for the original responses.
The IFN-γ ELISpot screening of the predicted HLA-B*15:02-restricted HSV-1/2 shared
peptide, YAHGHSLRLPY and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY in the Donor and Control PBMCs (Figure 4.14)
highlighted the significance of the YAHG_SLRLPY variant. Figure 4.21 shows affinity
of T cell responses to decreasing ex-vivo concentrations the variant YAHG_SLRLPY
peptide. Following this, tetramers were made for the YAHG_SLRLPY variant,
LAFVLDSPSAY and NIRQAGVQY as outlined in Chapter 2, Materials and Methods,
Section 2.2.2.3 Tetramers and Flow cytometry flow cytometry assays were performed
as outlined in Chapter 2 Materials and Methods, Section 2.2.2 Flow Cytometry
106
Figure 4.14 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 1 (CBZ-TEN) to the
YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY, YA_GHSLRLPY, and
YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3.
Cut-off for positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3).
107
Figure 4.15 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 2 (CBZ-SJS) to the
YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY, YA_GHSLRLPY, and
YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3.
Cut-off for positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3).
108
Figure 4.16 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 3 (CBZ-SJS) to the
YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY, YA_GHSLRLPY, and
YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3.
Cut-off for positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3).
109
Figure 4.17 Mean (+/- SD) IFN-γ responses SFU/million cells in Donor 4 (CBZ-SJS
non- B*15:02) to the YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-
Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line). Error bars
represent intra-sample variation (n=3).
110
Figure 4.18 Mean (+/- SD) IFN-γ responses SFU/million cells in Control 1 (CBZ-naive) to the
YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY, YA_GHSLRLPY, and
YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3.
Cut-off for positive responses, 50 SFU/million cells (red line). Error bars represent intra-sample variation
(n=3).
111
Figure 4.19 Mean (+/- SD) IFN-γ responses SFU/million cells in Control 2 (CBZ-naive
non- B*15:02) to the YAHGHSLRLPY peptide and the missing histidine variants, YAHG_SLRLPY,
YA_GHSLRLPY, and YA_G_SLRLPY determined using ELISpot, described in Chapter 2, Enzyme-
Linked ImmunoSpot 2.2.3. Cut-off for positive responses, 50 SFU/million cells (red line). Error bars
represent intra-sample variation (n=3).
112
4.4.1.4 YAHG_SLRLPY dose-dependent IFN-γ ELISpot
responses
The affinity of cellular responses to decreasing variant peptide YAHG_SLRLPY
concentrations (10, 1, and 0.1 μg/mL) was assessed through the IFN-γ ELISpot assay.
The cellular immune responses to the of the predicted HSV-1/2 variant peptide
YAHG_SLRLPY showed a significant decrease in SFU/million cells in relationship to
the concentration of the peptide in all three CBZ-SJS/TEN, HLA-B*15:02 positive
Donors (Figure 4.25), but not in Donor 4 (CBZ-SJS non-B*15:02).
Figure 4.20 Mean (+/- SD) IFN-γ responses SFU/million cells to the increasing concentrations of the
predicted HLA-B*15:02-restricted variant peptide, YAHG_SLRLPY in the three HLA-B*15:02 positive
CBZ-SJS/TEN Donors and Donor 4 (CBZ-SJS non-B*15:02) were determined using ELISpot,
described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3 with a concentrations of 0.1 μg/ml, 1 μg/ml,
and 10 μg/ml. Error bars represent intra-sample variation (n=3) and the p values were determined using
the Pearson correlation test (*p < 0.05) and r2 values non-linear regression analysis (n=4)
113
4.4.1.5 Predicted peptide tetramer staining
B*15:02 tetramers where constructed using the variant YAHG_SLRLPY
HSV-1/2 shared peptide, the LAFVLDSPSAY HSV-1 peptide, and the NIRQAGVQY
M. tuberculosis peptide, to confirm these identified peptides are
HLA-B*15:02-restricted and recognised by CD8+ T cells. The tetramer responses show
that all three peptides are HLA-B*15:02-restricted epitopes, that are recognised by
CD8+ T cells (Figure 4.21 to Figure 4.25).
Figure 4.21: Donor 1 CBZ-TEN, B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and NIRQAGVQY tetramer
stain, performed as outlined in Chapter 2, Tetramers 2.2.2.3. Samples were compared to negative
control which consisted of unstained sample spiked with PE and washed out as per the Tetramer
staining protocol. Error bars represent intra-sample variation (n=5).
114
Figure 4.22: Donor 2 (CBZ-SJS), B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and NIRQAGVQY
tetramer stain performed as outlined in Chapter 2, Tetramers 2.2.2.3. Samples were compared to
negative control which consisted of unstained sample spiked with PE and washed out as per the
Tetramer staining protocol. Error bars represent intra-sample variation (n=5).
Figure 4.23: Donor 3 (CBZ-SJS), B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and NIRQAGVQY
tetramer stain performed as outlined in Chapter 2, Tetramers 2.2.2.3. Samples were compared to
negative control which consisted of unstained sample spiked with PE and washed out as per the
Tetramer staining protocol. Error bars represent intra-sample variation (n=5).
115
Figure 4.24: Control 2 (CBZ-naive non-B*15:02), B*15:02-YAHG_SLRLPY, LAFVLDSPSAY, and
NIRQAGVQY tetramer stain performed as outlined in Chapter 2, Tetramers 2.2.2.3. Samples were
compared to negative control which consisted of unstained sample spiked with PE and washed out as
per the Tetramer staining protocol. Error bars represent intra-sample variation (n=5).
4.5 Discussion
This chapter examined methods to screen CBZ-SJS/TEN patients potential cross-
reactive memory T-cell responses to HLA-B*15:02-restricted HSV-1 and HSV-2
peptides. A series of predicted HLA-B*15:02-restricted HSV-1 and/or HSV-2 peptides
were identified through in-silico based predicted HLA-restricted epitope mapping. The
ex-vivo analysis identified several predicted peptides which matched the hypothesis
predictions, in that a proportion of the HSV-1 and/or HSV-2 HLA-B*15:02-restricted
peptides can induce a specific HLA-B*15:02-epitiope memory T-cell response shared
in patients who experience a CBZ-SJS/TEN reaction. These included the HSV-1,
envelope glycoprotein H derived peptide, LAFVLDSPSAY (UL22, AA 476-486), the
HSV-1/HSV-2 shared Helicase-primase-primase subunit (UL52, AA 811-821 and 823-
833, in HSV-1 and HSV-2 respectively) peptide, YAHGHSLRLPY and the previously
identified M. tuberculosis ESAT-6-like protein EsxB derived peptide, NIRQAGVQY (AA
72-80).
The pure YAHGHSLRLPY peptide failed to illicit the same response the original
peptide product in repeated IFN-γ ELISpot experiments. Both the original and pure
116
YAHGHSLRLPY peptide products were analysed via mass spectrometry. The mass
spectra analysis showed that the original YAHGHSLRLPY peptide product had at least
three possible variants of the YAHGHSLRLPY, with a loss of a histidine (H) at position
3 and/or 5. The YAHG_SLRLPY variant, missing the 5th Histidine (H), gave the
greatest IFN-γ ELISpot responses, ex-vivo.
A Basic Local Alignment Search Tool (BLAST) search of the National Centre for
Biotechnology Information (NCBI) protein database using the YAHG_SLRLPY atypical
epitope showed the specific-YAHG_SLRLPY amino acid sequence matched none of
the reference protein sequences in the NCBI protein database and one possibility is
that the cellular immune response generated by this atypical epitope is an artefact of
ex-vivo analysis (169, 188, 189, 214). The original YAHGHSLRLPY peptide originates
from a highly conserved region of the UL52 protein in all the various strains of HSV-1
and HSV-2 that have been identified and published. (169, 188, 189, 214). It should be
noted that not finding a match in a BLAST search does not suggest this specific
atypical epitope does not exist, it merely suggests it does not exist in any identified
and published sequence contained within the specific databases.
The identification of such an atypical epitope has a remarkable impact on our
understanding of immunological and/or virological processes. We need to better
understand the mechanisms behind ambiguous transcription, translation, protein
folding, degradation, and epitope synthesis before we can understand the efficiency
and frequency of atypical epitopes. Several debated mechanisms have been
identified, which could cause atypical epitope generation. (215-220) These include the
DRiP hypothesis which describes substandard polypeptides developing from
alternative and/or defective mRNAs, ribosomal frameshifts, downstream initiation
on genuine mRNAs, and other errors inherent in translation including tRNA-amino acid
misacylation. (221-230) Using the netChop 3.1 program to analysing YAHGHSLRLPY
and surrounding amino acids within the HSV-1 and HSV-2 Helicase-primase-primase
subunit, four cleavage sites were predicted (231). The four cleavage sites included the
5th histidine (H), and the 1st tyrosine (Y) and both leucine residues (L), but the netChop
program is rather underdeveloped (231).
The HLA-B*15:02-restricted peptides LAFVLDSPSAY and NIRQAGVQY produced
positive tetramer responses, in at least one of the three CBZ-SJS/TEN, HLA-B*15:02
positive donors. As we could not determine the M. tuberculosis serology of the Donors
and Controls, the positive NIRQAGVQY tetramer response in Donor 2 (SJS) is of
117
interest. The majority M. tuberculosis infections are latent and asymptomatic and this
specific epitope is not one of the 483 T-cell epitopes in 12 BCG vaccine strains,
according to Skjøt et al., 2002. The NIRQAGVQY epitope is one of four recognised by
CD8+ T cells that Li et al. 2014 identified as important for the development of M.
tuberculosis peptide-based vaccines and for improved diagnosis of TB in humans
(211, 232). The identification of NIRQAGVQY-specific CD8+ T cells either means the
patient has or had a TB infection or the epitope is non-specific.
The assessment of three HLA-B*15:02-restricted CBZ-SJS/TEN donors is not powerful
enough to exclude the HLA-B*15:02-restricted peptide LAFVLDSPSAY and while the
hypothesis originally stated that a specific HSV-1/HSV-2 epitope HLA-B*15:02-
restricted memory T-cell response shared in patients who experience a CBZ-SJS/TEN
reaction cross-reacts with neo-antigens derived by the off-target actions of drugs with
high-risk HLA alleles, it is also probable that several of HSV-1/HSV-2 epitope HLA-
B*15:02-restricted memory T-cell response are associated with CBZ-SJS/TEN. Ideally
more predicted HLA-B*15:02 restricted HSV-1 / HSV-2, peptides should be screened
before proceeding. Given the association between the CBZ-TEN reaction and the
acute HZ experienced by Donor 1 (CBZ-TEN) in-silico epitope mapping strategies
should also be extended to generating several HLA-restricted VZV peptides.
Further analysis is required, involving more CBZ-SJS/TEN donors and CBZ-naive and
CBZ-tolerant controls which have been hard to acquire. In the recent paper by Jing et
al., 2016 showed recognition of VZV-infected cells, proteins, and peptides by
polyclonal HSV-1–driven CD8 T cells (233). Along with the detection of cross-
reactivity, this paper also discovered several novel cross-reactive
T-cell epitopes, including one HLA-B*15:02-restricted HSV / VZV cross-reactive T-cell
epitope which was found using PBMC’s acquired from the same donor used in this
study, Donor 1 (233). Future experiments should include the assessment of this newly
identified VZV / HSV epitope, following the method and experimentation outlined in
this chapter. If the newly identified VZV / HSV epitope can fulfil the requirements as
the atypical YAHG_SRLPY HSV-1 / HSV-2 epitope has, both these epitopes can be
used in future studies into the immunopathogenesis of HLA-B*15:02-restricted CBZ-
SJS/TEN.
118
119
Chapter 5
Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis:
Specific T-cell Clonotype and Detection by Digital Droplet PCR
120
121
5 5.1 Introduction
This chapter will continue on this exploration of the heterologous immune model by
assessing specific cross-reactive TCR associated with HLA-B*15:02-resticted CBZ-
SJS/TEN. A strong association between HLA-B*15:02 CBZ-SJS/TEN in those of
South-east Asian ancestry has been established (2, 209, 210). Based on a strong
negative predictive values associated with HLA-B*15:02 carriage (100% in Han
Chinese), the Food and Drug Administration (USA) and similar regulatory agencies of
different countries have recommended that genetic screening for HLA-B*15:02, in
those of South-east Asian ancestry, before CBZ therapy and that all HLA-B*15:02
carriers, should not be administered CBZ, unless the benefits outweigh the risks (101).
The low/incomplete positive predictive value of HLA-B*15:02 carriage illustrates how
carriage is necessary, but not enough to explain CBZ-SJS/TEN pathogenesis and
other factors must also play a role in driving CBZ-SJS/TEN.
The heterologous immunity model explains, not only the variation of tissue distribution
between different clinical delayed IM-ADR, but also the low positive predictive value of
HLA-B*15:02 carriage in CBZ-SJS/TEN by explaining what is driving
immunopathogenesis. This study looked at expanding CBZ-specific T cells (CD8+ T
cells) to see if the patients in this study carried the oligoclonal CBZ-specific public TCR
sequences previously identified in Ko et al. 2011 (176). Through the development of a
Bio-Rad QX100/200 ddPCR assay, the mRNA expression of the CBZ-specific public
TCR sequences, Vβ 25-1*01 (Vβ 11s1) CDR3 CASSISGSY and CASSGLADVDN
sequences were analysed (176, 234). The Vβ 12-3/4*01 CDR3 CASSLAGELF was
identified in the analysis of CBZ-SJS/TEN patients blister fluid by colleagues at the
National Yang-Ming University and Chang Gung Memorial Hospital in Taiwan and
through personal communications with them, was also assessed (Table 5.1).
122
5.2 Hypothesis and Aims
Hypothesis
Patients that have experienced a CBZ-SJS/TEN share a subset of oligoclonal T cells,
previously identified CBZ-specific public TCR sequences Vβ 25-1*01 (Vβ 11s1) CDR3
CASSISGSY / CASSGLADVDN or the newly identified Vβ 12-3/4*01 CDR3
CASSLAGELF sequence.
Aims
To expand CBZ-specific T cells and identify specific CDR3 sequences in a novel
ddPCR assay (176).
5.3 Methods
5.3.1 Samples and Controls
The Controls and Donors used in this chapter, with a complete description, are listed
in Table 2.2 Chapter 2 Materials and Methods, Section 2.1.2 Carbamazepine -
Induced Stevens - Johnson syndrome and Toxic Epidermal Necrolysis.
5.3.2 Experimental Assays and Analysis
The stimulation and expansion culture outlined in Chapter 2, Materials and Methods
Section 2.2.1 Drug Stimulation and Cellular Expansion, was used to stimulate and
expand polyclonal T cells. The IFN-γ ELISpot assays and ICS flow cytometry outlined
in Chapter 2, Section 2.2 were used to assess the CBZ-associated immune
responses. Figure 5.1 includes an example of the raw ELISpot results from which spot
forming unit/one million cells (SFU/million cells) was derived and an example of the
ICS flow cytometry raw data plots from which the CD8+ T-cell IFN-γ response to CBZ
was detected both pre- and post-stimulation is shown in Figure 5.2. Statistical analysis
and graphical representations were calculated using GraphPad Prism software
Version 5.02 (GraphPad software Inc., California, USA).
RNA was extracted from T cells acquired from pre-stimulation and
post-stimulation and expansion, and converted to cDNA as highlighted in Chapter 2,
Section 2.4.1 RNA isolation and complementary DNA conversion. The cDNA was
used in the ddPCR assay to amplify and detect the specific TCR Vβ CDR3 sequences.
QX100/200 raw data output was analysed using the QuantaSoft software (Version
123
1.5.38.1118). As outlined in Chapter 2, Digital Droplet PCR 2.4.2 and in Appendix 9,
Section 9.2 the forward and reverse primers listed in Table 2.17 were validated using
the reference cDNA sequence. For the ddPCR specific Vβ CDR3 TCR analysis,
expression levels were normalised using RPPH1 gene expression and reported as a
percentage of normalised Cβ mRNA expression levels. Statistical analysis and
graphical representations were calculated using GraphPad Prism software Version
5.02 (GraphPad software Inc., California, USA).
Table 5.1: Distribution of the work within this chapter and accreditation to those who contributed
Work performed Accreditation
Information about the specific Vβ CDR3 TCR
sequences to target in ddPCR assays
Ko et al. 2011 (176)
and personal correspondence with
colleagues at Taipei Taiwan and
Chang Gung Memorial Hospital
Patient Phenotype and clinical analysis Elizabeth Philips
Ex-vivo analysis of CBZ-stimulated T cells Craig Rive
ddPCR assay development Craig Rive
Vβ, variable beta; CDR3, complementarity-determining region 3; TCR, T-cell receptor, ddPCR; digital droplet PCR.
5.4 Results
5.4.1 ELISpot and ICS Flow Cytometry responses in Donor
and Control cells pre- and post- CBZ stimulation and
expansion
The IFN-γ responses to both pre- and post- cellular stimulation and expansion cultures
were assessed using ELISpot and ICS, to show the T-cell expansion culture was
successful in expanding polyclonal T cells, some of which are CBZ-specific CD8+ T
cells. Statistically significant increases in T-cell IFN-γ responses were seen in the
three CBZ-SJS/TEN Donors CBZ-stimulated and expanded culture cells, when re-
exposed to CBZ compared to the controls (Donor 1 (CBZ-TEN) and Donor 2 (CBZ-
SJS) (***) p value < 0.0001, Donor 3 (CBZ-SJS) (*) p value < 0.05 Figure 5.1). ICS
IFN-γ flow cytometry analysis shows an increase in IFN-γ expression by CD8+ T cells
in the three CBZ-SJS/TEN Donors CBZ-stimulated and expanded cells when re-
exposed to CBZ compared to the controls (Figure 5.1).
