EUKARYOTIC CELL, Jan. 2010, p. 127–135 Vol. 9, No. 11535-9778/10/$12.00 doi:10.1128/EC.00255-09Copyright © 2010, American Society for Microbiology. All Rights Reserved.

The Glycosylation Pathway of Eimeria tenella Is Upregulated duringGametocyte Development and May Play a Role in Oocyst

Wall Formation�

Robert A. Walker, Iveta Slapetova, Jan Slapeta, Catherine M. Miller, and Nicholas C. Smith*Institute for the Biotechnology of Infectious Diseases, University of Technology, Sydney, New South Wales 2007, Australia

Received 28 August 2009/Accepted 27 October 2009

Sexual-stage glycoproteins of Eimeria are important components of the oocyst wall, a structure that ensuresthe efficient transmission of these and related parasites. In this study, the primary enzyme in the glycosylationpathway of Eimeria tenella, glucosamine:fructose-6-phosphate aminotransferase (EtGFAT), has been charac-terized as a macrogamete-specific protein. Although the transcription of EtGFAT was observed early inmacrogamete development, protein expression was restricted to mature macrogametes, prior to their conver-sion into unsporulated oocysts. Genes coding for three other enzymes required for N-acetylgalactosamine(GalNAc) synthesis were also transcribed during E. tenella macrogamete development. Gene transcription ofthe enzyme responsible for the O-linked transfer of GalNAc to proteins, EtGalNAc-T, was upregulatedprimarily in unsporulated oocyst stages, and accordingly, a significant increase in GalNAc levels was observedin E. tenella gametocytes and oocysts. Gam56 and Gam82, two well-characterized glycoproteins of Eimeriamacrogametes and the oocyst wall, contain high levels of GalNAc and represent probable targets of GalNAc Olinkage. It appears that the glycosylation pathway, specifically relating to the formation of GalNAc O links, isdramatically upregulated in E. tenella sexual stages and may play a role in directing a number of macrogameteproteins to the developing oocyst wall.

Eimeria tenella is a protozoan parasite of chickens and amember of the Apicomplexa, a phylum that includes manyimportant human pathogens, such as Plasmodium, Cryptospo-ridium, and Toxoplasma. Infection with one of seven species ofEimeria can cause coccidiosis, a highly contagious disease thatis estimated to cost the broiler industry in excess of $1.5 billionper annum (36). The extremely infectious nature of these par-asites can be attributed primarily to the durability of the ex-creted oocyst. Facilitating protection against detrimentalforces, both physical and chemical (18), is the bilayered oocystwall, a structure composed of a 40-nm outer layer and a200-nm inner layer (4). The development of the oocyst and itsprotective wall is preceded by the formation and maturation ofmale and female gametes, known as microgametes and mac-rogametes, respectively.

Microscopic analyses have consistently demonstrated thatwall-forming bodies I (WFBI) and II (WFBII) form the outerand inner layers of the oocyst wall, respectively (4, 13, 32).Furthermore, several proteins have been identified that aredetected both in macrogamete WFBs and in the oocyst wall.The best characterized of these are EmGam56 and EmGam82,glycoproteins of Eimeria maxima, which are components ofWFBII and, accordingly, the inner oocyst wall (13). EmGam56and EmGam82 are processed into smaller peptides prior toincorporation into the oocyst wall, where proposed cross-link-ing occurs to ensure the formation of a stable extracellularmatrix (5, 6). EtGam56, an E. tenella homologue of EmGam56,

appears to undergo a similar process of truncation prior tooocyst wall formation (19, 25), implying that this mechanism isstrongly conserved within the Eimeria genus.

The contents of the Eimeria oocyst wall were originallythought to consist of a high proportion of glycoproteins (37), atheory supported by biochemical analyses of EmGam56 andEmGam82 that revealed high concentrations of the aminosugar (glycan) galactosamine. It is unclear why these wall-forming proteins require glycosylation; however, the strongconservation of O-glycosylation motifs in both EmGam56 andEtGam56 (19) implies that it is an important process.N-Acetylgalactosamine (GalNAc) has also been implicated asthe likely glycan moiety of glycoproteins present in the oocystwall of the related apicomplexan, Cryptosporidium parvum,with a proposed role in host cell attachment (20, 35).

A key player in amino sugar biosynthesis and, potentially,glycosylation is glucosamine:fructose-6-phosphate aminotrans-ferase (GFAT) (10), an enzyme found among all known or-ganisms (12). Intriguingly, this enzyme has been found in Plas-modium berghei to be specific for macrogametes (17). Wereport here on the identification and characterization of ahighly conserved E. tenella-specific GFAT (EtGFAT), propos-ing a role for the enzyme in macrogametocyte developmentand oocyst wall formation. We analyzed the gene transcription,protein expression, and localization within different develop-mental stages of E. tenella. In addition, the gametocyte-specifictranscription of genes coding for other E. tenella glycosylationenzymes was also characterized to illustrate potential synchro-nicities. Finally, the relative levels of the two amino sugars,N-acetylglucosamine (GlcNAc) and GalNAc, were determinedin the different E. tenella stages with additional emphasis ondetecting unique glycosylated proteins.

* Corresponding author. Mailing address: Institute for the Biotech-nology of Infectious Diseases, University of Technology, Sydney, P.O.Box 123, Broadway, New South Wales 2007, Australia. Phone: 61 29514 4013. Fax: 61 2 9514 8206. E-mail: nick.smith@uts.edu.au.

� Published ahead of print on 6 November 2009.

127

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

MATERIALS AND METHODS

Bioinformatic analysis. The P. berghei GFAT protein (PB000496.03.0) wasidentified as an exclusive protein of macrogametes through analysis of the sup-plementary data provided by Khan et al. (17) at http://www.cell.com/cgi/content/full/121/5/675/DC1/. The identification of putative glycosylation enzymes wascarried out by using the BLASTp tool (1) available at the online predictedprotein databases of E. tenella (http://www.genedb.org/genedb/etenella/), Toxo-plasma gondii (http://toxodb.org), and C. parvum (http://cryptodb.org). The align-ment of similar protein or nucleic acid sequences was performed by usingCLUSTAL W (version 1.83) through the publicly available European Bioinfor-matics Institute website (http://www.ebi.ac.uk/Tools/clustalw/index.html) accord-ing to default settings. The calculation of molecular weights and prediction ofantigenicity for protein sequences was performed by using Protean (Lasergene 7Software Suite for Sequence Analysis; DNASTAR, Inc.). Catalytic domains ofGFAT were identified by using the ScanProsite tool (release 20.22) (14), whilethe locations of signal peptides were predicted with the SignalP 3.0 Server (8).