124
Figure 5.1: Left: Example IFN-γ ELISpot raw data. The unstimulated background and solvent controls
(DMSO/DMF at 1μL/mL), positive controls anti-CD3 antibody (wells B1 and B2, 0.1μg/mL) and SEB
(wells B3 and B4, 1μg/mL) responses at 200,000 cells per well. The test positive and test negative
responses highlight the typical positive and negative response to the test stimulant (drug or peptide
10μg/mL) with an input of 50,000 and 200,000 cell per well. Right: Mean (+/- SD) IFN-γ responses
SFU/million cells in CBZ-SJS/TEN Donors and Controls, both pre- and post-CBZ stimulation and
culture, were determined using ELISpot, described in Chapter 2, Enzyme-Linked ImmunoSpot 2.2.3.
Error bars represent intra-sample variation (n=3)
Figure 5.2: Left: Example ICS raw data plots showing the CBZ-associated cellular IFN-γ responses both
pre- and post-stimulation (CBZ 10μg/mL) in Donor 1 (CBZ-TEN). Right: Mean (+/- SD) IFN-γ ICS flow
cytometry analysis for CBZ-SJS/TEN Donor and controls cells both pre- and post- stimulation and
culture were determined using the ICS method outlined in Chapter 2, Intracellular cytokine staining
2.2.2.1. Error bars represent intra-sample variation (n=3).
125
5.4.2 TCR analysis of Donor and Control cells pre- and post-
CBZ stimulation and expansion using digital droplet
PCR
The assay workup required the validation of the specific primers, the thermocycling
conditions, constructing a positive control and assessment of the assay sensitivity.
Using a synthetic construct which contained the relevant primer sequences, the
ddPCR assay was validated (Appendix 9, Section 9.2).
5.4.2.1 TCR Vβ CDR3 ddPCR RNA expression analysis
Figure 5.3 to Figure 5.5 highlight the TCR Vβ CDR3 profile of Donor 1 (CBZ-TEN),
Donor 2 (CBZ-SJS) and Donor 3 (CBZ-SJS), with Table 5.2 summarising the findings.
In Donor 1 (CBZ-TEN) a significant increase in Vβ 25-1*01 (Vβ 11s1) CDR3
CASSISGSY expression was detected in the cells stimulated with CBZ and expanded
in culture compared to pre-stimulation, unstimulated and control drug-stimulated and
expanded cells. Donor 2 (CBZ-SJS) showed a significant increase in Vβ 25-1*01
CDR3 CASSISGSY expression in the CBZ-stimulated and expanded cells compared
to cells pre-stimulation and unstimulated expanded cells. However, the increase Vβ
25-1*01 CDR3 CASSISGSY expression, seen in CBZ-stimulated and expanded cells
was also seen control drug-stimulated and expanded cells.
Donor 2 (CBZ-SJS) and Donor 3 (CBZ-SJS) exhibited a significant increase in Vβ 12-
3/4*01 CDR3 CASSLAGELF expression in the cells stimulated with CBZ and
expanded in culture compared to the three control conditions. Donor 1 (CBZ-TEN) also
exhibited a significant increase in Vβ 12-3/4*01 CDR3 CASSLAGELF expression cells
stimulated with CBZ and expanded in culture when compared to the control pre-
stimulated cells only.
Vβ 25-1*01 CDR3 CASSGLAGVDN expression was found significant in Donor 3
(CBZ-SJS) CBZ-stimulated and expanded cells when compared to cells pre-
stimulation and unstimulated expanded cells. The increase in Vβ 25-1*01 CDR3
CASSISGSY expression seen in CBZ-stimulated and expanded cells was also seen
control drug-stimulated and expanded cells.
126
Figure 5.3: TCR Vβ CDR3 sequence profile of Donor 1 CBZ-TEN. Raw data analysed using Bio-Rad
QuantaSoft software, results normalised against RPHH1 expression, and calculated as a percentage
(%) of normalised Cβ expression. Statistical significance was determined using analysis of variance
(ANOVA) statistical analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value < 0.0001, *p value <
0.05).
127
Figure 5.4: Vβ TCR CDR3 sequence profile of Donor 2 (CBZ-SJS). Raw data analysed using Bio-Rad
QuantaSoft software, results normalised against RPHH1 expression, and calculated as a percentage
(%) of normalised Cβ expression. Statistical significance was determined using analysis of variance
(ANOVA) statistical analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value < 0.0001).
128
Figure 5.5: Vβ TCR CDR3 sequence profile of Donor 3 (CBZ-SJS). Raw data analysed using Bio-Rad
QuantaSoft software, results normalised against RPHH1 expression, and calculated as a percentage
(%) of normalised Cβ expression. Statistical significance was determined using analysis of variance
(ANOVA) statistical analysis (p value < 0.0001) and multiple comparison tests showed significant
differences between CBZ-stimulated cells to the other 3 conditions (***p value < 0.0001).
129
Table 5.2 Table 5.2 Summary of the ddPCR amplification and analysis of target Vβ CDR3 sequences as
a percentage (%) of expression in Donor 1 (CBZ-TEN), Donor 2 (CBZ-SJS), and Donor 3 (CBZ-SJS)
pre-stimulation cells, CBZ, control drug stimulated and expanded cells, and the unstimulated expanded
cells.
Sample Vβ 25-1*01 (Vβ 11s1) CDR3 CASSISGSY
Pre-stimulation CBZ stimulated Control drug stimulated Unstimulated
Donor 1
(CBZ-TEN)
1.46% 44.23%
5.72% 8.50%
Donor 2
(CBZ-SJS)
1.57% 8.23% 7.72% 0.79%
Donor 3
(CBZ-SJS)
0.73% 0.72% 0.01% 0.04%
Vβ 25-1*01 CDR3 CASSGLAGVDN
Pre-stimulation CBZ stimulated Control drug stimulated Unstimulated
Donor 1
(CBZ-TEN)
1.94% 3.34% 4.76% 9.07%
Donor 2
(CBZ-SJS)
0.44% 0.63% 1.35% 0.67%
Donor 3
(CBZ-SJS)
1.44% 14.02% 10.44% 3.66%
Vβ 12-3/4*01 CDR3 CASSLAGELF
Pre-stimulation CBZ stimulated Control drug stimulated Unstimulated
Donor 1
(CBZ-TEN)
0.07% 18.23%
6.84% 3.40%
Donor 2
(CBZ-SJS)
2.95% 75.33%
14.78% 2.90%
Donor 3
(CBZ-SJS)
1.23% 17.89%
0.34% 2.94%
5.5 Discussion
Using PBMC’s obtained from patients who had experienced a
CBZ-SJS/TEN reaction, this study showed that CBZ induced responses can be
expanded using a short cellular stimulation and expansion culture. CBZ-specific public
TCR sequences, Vβ 25-1*01 (Vβ 11s1) CDR3 CASSISGSY / CASSGLADVDN or the
130
newly identified Vβ 12-3/4*01 CDR3 CASSLAGELF sequence expression can be
detected using a two-step rtPCR and using the cDNA as the template in a ddPCR
assay (176).
The Vβ 25-1*01 (Vβ 11s1) CDR3 CASSISGSY sequence was found to be expressed
in Donor 1 (CBZ-TEN) when cells were stimulated with CBZ and expanded in culture
compared to the unstimulated and control drug-stimulated and expanded cells. The Vβ
12-3/4*01 CDR3 CASSSLAGELF sequence was found to be expressed in Donor 1
(CBZ-TEN) cells stimulated with CBZ and expanded in culture, when compared to pre-
stimulated cells and while not significant, an increase was seen when compared to the
unstimulated and control drug-stimulated and expanded cells (Table 5.2).
Donor 2 (CBZ-SJS) exhibited a significant increase in the Vβ 12-3/4*01 CD3
CASSLAGELF sequence expression in cells stimulated with CBZ and expanded in
culture compared to pre-stimulation, unstimulated and control drug-stimulated and
expanded cells (Table 5.2). Donor 3 (CBZ-SJS) also exhibited an increase in the Vβ
12-3/4*01 CD3 CASSLAGELF sequence expression. Cells from Donor 2 (CBZ-SJS)
and Donor 3 (CBZ-SJS) showed a CBZ-associated Vβ 25-1*01 CDR3 CASSISGSY
and CDR3 CASSSGLAGVDN increased expression, respectively (Table 5.2).
However, in both cases, the increase seen in the CBZ-stimulated and expanded cells
was also seen in the control drug-stimulated and expanded cells. It is possible the
increase in CDR3 CASSISGSY and CDR3 CASSSGLAGVDN sequence expression
results from a distorted representation of the T-cell repertoire driven by ex-vivo
expansion.
Jing et al. 2016 in collaboration with other members of our group showed recognition
of VZV-infected cells, proteins, and peptides by polyclonal HSV-1–driven CD8+ T cells.
In this paper, they identified several potential VZV / HSV cross-reactive Vβ TCR CDR3
sequences specific to Donor 1 (CBZ-TEN). The expression can be assessed using the
same method described in this chapter. Several IM-ADR studies have highlighted the
involvement of more complex TCR repertoire (116, 235, 236). It is also possible that
the specific Vβ or Vα TCR clonotype is not as essential as the specific-CDR3
sequence, which interacts with the HLA-bound peptide. This could mean that the TCR
repertoire can be heterogeneous and polyclonal, yet share the same or structurally
similar specific-CDR3 sequences. The data presented here shows in at least Donor 1
(CBZ-TEN) shows the CBZ-associated expansion of a polyclonal T-cell pool, each
expressing different Vβ specific-CDR3 sequences. Specific of cross-reactive memory
131
T cells might determine tissue specificity and severity of the reaction. Recent studies
have also highlighted how HSV-specific CD8αα+ tissue-resident T cells are persistent
within the epidermis over a prolonged period and cause rapid cytotoxicity to cells
expressing low levels of HSV reactivation (237). Going forward it may be prudent to
look at epidermal tissue samples from patient blister fluid, to identify CBZ-SJS/TEN
restricted TCR clonotype repertoire.
What this chapter has provided is a method that is adaptable and sensitive to pick up
the increased expression of known Vβ TCR CDR3 sequence. The method,
experimental design and in particular the ddPCR assay performed here can be utilised
in any study involving the quantitative assessment and expression of any known Vβ or
Vα TCR CDR3 sequence. The ddPCR method provided here can be utilised to further
assess Vβ TCR CDR3 sequences identified by Ko et al, the expression of VZV / HSV
cross-reactive Vβ or Vα TCR CDR3 sequences identified by Jing et al., 2016, or
identifying the HSV-specific CD8αα+ tissue-resident T-cell clonotype (176, 233, 237).
The ddPCR method outlined in this chapter can also be modified and adapted to
assess TCR expression in other delayed IM-ADR and can be used in several
immunological research disciplines, including T-cell immunology.
132
133
Chapter 6
Carbamazepine-Induced Stevens - Johnson Syndrome
and Toxic Epidermal Necrolysis:
Granulysin Expression
134
135
6 6.1 Introduction
Granulysin is an effector molecule that exhibits cytotoxic activity against several
pathogens and tumours while also possessing chemoattractant and proinflammatory
abilities (118-125). Granulysin can be expressed by several cells, including CD8+
cytotoxic T cells, CD4+ cytotoxic-like T cells, NK cells and NK-T cells (2, 119, 125-
127). Granulysin has proven to be a useful biomarker and an important cytotoxicity
mediator in several skin diseases besides SJS/TEN including acne, psoriasis and
folliculitis (119, 125, 129-132). In terms of SJS/TEN, granulysin has been associated
with the disseminated keratinocyte death seen in SJS/TEN pathology. (111, 117)
This chapter will explore CBZ-SJS/TEN immunopathogenesis through the expression
of granulysin in the PBMC’s acquired from patient donors that had experienced a
SJS/TEN reaction to CBZ, compared to CBZ-naive control PBMC’s. This will be
achieved using ICS and Immunophenotyping flow cytometry assays to define the
cellular subtypes within donor PBMC’s which show an increase in granulysin
expression when incubated with pharmacological relevant doses of CBZ, ex-vivo.
6.2 Hypothesis and Aims
Hypothesis
The analysis of CBZ-SJS/TEN patient donor PBMCs show an increase granulysin
expression within several cellular subtypes when stimulated with pharmacological
amounts of CBZ (10μg/mL) ex-vivo.
Aims
To detect granulysin expression in cellular subtypes within PBMC’s from
CBZ-SJS/TEN Donors and Controls stimulated with pharmacological amounts of CBZ
(10μg/mL) compared to unstimulated and control drug stimulated PBMC’s.
6.3 Methods
6.3.1 Samples and Controls
The Controls and Donors used in this chapter, with a complete description, are listed
in Table 2.2 Chapter 2 Materials and Methods, Section 2.1.2 Carbamazepine -
Induced Stevens - Johnson syndrome and Toxic Epidermal Necrolysis.
136
6.3.2 Experimental assays and analysis
ICS and immunophenotyping flow cytometry assays were performed as outlined in
Chapter 2 Materials and Methods, Section 2.2.2 Flow Cytometry. Figure 6.1 shows the
flow cytometry gating procedure used to isolate the relevant cellular subpopulations to
assess granulysin expression. From the forward and side scatter plots, the lymphocyte
population was identified and labelled gate A, which was then further separated into
CD3+ and CD3- cells (Figure 6.1B). The CD3- / CD56+ NK cell population was
assessed for granulysin expression (Figure 6.1C), the CD3+ cells were further sorted
into CD56+ and CD56- cells (Figure 6.1D). The CD3+ CD56- cells were sorted into
CD8+ and CD4+ (Figure 6.1E) and each assessed for granulysin expression (Figure
6.1E1 and E2). The CD56+ cells were sorted into CD8+ and CD4+ (Figure 6.1F) and
each assessed for granulysin expression (Figure 6.1F1 and F2). Statistical analysis
and graphical representations were calculated using GraphPad Prism software
Version 5.02 (GraphPad software Inc., California, USA). Figure 6.1 Top Right
highlights an example of negative to low Granulysin expression and Figure 6.1 bottom
right highlights an example of positive granulysin expression.
Table 6.1: Distribution of the work within this chapter and accreditation to those who contributed
Work performed Accreditation
Patient Phenotype and clinical analysis Elizabeth Philips
Ex-vivo analysis of CBZ-stimulated PBMC’s via
Flow Cytometry
Craig Rive
137
Figure 6.1: Left: Example immunophenotyping and ICS raw data plots showing the gating procedure
used to isolate the cellular subpopulations and determine their cytokine expression under the relevant
conditions. Top Right: Example of negative to low Granulysin expression. Bottom Right: Example of
positive granulysin expression.
6.4 Results
6.4.1 Evaluation of granulysin in CD8+ T cells obtained from
CBZ SJS/TEN donors and naive CBZ controls
Comparisons between unstimulated, CBZ-, and or control drug-stimulated CD8+
cytotoxic T cells in both CBZ-SJS/TEN Donors and CBZ-naive controls are highlighted
in Figure 6.2 to Figure 6.5. All data points in Figure 6.2 show the mean (SD+/-)
percentage of PBMC’s CD8+ cytotoxic T cells that express granulysin, for each sample
(n > 3) under the specific ex-vivo stimulation condition. Figure 6.3 shows the same
data but compares the unstimulated versus the CBZ-stimulated ex-vivo granulysin
responses for each sample.
138
Figure 6.2: Mean (+/- SD) Granulysin expression in CD8+ cytotoxic T cells from Donor and Control
PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated. Statistical significance was
determined using ANOVA analysis (p < 0.0001). Multiple comparison tests showed significance
between unstimulated and CBZ-stimulated donor PBMC’s (* p value < 0.05), CBZ and control drug-
stimulated donor PBMC’s (*** p value < 0.0001), CBZ and the unstimulated, CBZ and control drug-
stimulated donor PBMC’s (*** p value < 0.0001). The error bars represent inter-sample variation (n=4).
139
Figure 6.3: Mean (+/- SD) Granulysin expression in CD8+ cytotoxic T cells in Donor and Control PBMC’s
incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical significance between unstimulated
and CBZ-stimulated for each set of donors (***p value of < 0.0001), using the paired two-tailed T-test,
compared to the controls (not significant (ns)). The error bars represent intra-sample variation (n=4).
140
Figure 6.4 and Figure 6.5 highlight IFN-γ expression in CD8+ cytotoxic T cells. The
IFN-γ expression results were obtained by exposing PBMC’s from the Donors and
Controls to the same conditions in which the granulysin expression results in Figure
6.2 and Figure 6.3 were obtained. Comparing granulysin versus IFN-γ expression in
CD8+ cytotoxic T cells, differences were observed, including the percentage of CD3+
CD8+ T cells expressing IFN-γ when stimulated with CBZ (10μg/mL) being only 0.1-
0.2% of total PBMC’s, compared the percentage of CBZ-stimulated CD3+ CD8+ T cells
expressing granulysin (Figure 6.2).
Figure 6.4: Mean (+/- SD) INF-γ expression in CD8+ cytotoxic T cells from Donor and Control PBMC’s
incubated ex-vivo with CBZ, control drug, or left unstimulated. Statistical significance was determined
using ANOVA analysis (p < 0.0001). Multiple comparison tests showed significance between,
unstimulated and CBZ-stimulated donor PBMC’s (*** p value < 0.0001), CBZ and Control drug-
stimulated donor PBMC’s (*** p value < 0.0001), CBZ and the unstimulated, CBZ and Control drug-
stimulated donor PBMC’s (*** p value < 0.0001). The error bars represent inter-sample variation (n=4).
141
Figure 6.5: Mean (+/- SD) IFN-γ expression in CD8+ cytotoxic T cells in Donor and Control PBMC’s
incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical significance between unstimulated
and CBZ-stimulated Donor 1 (CBZ-TEN) (***p value of < 0.0001), Donor 2 (CBZ- SJS) (*p value of <
0.05) and Donor 4 (CBZ-SJS non- B*15:02) (*p value of < 0.05) using the paired two-tailed T-test.
Donor 3 (CBZ-SJS) and Controls CBZ-naive (both HLA-B*15:02 positive and negative) were not
significant (ns)). The error bars represent intra-sample variation (n=4).
142
6.4.2 Evaluation of granulysin in CD4+ T cells obtained from
CBZ SJS/TEN donors and naive CBZ controls
Comparisons between unstimulated, CBZ-, and control drug-stimulated CD4+ T cells in
both CBZ-SJS/TEN Donors and CBZ-naive controls are highlighted in Figure 6.6. All
data points in Figure 6.6 represents the mean (SD+/-) percentage of PBMC’s that are
granulysin-expressing, CD4+ T cells for each sample (n > 3) under the specific ex-vivo
stimulation condition. No significant difference in granulysin expression was seen in
CD4+ T cells from the HLA-B*15:02 positive donors, Donor 1 (CBZ-TEN), Donor 2
(CBZ-SJS) and Donor 3 (CBZ-SJS) and the CBZ-naive controls when stimulated with
a pharmacological relevant dose of CBZ compared to control drug, or left
unstimulated. Figure 6.7 shows, Donor 4 (CBZ-SJS non-B*15:02) showed a significant
increase in granulysin expression by CD4+ T cells exposed to CBZ, compared to the
HLA-B*15:02 donors, Donor 1 (CBZ-TEN), Donor 2 (CBZ-SJS) and Donor 3 (CBZ-
SJS) and controls. Figure 6.8 further supports this with a significant increase in IFN-γ
expression by CD4+ T cells in Donor 4 (CBZ-SJS non-B*15:02) when exposed to CBZ.
143
Figure 6.6: Mean (+/- SD) Granulysin expression in CD3+ CD4
+ CD56
- T cells in Donor and Control
PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated. No statistical significance was
determined between the means of the various conditions. (ANOVA analysis and multiple comparison
tests).The error bars represent inter-sample variation (n=4).
144
Figure 6.7: Mean (+/- SD) Granulysin expression in CD4+ T cells in Donor and Control PBMC’s
incubated ex-vivo with CBZ versus unstimulated PBMC’s. Statistical significance was found between
Donor 4 (CBZ-SJS non- B*15:02) unstimulated and CBZ-stimulated PBMC’s (*** p value < 0.0001).
HLA-B*15:02 positive Donors 1 (CBZ-TEN), Donor 2 (CBZ-SJS), and Donor 3 (CBZ-SJS) unstimulated
versus CBZ-stimulated PBMC’s, and the Controls were found to be not significant using a paired two-
tailed T-test. The error bars represent intra-sample variation (n=4).
145
Figure 6.8: Mean (+/- SD) IFN-γ expression in CD4+ T cells in Donor and Control PBMC’s incubated ex-
vivo with CBZ versus unstimulated PBMC’s. Statistical significance was found between Donor 4 (CBZ-
SJS non- B*15:02) unstimulated and CBZ-stimulated PBMC’s (*** p value < 0.0001). HLA-B*15:02
positive Donors 1 (CBZ-TEN), Donor 2 (CBZ-SJS), and Donor 3 (CBZ-SJS) unstimulated versus CBZ-
stimulated PBMC’s, and the Controls were found to be not significant using a paired two-tailed T-test.
The error bars represent intra-sample variation (n=4).
146
6.4.3 Evaluation of granulysin in CD56+ NK and NK-T cells
obtained from CBZ SJS/TEN donors and naive CBZ
controls
The final PBMC’s cellular subsets included CD56+ NK cells and CD3+ CD56+ CD8+ or
CD4+ cell populations. CD56+ on the CD3+ T cells could reflect T-cell activation and
not specifically NK-T cells themselves (238). No significant correlation was seen
between unstimulated, CBZ-, and control drug-stimulated granulysin expression in
CBZ-SJS/TEN Donors and CBZ-naive controls as highlighted in Figure 6.9, Figure
6.10, and Figure 6.11. All data points in the following graphs represents the mean
(SD+/-) percentage of total PBMC’s that are granulysin-expressing, CD56+ NK cells
(Figure 6.9), CD56+ CD8+ NK-T cells (Figure 6.10), or CD56+ CD4+ NK-T cells (Figure
6.11) for each sample (n > 3) under the specific ex-vivo stimulation condition.
Figure 6.9: Mean (+/- SD) Granulysin expression in CD56+ NK cells in Donor and Control PBMC’s
incubated ex-vivo with CBZ, control drug, or left unstimulated. The error bars represent variation within
the same sample on multiple test (N tests per sample in each condition = 4).
147
Figure 6.10: Mean (+/- SD) Granulysin expression in CD3+ CD8
+ CD56
+ NK-T cells in Donor and
Control PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated. The error bars represent
intra-sample variation (n=4).
148
Figure 6.11: Mean (+/- SD) Granulysin expression in CD3+ CD4
+ CD56
+ NK-T cells in Donor and
Control PBMC’s incubated ex-vivo with CBZ, control drug, or left unstimulated. The error bars represent
inter-sample variation (n=4).
6.5 Discussion
Granulysin has been attributed to the disseminated keratinocyte death seen in
SJS/TEN pathology. (111, 117) Granulysin in the epidermal blister fluid of SJS/TEN
patients; predominately the 15-kDa form is secreted by both NK cells and CD8+ T cells
via a nongranular exocytotic pathway (103, 117, 210). Lamotrigine is another
antiepileptic drug associated with SJS/TEN. In 2014, a case study of one patient with
lamotrigine-induced TEN showed an increase in CD56+ NK cell granulysin expression,
when the patient PBMC’s were exposed to lamotrigine ex-vivo over a four-day period.
(134) Another finding by Porebski et al. 2013 showed an increase in granulysin
expression by CD4+ T cell from patients who experienced a lamotrigine-induced
SJS/TEN, when re-exposed to lamotrigine ex-vivo (135).
149
In this specific analysis granulysin expression is not representative of disease
progression or a prediction marker, but it does have the ability to be an important test
in the diagnosis SJS/TEN and allow clinicians to have more confidence in identifying
the culprit drug. The performed in this chapter differs from these and other studies
involving antiepileptic drug-induced SJS/TEN and granulysin expression in that Figure
6.2 and Figure 6.3 show an increase in granulysin expression in CD8+ cytotoxic T cells
within PBMC’s exposed to CBZ, ex-vivo. These PBMC’s obtained from CBZ-SJS/TEN
donors up to 17 years after the initial CBZ-SJS/TEN reaction. Figure 6.2 shows an
increased expression of granulysin in unstimulated CD8+ cytotoxic T cells within the
donor PBMC’s when compared to the controls. This suggests the Donors have an
increased number CD8+ cytotoxic T cells already expressing granulysin, which
supports studies that show that granulysin is produced by CD8+ T cells, unlike other
apoptotic molecules like perforin and granzyme B (239). This increased frequency of
CD8+ cytotoxic T cells already expressing granulysin, coupled with the further increase
in granulysin expression by CD8+ cytotoxic T cells when PBMC’s are incubated with
CBZ ex-vivo, supports previous data that suggests CBZ-SJS/TEN is a memory based
immune response, with several CD8+ T cells “pre-loaded” with granulysin. This also
explains why some patients experience a whole skin necrolysis in as little as 24-36
hours.
No significant increase in granulysin expression was detected in CBZ-SJS/TEN Donor
and CBZ-naive control CD56+ cell subtypes when exposed to the various conditions
(unstimulated, CBZ-, and control drug-stimulated) (Figure 6.9, Figure 6.10, and Figure
6.11). This coupled with the increase in granulysin-expressing, CD8+ cytotoxic T cells
within PBMC’s exposed to CBZ, ex-vivo, we propose that CD8+ cytotoxic T cells are
the initial leukocyte subtype. The evidence of granulysin producing NK cells within
patient blister fluid at the time of a reaction could result from the initial CD8+ cytotoxic
T-cell reaction, leading to granulysin release which not only has a cytotoxic role but a
chemotaxic role, attracting NK cells to the site of inflammation exacerbating the
situation (239, 240). Further studies are required to verify this proposal.
Experimentation should involve immunophenotyping skin-infiltrating lymphocytes at
the acute phase of SJS/TEN. A recent presentation at the European Academy of
Allergy and Clinical Immunology’s 2016 Drug Hypersensitivity Meeting in Malaga,
Spain Villani A.P. et al. 2016 presented data which shows that CD8+ T cells and to a
lesser extent CD4+ T cells, were the main leukocyte subsets found in acute TEN
blisters (240).
150
Donor 4 (CBZ-SJS non-B*15:02) also showed a higher level of granulysin expression
in CD4+ T cells, that also increased with CBZ exposure, ex-vivo (Figure 6.7). This is
supported by the increase in IFN-γ under the same conditions (Figure 6.8). While only
one patient, it raises interesting questions and supports the results of Porebski et al.
2013 in lamotrigine-induced SJS/TEN (135). However, it was also noted that Donor 4
(CBZ-SJS non-15:02) also expressed higher levels of granulysin in the CD3+ CD4+
CD56+ cell subpopulation, irrespective of CBZ or control drug stimulation or left
unstimulated (Figure 6.11). Further analysis using samples acquired from
non-HLA-B*15:02 SJS/TEN patients is required before any potential models can be
hypothesised.
151
Chapter 7
Summary and Conclusion
152
153
7 7.1 Introduction
Studies have shown that approximately 2.2 million serious ADR occur every year in
the United States of America, with over 100 thousand (4.5%) resulting in death (3-6).
ADR are the fourth to sixth most common cause of mortality in the developed world.
This places high demands on hospitals, healthcare institutions and facilities, and
auxiliary health care services. The enormous burden and cost of ADR are incompletely
captured and underestimated (1, 5, 7).
The low frequency of these deadly, delayed IM-ADR means they are rarely seen in the
pre-clinical and pre-marketing phases of testing. Delayed IM-ADR were considered
unpredictable until researchers identified the association between carriage of the HLA-
B*57:01 allele and ABC-HSS. This pharmacogenetic association leads to HLA-
B*57:01 genetic screening been implemented globally in primary HIV clinical practice,
allowing ABC to stay on the market, while reducing the numbers of ABC-HSS case.
This HLA-drug association has also led to a greater understanding of the
immunopathogenesis underlying this T cell-driven delayed IM-ADR
7.2 Nevirapine Induced Hypersensitivity
7.2.1 NVP-SCAR Associated HLA Class-I Binding Cleft
Characteristics
NVP has been associated with a diverse number of HSR clinical phenotypes and
numerous HLA alleles. We explored the notion that tissue specificity of NVP-SCAR
and the various HLA alleles associations can be explained by similarities in HLA
peptide-binding cleft structures, by grouping HLA alleles according to shared key
amino acid residues which make up the HLA class-I binding cleft pockets (A-F),
MHCcluster algorithm, which seeks to group HLA molecules based on their peptide-
binding specificity as predicted by NetMHCpan 2.8, and looking at the validated CREG
HLA supertypes, which groups HLA alleles based on similarities in cross-reactivity of
public epitopes among HLA class-I alleles and binding cleft pocket chemistry. (168-
172)
154
7.2.1.1 NVP-HSR with hepatitis
A vast majority of NVP-HSR involve hepatic symptoms, with 80% NVP-DRESS cases
presenting with liver complications. An increased risk of NVP-HSR with hepatitis was
associated with the validated HLA supertype CREG B*07 and the MHCcluster
assigned pb-B*78 group. The MHCcluster assigned pb-B*78 group and binding cleft B-
pocket residue analysis of the showed the HLA-B*55:01 and HLA-B*56:01 alleles
shared the same binding cleft B-pocket residues and were the two alleles were shared
between the CREG B*07 and pb-B*78 groups. Further, analysis of these alleles is
required, but Donor 2 (NVP-HSR), who experienced a NVP-DRESS reaction, 7 days
after NVP initiation, carried the HLA-B*56:01 and HLA-C*04:03 alleles.
7.2.1.2 NVP-SCAR
The HLA-C*04:01 alleles was shown to be a significant predictive HLA allele in NVP-
SCAR (Table 3.8). Other significant HLA-C alleles associated with NVP-SCAR
included the HLA-C*05:01 alleles among Caucasian and the HLA-C*18:01 among
Africans. The HLA-C*04:01, -C*05:01, -C*18:01, and other related alleles prevalent in
the cohort were analysed using MHCcluster to see if they shared similar predicted
peptide-binding capabilities. MHCcluster analysis showed these alleles all preferred to
bind 9mer peptides with an Aspartic acid (D) at position 2 of the peptide (from the NH2
terminal end) which interacts with binding cleft B-pocket.
HLA-C*04:01, HLA-C*05:01, and HLA-C*18:01 also shared the same binding cleft F-
pocket residue. This F-pocket structure also proved to a significant predictor for NVP-
rash associated SCAR, when the cohort was analysed together, but only remained
significant in Caucasians, when the data was adjusted for race (Table 3.8). This group
of alleles which share the same binding cleft F-pocket possesses varied binding cleft
B-pocket sequences suggesting the potential importance of the binding cleft F-pocket.
The F-pocket sequence significance and the virtual modelling analysis performed by
colleagues at the University of Florida showed the interaction between NVP within the
B-pocket. More research is required before a model can be formulated to further
analyse NVP-SCAR and the significance of the shared F-pocket sequences and how
the preferred binding of NVP near the B-pocket interacts with peptide presentation (83-
85).
155
7.2.2 Diminishing Ex-vivo PBMC’s Responses and NVP-HSR
Immunopathogenesis
This smaller study was part of a larger study involving NVP-SCAR
immunopathogenesis (138). As highlighted in Keane et al. 2014, one patient exhibited
an increase in Tregs cell numbers corresponded with diminishing IFN-γ ELISpot
responses (138). After this first analysis, PBMC's samples were limiting, therefore to
discuss this question and provide more data to complement the data published by
Keane et al. 2014, donor plasma was analysed over the time course of NVP-DRESS
to see if the cytokine environment reflects the changes in specific T-cell
subpopulations. Several cytokines were measured in patients over the time course of
a NVP-DRESS reaction. Donor 1 (NVP-HSR) showed a detectable IFN-γ release at
day 1 post NVP- DRESS, which then decreased, potentially due to the withdrawal of
NVP. Both Donor 1 (NVP-HSR) and Donor 2 (NVP-HSR) both showed significant IL-6
levels within the first 8 days post NVP- DRESS.
Elevated IL-6 levels in plasma samples can be linked to numerous different
pathologies but taken in context could be significant in the immunopathogenesis of, or
recovery from, a NVP-DRESS reaction (195-197). Given this increase in IL-6 and the
role IL-6 plays in Tregs/Th17 balance, this cytokine alongside other key factors like
carriage specific HLA class-I alleles could be important in NVP-DRESS
immunopathogenesis. One model we propose is that the decrease in Tregs at the time
of the reaction, due to IL-6 altering the Th17/Treg balance might be partially driving
NVP-DRESS and the return of Tregs during recovery is responsible for the NVP-
stimulated diminishing IFN-γ PBMC's responses.
While this increase in IL-6 and the fact that Keane et al. 2014 showed the removal of
CD25+ T cells had no effect on restoring diminishing NVP-stimulated, IFN-γ ELISpot
responses, this data combined is only from a few patients (138). To further analyse
this proposed model, future analysis should look at the expression and quantification
of inhibitory immune receptors; CTLA4, PD-1, and/or PD-L1 (203-206). Ex-vivo
experiments including monoclonal antibodies directed towards blocking these
inhibitory immune receptors to see if the ex-vivo response can be recovered or further
rule out the role of Tregs in diminishing NVP-stimulated IFN-γ PBMC responses (203,
205, 206). While it would have been preferential to perform this on the specific
samples used in Keane et al. 2014 and within this thesis, this could not be performed
156
as samples were limited and used in the first study by Niamh Keane et al. 2014, hence
the reason we analysed the Donors' plasma cytokine environment.
7.3 Carbamazepine-Induced Stevens - Johnson
syndrome and Toxic Epidermal Necrolysis
A strong association between HLA-B*15:02 and other B75 serotypes, including the
HLA-B*15:08, -B*15:11, and -B*15:21 alleles and CBZ-SJS/TEN has already been
established (2, 207, 208). Furthermore, the HLA-B*15:02 and SJS/TEN association
has been extended to several other Antiepileptic drugs, including phenytoin,
lamotrigine, and oxcarbazepine. While screening for HLA-B*15:02 carriage based on
the 100% negative predictive value is a workable option, the low positive predictive
value of HLA-B*15:02 in CBZ-SJS/TEN (3.0-7.7% in Han Chinese) means screening
for HLA-B*15:02 prevents large number of patients who carry an associated HLA allele
from taking these CBZ. Limits are placed on the number of alternative drugs that can
be prescribed. Understanding this disparity between negative and positive predictive
values will help in our understanding of the immunopathogenesis driving HLA-
restricted drug-SJS/TEN and allow for more effective screening methods to be used.
The heterologous immune responses have been suggested as a model to explain not
only the low positive predictive value associated with at-risk HLA alleles and CBZ-
SJS/TEN but also explains the varied tissue distribution of IM-ADR.
One aspect this body of work has explored involves a heterologous immune response
explained in Chapter 1 (Section 1.4 Established Models of HLA-driven delayed
Immunologically Mediated-Adverse Drug Reactions) which might explain the low and
incomplete positive predictive value associated with HLA-restricted CBZ-SJS/TEN.
The existence or nonexistence of epitope-specific class-I memory T cells which
express a specific cross-reactive TCR, might determine CBZ-SJS/TEN development in
individuals who carry the at-risk HLA allele. This would also go further to explain the
low positive predictive value of HLA-B*15:02 in CBZ-SJS/TEN and further our
understanding of the immunopathogenic mechanisms driving drug-SJS/TEN.