Animals and parasites. Australorp cockerels (Barter and Sons Pty., Ltd.,Huntingwood, New South Wales, Australia) were purchased at 1 day of age andkept at 21°C with a 12-h light/dark cycle and with free access to food and water.Merozoites and unsporulated oocysts were purified from E. tenella-infectedchicken ceca at 112 h postinfection (p.i.) and 168 h p.i, respectively, and oocystssporulated where necessary, as described previously (34). Gametocytes were alsopurified from infected chicken ceca at 134 h p.i. by using the method describedpreviously for E. maxima (30). Whole cecal samples were also taken at 134 and144 h p.i. for immunolocalization studies. The samples were stored in 2% para-formaldehyde–0.1 M phosphate buffer (pH 7.4) until sectioning. Uninfectedchicken cecal scrapings were also prepared as a negative control for reversetranscription-PCR (RT-PCR) and protein analyses.

RT-PCR. Total RNA was purified from different E. tenella samples by usingTRIzol reagent (Invitrogen). Unsporulated and sporulated oocysts were vortexedwith an equal volume of glass beads (710 to 1,180 �m; Sigma) prior to RNAextraction until cell lysis could be observed for �90% of each sample. The analysisof major rRNA bands was performed with an Experion automated electrophoresissystem (Bio-Rad) using the Experion RNA StdSens chip. Total RNA samples weretreated with DNase I (RNase-free) (Roche), for 1 h at 37°C, and the reaction wasstopped with the addition of 2.5 mM EDTA, followed by a 10-min incubationat 75°C. The synthesis of cDNA was carried out by using a SuperScript IIIfirst-strand synthesis system for RT-PCR using oligo(dT)20 primer. The E.tenella cDNA samples were standardized to comparable levels of EtActintranscription by amplifying the gene from different dilutions (1/5, 1/25, and1/100) of each sample at 25 cycles. PCR was carried out with Advantage 2polymerase (Clontech) using gene-specific primers at a final concentration of0.2 �M. All PCR amplification was carried out using the following program: denatur-ation (95°C, 3 min) for 1 cycle and then denaturation (95°C, 30 s), annealing (65°C, 1min), and extension (68°C, 3 min) for 25 to 35 cycles. The design of oligonucleotideprimers was based on genomic sequence obtained from the E. tenella Genome Project(http://www.sanger.ac.uk/Projects/E_tenella/http://www.sciencedirect.com/science?_ob�RedirectURL&_method�externObjLink&_locator�url&_cdi�6626&_plusSign�%2B&_targetURL�http%253A%252F%252Fwww.sanger.ac.uk%252FProjects%252FE_tenella%252F) using the xx/xx/200x assembly. The names and sequencesof forward and reverse primers used to amplify each E. tenella gene are detailedin Table 1. PCR products were analyzed by agarose gel electrophoresis usingGelRed for nucleic acid visualization.

Sequencing. Each PCR product was excised from an agarose gel and the DNApurified by using a QIAquick gel extraction kit (Qiagen). The purified DNA wasthen cloned into the sequencing vector, pCR4-TOPO, using a TOPO TA cloningkit (Invitrogen). The recombinant plasmids were sequenced by using the forwardand reverse M13 primers (vector specific) at the Australian Genome ResearchFacility (Brisbane, Australia). Sequence data were analyzed by using the SeqManprogram (Lasergene 7 Software Suite for Sequence Analysis; DNASTAR, Inc.) andaligned to the original gene sequences by using CLUSTAL W (described above).

Generation of antisera for EtGFAT detection. A short peptide (CNPDKPRGLAKTVTVS-NH2) was designed to the last 15 amino acids of the EtGFATprotein sequence (C terminal). The peptide was synthesized by Auspep Pty., Ltd.(Melbourne, Australia) to a purity of 82%. The N-terminal cysteine residue wasadded to facilitate conjugation to keyhole limpet hemocyanin (KLH) carrierprotein (also performed at Auspep). A single rabbit was immunized at 0, 3, 6, and9 weeks with 500-�g doses of the KLH-conjugated EtGFAT peptide, adminis-tered by subcutaneous injection at several different sites, by the Institute ofMedical Veterinary Sciences (Adelaide, Australia). Antigen used for the firstinoculation was emulsified in complete Freund adjuvant, whereas antigen forsubsequent inoculations was emulsified in incomplete Freund adjuvant. Prebleed

sera was taken prior to the first inoculation (negative control), while the anti-EtGFAT sera were collected by exsanguination at 10.5 weeks.

SDS-PAGE and transfer. Parasite purifications and negative control chickenceca to be analyzed by Western blotting were prepared under reducing andalkylating conditions as follows: samples were resuspended in reducing buffer (6M guanidinium HCl, 50 mM Tris-HCl, 10 mM EDTA, 10 mM dithiothreitol [pH8.6]) and incubated for 2 h at 60°C, after which a 1/4 volume of alkylating buffer(reducing buffer with 200 mM iodoacetamide) was added, and samples incubatedfor an additional 30 min in the dark. The reaction was stopped by the additionof 250 mM dithiothreitol, and insoluble material removed by 15 min of centrif-ugation (10,000 � g). Biological samples to be analyzed by lectin blotting wereprepared under reducing conditions by resuspending in 2� SDS reducing buffer(100 mM Tris-HCl [pH 6.8], 20% glycerol, 4% SDS, 200 mM dithiothreitol). Theinitial lysis of oocyst samples was achieved by vortexing with glass beads (asdescribed earlier). All protein samples were supplemented with 0.02% bromo-phenol blue and heated for 5 min at 95°C prior to electrophoresis. Approximately5 �g of each protein sample (quantified by using a NanoDrop ND-1000 spec-trophotometer) was electrophoresed at 180 V for 1 h on a 4 to 12% polyacryl-amide gel (NuPAGE Bis-Tris gel; Invitrogen) using morpholine ethanesulfonicacid (MES) buffer (Invitrogen). A SeeBlue Plus2 prestained standard (Invitro-gen) was run for size estimation. One gel was stained with Flamingo fluorescentgel stain (Bio-Rad) to ensure that equal quantities of total protein had beenloaded into each well. Proteins were transferred to polyvinylidene difluoridemembrane for 1 h at 100 V according to protocols published previously (16).