7.3.1 Predicted HLA-restricted Peptide Screening
The identification of HLA-B*15:02-restricted peptides, shared and restricted to
CBZ-SJS/TEN patients, is an essential step assessing the heterologous immune
model as it relates to HLA-B*15:02-restricted CBZ-SJS/TEN. This initial screening of
HSV-1 and/or HSV-2 predicted HLA-B*15:02-restricted peptides generated by in-silico
157
epitope mapping techniques, designed and performed by colleagues at The Institute
for Immunology and Infectious Diseases, Murdoch University, Perth, Australia, elicited
genuine peptide IFN-γ ELISpot responses. The atypical YAHG_SLRLPY epitope, a
variant of the HSV-1/HSV-2 shared Helicase-primase-primase subunit (UL52 amino
acid positions 811-821 and 823-833, in HSV-1 and HSV-2 respectively) peptide
YAHGHSLRLPY, was the only peptide that fitted the parameters outlined by the
hypothesis.
A protein BLAST search of this atypical epitope did not match anything within the
NCBI databases (169, 186, 187, 212). This peptide originates from a highly conserved
region of the UL52 protein in all the various strains of HSV-1 and HSV-2 that have
been identified and published Specific-YAHG_SLRLPY amino acid sequence matched
none of the reference protein sequence in the NCBI protein database (169, 186, 187,
212).
The identification of such an atypical epitope has a remarkable impact on our
understanding of immunological and/or virological processes. A better understand of
the mechanisms behind ambiguous transcription, translation, protein folding and
degradation, and epitope synthesis is required before the efficiency and frequency of
atypical epitopes can be determined.
Several debated mechanisms have been identified, which could cause atypical epitope
generation (213-218). These include the DRiP hypothesis which describes
substandard polypeptides developing from alternative and/or defective mRNAs,
ribosomal frameshifts, downstream initiation on genuine mRNAs, and other errors
inherent in translation including tRNA-amino acid misacylation (219-228). Using the
netChop 3.1 program to analysing YAHGHSLRLPY and surrounding amino acids
within the HSV-1 and HSV-2 Helicase-primase-primase subunit, four cleavage sites
were predicted (229). The four cleavage sites included the 5th histidine (H), and the
1st tyrosine (Y) and both leucine residues (L), but the netChop program is rather
underdeveloped (229).
Continued analysis using more CBZ - SJS/TEN patients and CBZ-tolerant controls, is
required before an atypical epitope, like YAHG_SLRLY can be considered as a
potential epitope responsible in the primary immune response and the subsequent
maintenance of the memory T cell which express the specific cross-reactive TCR, in a
heterologous immune response. Future analysis should also not rule out other HHV or
persistent pathogens to screen for cross-reactivity. Given the association between the
158
CBZ-TEN reaction and the acute HZ experienced by Donor 1 (CBZ-TEN), in-silico
epitope mapping strategies should also be extended to generating several HLA-
restricted VZV peptides.
As highlighted in Chapter 4, a recent paper by Jing et al., 2016 discovered several
novel cross-reactive T-cell epitopes, including a HLA-B*15:02-restricted HSV / VZV
cross-reactive T-cell epitope found using PBMC’s acquired from Donor 1 (CBZ-TEN)
(231). This epitope should also be screened using the other Donors in this chapter
which have shown responses to the atypical YAHG_SRLPY HSV-1 / HSV-2 epitope. If
this newly identified VZV / HSV epitope meets the requirements outlined in the
hypothesis and aims of this chapter, as the atypical YAHG_SRLPY HSV-1 / HSV-2
epitope has, both these epitopes can be used in future studies into the
immunopathogenesis of HLA-B*15:02-restricted CBZ-SJS/TEN.
7.3.2 Specific T-cell Clonotype and Detection by ddPCR
This study also showed that CBZ induced responses can be expanded from PBMC’s
obtained from patients up to 17 years after the initial reaction. Expression of the
previously identified CBZ-specific public TCR sequences, Vβ 25-1*01 (Vβ 11s1) CDR3
CASSISGSY / CASSGLADVDN or the newly identified Vβ 12-3/4*01 CDR3
CASSLAGELF sequence can be detected using ddPCR (176).
The Vβ 25-1*01 (Vβ 11s1) CDR3 CASSISGSY sequence was found to be expressed
in Donor 1 (CBZ-TEN), when cells were stimulated with CBZ and expanded in culture
when compared to the unstimulated and control drug-stimulated and expanded cells.
The Vβ 12-3/4*01 CDR3 CASSSLAGELF sequence was found to be expressed in
Donor 1 (CBZ-TEN) cells stimulated with CBZ and expanded in culture when
compared to pre-stimulated cells and while not significant, an increase was seen when
compared to the unstimulated and control drug-stimulated and expanded cells.
Donor 2 (CBZ-SJS) exhibited a significant increase in the Vβ 12-3/4*01 CD3
CASSLAGELF sequence expression in cells stimulated with CBZ and expanded in
culture compared to pre-stimulation, unstimulated and control drug-stimulated and
expanded cells. Donor 3 (CBZ-SJS) also exhibited an increase in the Vβ 12-3/4*01
CD3 CASSLAGELF sequence expression. Cells from Donor 2 (CBZ-SJS) and Donor 3
(CBZ-SJS) showed a CBZ-associated increase in Vβ 25-1*01 CDR3 CASSISGSY and
CDR3 CASSSGLAGVDN expression, respectively. However, in both cases, the
increase in CBZ-stimulated and expanded cells was also seen in the control drug-
stimulated, expanded cells. It is possible the increase in CDR3 CASSISGSY and
159
CDR3 CASSSGLAGVDN sequence expression results from a distorted representation
of the T-cell repertoire driven by ex-vivo expansion.
This study did not confirm the findings by Ko et al, 2011, but an increase in Vβ 25-1*01
(Vβ 11s1) CDR3 CASSISGSY expression in CBZ-stimulated cells from Donor 1 (CBZ-
TEN) was seen. In contrast to the proposal by Ko et al, 2011, several IM-ADR studies
have highlighted the involvement of a more complex TCR repertoire (116, 233, 234). It
is also possible that the specific Vβ or Vα TCR clonotype is not as essential as the
specific-CDR3 sequence, which interacts with the HLA-bound peptide. This could
mean that the TCR repertoire can be heterogeneous and polyclonal, yet share the
same or structurally similar specific-CDR3 sequences.
Recent studies have also highlighted how HHV can drive the production of tissue-
resident memory T cells, possessing high cytolytic potential and a low trigger threshold
causing local tissue damage (235). One such example includes HSV-specific CD8αα+
tissue-resident T cells, persistent within the epidermis over a prolonged period and
causes rapid cytotoxicity to cells expressing low levels of HSV reactivation (235).
Going forward it will be prudent to look at epidermal tissue samples to identify both
HLA-restricted pathogenic epitopes and to screen for potential TCR clonotypes
involved in CBZ-SJS/TEN, to prove this heterologous immune model.
The recent paper by Jing et al., 2016 showed the recognition of VZV-infected cells,
proteins, and peptides by polyclonal HSV-1–driven CD8+ T cells. In this paper, they
identified several potential VZV / HSV cross-reactive Vβ TCR CDR3 sequences
specific the same Donor 1 (CBZ-TEN) also analysed here (231). The expression of
these VZV / HSV cross-reactive Vβ TCR CDR3 sequences can be assessed using the
same method described in this chapter.
What this chapter has provided is an adaptable and sensitive experimental method to
assess TCR expression. In particular, the ddPCR assay highlighted can be utilised in
any study involving the quantitative assessment and expression of any known Vβ or
Vα TCR CDR3 sequence. The ddPCR method used here can be utilised to further
assess Vβ TCR CDR3 sequences identified by Ko et al, the expression of VZV / HSV
cross-reactive Vβ or Vα TCR CDR3 sequences identified by Jing et al., 2016, or
identifying the HSV-specific CD8αα+ tissue-resident T-cell clonotype. This specific
ddPCR assay can be modified and adapted to not only assess TCR expression in
other delayed IM-ADR, this assay can be used across several immunological research
disciplines, including tumour T-cell immunology.
160
7.3.3 Granulysin Expression
Chapter 4 and 5 approached the study of CBZ-SJS/TEN immunopathogenesis by
evaluating the heterologous immunity model. Chapter 6 looked at another aspect of
CBZ-SJS/TEN immunopathogenesis, granulysin expression. The examination of
granulysin expression in patient PBMC’s obtained up to 17 years after the initial CBZ-
SJS/TEN reaction, involved the ex-vivo CBZ stimulation to show the relevant PBMC's
subtypes involved.
The granulysin analysis in this body of research differs from other bodies of work
because it shows an increase in granulysin-expressing by CD8+ cytotoxic T cells within
PBMC’s exposed to CBZ, ex-vivo (103, 116, 117, 134, 135). This study also shows an
increased expression of granulysin in unstimulated CD8+ cytotoxic T cells within the
donor PBMC’s when compared to the controls. The findings here suggest that CD8+
cytotoxic T cells are a primary cellular subtype within the PBMC’s that interacts with
CBZ. This would support the current model for immunopathogenesis, in that CBZ-
SJS/TEN is driven by CD8+ T cells through a HLA-restricted TCR interaction and their
activation recruits other granulysin producing cells into this reaction. This would also
explain why it is common to find not only activated CD8+ cytotoxic T cells, but other
activated granulysin excreting cells like NK and NK T cells, within the epidermal
blisters of patients during the reaction (113, 114, 117).
It has been shown that granulysin can cause a 2 to 7 fold increase in chemotaxis of
monocytes, CD4+, and CD8+ memory T cells, NK cells, and mature, monocyte-derived
dendritic cells (239, 240). While further studies are required to verify this,
experimentation should involve immunophenotyping skin-infiltrating lymphocytes at the
acute phase of SJS/TEN. A recent presentation at the European Academy of Allergy
and Clinical Immunology's 2016 Drug Hypersensitivity Meeting in Malaga, Spain Villani
A.P. et al. 2016 presented data which shows that CD8+ T cells and to a lesser extent
CD4+ T cells, were the main leukocyte subsets found in acute TEN blisters (238).
This study also showed an increase in granulysin expression by CBZ-stimulated CD4+
T cells in Donor 4 (CBZ-SJS non-B*15:02). Donor 4 (CBZ-SJS non-B*15:02), also
exhibited an increased expression of granulysin in unstimulated CD4+ T cells,
supported by the increase in IFN-γ under the same conditions. This is only one patient,
but it supports what Porebski et al. 2013 showed with lamotrigine- SJS/TEN (135).
161
7.3.4 Future Experimentation for HLA-15:02-restricted CBZ-
SJS/TEN
Future work should combine the experiments and results of Chapter 4, to see if the
identified HLA-B*15:02-restricted epitopes elicit granulysin responses in the memory T
cells which express the TCR sequences (Chapter 6) identified in Chapter 5. This
would be strong evidence of the heterologous model. The preliminary work on this has
so far failed to show the epitopes, identified in Chapter 4, elicit the same granulysin
response as seen in CBZ stimulation highlighted in Chapter 5, in memory T cells which
express the TCR sequences shown in Chapter 6 (Appendix 9, Section 9.3 Future
experimentation for HLA-15:02-restricted CBZ-SJS/TEN, Figure 9.16 and Figure 9.17).
Despite this, Chapters 4, 5, and 6 provide a way forward to continue the search for
potential HLA-B*15:02-restricted epitope responses to prove or disprove the
heterologous model.
7.4 Final Conclusions
Not only do ADRs place a great deal of demand and strain on hospitals, healthcare
facilities, auxiliary healthcare services, they are a major cause of iatrogenic and
preventable disease and death (1, 2). The ABC translational roadmap is a successful
example of how the research discoveries can be translated into clinical practice
leading to improved patient care. The ability to identify patients at risk of experiencing
a drug-specific IM-ADR, before administering the drug is an advantageous concept. To
achieve a greater understanding of IM-ADR immunopathogenesis is required. Both
CBZ-SJS/TEN and NVP-SCARs are distinct clinical and immunological syndromes,
but they share are several significant similarities which suggest that the underlying
immunopathogenesis driving SCARs may share commonalities. Both CBZ-SJS/TEN
and NVP-SCARs provide important examples for the immunopathogenesis of severe
T cell-mediated drug reactions.
As with ABC and HLA-B*57:01 genetic screening, the Food and Drug Administration
(USA) recommends genetic screening for HLA-B*15:02 before CBZ therapy and that
all HLA-B*15:02 carriers, should not be administered CBZ unless the benefits
outweigh the risks (101). The low positive predictive value associated with HLA-
B*15:02 carriage alone means numerous HLA-B*15:02 carriers who would otherwise
benefit from CBZ therapy, are required to undertake alternative treatments or risk
experiencing an SJS/TEN reaction. Further insight into the immunopathogenesis is
162
required to improve screening methods which would increase our ability to predict and
avoid potential CBZ-SJS/TEN reactions.
In terms of CBZ-SJS/TEN, we have shown that that increased expression of the
SJS/TEN associated cytotoxic molecule, granulysin in CD8+ T cells can be detected in
an ex-vivo assay in which PBMC’s isolated from CBZ-SJS/TEN patients are exposed
to CBZ. Future experimentation should include CBZ-naive and CBZ-tolerant controls
to determine if the flow cytometry ICS assay described in this body of work is useful in
improving CBZ-SJS/TEN prediction in conjunction with HLA-B*15:02 carriage. The
ddPCR method developed in this body of research should be used in further analysing
the TCR sequences identified in Jing et al. 2016 (231). A greater understanding of
cross-reactive memory T-cell responses would help us understand why not all patients
who carry at-risk alleles develop an IM-ADR. Continued research into the specificities
of the T cells involved in CBZ-SJS/TEN is required, however, the ddPCR method
outlined here can be translated into clinical practice, in conjunction with genetic
screening for HLA-B*15:02 to improve the predictability of IM-ADR.
Future research into the CBZ-SJS/TEN associated T cells should focus on advances
in the ability to characterise individual patient TCR repertoires by means of deep
sequencing, targeting the Vα and Vβ TCR genes and gene expression, and
sequencing based assays which can show paired TCR α- and β-chain sequences.
To add to our understanding of CBZ-SJS/TEN specific cross-reactive memory T-cell
responses we looked at potential epitope-specific T-cell responses. We have also
identified specific HSV-1/HSV-2 responses, with one atypical epitope being shared
among the HLA-B*15:02-CBZ-SJS/TEN patients. We propose that further
experimentation to answer the question of cross-reactivity between drug-derived
neo-antigen and viral-specific memory T cells should include the atypical epitope
identified in this body of work and the HSV/VZV cross-reactive epitope found by
Jing et al. 2016 (231). Continued work should include improving computational and
experimental methods to better identify HLA-restricted epitopes from candidate
pathogens like HHV potentially responsible for the initial priming and maintaining the
cross-reactive pathogenic T cell involved in heterologous driven immunopathogenesis
models.
Combining the experiments of Chapter 4, Chapter 5, and Chapter 6 to identify HLA-
B*15:02-restricted epitopes that elicit granulysin responses in the memory T cells
which express specific TCR sequences would provide strong evidence of the
163
heterologous model. The preliminary work on this has so far failed to show the
epitopes, identified in Chapter 4, elicit the same granulysin response as seen in CBZ
stimulation highlighted in Chapter 5, in memory T cells which express the TCR
sequences shown in Chapter 6 (Appendix 9, Section 9.6 Future experimentation for
HLA-15:02-restricted CBZ-SJS/TEN). The method and experimentation in these
Chapters have provided a way forward to continue the search for potential HLA-
B*15:02-restricted epitope responses to prove or disprove the heterologous model.
In contrast to ABC-HSS and CBZ-SJS/TEN, genetic screening for NVP-HSR
associated HLA alleles has been difficult, due to the number of varied HLA allele and
the associated incomplete predictive values. We proposed that the variation in NVP-
HSR associated HLA alleles was due to several HLA alleles similar HLA binding
cleft/groove properties and/or predicted peptide/NVP-binding characteristics. The
shared association between the F-pocket of the NVP-SCAR predictive allele HLA-
C*04:01 and other ethnic-specific predictive HLA alleles like HLA-C*05:01 and HLA-
C*18:01 was a predictive factor in NVP-SCAR.