Immunoblotting and lectin blotting. Membranes used for immunoblottingwere blocked, washed, and probed with primary and secondary antibodies asdescribed previously (3). The rabbit anti-EtGFAT and mouse anti-EmGam56 (5)primary antibodies were used at dilutions of 1 in 100 and 1 in 200, respectively.The rabbit and mouse primary antibodies were detected with anti-rabbit andanti-mouse IgG alkaline phosphatase-conjugated secondary antibodies, respec-tively, at a dilution of 1 in 1,000. Membranes used for lectin blotting wereblocked for 30 min at 37°C in phosphate-buffered saline (PBS; 137 mM NaCl, 2.7mM KCl, 4.3 mM Na2HPO4, 1.4 mM KH2PO4 [pH 7.4]) supplemented with 5%gelatin. The membrane was washed twice for 4 min in PBS–0.05% Tween 20 andonce for 4 min in PBS. Each membrane was probed with 10 �g of biotinylatedlectin (Vector Laboratories)/ml in PBS–1% gelatin–0.05% Tween 20 (blockingbuffer) for 1 h at room temperature with constant agitation. Wheat germ agglu-tinin (WGA) lectin was used to detect N-acetylglucosamine, and Jacalin (JAC)lectin was used to detect N-acetylgalactosamine. Each membrane was washed andprobed (as described above) with ExtrAvidin alkaline phosphatase (Sigma) at 1 in2,000 in blocking buffer. Membranes were washed and glycosylated proteins de-tected using Fast 5-bromo-4-chloro-3-indolylphosphate (BCIP)/nitroblue tetrazo-lium (NBT) substrate (Sigma) according to the manufacturer’s instructions.

Immunofluorescence microscopy. Paraffin sections were cut from fixed sam-ples of E. tenella (134 and 144 h p.i) to a thickness of 4 �m. The tissue wasrehydrated by soaking the slides in xylol three times for 10 min each time, 100%ethanol twice for 3 min each time, 95% ethanol for 3 min, 90% ethanol for 3 min,

TABLE 1. Primers used for the amplification of E. tenellagene transcripts

Gene Primer Sequence (5�–3�)

EtGFAT Et57F GGGCGATGGGCAGCTTACTACAACEt58R TCAAATGAACGCCCAAGGTCCAG

EtAGM Et155F GCAGGTGGGAGTTGTACAGACAGC

Et156R CTGCAACTGCGGGGAATTCGEtUAP Et157F GCTTTGAAGGCCCCAAAGG

Et158R GGCAGTTGTCGACAGGGAGGEtUAE Et167F GCTACATCGGCAGCCACACG

Et168R CACTGGCAGCAAATTGTTTGGCEtGalNAc-T Et165F GACGAGTACTTGCCTTACCTCCCC

Et166R CACGCGGTTCTTCCACACGEtActin E0043 GGAATTCGTTGGCCGCCCAAAGA

ATCCE0044 GCTCTAGATTAGCTCGGCCCAGAC

TCATCEtGam56 E0035 CATATGGTAGAAGTGCCAATGGAC

E0036 CACGTGTTAGTAGAAGCTGGAGTGGCT

128 WALKER ET AL. EUKARYOT. CELL

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

70% ethanol for 3 min, and citrate buffer (10 mM [pH 6.0]) three times for 10min each time. Antigen retrieval was carried out using a 900-W microwave ovenas follows: samples were boiled three times for 5 min each time in citrate bufferon medium power and for 10 min in Tris-HCl buffer (100 mM, pH 10.0) on lowpower. Rabbit anti-EtGFAT (1 in 100) and mouse anti-EmGam56 (1 in 200)were diluted in PBS–3% bovine serum albumin–0.05% Tween 20 (blockingbuffer), added to slides, and incubated overnight at 4°C in a humidified chamber.The slides were washed the following day with PBS three times for 10 min eachtime. Goat anti-rabbit IgG-fluorescein isothiocyanate (FITC) conjugate (Sigma)and goat anti-mouse IgG-Texas Red (Invitrogen) secondary antibodies werediluted 1 in 100 in blocking buffer and applied to tissue sections for 1 h at roomtemperature (in the dark). Slides were washed twice in PBS for 10 min, coun-terstained with 1 �g of DAPI (4�,6�-diamidino-2-phenylindole)/ml for 5 min, andwashed twice more. The tissue sections were mounted in PBS–50% glycerolunder a glass coverslip and visualized with a Research BX51 microscope (Olym-pus Optical Co., Ltd.). FITC-conjugated antibodies were visualized by using a470- to 490-nm excitation filter, Texas Red-conjugated antibodies were visualizedby using a 520- to 550-nm excitation filter, and DAPI-positive cells (i.e., E. tenellamerozoites, microgametes, and host cell nuclei) were visualized by using a 330-to 385-nm excitation filter. The acquisition of images and the overlay of imagesvisualized under different filters were performed using the DP Controller soft-ware (Olympus Optical).

Lectin microtiter assay. Protein lysates, prepared for lectin blotting (as de-scribed above), were diluted to 5 ng/�l (for GalNAc detection) or 1 ng/�l(GlcNAc) in enzyme-linked immunosorbent assay (ELISA) buffer I (0.59%NaHCO3, 0.31% Na2CO3, 0.02% NaN3 [pH 9.6]) and added in quadruplicate(100 �l/well) to a 96-well, U-bottom, ELISA microplate (Griener Bio-One).After an overnight incubation at 4°C, wells were rinsed twice in blocking buffer(PBS, 0.05% Tween 20), once in PBS, and blocked for 1 h at room temperaturewith PBS–0.5% Tween 20. Wells were rinsed (as described above) and probedfor 1 h at room temperature with WGA (diluted to 10 �g/ml in blocking buffer)or JAC (1 �g/ml) biotinylated lectin. Wells were rinsed (as described above) andprobed for 1 h at room temperature with ExtrAvidin alkaline phosphataseconjugate (1 in 10,000 in blocking buffer). Plates were rinsed as described above,and 200 �l of p-nitrophenyl phosphate disodium substrate, prepared at 1 mg/mlin 1 M diethanolamine (pH 9.8), was added to each well. After 30 min, theabsorbance values were read at 405 nm by using a PowerWave HT microplatescanning spectrophotometer (BioTek Instruments, Inc.).

Statistical analysis. One-way and two-way analysis of variance (ANOVA) andBonferroni’s multiple comparison posttests were carried out on lectin microtiterassay results. All tests were conducted on quadruplicate samples using theGraphPad Prism version 5.00 program (GraphPad Software, Inc.).

Nucleotide sequence accession numbers. The partial mRNA and correspond-ing amino acid sequences of EtGFAT, EtAGM, EtUAP, EtUAE, and EtGal-NAc-T were deposited into GenBank under accession numbers GQ463153 toGQ463157, respectively.

RESULTS

Identification and conservation of EtGFAT. The GFAT pro-tein of P. berghei (PB000496.03.0 [PbGFAT]) has previously

been detected in macrogametes through high-throughput pro-teomics (17). Here, homologues of PbGFAT were identified inE. tenella and the related Apicomplexa, Toxoplasma gondii andC. parvum, using BLASTp analysis of their respective pre-dicted protein databases. A putative GFAT protein was iden-tified in E. tenella showing a high level of homology to PbGFATof 8.4 E�177 and is referred to as EtGFAT. The GFAT pro-teins in T. gondii (TgGFAT) and C. parvum (CpGFAT) alsoshowed high levels of sequence homology to PbGFAT at 6.7E�164 and 1.4 E�176, respectively.

The EtGFAT predicted protein sequence is 640 amino acidslong with a predicted N-terminal signal peptide truncating thepredicted mature protein to 625 residues. PbGFAT, TgGFAT,or CpGFAT were not predicted to contain signal peptide se-quences. The mature EtGFAT sequence was calculated tohave a molecular mass of 67.7kDa. Pfam analysis of theEtGFAT protein sequence revealed the presence of a glutamineaminotransferase class II motif (GAT2; Pfam-A: PF00310) andtwo sugar isomerase motifs (SIS; Pfam-A: PF01380). Thesecatalytic domains are strongly conserved in the four apicom-plexan GFAT sequences (Fig. 1), and their relative positionsare consistent with other GFAT enzymes (12), although theGAT domain of TgGFAT is incomplete.

Sexual-stage-specific expression of EtGFAT. Further inves-tigation was focused on testing the hypothesis that EtGFAT,like PbGFAT, is developmentally expressed in macrogametes.Total RNA was isolated from purified E. tenella merozoites,gametocytes, unsporulated oocysts, and sporulated oocysts andfrom uninfected host cecal scrapings (negative control). Thesize difference between the large rRNA subunit of Gallus gal-lus (28S) and E. tenella (26S) has been described previously(31) and was utilized here to assess the level of host contam-ination in the different parasite purifications. The presence ofa faint host-specific 28S rRNA band in the gametocyte sampleis consistent with microscopic examination of gametocyte pu-rifications where host contamination was commonly observed(data not shown); however, purified merozoite and unsporu-lated and sporulated oocyst samples were free of contaminat-ing host RNA (Fig. 2A).

The gene encoding EtGFAT (EtGFAT) was transcribed al-most exclusively in E. tenella gametocytes, with only faint tran-scription detected in late merozoite stages (112 h p.i.) and

FIG. 1. Conservation of GFAT catalytic domains in the apicomplexan glucosamine:fructose-6-phosphate aminotransferases. Schematic rep-resentations of the predicted protein sequences for EtGFAT (E. tenella, SNAP00000005021), PbGFAT (P. berghei, PB000392.03.0), TgGFAT (T.gondii, TGGT1_116350), and CpGFAT (C. parvum, cgd1_3730) show the location of the class II glutamine aminotransferase, “GAT2,” and twosugar isomerase motifs, “SIS (1)” and “SIS (2),” marked as boxes with the first and last residue numbered accordingly.

VOL. 9, 2010 GLYCOSYLATION IS UPREGULATED IN E. TENELLA GAMETOCYTES 129

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

none in unsporulated and sporulated oocyst stages (Fig. 2B).The EtGFAT gene amplified at the expected size of 339 bp,and sequencing of the purified DNA confirmed the identity ofthe amplicon (100% identity to SNAP00000005021). Thetranscription profile of EtGFAT was very similar to that ofEtGam56, the gene encoding the macrogamete-specific proteinEtGam56, although the transcription of EtGFAT is detectedearlier than EtGam56. As expected, none of the E. tenella-specific genes were amplified from uninfected chicken cDNA.

To determine whether the increased transcription of

EtGFAT in E. tenella gametocytes corresponded to increasedexpression of the native EtGFAT protein, antiserum was de-veloped against a synthetic peptide representing the last (i.e.,C-terminal) 15 amino acids of EtGFAT. KLH was conjugatedto the peptide antigen prior to immunization to promote im-munostimulation and optimum antibody production. ELISAanalysis of the anti-EtGFAT antisera revealed highly specificreactivity against the unconjugated EtGFAT synthetic peptidecompared to the reactivity of prebleed sera from the sameanimal (data not shown). Western blot analysis revealed an80-kDa protein exclusively in gametocytes (Fig. 3), a findingconsistent with the RT-PCR results (Fig. 2B). This is inter-preted as the native EtGFAT protein, albeit at a larger sizethan the 67.7 kDa calculated from the mature protein se-quence. However, it should be noted that the antisera alsoreacted slightly with merozoite proteins at approximately 85,100, and 120 kDa. As expected, the native EtGam56 (51 kDa)and truncated EtGam56 (32 kDa) were detected in E. tenellagametocytes and unsporulated oocysts, respectively (Fig. 3),using antisera previously developed against EmGam56, the E.maxima homologue of EtGam56 (5). No prominent bandswere detected in any of the five protein samples when we usedeither prebleed antisera or anti-KLH antibody (data notshown).

EtGFAT is localized to E. tenella macrogametes. Sectionsprepared from E. tenella-infected chicken intestine wereprobed with anti-EtGFAT antisera in order to localize theexpression of the native protein in situ. The sections were alsoprobed with anti-EmGam56 to ensure the positive identifica-tion of E. tenella macrogametes. Like anti-EmGam56, anti-EtGFAT localized specifically to E. tenella macrogametes(DAPI negative) at 144 h p.i. and displayed negligible bindingto surrounding host tissue and E. tenella microgametes, both ofwhich were stained positively with DAPI (Fig. 4A). Closerexamination of E. tenella macrogametes revealed that

FIG. 2. Relative transcription of EtGFAT in different developmen-tal stages of E. tenella. (A) Analysis of total RNA purified from E.tenella and host tissue using automated electrophoresis. The majorrRNA bands, including the 28S (host-specific), 26S (parasite-specific),and 18S (parasite and host), rRNA bands, are marked accordingly.(B) RT-PCR analysis of EtGFAT and EtGam56 transcription. Prior toRT-PCR, each cDNA sample was standardized to comparable levels ofEtActin transcription. Merozoites (M), gametocytes (G), unsporulatedoocysts (U), sporulated oocysts (S), and uninfected host control(H) are as indicated.