164
165
8 Bibliography 1. Lazarou J, Pomeranz BH, Corey PN. Incidence of adverse drug reactions in hospitalized patients: a meta-analysis of prospective studies. Jama. 1998 Apr 15;279(15):1200-5. 2. Rive C, Bourke J, Phillips EJ. Testing for Drug Hypersensitivity Syndromes. The Clinical Biochemist Reviews. 2013;34(1):15-38. 3. Medicine. Io. Committee on Identifying and Preventing Medication Errors. Preventing Medication Errors. Washington, DC. : The National Academies Press; 2006. 4. Gandhi TK, Weingart SN, Seger AC, Borus J, Burdick E, Poon EG, et al. Outpatient prescribing errors and the impact of computerized prescribing. Journal of general internal medicine. 2005 Sep;20(9):837-41. 5. Bourgeois FT, Shannon MW, Valim C, Mandl KD. Adverse Drug Events in the Outpatient Setting: An 11-Year National Analysis. Pharmacoepidemiology and drug safety. 2010;19(9):901-10. 6. McCarthy R. The price you pay for the drug not taken. Business and health. 1998 Oct;16(10):27-8, 30, 2-3. 7. Krueger KP, Berger BA, Felkey B. Medication adherence and persistence: a comprehensive review. Advances in therapy. 2005 Jul-Aug;22(4):313-56. 8. Alomar MJ. Factors affecting the development of adverse drug reactions (Review article). Saudi Pharmaceutical Journal. 2014 4//;22(2):83-94. 9. Park BK, Pirmohamed M, Kitteringham NR. Role of drug disposition in drug hypersensitivity: a chemical, molecular, and clinical perspective. Chemical research in toxicology. 1998 Sep;11(9):969-88. 10. Lucena MI, Garcia-Cortes M, Cueto R, Lopez-Duran J, Andrade RJ. Assessment of drug-induced liver injury in clinical practice. Fundamental & clinical pharmacology. 2008 Apr;22(2):141-58. 11. Sasidharanpillai S, Riyaz N, Khader A, Rajan U, Binitha MP, Sureshan DN. Severe Cutaneous Adverse Drug Reactions: A Clinicoepidemiological Study. Indian Journal of Dermatology. 2015 Jan-Feb;60(1):102-. 12. Shiina T, Ando A, Suto Y, Kasai F, Shigenari A, Takishima N, et al. Genomic anatomy of a premier major histocompatibility complex paralogous region on chromosome 1q21-q22. Genome Res. 2001 May;11(5):789-802. 13. Urayama KY, Thompson PD, Taylor GM, Trachtenberg EA, Chokkalingam AP. Genetic variation in the extended major histocompatibility complex and susceptibility to childhood acute lymphoblastic leukemia: a review of the evidence. Frontiers in Oncology. [Review]. 2013 2013-December-12;3. 14. Parkin J, Cohen B. An overview of the immune system. Lancet. 2001 Jun 2;357(9270):1777-89. 15. Prugnolle F, Manica A, Charpentier M, Guegan JF, Guernier V, Balloux F. Pathogen-driven selection and worldwide HLA class I diversity. Current biology : CB. 2005 Jun 7;15(11):1022-7. 16. Qutob N, Balloux F, Raj T, Liu H, Marion de Proce S, Trowsdale J, et al. Signatures of historical demography and pathogen richness on MHC class I genes. Immunogenetics. 2012 Mar;64(3):165-75. 17. Cole DK. Re-directing CD4+ T cell responses with the flanking residues of MHC class II-bound peptides: the core is not enough. Frontiers in Immunology. [Review]. 2013 2013-July-1;4. 18. Braciale TJ, Morrison LA, Sweetser MT, Sambrook J, Gething MJ, Braciale VL. Antigen presentation pathways to class I and class II MHC-restricted T lymphocytes. Immunological reviews. 1987 Aug;98:95-114.
166
19. Greenberg S, Silverstein S, Paul W. Fundamental immunology. Fundamental Immunology. 1993:509. 20. Heath WR, Carbone FR. Cross-presentation in viral immunity and self-tolerance. Nat Rev Immunol. [10.1038/35100512]. 2001 11//print;1(2):126-34. 21. Boesteanu A, Brehm M, Mylin LM, Christianson GJ, Tevethia SS, Roopenian DC, et al. A molecular basis for how a single TCR interfaces multiple ligands. Journal of immunology (Baltimore, Md : 1950). 1998 Nov 1;161(9):4719-27. 22. Guermonprez P, Valladeau J, Zitvogel L, Théry C, Amigorena S. Antigen presentation and T cell stimulation by dendritic cells. Annual review of immunology. 2002;20(1):621-67. 23. Donohue KB. Cross-priming utilizes antigen not available to the direct presentation pathway. Immunology. [10.1111/j.1365-2567.2006.02406.x]. 2006 //;119:63-73. 24. Gamadia LE, Remmerswaal EB, Surachno S, Lardy NM, Wertheim-van Dillen PM, van Lier RA, et al. Cross-reactivity of cytomegalovirus-specific CD8+ T cells to allo-major histocompatibility complex class I molecules. Transplantation. 2004 Jun 27;77(12):1879-85. 25. Kobayashi KS, van den Elsen PJ. NLRC5: a key regulator of MHC class I-dependent immune responses. Nat Rev Immunol. [10.1038/nri3339]. 2012 12//print;12(12):813-20. 26. Janeway CA Jr, Travers P, Walport M, al. e. Immunobiology: The Immune System in Health and Disease. . New York: Garland Science; 2001. 27. Chitgopeker P, Sahni D. T-Cell Receptor Gene Rearrangement Detection in Suspected Cases of Cutaneous T-Cell Lymphoma. The Journal of investigative dermatology. [Research Techniques Made Simple]. 2014 04//print;134(4):e19. 28. Joachims ML, Chain JL, Hooker SW, Knott-Craig CJ, Thompson LF. Human αβ and γδ thymocyte development: TCR gene rearrangements, intracellular TCRβ expression, and γδ developmental potential—differences between men and mice. The Journal of Immunology. 2006;176(3):1543-52. 29. Janeway CA Jr, Travers P, Walport M, al. e. Immunobiology: The Immune System in Health and Disease. . New York: Garland Science; 2001. Available from: http://www.ncbi.nlm.nih.gov/books/NBK27136/. 30. Dik WA, Pike-Overzet K, Weerkamp F, de Ridder D, de Haas EF, Baert MR, et al. New insights on human T cell development by quantitative T cell receptor gene rearrangement studies and gene expression profiling. The Journal of experimental medicine. 2005;201(11):1715-23. 31. Janeway CA Jr, Travers P, Walport M, al. e. Immunobiology: The Immune System in Health and Disease. . New York: Garland Science; 2001. Available from: http://www.ncbi.nlm.nih.gov/books/NBK27145/. 32. Germain RN. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. [10.1038/nri798]. 2002 05//print;2(5):309-22. 33. Singer A. New perspectives on a developmental dilemma: the kinetic signaling model and the importance of signal duration for the CD4/CD8 lineage decision. Current opinion in immunology. 2002;14(2):207-15. 34. Liu X, Bosselut R. Duration of TCR signaling controls CD4-CD8 lineage differentiation in vivo. Nature immunology. 2004;5(3):280-8. 35. Branch EI. CD4/CD8 coreceptors in thymocyte development, selection, and lineage commitment: analysis of the CD4/CD8 lineage decision. T Cell Subsets: Cellular Selection, Commitment and Identity. 2004;83:91. 36. Takada K, Jameson SC. Naive T cell homeostasis: from awareness of space to a sense of place. Nature Reviews Immunology. 2009;9(12):823-32.
167
37. Surh CD, Sprent J. Homeostasis of naive and memory T cells. Immunity. 2008;29(6):848-62. 38. Sprent J, Surh CD. Normal T cell homeostasis: the conversion of naive cells into memory-phenotype cells. Nature immunology. 2011;12(6):478-84. 39. Wells A, Gudmundsdottir H, Turka L. Following the fate of individual T cells throughout activation and clonal expansion. Signals from T cell receptor and CD28 differentially regulate the induction and duration of a proliferative response. Journal of Clinical Investigation. 1997;100(12):3173. 40. Gudmundsdottir H, Wells AD, Turka LA. Dynamics and requirements of T cell clonal expansion in vivo at the single-cell level: effector function is linked to proliferative capacity. The Journal of Immunology. 1999;162(9):5212-23. 41. Zhu J, Paul WE. CD4 T cells: fates, functions, and faults. Blood. [10.1182/blood-2008-05-078154]. 2008;112(5):1557-69. 42. Zhu J, Yamane H, Paul WE. Differentiation of Effector CD4 T Cell Populations. Annual review of immunology. 2010;28:445-89. 43. Zhang N, Bevan Michael J. CD8+ T Cells: Foot Soldiers of the Immune System. Immunity. 2011;35(2):161-8. 44. Romagnani S. T-cell subsets (Th1 versus Th2). Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology. 2000 Jul;85(1):9-18; quiz , 21. 45. Garrod Kym R, Moreau Hélène D, Garcia Z, Lemaître F, Bouvier I, Albert Matthew L, et al. Dissecting T Cell Contraction In Vivo Using a Genetically Encoded Reporter of Apoptosis. Cell Reports. 2012 11/29/;2(5):1438-47. 46. Krammer PH, Arnold R, Lavrik IN. Life and death in peripheral T cells. Nat Rev Immunol. 2007 Jul;7(7):532-42. 47. Farber DL, Yudanin NA, Restifo NP. Human memory T cells: generation, compartmentalization and homeostasis. Nat Rev Immunol. [Review]. 2014 01//print;14(1):24-35. 48. Harty JT, Badovinac VP. Shaping and reshaping CD8+ T-cell memory. Nature Reviews Immunology. 2008;8(2):107-19. 49. Joshi NS, Kaech SM. Effector CD8 T cell development: a balancing act between memory cell potential and terminal differentiation. The Journal of Immunology. 2008;180(3):1309-15. 50. Williams MA, Bevan MJ. Effector and memory CTL differentiation. Annu Rev Immunol. 2007;25:171-92. 51. Kaech SM, Cui W. Transcriptional control of effector and memory CD8+ T cell differentiation. Nat Rev Immunol. [10.1038/nri3307]. 2012;12(11):749-61. 52. Rehermann B, Shin EC. Private aspects of heterologous immunity. The Journal of experimental medicine. 2005 Mar 7;201(5):667-70. 53. Welsh RM, Selin LK. No one is naive: the significance of heterologous T-cell immunity. Nat Rev Immunol. 2002 Jun;2(6):417-26. 54. D'Orsogna LJA, Roelen DL, Doxiadis IIN, Claas FHJ. Alloreactivity from human viral specific memory T-cells. Transplant immunology. 2010 8//;23(4):149-55. 55. Landais E, Morice A, Long HM, Haigh TA, Charreau B, Bonneville M, et al. EBV-specific CD4+ T cell clones exhibit vigorous allogeneic responses. Journal of immunology (Baltimore, Md : 1950). 2006 Aug 1;177(3):1427-33. 56. D'Orsogna LJ, Roelen DL, Doxiadis, II, Claas FH. Screening of viral specific T-cell lines for HLA alloreactivity prior to adoptive immunotherapy may prevent GvHD. Transplant immunology. 2011 Apr 15;24(3):141. 57. Koelle DM, Chen HB, McClurkan CM, Petersdorf EW. Herpes simplex virus type 2-specific CD8 cytotoxic T lymphocyte cross-reactivity against prevalent HLA class I alleles. Blood. 2002 May 15;99(10):3844-7.
168
58. Moss P, Khan N. CD8(+) T-cell immunity to cytomegalovirus. Hum Immunol. 2004 May;65(5):456-64. 59. D'Orsogna LJ, Roelen DL, van der Meer-Prins EM, van der Pol P, Franke-van Dijk ME, Eikmans M, et al. Tissue specificity of cross-reactive allogeneic responses by EBV EBNA3A-specific memory T cells. Transplantation. 2011 Mar 15;91(5):494-500. 60. Brook MO, Wood KJ, Jones ND. The impact of memory T cells on rejection and the induction of tolerance. Transplantation. 2006 Jul 15;82(1):1-9. 61. Farcas A, Bojita M. Adverse drug reactions in clinical practice: a causality assessment of a case of drug-induced pancreatitis. J Gastrointestin Liver Dis. 2009;18(3):353-8. 62. Mawson AR, Eriator I, Karre S. Stevens-Johnson Syndrome and Toxic Epidermal Necrolysis (SJS/TEN): Could Retinoids Play a Causative Role? Medical Science Monitor : International Medical Journal of Experimental and Clinical Research. 2015 01/12;21:133-43. 63. Harr T, French LE. Toxic epidermal necrolysis and Stevens-Johnson syndrome. Orphanet journal of rare diseases. 2010;5:39. 64. R S, DA K. Drug allergy: an updated practice parameter. Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology. 2010 Oct;105(4):259-73. 65. Bastuji-Garin S, Rzany B, Stern RS, Shear NH, Naldi L, Roujeau JC. Clinical classification of cases of toxic epidermal necrolysis, Stevens-Johnson syndrome, and erythema multiforme. Archives of dermatology. 1993 Jan;129(1):92-6. 66. Solensky R KD, Bernstein IL, Bloomberg GR, Castells MC, Mendelson LM, Weiss ME, Bernstein DI, Blessing-Moore J, Cox L, Lang DM, Nicklas RA, Oppenheinmer J, Portnoy JM, Randolph C, Schuller DE, Spector S, Tilles S, Wallace D, Dowling PJ, Dykewicz M, Greenberger PA, Macy EM, May KR, Nguygen MT, Schwartz L, Solensky R, Khan DA, Bernstein IL, Bloomberg GR, Castells MC, Mendelson L, Weiss ME, Bernstein DI, Blessing-Moore J, Cox L, Lang DM, Nicklas R, Oppenheimer J, Portnoy JM, Randolph C, Schuller DE, Spector SL, Tilles SA, Wallace D, Dowling PJ, Dykewicz MS, Greenberger PA, Macy EM, May KR, Nguyen MT, Schwartz LB. Drug allergy: an updated practice parameter. Annals of allergy, asthma & immunology : official publication of the American College of Allergy, Asthma, & Immunology. 2010 Oct;105(4):259-73. 67. Pavlos R, Mallal S, Phillips E. HLA and pharmacogenetics of drug hypersensitivity. Pharmacogenomics. 2012 Aug;13(11):1285-306. 68. Pavlos R, Mallal S, Ostrov D, Buus S, Metushi I, Peters B, et al. T Cell–Mediated Hypersensitivity Reactions to Drugs. Annual review of medicine. 2015 10/27;66:439-54. 69. Choudhary S, McLeod M, Torchia D, Romanelli P. Drug Reaction with Eosinophilia and Systemic Symptoms (DRESS) Syndrome. The Journal of Clinical and Aesthetic Dermatology. 2013;6(6):31-7. 70. Bocquet H, Bagot M, Roujeau JC. Drug-induced pseudolymphoma and drug hypersensitivity syndrome (Drug Rash with Eosinophilia and Systemic Symptoms: DRESS). Seminars in cutaneous medicine and surgery. 1996 Dec;15(4):250-7. 71. Roujeau JC. Clinical heterogeneity of drug hypersensitivity. Toxicology. 2005;209(2):123-9. 72. Hunziker T, Künzi UP, Braunschweig S, Zehnder D, Hoigné R. Comprehensive hospital drug monitoring (CHDM): adverse skin reactions, a 20-year survey. Allergy. 1997;52(4):388-93. 73. Lee A, Thomson J. Drug-induced skin reactions. Pharmaceut J 1999; 262: 357. 2006;362.
169
74. Phillips E, Mallal SA. HLA and Drug Reactions. In: Mehra NK, Mehra NK, editors. The HLA Complex in Biology and Medicine : A Resource Book. New Delhi, India: Jitendar P Vij, Jaypee Brothers Medical Publishers (P) Ltd; 2010. p. 332-49. 75. Phillips E, Mallal S. Successful translation of pharmacogenetics into the clinic: the abacavir example. Molecular diagnosis & therapy. 2009;13(1):1-9. 76. Phillips EJ, Mallal SA. Pharmacogenetics of drug hypersensitivity. Pharmacogenomics. 2010 Jul;11(7):973-87. 77. Symonds W, Cutrell A, Edwards M, Steel H, Spreen B, Powell G, et al. Risk factor analysis of hypersensitivity reactions to abacavir. Clin Ther. 2002 Apr;24(4):565-73. 78. Phillips EJ, Chung W-H, Mockenhaupt M, Roujeau J-C, Mallal SA. Drug hypersensitivity: pharmacogenetics and clinical syndromes. Journal of Allergy and Clinical Immunology. 2011;127(3):S60-S6. 79. Mallal S, Phillips E, Carosi G, Molina J-M, Workman C, Tomažič J, et al. HLA-B*5701 Screening for Hypersensitivity to Abacavir. New England Journal of Medicine. 2008;358(6):568-79. 80. Phillips EJ, Wong GA, Kaul R, Shahabi K, Nolan DA, Knowles SR, et al. Clinical and immunogenetic correlates of abacavir hypersensitivity. Aids. 2005 Jun 10;19(9):979-81. 81. Saag M, Balu R, Phillips E, Brachman P, Martorell C, Burman W, et al. High sensitivity of human leukocyte antigen-b*5701 as a marker for immunologically confirmed abacavir hypersensitivity in white and black patients. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2008 Apr 1;46(7):1111-8. 82. Lucas A, Lucas M, Strhyn A, Keane NM, McKinnon E, Pavlos R, et al. Abacavir-Reactive Memory T Cells Are Present in Drug Naïve Individuals. PLoS ONE. 2015 02/12;10(2):e0117160. 83. Ostrov DA, Grant BJ, Pompeu YA, Sidney J, Harndahl M, Southwood S, et al. Drug hypersensitivity caused by alteration of the MHC-presented self-peptide repertoire. Proceedings of the National Academy of Sciences. 2012 June 19, 2012;109(25):9959-64. 84. Illing PT, Vivian JP, Dudek NL, Kostenko L, Chen Z, Bharadwaj M, et al. Immune self-reactivity triggered by drug-modified HLA-peptide repertoire. Nature. [10.1038/nature11147]. 2012 06/28/print;486(7404):554-8. 85. Norcross MA, Luo S, Lu L, Boyne MT, Gomarteli M, Rennels AD, et al. Abacavir induces loading of novel self-peptides into HLA-B*57: 01: an autoimmune model for HLA-associated drug hypersensitivity. Aids. 2012 Jul 17;26(11):F21-9. 86. Medicine USNLo. Carbamazepine; Compound summary for CID2554. 2015 [updated 23/02/2015]. 87. Patterson JF. Carbamazepine in the treatment of phantom limb pain. South Med J. 1988 1988/09//;81(9):1100-2. 88. Ambrósio A, Soares-da-Silva P, Carvalho C, Carvalho A. Mechanisms of Action of Carbamazepine and Its Derivatives, Oxcarbazepine, BIA 2-093, and BIA 2-024. Neurochem Res. 2002 2002/02/01;27(1-2):121-30. 89. Davies JA. Mechanisms of action of antiepileptic drugs. Seizure. 1995 12//;4(4):267-71. 90. Bialer M. Why are antiepileptic drugs used for nonepileptic conditions? Epilepsia. 2012 Dec;53 Suppl 7:26-33. 91. Thomas JR, Hobson A, Gray RN, Roy YM, P W, C E. Cochrane Pain, Palliative and Supportive Care Group. The Cochrane Collaboration 2013;1. 92. Health topics/Essential medicines, (2013).
170
93. Chung WH, Hung SI, Hong HS, Hsih MS, Yang LC, Ho HC, et al. Medical genetics: a marker for Stevens-Johnson syndrome. Nature. 2004 Apr 1;428(6982):486. 94. Alfirevic A, Jorgensen AL, Williamson PR, Chadwick DW, Park BK, Pirmohamed M. HLA-B locus in Caucasian patients with carbamazepine hypersensitivity. Pharmacogenomics. 2006 Sep;7(6):813-8. 95. Lonjou C, Borot N, Sekula P, Ledger N, Thomas L, Halevy S, et al. A European study of HLA-B in Stevens–Johnson syndrome and toxic epidermal necrolysis related to five high-risk drugs. Pharmacogenet Genomics. 2008;18:99–107. 96. Man CB, Kwan P, Baum L, Yu E, Lau KM, Cheng AS, et al. Association between HLA-B*1502 allele and antiepileptic drug-induced cutaneous reactions in Han Chinese. Epilepsia. 2007 May;48(5):1015-8. 97. Bureau USC. International Data Base. Washington, D.C.2015 [cited 2016]; Available from: https://www.census.gov/data/developers/data-sets/international-database.html 98. Andreev K, Kantorova V, Bongaarts J. Demographic components of future population growth. Technical Paper. 2013;3. 99. United Nations DoEaSA, Population Division. Demographic Components of Future Population Growth: 2015 Revision. New York: United Nations.; 2015; Available from: unpopulation.org. 100. Khor AH, Lim KS, Tan CT, Wong SM, Ng CC. HLA-B*15:02 association with carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in an Indian population: a pooled-data analysis and meta-analysis. Epilepsia. 2014 Nov;55(11):e120-4. 101. Ferrell PB, McLeod HL. Carbamazepine, HLA-B*1502 and risk of Stevens–Johnson syndrome and toxic epidermal necrolysis: US FDA recommendations. Pharmacogenomics. 2008;9(10):1543-6. 102. Wei C-Y, Chung W-H, Huang H-W, Chen Y-T, Hung S-I. Direct interaction between HLA-B and carbamazepine activates T cells in patients with Stevens-Johnson syndrome. Journal of Allergy and Clinical Immunology. 2012;129(6):1562-9. e5. 103. Chung W-H, Hung S-I. Recent advances in the genetics and immunology of Stevens-Johnson syndrome and toxic epidermal necrosis. Journal of dermatological science. 2012;66(3):190-6. 104. Kaniwa N, Saito Y, Aihara M, Matsunaga K, Tohkin M, Kurose K, et al. HLA-B*1511 is a risk factor for carbamazepine-induced Stevens-Johnson syndrome and toxic epidermal necrolysis in Japanese patients. Epilepsia. 2010 Dec;51(12):2461-5. 105. Kim SH, Lee KW, Song WJ, Kim SH, Jee YK, Lee SM, et al. Carbamazepine-induced severe cutaneous adverse reactions and HLA genotypes in Koreans. Epilepsy Res. 2011 Nov;97(1-2):190-7. 106. Ikeda H, Takahashi Y, Yamazaki E, Fujiwara T, Kaniwa N, Saito Y, et al. HLA class I markers in Japanese patients with carbamazepine-induced cutaneous adverse reactions. Epilepsia. 2010 Feb;51(2):297-300. 107. Ozeki T, Mushiroda T, Yowang A, Takahashi A, Kubo M, Shirakata Y, et al. Genome-wide association study identifies HLA-A*3101 allele as a genetic risk factor for carbamazepine-induced cutaneous adverse drug reactions in Japanese population. Human molecular genetics. 2011 Mar 1;20(5):1034-41. 108. McCormack M, Alfirevic A, Bourgeois S, Farrell JJ, Kasperavičiūtė D, Carrington M, et al. HLA-A* 3101 and carbamazepine-induced hypersensitivity reactions in Europeans. New England Journal of Medicine. 2011;364(12):1134-43. 109. Genin E, Chen DP, Hung SI, Sekula P, Schumacher M, Chang PY, et al. HLA-A*31:01 and different types of carbamazepine-induced severe cutaneous adverse
171
reactions: an international study and meta-analysis. The pharmacogenomics journal. 2014 Jun;14(3):281-8. 110. Hung SI, Chung WH, Jee SH, Chen WC, Chang YT, Lee WR, et al. Genetic susceptibility to carbamazepine-induced cutaneous adverse drug reactions. Pharmacogenetics and genomics. 2006 Apr;16(4):297-306. 111. Nickoloff BJ. Saving the skin from drug-induced detachment. Nat Med. [10.1038/nm1208-1311]. 2008 12//print;14(12):1311-3. 112. Viard I, Wehrli P, Bullani R, Schneider P, Holler N, Salomon D, et al. Inhibition of toxic epidermal necrolysis by blockade of CD95 with human intravenous immunoglobulin. Science (New York, NY). 1998 Oct 16;282(5388):490-3. 113. Nassif A, Bensussan A, Boumsell L, Deniaud A, Moslehi H, Wolkenstein P, et al. Toxic epidermal necrolysis: effector cells are drug-specific cytotoxic T cells. The Journal of allergy and clinical immunology. 2004 Nov;114(5):1209-15. 114. Nassif A, Bensussan A, Dorothee G, Mami-Chouaib F, Bachot N, Bagot M, et al. Drug Specific Cytotoxic T-Cells in the Skin Lesions of a Patient with Toxic Epidermal Necrolysis. 2002 04//print;118(4):728-33. 115. Downey A, Jackson C, Harun N, Cooper A. Toxic epidermal necrolysis: Review of pathogenesis and management. Journal of the American Academy of Dermatology. 2012;66(6):995-1003. 116. Chung W-H, Pan R-Y, Chu M-T, Chin S-W, Huang Y-L, Wang W-C, et al. Oxypurinol-Specific T Cells Possess Preferential TCR Clonotypes and Express Granulysin in Allopurinol-Induced Severe Cutaneous Adverse Reactions. [Original Article]. 2015 06/04/online. 117. Chung WH, Hung SI, Yang JY, Su SC, Huang SP, Wei CY, et al. Granulysin is a key mediator for disseminated keratinocyte death in Stevens-Johnson syndrome and toxic epidermal necrolysis. Nat Med. 2008 Dec;14(12):1343-50. 118. Stenger S, Rosat JP, Bloom BR, Krensky AM, Modlin RL. Granulysin: a lethal weapon of cytolytic T cells. Immunol Today. 1999 Sep;20(9):390-4. 119. Krensky AM, Clayberger C. Granulysin: a novel host defense molecule. American journal of transplantation : official journal of the American Society of Transplantation and the American Society of Transplant Surgeons. 2005 Aug;5(8):1789-92. 120. Sahiratmadja E, Alisjahbana B, Buccheri S, Di Liberto D, de Boer T, Adnan I, et al. Plasma granulysin levels and cellular interferon-gamma production correlate with curative host responses in tuberculosis, while plasma interferon-gamma levels correlate with tuberculosis disease activity in adults. Tuberculosis (Edinburgh, Scotland). 2007 Jul;87(4):312-21. 121. Di Liberto D, Buccheri S, Caccamo N, Meraviglia S, Romano A, Di Carlo P, et al. Decreased serum granulysin levels in childhood tuberculosis which reverse after therapy. Tuberculosis (Edinburgh, Scotland). 2007 Jul;87(4):322-8. 122. Farouk SE, Mincheva-Nilsson L, Krensky AM, Dieli F, Troye-Blomberg M. Gamma delta T cells inhibit in vitro growth of the asexual blood stages of Plasmodium falciparum by a granule exocytosis-dependent cytotoxic pathway that requires granulysin. European journal of immunology. 2004 Aug;34(8):2248-56. 123. Kaspar AA, Okada S, Kumar J, Poulain FR, Drouvalakis KA, Kelekar A, et al. A distinct pathway of cell-mediated apoptosis initiated by granulysin. Journal of immunology (Baltimore, Md : 1950). 2001 Jul 1;167(1):350-6. 124. Pages F, Berger A, Camus M, Sanchez-Cabo F, Costes A, Molidor R, et al. Effector memory T cells, early metastasis, and survival in colorectal cancer. The New England journal of medicine. 2005 Dec 22;353(25):2654-66. 125. Clayberger C, Krensky AM. Granulysin. Current Opinion in Immunology. 2003 10//;15(5):560-5.
172
126. Chung W-H, Hung S-I, Yang J-Y, Su S-C, Huang S-P, Wei C-Y, et al. Granulysin is a key mediator for disseminated keratinocyte death in Stevens-Johnson syndrome and toxic epidermal necrolysis. Nat Med. [10.1038/nm.1884]. 2008 12//print;14(12):1343-50. 127. Appay V. The physiological role of cytotoxic CD4+ T-cells: the holy grail? Clinical and Experimental Immunology. 2004 07/23/accepted;138(1):10-3. 128. Sarwal MM, Jani A, Chang S, Huie P, Wang Z, Salvatierra Jr O, et al. Granulysin expression is a marker for acute rejection and steroid resistance in human renal transplantation. Human Immunology. 2001 1//;62(1):21-31. 129. Raychaudhuri SP, Jiang WY, Raychaudhuri SK, Krensky AM. Lesional T cells and dermal dendrocytes in psoriasis plaque express increased levels of granulysin. Journal of the American Academy of Dermatology. 2004 Dec;51(6):1006-8. 130. Oono T, Morizane S, Yamasaki O, Shirafuji Y, Huh WK, Akiyama H, et al. Involvement of granulysin-producing T cells in the development of superficial microbial folliculitis. Br J Dermatol. 2004 May;150(5):904-9. 131. McInturff JE, Wang SJ, Machleidt T, Lin TR, Oren A, Hertz CJ, et al. Granulysin-derived peptides demonstrate antimicrobial and anti-inflammatory effects against Propionibacterium acnes. The Journal of investigative dermatology. 2005 Aug;125(2):256-63. 132. Kotsch K, Mashreghi MF, Bold G, Tretow P, Beyer J, Matz M, et al. Enhanced granulysin mRNA expression in urinary sediment in early and delayed acute renal allograft rejection. Transplantation. 2004 Jun 27;77(12):1866-75. 133. Mueller H, Fae KC, Magdorf K, Ganoza CA, Wahn U, Guhlich U, et al. Granulysin-expressing CD4+ T cells as candidate immune marker for tuberculosis during childhood and adolescence. PLoS One. 2011;6(12):e29367. 134. Won HK, Lee JW, Song WJ, Klaewsongkram J, Kang MG, Park HK, et al. Lamotrigine-induced toxic epidermal necrolysis confirmed by in vitro granulysin and cytokine assays. Asia Pacific allergy. 2014 Oct;4(4):253-6. 135. Porebski G, Pecaric-Petkovic T, Groux-Keller M, Bosak M, Kawabata TT, Pichler WJ. In vitro drug causality assessment in Stevens–Johnson syndrome – alternatives for lymphocyte transformation test. Clinical & Experimental Allergy. 2013;43(9):1027-37. 136. Bisio F, Masini G, Blasi Vacca E, Calzi A, Cardinale F, Bruzzone B, et al. Effectiveness of a project to prevent HIV vertical transmission in the Republic of Congo. Journal of Antimicrobial Chemotherapy. 2013 April 14, 2013. 137. Coovadia HM, Brown ER, Fowler MG, Chipato T, Moodley D, Manji K, et al. Efficacy and safety of an extended nevirapine regimen in infant children of breastfeeding mothers with HIV-1 infection for prevention of postnatal HIV-1 transmission (HPTN 046): a randomised, double-blind, placebo-controlled trial. The Lancet. 2012;379(9812):221-8. 138. Keane NM, Pavlos RK, McKinnon E, Lucas A, Rive C, Blyth CC, et al. HLA class I restricted CD8+ and class II restricted CD4+ T cells are implicated in the pathogenesis of nevirapine hypersensitivity. AIDS. 2014;28(13):1891-901. 139. Pollard RB, Robinson P, Dransfield K. Safety profile of nevirapine, a nonnucleoside reverse transcriptase inhibitor for the treatment of human immunodeficiency virus infection. Clinical Therapeutics. 1998;20(6):1071-92. 140. Gangar M, Arias G, O'Brien JG, Kemper CA. Frequency of cutaneous reactions on rechallenge with nevirapine and delavirdine. Annals of Pharmacotherapy. 2000;34(7-8):839-42. 141. Keane N. Nevirapine. Reactions Weekly. [journal article]. 2015;1559(1):122-.
173
142. Martin AM, Nolan D, James I, Cameron P, Keller J, Moore C, et al. Predisposition to nevirapine hypersensitivity associated with HLA-DRB1*0101 and abrogated by low CD4 T-cell counts. Aids. 2005 Jan 3;19(1):97-9. 143. Vitezica ZG, Milpied B, Lonjou C, Borot N, Ledger TN, Lefebvre A, et al. HLA-DRB1*01 associated with cutaneous hypersensitivity induced by nevirapine and efavirenz. Aids. 2008 Feb 19;22(4):540-1. 144. Gonzalez-Galarza FF, Christmas S, Middleton D, Jones AR. Allele frequency net: a database and online repository for immune gene frequencies in worldwide populations. Nucleic Acids Research. 2011 January 1, 2011;39(suppl 1):D913-D9. 145. Phillips E BJ, Sanne I, Lederman M, Hinkle J, Rousseau F, I J, et al. Associations between HLA-DRBA*0102, HLA-B*5801 and hepatotoxicity in patients who initiated nevirapine containing regimens in South Africa. 18th Conference on retroviruses and opportunistic infections [Conference proceeding]; Boston, MA, USA. Feb 27-March 1; 2011. 146. Littera R, Carcassi C, Masala A, Piano P, Serra P, Ortu F, et al. HLA-dependent hypersensitivity to nevirapine in Sardinian HIV patients. Aids. 2006 Aug 1;20(12):1621-6. 147. Gatanaga H, Yazaki H, Tanuma J, Honda M, Genka I, Teruya K, et al. HLA-Cw8 primarily associated with hypersensitivity to nevirapine. Aids. 2007 Jan 11;21(2):264-5. 148. Gao S, Gui XE, Liang K, Liu Z, Hu J, Dong B. HLA-Dependent Hypersensitivity Reaction to Nevirapine in Chinese Han HIV-Infected Patients. AIDS Res Hum Retroviruses. 2011:540-43. 149. Yuan J, Guo S, Hall D, Cammett AM, Jayadev S, Distel M, et al. Toxicogenomics of nevirapine-associated cutaneous and hepatic adverse events among populations of African, Asian, and European descent. AIDS. 2011;25(Nevirapine Toxicogenomics Study Team). 150. Phillips EJ, Keane N, Blyth C. Both HLA Class I CD8+restricted and HLA Class II CD4+ restriced T Cells are implicated in the pathogenises of nevirapine hypersensitivity 51st ICAAC; Chicago IL, USA2011. 151. Puangpetch A, Koomdee N, Chamnanphol M, Jantararoungtong T, Santon S, Prommas S, et al. HLA-B allele and haplotype diversity among Thai patients identified by PCR-SSOP: evidence for high risk of drug-induced hypersensitivity. Frontiers in Genetics. 2014;5. 152. Chantarangsu S, Mushiroda T, Mahasirimongkol S, Kiertiburanakul S, Sungkanuparph S, Manosuthi W, et al. HLA-B*3505 allele is a strong predictor for nevirapine-induced skin adverse drug reactions in HIV-infected Thai patients. Pharmacogenetics and genomics. 2009 Feb;19(2):139-46. 153. Likanonsakul S, Rattanatham T, Feangvad S, Uttayamakul S, Prasithsirikul W, Tunthanathip P, et al. HLA-Cw*04 allele associated with nevirapine-induced rash in HIV-infected Thai patients. AIDS research and therapy. 2009;6(1):22. 154. Bonjoch A, Paredes R, Galvez J, Miralles C, Videla S, Martínez E, et al. Antiretroviral Treatment Simplification With 3 NRTIs or 2 NRTIs Plus Nevirapine in HIV-1-Infected Patients Treated With Successful First-Line HAART. JAIDS Journal of Acquired Immune Deficiency Syndromes. 2005;39(3):313-6. 155. Carr DF, Chaponda M, Jorgensen AL, Castro EC, van Oosterhout JJ, Khoo SH, et al. Association of human leukocyte antigen alleles and nevirapine hypersensitivity in a Malawian HIV-infected population. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2013 May;56(9):1330-9. 156. Pichler WJ. The pi concept: pharmacological interaction of drugs with immune receptors. The World Allergy Organization journal. 2008;1(6):96.