FIG. 3. Relative expression of EtGFAT in different developmental stages of E. tenella. Immunoblot analysis of whole-cell protein lysates fromE. tenella was performed, and host tissues were probed with antisera developed against either EtGFAT or EmGam56. The native EtGFAT (closedblack arrow), the native EtGam56 (open white arrow), and the truncated EtGam56 protein (asterisk) are marked accordingly. An identicalSDS-PAGE gel was stained for total protein using Flamingo fluorescent gel stain to demonstrate comparable protein loading. Size markers (inkilodaltons) are displayed to the left of each immunoblot. Merozoites (M), gametocytes (G), unsporulated oocysts (U), sporulated oocysts (S), anduninfected host control (H) are as indicated.

130 WALKER ET AL. EUKARYOT. CELL

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

EtGam56 localized to WFBII (Fig. 4B), a finding consistent withanti-EmGam56 localization within E. maxima macrogametes(13). In contrast, EtGFAT localization was more diffuse, and itis not clear whether the protein is restricted to any specificorganelle (Fig. 4B). Populations of merozoites (DAPI posi-tive), also present in the 144-h p.i. section, were not detectedwith either the anti-EtGFAT or anti-EmGam56 antisera (Fig.4C), which is consistent with the findings of Western blotanalyses (Fig. 3). Although EtGam56 was also detected inmacrogametes at the earlier postinfection time point of 134 hp.i., EtGFAT was detected only at 144 h p.i. (data not shown).

Glycosylation enzymes downstream of EtGFAT also displaygametocyte-specific transcription. GFAT represents the firstenzyme in the amino sugar biosynthesis and glycosylation path-way illustrated in Fig. 5. BLASTp analysis using previouslycharacterized glycosylation enzymes from other organisms un-covered all but two of these enzymes (glucosamine-6-phos-phate N-acetyltransferase [GNA] and GlcNAc-T) in the E.tenella predicted protein database (Table 2). No E. tenellahomologue could be identified for either the Giardia intestina-lis (21) or Mus musculus (9) GNA protein sequence. Theprimary E. tenella hit for the Caenorhabditis elegansGlcNAc-T (22) was not considered a true orthologue becauseit was already annotated as a putative stress-induced proteinand showed only 24% identity. Although the primary E. tenellahit for the Dictyostelium discoideum GlcNAc-T (42) returnedan E value of 2.2 E�34, a majority of the alignment was to anear continuous stretch of asparagine residues (approximately60 Asp over a 70-amino-acid region), and when this region wasremoved from the BLASTp query sequence, no homologue

was identified. The E. tenella phosphoacetylglucosamine mu-tase (EtAGM) and E. tenella UDP-N-acetylglucosamine 4-epi-merase (EtUAE) protein sequences were identified by usingreference sequences obtained from the annotated genome da-tabase of C. parvum, whereas the E. tenella UAP-N-acetylglu-cosamine pyrophosphorylase (EtUAP) and EtGalNAc-T wereidentified using reference proteins from G. intestinalis (21) andT. gondii (38), respectively.

The developmental transcription of the genes encoding thesenewly uncovered E. tenella glycosylation enzymes was investigatedand compared to that of EtGFAT. Interestingly, the gene tran-scription of all four enzymes (including EtGFAT) involved in thesynthesis of the N-acetylgalactosamine (GalNAc) glycan dis-played very similar profiles, with the most prominent transcriptiondetected in the gametocyte stages (Fig. 6). Additional transcrip-tion was detected at much lower levels in merozoites for EtGFAT,EtAGM, and EtUAP but not for EtUAE, whereas no transcriptionof any of these four genes was observed in either unsporulated orsporulated oocysts. In contrast, the transcription of EtGalNAc-T,the gene encoding the enzyme responsible for the transfer ofGalNAc to proteins, was strongest in unsporulated oocysts withlower levels of transcription also observed in gametocytes andsporulated oocysts. No transcription of EtGalNAc-T was ob-served in the merozoite stages. Again, no E. tenella genes wereamplified from uninfected host cDNA.

Sequencing of each of the PCR amplicons confirmed theidentity of all E. tenella genes analyzed. The sequencesobtained for EtAGM and EtUAP were 99 and 100%identical to the original predicted gene sequence (as listedin Table 2). Both EtUAE (99%) and EtGalNAc-T (100%)

FIG. 4. Immunolocalization of native EtGFAT in E. tenella. Paraffin sections of E. tenella-infected chicken intestine were taken at 144 h p.i.and stained with rabbit antisera developed against EtGFAT and mouse antisera developed against EmGam56. EtGFAT was detected with anFITC-conjugated anti-rabbit antibody (green) and EmGam56 with a Texas Red-labeled anti-mouse antibody (red). The sections were counter-stained with DAPI (blue) for the detection of host, merozoite, and microgamete nuclei. An overlay of all three colors is shown for each image.(A) Region of tissue infected with E. tenella macrogametes (mac) and microgametes (mic); (B) closer examination of an E. tenella macrogamete;(C) region of infected tissue with E. tenella merozoites (mer). Bars, 10 �m.

VOL. 9, 2010 GLYCOSYLATION IS UPREGULATED IN E. TENELLA GAMETOCYTES 131

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

showed stronger homology to alternative gene predictions(EIMER_contig_00031419.Exonerate2BLASTCDS.Gene.2and GLIMMERHMM190_V3.0.1_PHASES00000221606, re-spectively) than listed in Table 2. However, an even greater

level of homology was observed between the sequencedEtUAE to cgd4_2600 (51% compared to 50% for the originalsequence) and between the sequenced EtGalNAc-T andAY424890 (62% compared to 47%) using BLASTx analysis of

FIG. 5. Schematic representation of the amino sugar biosynthesis and glycosylation pathway. The name of each carbohydrate substrate andproduct is listed to the right of its chemical structure. The abbreviated name of the enzyme responsible for each step in the pathway is listed belowthe carbohydrate substrate in a black box. GFAT, glucosamine:fructose-6-phosphate aminotransferase; GNA, glucosamine-6-phosphate N-acetyltransferase; AGM, phosphoacetylglucosamine mutase; UAP, UDP-N-acetylglucosamine pyrophosphorylase; UAE, UDP-N-acetylglu-cosamine 4-epimerase; GlcNAc-T, N-acetylglucosaminyl transferase; GalNAc-T, N-acetylgalactosaminyl transferase.

TABLE 2. Identification of putative amino sugar biosynthesis and glycosylation enzymes in E. tenella

Enzymea Reference sequence (organism)b E. tenella homologue BLAST E-valuec

GFAT PB000496.03.0 (Plasmodium berghei) SNAP00000005021 8.4 E�177

GNA AY185915 (Giardia intestinalis) None 0.53*NP_062298 (Mus musculus) None 0.99*

AGM cgd4_3310 (Cryptosporidium parvum) SNAP00000000160 7.5 E�28

UAP AY187035 (Giardia intestinalis) SNAP00000006592 2.2 E�13

UAE cgd4_2600 (Cryptosporidium parvum) EIMER_contig00031419.(Exonerate2BLASTCDS.Gene.15) 4.5 E�91

GlcNAc-T U77412 (Caenorhabditis elegans) NAd 1.0 E�09*AF375997 (Dictyostelium discoideum) NA 2.2 E�34*

GalNAc-T AY424890 (Toxoplasma gondii) EIMER_contig_00030594 (Exonerate2BLASTCDS.Gene.387) 3.0 E�101

a Enzyme names have been abbreviated as listed in the legend to Fig. 5.b Reference enzyme protein sequences are from the organisms listed in parentheses.c �, BLAST hits not considered to represent true homologues (see the text).d NA, not applicable.

132 WALKER ET AL. EUKARYOT. CELL

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

the C. parvum and T. gondii predicted protein databases, re-spectively.

GlcNAc is transiently higher in gametocytes, while GalNAcremains higher in subsequent oocyst stages. A microtiter assaywas used to establish the relative levels of amino sugar (eitheras free glycans or glycoproteins) present in different develop-mental stages of E. tenella. GlcNAc and GalNAc were detectedin each cell lysate using the lectins WGA and JAC, respec-tively. A significant increase (P � 0.001) in the level of GlcNAcwas observed in E. tenella gametocytes (134 h p.i.) and wasdetermined to be approximately eight times higher than thelevels in merozoites and sporulated oocysts and approximatelysix times higher than the levels in unsporulated oocysts (Fig.7A). The relatively moderate level of GlcNAc detected inuninfected host lysate was still significantly lower (P � 0.001)than that observed in E. tenella gametocytes, indicating that theunavoidable host contamination in this sample was not leadingto an overestimation of GlcNAc levels. Similarly, a significantincrease (P � 0.001) in GalNAc was observed in gametocytescompared to merozoites (Fig. 7B). However, the levels of thisamino sugar were not significantly different (P � 0.05) ingametocytes and unsporulated oocysts, both of which wereapproximately five times higher than the levels in merozoites.Furthermore, a significant twofold increase (P � 0.001) wasalso observed in sporulated oocysts compared to unsporulatedoocysts and gametocytes. Uninfected host GalNAc levels weresignificantly lower (P � 0.001) than that of the gametocytesample, again indicating no overestimation of GalNAc in thisparasite sample.

The protein lysates used for the lectin microtiter assaywere also analyzed by lectin blotting. Again, WGA and JACwere used to detect proteins glycosylated with GlcNAc orGalNAc amino sugars, respectively. A comparison of bothblots revealed a number of common protein bands, includ-ing a gametocyte-specific 35-kDa band, an unsporulated oo-cyst-specific 32-kDa band, and 120- and 75-kDa bands insporulated oocysts (Fig. 8). However, a number of bands

were detected only with JAC (i.e., GalNAc glycans present),including a gametocyte-specific band of �51 kDa. Further-more, some common protein bands were more prominentwhen detected with JAC than with WGA, such as the un-sporulated oocyst-specific 32-kDa band.

DISCUSSION

The development of micro- and macrogametocytes in theEimeria parasite is an essential process that precedes theformation of the unsporulated oocyst, a life cycle stageadapted for efficient transmission between hosts. The iden-tification of the macrogamete-specific GFAT in the fellowapicomplexan P. berghei (17) has provided the basis for an

FIG. 6. Relative transcription of glycosylation genes in differentdevelopmental stages of E. tenella. RT-PCR was carried out on five E.tenella genes encoding enzymes involved in glycan synthesis (includingEtGFAT, EtAGM, EtUAP, and EtUAE) and glycan transfer (EtGalNAc-T). Prior to RT-PCR, each cDNA sample was standardized to com-parable levels of EtActin transcription. Merozoites (M), gametocytes(G), unsporulated oocysts (U), sporulated oocysts (S), and uninfectedhost control (H) are as indicated.

FIG. 7. Relative amino sugar levels in different developmentalstages of E. tenella. Cell lysates of each sample were assayed for thepresence of the amino sugars, N-acetylglucosamine and N-acetyl-galactosamine, using the lectins WGA (A) and JAC (B), respec-tively (white bars). All samples were also tested in the absence oflectin (black bars). A statistical comparison was made between eachof the five protein samples (***, P � 0.001; **, P � 0.01; *, P �0.05; ns, P � 0.05 [not significant]). All samples were tested inquadruplicate. Merozoites (M), gametocytes (G), unsporulated oo-cysts (U), sporulated oocysts (S), and uninfected host control(H) are as indicated.

VOL. 9, 2010 GLYCOSYLATION IS UPREGULATED IN E. TENELLA GAMETOCYTES 133

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

analysis of macrogamete-specific glycosylation in E. tenella,as outlined here.

A homologous group of GFAT enzymes was uncovered inE. tenella (EtGFAT), T. gondii (TgGFAT), and C. parvum(CpGFAT) using the P. berghei GFAT protein sequence as aBLAST query. The GFAT classification of these four se-quences was also confirmed by the identification of the threecharacteristic GFAT catalytic domains (Fig. 1A). The absenceof the complete GAT2 motif in TgGFAT was not addressedhere but may be the result of incorrect coding sequence pre-dictions from genomic sequence data.