174
157. Adam J, Pichler WJ, Yerly D. Delayed drug hypersensitivity: models of T‐cell stimulation. British journal of clinical pharmacology. 2011;71(5):701-7. 158. Gerber BO, Pichler WJ. Cellular mechanisms of T cell mediated drug hypersensitivity. Current opinion in immunology. 2004;16(6):732-7. 159. Zanni MP, von Greyerz S, Schnyder B, Brander KA, Frutig K, Hari Y, et al. HLA-restricted, processing- and metabolism-independent pathway of drug recognition by human alpha beta T lymphocytes. J Clin Invest. 1998 Oct 15;102(8):1591-8. 160. Zanni MP, von Greyerz S, Schnyder B, Wendland T, Pichler WJ. Allele-unrestricted presentation of lidocaine by HLA-DR molecules to specific alphabeta+ T cell clones. International immunology. 1998;10(4):507-15. 161. Schnyder B, Mauri-Hellweg D, Zanni M, Bettens F, Pichler WJ. Direct, MHC-dependent presentation of the drug sulfamethoxazole to human alphabeta T cell clones. Journal of Clinical Investigation. 1997;100(1):136. 162. Pavlos R, Mallal S, Ostrov D, Pompeu Y, Phillips E. Fever, rash and systemic symptoms: understanding the role of virus and HLA in severe cutaneous drug allergy. The journal of allergy and clinical immunology In practice. 2014 Jan-Feb;2(1):21-33. 163. Amir AL, D'Orsogna LJ, Roelen DL, van Loenen MM, Hagedoorn RS, de Boer R, et al. Allo-HLA reactivity of virus-specific memory T cells is common. Blood. 2010 Apr 15;115(15):3146-57. 164. Amir AL, van der Steen DM, Hagedoorn RS, Kester MG, van Bergen CA, Drijfhout JW, et al. Allo-HLA-reactive T cells inducing graft-versus-host disease are single peptide specific. Blood. 2011 Dec 22;118(26):6733-42. 165. Deckers JG, Boonstra JG, Van der Kooij SW, Daha MR, Van der Woude FJ. Tissue-specific characteristics of cytotoxic graft-infiltrating T cells during renal allograft rejection. Transplantation. 1997 Jul 15;64(1):178-81. 166. Koelle DM, Chen HB, McClurkan CM, Petersdorf EW. Herpes simplex virus type 2–specific CD8 cytotoxic T lymphocyte cross-reactivity against prevalent HLA class I alleles. Presented in part at the 25th International Herpesvirus Workshop, Portland, OR, July 2000 [abstract 516]. 2002 2002-05-15 00:00:00;99(10):3844-7. 167. White KD, Chung WH, Hung SI, Mallal S, Phillips EJ. Evolving models of the immunopathogenesis of T cell-mediated drug allergy: The role of host, pathogens, and drug response. The Journal of allergy and clinical immunology. 2015 Aug;136(2):219-34. 168. Thomsen M, Lundegaard C, Buus S, Lund O, Nielsen M. MHCcluster, a method for functional clustering of MHC molecules. Immunogenetics. 2013 06/18;65(9):655-65. 169. Hoof I, Peters B, Sidney J, Pedersen LE, Sette A, Lund O, et al. NetMHCpan, a method for MHC class I binding prediction beyond humans. Immunogenetics. 2009 Jan;61(1):1-13. 170. Nielsen M, Lundegaard C, Blicher T, Lamberth K, Harndahl M, Justesen S, et al. NetMHCpan, a Method for Quantitative Predictions of Peptide Binding to Any HLA-A and -B Locus Protein of Known Sequence. PLoS ONE. 2007;2(8):e796. 171. Sidney J, Peters B, Frahm N, Brander C, Sette A. HLA class I supertypes: a revised and updated classification. BMC immunology. 2008;9:1. 172. Lund O, Nielsen M, Kesmir C, Petersen AG, Lundegaard C, Worning P, et al. Definition of supertypes for HLA molecules using clustering of specificity matrices. Immunogenetics. 2004 Mar;55(12):797-810. 173. Hanafusa T, Azukizawa H, Matsumura S, Katayama I. The predominant drug-specific T-cell population may switch from cytotoxic T cells to regulatory T cells during the course of anticonvulsant-induced hypersensitivity. J Dermatol Sci. 2012 Mar;65(3):213-9.
175
174. Chang CC, Too CL, Murad S, Hussein SH. Association of HLA-B*1502 allele with carbamazepine-induced toxic epidermal necrolysis and Stevens-Johnson syndrome in the multi-ethnic Malaysian population. International journal of dermatology. 2011 Feb;50(2):221-4. 175. Warren R.L., Freeman JD, Zeng T, Choe G, Munro S, Moore R, et al. Exhaustive T-cell repertoire sequencing of human peripheral blood samples reveals signatures of antigen selection and a directly measured repertoire size of at least 1 million clonotypes. Genome Res. 2011; 21:790-7. 176. Ko TM, Chung WH, Wei CY, Shih HY, Chen JK, Lin CH, et al. Shared and restricted T-cell receptor use is crucial for carbamazepine-induced Stevens-Johnson syndrome. The Journal of allergy and clinical immunology. 2011 Dec;128(6):1266-76.e11. 177. Kappelhoff BS, van Leth F, MacGregor TR, Lange J, Beijnen JH, Huitema AD. Nevirapine and efavirenz pharmacokinetics and covariate analysis in the 2NN study. Antiviral therapy. 2005;10(1):145-55. 178. García-Piñeres AJ, Hildesheim A, Williams M, Trivett M, Strobl S, Pinto LA. DNAse treatment following thawing of cryopreserved PBMC is a procedure suitable for lymphocyte functional studies. Journal of immunological methods. 2006;313(1):209-13. 179. Costantini A, Mancini S, Giuliodoro S, Butini L, Regnery CM, Silvestri G, et al. Effects of cryopreservation on lymphocyte immunophenotype and function. Journal of Immunological Methods. 2003 7//;278(1–2):145-55. 180. BD. BD FLUORESCENCE SPECTRUM VIEWER A MULTICOLOR TOOL. San Jose: BD Biosciences; 2016 [cited 2013-2015]; Available from: http://www.bdbiosciences.com/anz/research/multicolor/spectrum_viewer. 181. Hogg AE, Bowick GC, Herzog NK, Cloyd MW, Endsley JJ. Induction of granulysin in CD8+ T cells by IL-21 and IL-15 is suppressed by human immunodeficiency virus-1. Journal of Leukocyte Biology. 2009 November 1, 2009;86(5):1191-203. 182. Fischer AH, Jacobson KA, Rose J, Zeller R. Fixation and permeabilization of cells and tissues. CSH protocols. 2008;2008:pdb.top36. 183. Leisner C, Loeth N, Lamberth K, Justesen S, Sylvester-Hvid C, Schmidt EG, et al. One-pot, mix-and-read peptide-MHC tetramers. PLoS One. 2008;3(2):e1678. 184. Svitek N, Hansen AM, Steinaa L, Saya R, Awino E, Nielsen M, et al. Use of “one-pot, mix-and-read” peptide-MHC class I tetramers and predictive algorithms to improve detection of cytotoxic T lymphocyte responses in cattle. Veterinary Research. 2014 04/28;45(1):50. 185. Menezes J, Jondal M, Leibold W, Dorval G. Epstein-Barr virus interactions with human lymphocyte subpopulations: virus adsorption, kinetics of expression of Epstein-Barr virus-associated nuclear antigen, and lymphocyte transformation. Infection and Immunity. 1976;13(2):303-10. 186. Uphoff CC, Drexler HG. Detecting mycoplasma contamination in cell cultures by polymerase chain reaction. Methods Mol Biol. 2011;731:93-103. 187. Boslett B, Nag S, Resnick A. Detection and Antibiotic Treatment of Mycoplasma arginini Contamination in a Mouse Epithelial Cell Line Restore Normal Cell Physiology. BioMed Research International. 2014;2014:7. 188. Vita R ZL, Greenbaum JA, Emami H, Hoof I, Salimi N, Damle R, Sette A, Peters B. T. The immune epitope database 2.0. Nucleic Acids Res 2010;JAN 38:(Database issue):D854-62. 189. Tatusova T, Ciufo S, Fedorov B, O'Neill K, Tolstoy I. RefSeq microbial genomes database: new representation and annotation strategy. Nucleic Acids Res. 2014 Jan;42(Database issue):D553-9.
176
190. Hertz T, Nolan D, James I, John M, Gaudieri S, Phillips E, et al. Mapping the landscape of host-pathogen coevolution: HLA class I binding and its relationship with evolutionary conservation in human and viral proteins. Journal of virology. 2011;85(3):1310-21. 191. Wade JA, Katovich Hurley C, Takemoto SK, Thompson J, Davies SM, Fuller TC, et al. HLA mismatching within or outside of cross-reactive groups (CREGs) is associated with similar outcomes after unrelated hematopoietic stem cell transplantation. Blood. 2007 2007-05-01 00:00:00;109(9):4064-70. 192. Madden DR. The three-dimensional structure of peptide-MHC complexes. Annu Rev Immunol. 1995;13:587-622. 193. Guo HC, Jardetzky TS, Garrett TP, Lane WS, Strominger JL, Wiley DC. Different length peptides bind to HLA-Aw68 similarly at their ends but bulge out in the middle. Nature. 1992 Nov 26;360(6402):364-6. 194. Saper MA, Bjorkman PJ, Wiley DC. Refined structure of the human histocompatibility antigen HLA-A2 at 2.6 A resolution. Journal of molecular biology. 1991 May 20;219(2):277-319. 195. Madden DR, Gorga JC, Strominger JL, Wiley DC. The three-dimensional structure of HLA-B27 at 2.1 A resolution suggests a general mechanism for tight peptide binding to MHC. Cell. 1992 Sep 18;70(6):1035-48. 196. Ridker PM, Rifai N, Stampfer MJ, Hennekens CH. Plasma concentration of interleukin-6 and the risk of future myocardial infarction among apparently healthy men. Circulation. 2000 Apr 18;101(15):1767-72. 197. Schönrock LM, Gawlowski G, Brück W. Interleukin-6 expression in human multiple sclerosis lesions. Neuroscience Letters. 2000 11/10/;294(1):45-8. 198. Tackey E, Lipsky PE, Illei GG. Rationale for interleukin-6 blockade in systemic lupus erythematosus. Lupus. 2004 2004;13(5):339-43. 199. Sculco PK, McLawhorn AS, Desai N, Su EP, Padgett DE, Jules-Elysee K. The Effect of Perioperative Corticosteroids in Total Hip Arthroplasty: A Prospective Double-Blind Placebo Controlled Pilot Study. The Journal of Arthroplasty.31(6):1208-12. 200. Ogata M, Satou T, Kawano R, Takakura S, Goto K, Ikewaki J, et al. Correlations of HHV-6 viral load and plasma IL-6 concentration with HHV-6 encephalitis in allogeneic stem cell transplant recipients. Bone marrow transplantation. 2010 Jan;45(1):129-36. 201. Pritchett JC, Nanau RM, Neuman MG. The Link between Hypersensitivity Syndrome Reaction Development and Human Herpes Virus-6 Reactivation. International journal of hepatology. 2012;2012:723062. 202. Criado PR, Criado RFJ, Avancini JdM, Santi CG. Drug reaction with Eosinophilia and Systemic Symptoms (DRESS) / Drug-induced Hypersensitivity Syndrome (DIHS): a review of current concepts. Anais Brasileiros de Dermatologia. 2012;87:435-49. 203. Kimura A, Naka T, Nohara K, Fujii-Kuriyama Y, Kishimoto T. Aryl hydrocarbon receptor regulates Stat1 activation and participates in the development of Th17 cells. Proceedings of the National Academy of Sciences. 2008;105(28):9721-6. 204. Luckheeram RV, Zhou R, Verma AD, Xia B. CD4+T Cells: Differentiation and Functions. Clinical and Developmental Immunology. 2012;2012:12. 205. Ott PA, Hodi FS, Robert C. CTLA-4 and PD-1/PD-L1 blockade: new immunotherapeutic modalities with durable clinical benefit in melanoma patients. Clinical Cancer Research. 2013;19(19):5300-9. 206. Topalian SL, Hodi FS, Brahmer JR, Gettinger SN, Smith DC, McDermott DF, et al. Safety, activity, and immune correlates of anti–PD-1 antibody in cancer. New England Journal of Medicine. 2012;366(26):2443-54.
177
207. Brahmer JR, Tykodi SS, Chow LQ, Hwu W-J, Topalian SL, Hwu P, et al. Safety and activity of anti–PD-L1 antibody in patients with advanced cancer. New England Journal of Medicine. 2012;366(26):2455-65. 208. Thompson CB, Allison JP. The Emerging Role of CTLA-4 as an Immune Attenuator. Immunity. 1997;7(4):445-50. 209. Wang Q, Zhou JQ, Zhou LM CZ, Fang ZY, Chen SD, Yang LB, et al. Association between HLA-B*1502 allele and carbamazepine-induced severe cutaneous adverse reactions in Han people of southern China mainland. Seizure. 2011;20:446–8. 210. Chung WH, Hung SI, Hong HS, Hsih MS, Yang LC, Ho HC, et al. Medical genetics: a marker for Stevens–Johnson syndrome. Nature. 2004;428 486. 211. Li L, Yang B, Yu S, Zhang X, Lao S, Wu C. Human CD8+ T cells from TB pleurisy respond to four immunodominant epitopes in Mtb CFP10 restricted by HLA-B alleles. PLoS One. 2013;8(12):e82196. 212. Rao X, Hoof I Fau - Costa AICAF, Costa Ai Fau - van Baarle D, van Baarle D Fau - Kesmir C, Kesmir C. HLA class I allele promiscuity revisited. 2011(1432-1211 (Electronic)). 213. Frahm N, Yusim K, Suscovich TJ, Adams S, Sidney J, Hraber P, et al. Extensive HLA class I allele promiscuity among viral CTL epitopes. European journal of immunology. 2007;37(9):2419-33. 214. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 1997 Sep 1;25(17):3389-402. 215. Golovina TN, Morrison SE, Eisenlohr LC. The Impact of Misfolding versus Targeted Degradation on the Efficiency of the MHC Class I-Restricted Antigen Processing. The Journal of Immunology. 2005 March 1, 2005;174(5):2763-9. 216. Khan S, de Giuli R, Schmidtke G, Bruns M, Buchmeier M, van den Broek M, et al. Cutting Edge: Neosynthesis Is Required for the Presentation of a T Cell Epitope from a Long-Lived Viral Protein. The Journal of Immunology. 2001 November 1, 2001;167(9):4801-4. 217. Princiotta MF, Finzi D, Qian S-B, Gibbs J, Schuchmann S, Buttgereit F, et al. Quantitating Protein Synthesis, Degradation, and Endogenous Antigen Processing. Immunity. 2003 3//;18(3):343-54. 218. Schubert U, Antón LC, Gibbs J, Norbury CC, Yewdell JW, Bennink JR. Rapid degradation of a large fraction of newly synthesized proteins by proteasomes. Nature. [10.1038/35008096]. 2000 04/13/print;404(6779):770-4. 219. Reits EAJ, Vos JC, Gromme M, Neefjes J. The major substrates for TAP invivo are derived from newly synthesized proteins. Nature. [10.1038/35008103]. 2000 04/13/print;404(6779):774-8. 220. Mayrand S-M, Green WR. Non-traditionally derived CTL epitopes: exceptions that prove the rules? Immunology Today. 1998;19(12):551-6. 221. Yewdell JW, Anton LC, Bennink JR. Defective ribosomal products (DRiPs): a major source of antigenic peptides for MHC class I molecules? Journal of immunology (Baltimore, Md : 1950). 1996 Sep 1;157(5):1823-6. 222. Wang RF, Parkhurst MR, Kawakami Y, Robbins PF, Rosenberg SA. Utilization of an alternative open reading frame of a normal gene in generating a novel human cancer antigen. The Journal of experimental medicine. 1996 Mar 1;183(3):1131-40. 223. Shastri N, Nguyen V, Gonzalez F. Major histocompatibility class I molecules can present cryptic translation products to T-cells. The Journal of biological chemistry. 1995 Jan 20;270(3):1088-91. 224. Bullock TN, Patterson AE, Franlin LL, Notidis E, Eisenlohr LC. Initiation codon scanthrough versus termination codon readthrough demonstrates strong potential for
178
major histocompatibility complex class I-restricted cryptic epitope expression. The Journal of experimental medicine. 1997 Oct 6;186(7):1051-8. 225. Bullock TN, Eisenlohr LC. Ribosomal scanning past the primary initiation codon as a mechanism for expression of CTL epitopes encoded in alternative reading frames. The Journal of experimental medicine. 1996 Oct 1;184(4):1319-29. 226. Fetten JV, Roy N, Gilboa E. A frameshift mutation at the NH2 terminus of the nucleoprotein gene does not affect generation of cytotoxic T lymphocyte epitopes. Journal of immunology (Baltimore, Md : 1950). 1991 Oct 15;147(8):2697-705. 227. Berglund P, Finzi D, Bennink JR, Yewdell JW. Viral alteration of cellular translational machinery increases defective ribosomal products. Journal of virology. 2007 Jul;81(13):7220-9. 228. Netzer N, Goodenbour JM, David A, Dittmar KA, Jones RB, Schneider JR, et al. Innate immune and chemically triggered oxidative stress modifies translational fidelity. Nature. 2009 Nov 26;462(7272):522-6. 229. Yewdell JW, Nicchitta CV. The DRiP hypothesis decennial: support, controversy, refinement and extension. Trends in immunology. 2006 Aug;27(8):368-73. 230. Yewdell JW. DRiPs Solidify: Progress in Understanding Endogenous MHC Class I Antigen Processing. Trends in immunology. 2011 09/29;32(11):548-58. 231. Nielsen M, Lundegaard C, Lund O, Kesmir C. The role of the proteasome in generating cytotoxic T-cell epitopes: insights obtained from improved predictions of proteasomal cleavage. Immunogenetics. 2005 Apr;57(1-2):33-41. 232. Skjøt RLV, Brock I, Arend SM, Munk ME, Theisen M, Ottenhoff THM, et al. Epitope Mapping of the Immunodominant Antigen TB10.4 and the Two Homologous Proteins TB10.3 and TB12.9, Which Constitute a Subfamily of the esat-6 Gene Family. Infection and Immunity. 2002;70(10):5446-53. 233. Jing L, Laing KJ, Dong L, Russell RM, Barlow RS, Haas JG, et al. Extensive CD4 and CD8 T Cell Cross-Reactivity between Alphaherpesviruses. The Journal of Immunology. 2016 March 1, 2016;196(5):2205-18. 234. Folch G, Lefranc MP. The human T cell receptor beta variable (TRBV) genes. Experimental and clinical immunogenetics. 2000;17(1):42-54. 235. Koning D, Costa AI, Hasrat R, Grady BP, Spijkers S, Nanlohy N, et al. In vitro expansion of antigen-specific CD8+ T cells distorts the T-cell repertoire. Journal of immunological methods. 2014;405:199-203. 236. Adam J, Eriksson KK, Schnyder B, Fontana S, Pichler WJ, Yerly D. Avidity determines T-cell reactivity in abacavir hypersensitivity. European journal of immunology. 2012 Jul;42(7):1706-16. 237. Zhu J, Peng T, Johnston C, Phasouk K, Kask AS, Klock A, et al. Immune surveillance by CD8alphaalpha+ skin-resident T cells in human herpes virus infection. Nature. 2013 May 23;497(7450):494-7. 238. Pittet MJ, Speiser DE, Valmori D, Cerottini J-C, Romero P. Cutting edge: cytolytic effector function in human circulating CD8+ T cells closely correlates with CD56 surface expression. The Journal of Immunology. 2000;164(3):1148-52. 239. Ogawa K, Takamori Y, Suzuki K, Nagasawa M, Takano S, Kasahara Y, et al. Granulysin in human serum as a marker of cell-mediated immunity. European journal of immunology. 2003;33(7):1925-33. 240. Villani A.P., Rozières A., Bensaïd B., Tardieu M., Albert F., Mutez V., et al. Massive Expansion Of Clonotypic And Polycytotoxic CD8+ T Cells In Toxic Epidermal Necrolysis. 7th Drug Hypersensitivity Meeting (DHM) 21st - 23rd April, 2016; Malaga, Spain Clinical and Translational Allergy; 2016. 241. Rebecca Pavlos CR, Elizabeth McKinnon, David Ostrov, Pablo C. Plascencia, Bjoern Peters, Jing Yuan, Silvana Gaudieri, David Haas, Simon Mallal, Elizabeth J.