PbGFAT was previously detected in purified samples of P.berghei macrogametes (17), and accordingly, EtGFAT genetranscription was restricted almost exclusively to gametocytestages of E. tenella (Fig. 2), corresponding to the detection ofnative EtGFAT protein in E. tenella gametocytes by Westernblotting (Fig. 3). The size discrepancy observed between thenative EtGFAT and its calculated molecular weight was sur-prising but has been observed previously with GFAT proteins(27). The minimal transcription of EtGFAT in late-stage mero-zoites did not appear to correspond to protein expression inthe same parasite stage. However, it is possible that the faintmerozoite-specific protein bands (detected at a higher molec-ular weight than the gametocyte-specific EtGFAT) may rep-resent different posttranslational modifications of EtGFAT.

Immunolocalization experiments successfully demonstratedexclusive expression of the native EtGFAT protein within E.tenella macrogametes but not microgametes, merozoites, oruninfected host (Fig. 4). EtGFAT was not, however, defini-tively localized to any known macrogamete organelles, such aswall-forming bodies (see anti-EmGam56, Fig. 4B); studies with

human GFAT, by comparison, have demonstrated cytoplasmiclocalization of the native protein (27).

The observed synchronicity of EtGFAT, EtAGM, EtUAP,and EtUAE transcription in E. tenella gametocytes (Fig. 6)implies that the entire glycan synthesis pathway is “switchedon” during gametocyte development. Like E. tenella, genesencoding the G. intestinalis enzymes responsible for GalNAcproduction are transcribed at higher levels during encystment(21), leading to the formation of a GalNAc-rich (63%) cystwall (15, 29). The absence of a putative “EtGNA” was unex-pected, but given the importance of this enzyme, it is unlikelythat EtGNA is truly absent (perhaps indicating a higher levelof sequence divergence with this enzyme).

Amino sugars from other excretable cyst-producing eukaryoteshave been shown to be directly incorporated into the cyst wall ascarbohydrate polymers. In addition to G. intestinalis, Entamoebainvadens utilizes newly produced GlcNAc as a substrate forchitin and chitosan, the two major components of the cyst wall(2, 11). However, the low levels of carbohydrate (1%) detectedin purified oocyst wall samples of Eimeria (23) suggest that theyare unlikely to be composed of similar amino sugar polymers. Itwould seem, therefore, the likely fate of amino sugars in Eimeriagametocytes is as substrates for protein glycosylation.

The absence of a putative GlcNAc-T in E. tenella (Table 2)suggests that GlcNAc is required as a substrate for GalNAcsynthesis (via the activity of EtUAE) rather than direct proteinglycosylation. This theory was supported by observations of atransient GalNAc increase in E. tenella gametocytes, with areturn to lower levels in oocyst stages (Fig. 7). GlcNAc is alsoan essential substrate for the formation of glycosylphosphati-dylinositol-anchored proteins (28, 41), which comprise many ofthe known surface molecules of E. tenella merozoites and sporo-zoites (40). Here, however, we have focused on the process of N-and O-linked glycosylation and its potential role with known O-linked glycoproteins of gametocytes, such as EtGam56.

The prolonged transcription of EtGalNAc-T (at its highest inunsporulated oocysts [Fig. 6]) was consistent with a prolongedGalNAc increase in E. tenella gametocytes and oocyst stages(Fig. 7), and this may have a direct link with the stockpiling andeventual cross-linking of the oocyst wall glycoproteins Gam56and Gam82 (6, 7). It is possible that O glycosylation is requiredfor trafficking of these proteins to the oocyst wall, a hypothesissupported by the conservation of an O glycosylation motif inboth EmGam56 and EtGam56 and an additional oocyst wallprotein of E. tenella, EtGam22 (19).

The synchronized production of oocyst wall-forming pro-teins and upregulation of glycosylation in E. tenella gameto-cytes is a trait unlikely to be shared with the P. berghei (thesource of the GFAT sequence used for the original BLASTquery), whose oocysts are not excreted and do not possess arigid wall. However, the transcription of cyst wall proteins—CWP1, CPW2, and CWP3—and of glucosamine-6-phosphateisomerase (i.e., GFAT equivalent) in encysting Giardia lambliais synchronized (21) and under the control of a single tran-scription factor, gMyb2, itself upregulated during encystation(39). The identification of a macrogamete-specific transcrip-tion factor and promoter (i.e., that might be controlling thetranscription of glycosylation enzymes) could help identifyother sexual stage proteins of E. tenella and have applications

FIG. 8. Detection of glycosylated proteins in different develop-mental stages of E. tenella. Immunoblots of whole-cell proteinlysates from E. tenella and host tissue were probed with WGA or JAC forthe detection of proteins glycosylated with N-acetylglucosamine or N-acetylgalactosamine, respectively. A unique gametocyte-specific band(open white arrow) and unsporulated oocyst-upregulated band (aster-isk), both JAC positive, are marked accordingly. Size markers (inkilodaltons) are displayed to the left of each lectin blot. Merozoites(M), gametocytes (G), unsporulated oocysts (U), sporulated oocysts(S), and uninfected host control (H) are as indicated.

134 WALKER ET AL. EUKARYOT. CELL

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from

in developing transgenic yellow fluorescent protein-taggedmacrogametes (33, 44).

Glycosylation is utilized by other eukaryotes for a multitudeof functions, including protein folding, targeting, recognition,and adhesion (26). In fungi, GFAT has already been success-fully targeted for selective inhibition (24, 43), and likewise,EtGFAT may represent an effective target for controlling E.tenella infections and the transmission of avian coccidiosis.

ACKNOWLEDGMENTS

This project was made possible by the funding of a Ph.D. scholarshipby the Institute for the Biotechnology of Infectious Diseases, Univer-sity of Technology, Sydney, Australia. E. tenella whole-genome se-quence data were produced by a BBSRC-funded collaboration be-tween the Pathogen Sequencing Unit at the Wellcome Trust SangerInstitute and the Institute for Animal Health (United Kingdom).

The Houghton strain of E. tenella was originally provided by MartinShirley (Institute for Animal Health, Compton Laboratory, Newbury,Berkshire, United Kingdom).

REFERENCES

1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generationof protein database search programs. Nucleic Acids Res. 25:3389–3402.