179
Phillips, editor. Specific Binding Characteristics of HLA Alleles Associate with Nevirapine Hypersensitivity. Conference on Retroviruses and Opportunistic Infections (CROI), At Boston, Massachusetts; 2014. 242. Rive C, Pavlos R, Ostrov D, Plasencia P, Hung S-I, Chung W, et al. HLA class I-drug-T-cell receptor interactions in SJS/TEN. Clinical and Translational Allergy. 2014;4(3).
180
181
9 Appendix 9.1 Nevirapine isolation from Viramune tablets
One tablet of Viramune contains 200mg of NVP; one tablet of Viramune extended-
release (XR) contains 400mg of NVP. NVP extraction from its tablet form requires the
separation of NVP from the drug excipients. In a sterile environment, like that of a
class-II biological hood:
A 200mg NVP tablet was crushed into a fine powder, transferred into a sterile 50
mL Schott bottle (autoclaved), and diluted in 40 mL of DMSO (5mg of NVP per mL
of DMSO).
Tablet/DMSO solution was then transferred to the appropriate tubes, centrifuged at
7224 RCF (10,000 RPM) for 5 minutes.
Supernatant, containing NVP dissolved in DMSO, was then transferred to a sterile
50 mL Schott bottle (autoclaved).
NVP/DMSO solution was diluted with sterile 1x PBS, giving a final concentration of
1 mg/mL (1:5 dilution).
NVP solution was then filtered using a 0.22 μm filter and transferred to a correctly
labelled sterile 50 mL Schott bottle (autoclaved) wrapped in aluminium foil, and
stored in a dark environment at room temperature. As a means of quality control
any NVP made and stored in this manner would be disposed of after 2 weeks.
Check on Nano drop for absorbance at 260nm, should read at 6.0 (For NanoDrop,
make up three Eppendorf tubes).
o Tube 1 = 750uls of PBS alone
o Tube 2 = 750uls of PBS plus 250 of DMSO
o Tube 3 = 750uls of PBS plus 250 of NVP 1mg/mL
182
9.2 Chapter 5 Specific T-cell clonotype and
detection by ddPCR
9.2.1 Reference Sequence Amplicon Analysis QPCR Primer
Validation
The first step in setting up a TCR CDR3 sequence specific PCR assay involves
designing the oligonucleotide primer sets and optimising various aspects of the assay,
including the optimal thermocycling conditions. This was done using a real time,
quantitative PCR assay and the EvaGreen master mix. Firstly multiple variations of the
primer sets were designed, but failed and were excluded. The primer sets and master
mix highlighted Chapter 2 Methods and Materials, Section 2.4.2 Digital Droplet PCR
Table 2.15, Table 2.17, and Table 2.17 were used, and thermocycling conditions
optimised. This included analysing various annealing temperatures. As shown in
Figure 9.2 and Figure 9.2, it was determined that an annealing temperature of 58°C for
30 sec was better for all this specific ddPCR assay, in preference to the manufactures
recommended protocol of having a 60 sec annealing and denaturing combined step at
60°C.
Figure 9.1: Analysis of specific Vβ CDR3 primers using serial dilutions of the reference sequence
amplicons, with the annealing temperature set at 58◦C
183
Figure 9.2: Analysis of specific Vβ CDR3 primers using serial dilutions of the reference sequence
amplicons, with the annealing temperature set at and 60◦C.
9.2.2 The ddPCR Sensitivity Analysis
The sensitivity of the ddPCR assay was assessed using the serially diluted synthetic
construct amplicons. This analysis confirms the manufactures claims that the ddPCR
method is sensitive enough to detect single copies of target DNA. The range of the
ddPCR copy number detection, using the EvaGreen ddPCR assay is sensitive enough
to detect DNA from 105 copies of DNA, down to the single copy level. This was shown
in the analysis of serially diluted synthetic construct amplicons (Figure 9.3 to Figure
9.5).
184
Figure 9.3: the QuantaSoft raw digital droplet PCR plots. Reference sequence amplicons, serially
diluted to test the sensitivity of the digital droplet PCR and qualifying the assay parameters.
185
Figure 9.4: the QuantaSoft digital droplet PCR output of positive and total events recorded for the raw
plots outlined in Figure 9.10 Reference sequence amplicons, serially diluted to test the sensitivity of the
digital droplet PCR and qualifying the assay parameters.
Figure 9.5: Digital droplet PCR Reference sequence amplicons serial dilution result and QuantaSoft
output (copies/μL). Reference sequence amplicons, serially diluted to test the sensitivity of the digital
droplet PCR and qualifying the assay parameters.
186
9.3 Future experimentation for HLA-15:02-restricted
CBZ-SJS/TEN
9.3.1 Preliminary granulysin expression data
Stimulation of Donor PBMC’s with CBZ and with the HLA-B*15:02-restricted peptides
identified in Chapter 4 Predicted HLA-Restricted Peptide Screening, failed to show
increased granulysin expression in peptide stimulation CD8+ T cells significantly above
that of the unstimulated response, matching that of the CBZ-stimulated CD8+ T cells
(Figure 9.16).
Figure 9.6: Mean (+/- SD) Granulysin expression by CD8+ T cells, stimulated by the epitopes discovered
in Chapter 4 Predicted HLA-Restricted Peptide Screening (10μg/mL) and CBZ (10μg/mL).
187
9.3.2 Preliminary TCR expression data
Stimulation of Donor PBMC’s with CBZ and with the HLA-B*15:02-restricted peptides
identified in Chapter 4 Predicted HLA-Restricted Peptide Screening, failed to show an
expansion of TCR Vβ-12 CDR3 LAGELF and Vβ-11 CDR3 ISGSY in Donor 1 (CBZ-
TEN) matching that of the CBZ-stimulated response (Figure 9.17).
Figure 9.7: TCR Vβ-12 CDR3 LAGELF and Vβ-11 CDR3 ISGSY sequence profile of Donor 1 (CBZ-
TEN) when stimulated with stimulated by the epitopes discovered in Chapter 4 Predicted HLA-
Restricted Peptide Screening (10μg/mL) and CBZ (10μg/mL). Raw data analysed using Bio-Rad
QuantaSoft software, results normalised against RPHH1 expression, and calculated as a percentage
(%) of normalised Cβ expression.
188
9.4 Publication and Conference Abstracts
9.4.1 Journal Publications
Title: HLA Class-I restricted CD8 (+) and Class-II restricted CD4 (+) T cells are
implicated in the Pathogenesis of Nevirapine Hypersensitivity.
DOI:10.1097/QAD.0000000000000345 AIDS, London, 24 August 2014 - Volume 28 -
Issue 13 - p 1891–1901.
Niamh M Keanea*, Rebecca K Pavlosa*, Elizabeth McKinnona*, Andrew Lucasa, Craig
Rivea, Christopher C Blythb,c, David Dunna, Michaela Lucasd, Simon Mallala,e,
Elizabeth Phillipsa,e: aInstitute for Immunology and Infectious Diseases, Murdoch
University, bDepartment of Paediatrics and Adolescent Medicine, Princess Margaret
Hospital for Children, cSchool of Paediatrics & Child Health, dSchool of Medicine &
Pharmacology and School of Pathology & Laboratory Medicine, The University of
Western Australia, Perth, Western Australia, Australia, and eVanderbilt University
School of Medicine, Nashville, Tennessee, USA
Figure 9.8: Abstract of HLA Class-I restricted CD8 (+) and Class-II restricted CD4 (+) T cells are
implicated in the Pathogenesis of Nevirapine Hypersensitivity paper.
Published in AIDS, London, 24 August 2014 - Volume 28 - Issue 13 - p 1891–1901.
DOI:10.1097/QAD.0000000000000345 (138).
Title: Testing for Drug Hypersensitivity Syndromes.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3626363/ The Clinical biochemist.
Reviews / Australian Association of Clinical Biochemists 02/2013; 34(1):15-38.
189
Craig M Rive1, Jack Bourke2, Elizabeth J Phillips1-4: 1Institute for Immunology and
Infectious Diseases, Murdoch University, 2Department of Clinical Immunology &
Immunogenetics, Royal Perth Hospital, Western Australia; 3Department of Clinical
Immunology & Infectious Diseases, Sir Charles Gairdner Hospital, Western Australia; 4Pathology & Laboratory Medicine, University of Western Australia, Australia
Figure 9.9: Abstract of Testing for Drug Hypersensitivity Syndromes.
Published in The Clinical biochemist. Reviews / Australian Association of Clinical Biochemists 02/2013;
34(1):15-38. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3626363/ (2).
9.4.2 Publications in development
1. Title: Peptide-Binding Characteristics of HLA Alleles Associate with Cutaneous
Nevirapine Hypersensitivity – Co-author based on Chapter 3: Nevirapine.
2. Title: The use of droplet digital PCR to explore shared and restricted T-cell
receptor use in HLA-B*15:02 driven, carbamazepine-induced Steven-Johnson
syndrome / Toxic epidermal necrolysis – Primary author based on Chapter 5 -
Carbamazepine induced Stevens-Johnson syndrome and toxic epidermal
necrolysis Immunopathogenesis: Specific T-cell clonotypes.
190
9.4.3 Conference Proceedings
9.4.3.1 Posters
Title: HLA Class-I-drug-T-cell receptor interaction and cytokine expression in SJS/TEN.
DOI: 10.13140/RG.2.1.4937.5207 Science on the Swan, Western Australia, Perth.
April, 2015
Authors: Craig Rive1, David Ostrov2, Abha Chopra1, Rebecca Pavlos1 Simon Mallal1,3,
Elizabeth J. Phillips1,3:1Institute for Immunology and Infectious Diseases, Murdoch,
Australia,2University of Florida College of Medicine, Gainesville, FL,3Vanderbilt
University Medical Centre, Nashville, TN.
Figure 9.10: Poster presented at Science on the Swan, April 2015.
https://www.researchgate.net/publication/281661878_HLA_Class_I-drug-T-
cell_receptor_interaction_and_cytokine_expression_in_SJSTEN
DOI: 10.13140/RG.2.1.4937.5207
191
Title: Specific Binding Characteristics of HLA Alleles Associate with Nevirapine Hypersensitivity.
DOI: 10.13140/RG.2.1.1206.1287 Conference on Retroviruses and Opportunistic
Infections (CROI), Boston, Massachusetts; 2014
Authors: Rebecca Pavlos1, Craig Rive1, Elizabeth McKinnon1, David Ostrov2, Bjoern
Peters3, Jing Yuan4, Silvana Gaudieri1,5, David Haas6, Simon Mallal1,6, and Elizabeth
J. Phillips1,6: Institute for Immunology and Infectious Diseases, Murdoch, AUSTRALIA, 2University of Florida College of Medicine, Gainesville, FL, 3La Jolla Institute for Allergy
and Immunology, La Jolla, CA, 4Boehringer Ingelheim Pharmaceuticals Inc.,
Ridgefield, CT, 5University of Western Australia, Crawley, AUSTRALIA, 6Vanderbilt
University Medical Centre, Nashville, TN
Figure 9.11: Poster presented at Conference on Retroviruses and Opportunistic Infections (CROI),
Boston, Massachusetts; 2014. https://www.researchgate.net/publication/275332026_Specific_Binding_
Characterstics_of_HLA_Alleles_Associate_with_Nevirapine_Hypersensitivity
DOI: 10.13140/RG.2.1.1206.1287. (241)
192
9.4.3.2 Presentations
Title: HLA class-I-drug-T-cell receptor interactions in SJS/TEN.
DOI:10.1186/2045-7022-4-S3-P2 at Drug hypersensitivity meeting 6 (DHM6), Bern
Switzerland April, 2014
Authors: Craig Rive1, Rebecca Pavlos1, David Ostrov2, Pablo Plasencia2, Shien-Iu
Hung3 WenHung Chung4, Bjoern Peters5, Soren Buus6, Simon Mallal1,7, Elizabeth J.
Phillips1,7, 1Institute for Immunology and Infectious Diseases, Murdoch, Australia, 2University of Florida College of Medicine, Gainsville, FL, 3Institute of Pharmacology,
School of Medicine, Genome Research Centre, National Yang-Ming University, Taipei,
Taiwan., 4Department of Dermatology, Chang Gung Memorial Hospital, College of
Medicine, Chang Gung University, Keelung,5La Jolla Institute for Allergy and
Immunology, La Jolla, CA, 6Laboratory of Experimental Immunology, University of
Copenhagen, Copenhagen, Denmark. 7Vanderbilt University Medical Centre,
Nashville, TN.
Figure 9.12: Abstract for talk presented at Drug hypersensitivity meeting 6 (DHM6), Bern Switzerland
April, 2014.
http://www.ctajournal.com/content/4/S3/P2 DOI:10.1186/2045-7022-4-S3-P2 or
https://www.researchgate.net/publication /274893067_
HLA_class_I-drug-T-cell_receptor_interactions_in_SJSTEN. (242)
193
Title: HLA Class-I-drug-T-cell receptor and Carbamazepine induced Stevens-Johnson syndrome / Toxic epidermal necrolysis
DOI: 10.13140/RG.2.1.2709.2962. The Australian Society for Medical Research
(ASMR), Perth Western Australia June, 2014.
Authors: Craig Rive1, Rebecca Pavlos1, David Ostrov2, Pablo Plasencia2, Shien-Iu
Hung3 WenHung Chung4, Bjoern Peters5, Soren Buus6, Simon Mallal1,7, Elizabeth J.
Phillips1,7, 1Institute for Immunology and Infectious Diseases, Murdoch, Australia, 2University of Florida College of Medicine, Gainsville, FL, 3Institute of Pharmacology,
School of Medicine, Genome Research Centre, National Yang-Ming University, Taipei,
Taiwan., 4Department of Dermatology, Chang Gung Memorial Hospital, College of
Medicine, Chang Gung University, Keelung,5La Jolla Institute for Allergy and
Immunology, La Jolla, CA, 6Laboratory of Experimental Immunology, University of
Copenhagen, Copenhagen, Denmark. 7Vanderbilt University Medical Centre,
Nashville, TN.
Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN). CBZ-SJS/TEN has been associated with HLA-B*15:02 carriage and specific T-cell Background: Carbamazepine (CBZ) is associated with the severe cutaneous drug reaction clonotypes. We aimed to characterise the interactions between specific T-cell receptor (TCR) clonotypes, HLA-B*15:02 and CBZ.
Methods: Peripheral blood mononuclear cells (PBMC’s) were isolated from patients with CBZ-SJS/TEN and healthy controls, stimulated with 10ug/mL CBZ (Sigma, cat. no. C4024-5G) and cultured over a 9-14 day period. RNA was isolated at various time points and TCR Vβ subtypes were assessed using digital droplet PCR (Bio-Rad QX100 droplet digital PCR system). Drug-specific T-cell IFN-γ and granulysin responses were assessed by ELISpot and ICS. In-silico modelling was used to examine the interaction between the known specific TCR Vβ and Vα chains, CBZ and HLA-B*15:02.
Results: CBZ-specific T-cell IFN-γ and granulysin responses were detected many years following the original SJS/TEN reaction. Expansion of specific TCR CDR3 sequences was confirmed in CBZ-SJS/TEN patient cultures. In-silico modelling of the CBZ-HLA-B*15:02-TcR interaction suggests that CBZ binds non-covalently in the P4 binding pocket of the HLA-B*15:02 antigen binding cleft in a site that is typically occupied with bound peptide.
Conclusions: These findings raise two non-mutually exclusive possibilities: 1) CBZ may block peptide-binding and be presented by HLA-B*15:02 in a solvent exposed manner available for direct recognition by the TCR, 2) CBZ binding the central portion of the HLA-B*15:02 antigen binding cleft may permit long peptides to bind conventionally at the peptide termini (in the A- and F-pockets) and bulge over the drug in the central residues to permit indirect recognition of CBZ (peptide mediated TCR contact).