2. Arroyo-Begovich, A., A. Carabez-Trejo, and J. Ruiz-Herrera. 1980. Identifi-cation of the structural component in the cyst wall of Entamoeba invadens. J.Parasitol. 66:735–741.

3. Belli, S. I., M. Lee, P. Thebo, M. G. Wallach, B. Schwartsburd, and N. C. Smith.2002. Biochemical characterisation of the 56 and 82-kDa immunodominant game-tocyte antigens from Eimeria maxima. Int. J. Parasitol. 32:805–816.

4. Belli, S. I., N. C. Smith, and D. Ferguson. 2006. The coccidian oocyst: atough nut to crack! Trends Parasitol. 22:416–423.

5. Belli, S. I., M. G. Wallach, C. Luxford, M. J. Davies, and N. C. Smith. 2003.Roles of tyrosine-rich precursor glycoproteins and dityrosine- and 3,4-dihy-droxyphenylalanine-mediated protein cross-linking in development of the oocystwall in the coccidian parasite Eimeria maxima. Eukaryot. Cell 2:456–464.

6. Belli, S. I., M. G. Wallach, and N. C. Smith. 2003. Cloning and character-ization of the 82-kDa tyrosine-rich sexual stage glycoprotein, GAM82, andits role in oocyst wall formation in the apicomplexan parasite, Eimeriamaxima. Gene 307:201–212.

7. Belli, S. I., D. Witcombe, M. G. Wallach, and N. C. Smith. 2002. Functional genom-ics of gam56: characterisation of the role of a 56 kilodalton sexual stage antigen inoocyst wall formation in Eimeria maxima. Int. J. Parasitol. 32:1727–1737.

8. Bendtsen, J. D., H. Nielsen, G. von Heijne, and S. Brunak. 2004. Improvedprediction of signal peptides: SignalP 3.0. J. Mol. Biol. 340:783–795.

9. Boehmelt, G., I. Fialka, G. Brothers, M. D. McGinley, S. D. Patterson, R.Mo, C. C. Hui, S. Chung, L. A. Huber, T. W. Mak, and N. N. Iscove. 2000.Cloning and characterization of the murine glucosamine-6-phosphate acetyl-transferase EMeg32: differential expression and intracellular membrane as-sociation. J. Biol. Chem. 275:12821–12832.

10. Buchanan, J. M. 1973. The amidotransferases. Adv. Enzymol. Relat. AreasMol. Biol. 39:91–183.

11. Das, S., K. Van Dellen, D. Bulik, P. Magnelli, J. Cui, J. Head, P. W. Robbins,and J. Samuelson. 2006. The cyst wall of Entamoeba invadens containschitosan (deacetylated chitin). Mol. Biochem. Parasitol. 148:86–92.

12. Durand, P., B. Golinelli-Pimpaneau, S. Mouilleron, B. Badet, and M. A.Badet-Denisot. 2008. Highlights of glucosamine-6P synthase catalysis. Arch.Biochem. Biophys. 474:302–317.

13. Ferguson, D. J., S. I. Belli, N. C. Smith, and M. G. Wallach. 2003. Thedevelopment of the macrogamete and oocyst wall in Eimeria maxima: im-muno-light and electron microscopy. Int. J. Parasitol. 33:1329–1340.

14. Gattiker, A., E. Gasteiger, and A. Bairoch. 2002. ScanProsite: a reference im-plementation of a PROSITE scanning tool. Appl. Bioinformatics 1:107–108.

15. Gerwig, G. J., J. A. van Kuik, B. R. Leeflang, J. P. Kamerling, J. F. Vlieg-enthart, C. D. Karr, and E. L. Jarroll. 2002. The Giardia intestinalis fila-mentous cyst wall contains a novel (1-3)-N-acetyl-D-galactosamine polymer:a structural and conformational study. Glycobiology 12:499–505.

16. Harlow, E., and D. Lane. 1988. Immunoblotting and antibodies: a laboratory man-ual, p. 490–492. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

17. Khan, S. M., B. Franke-Fayard, G. R. Mair, E. Lasonder, C. J. Janse, M. Mann, andA. P. Waters. 2005. Proteome analysis of separated male and female gametocytesreveals novel sex-specific Plasmodium biology. Cell 121:675–687.

18. Korich, D. G., J. R. Mead, M. S. Madore, N. A. Sinclair, and C. R. Sterling. 1990.Effects of ozone, chlorine dioxide, chlorine, and monochloramine on Cryptospo-ridium parvum oocyst viability. Appl. Environ. Microbiol. 56:1423–1428.

19. Krucken, J., R. J. Hosse, A. N. Mouafo, R. Entzeroth, S. Bierbaum, P.

Marinovski, K. Hain, G. Greif, and F. Wunderlich. 2008. Excystation ofEimeria tenella sporozoites impaired by antibody recognizing gametocyte/oocyst antigens GAM22 and GAM56. Eukaryot. Cell 7:202–211.

20. Llovo, J., A. Lopez, J. Fabregas, and A. Munoz. 1993. Interaction of lectinswith Cryptosporidium parvum. J. Infect. Dis. 167:1477–1480.

21. Lopez, A. B., K. Sener, E. L. Jarroll, and H. van Keulen. 2003. Transcriptionregulation is demonstrated for five key enzymes in Giardia intestinalis cystwall polysaccharide biosynthesis. Mol. Biochem. Parasitol. 128:51–57.

22. Lubas, W. A., D. W. Frank, M. Krause, and J. A. Hanover. 1997. O-linkedGlcNAc transferase is a conserved nucleocytoplasmic protein containingtetratricopeptide repeats. J. Biol. Chem. 272:9316–9324.

23. Mai, K., P. A. Sharman, R. A. Walker, M. Katrib, D. DeSouza, M. J.McConville, M. G. Wallach, S. I. Belli, D. J. Ferguson, and N. C. Smith.2009. Oocyst wall formation and composition in coccidian parasites. Mem.Inst. Oswaldo Cruz 104:281–289.

24. Milewski, S., H. Chmara, and E. Borowski. 1986. Antibiotic tetaine: a se-lective inhibitor of chitin and mannoprotein biosynthesis in Candida albi-cans. Arch. Microbiol. 145:234–240.

25. Mouafo, A. N., A. Weck-Heimann, J. F. Dubremetz, and R. Entzeroth. 2002. Mono-clonal antibodies specific for the two types of wall-forming bodies of Eimeria tenellamacrogametes (Coccidia, Apicomplexa). Parasitol. Res. 88:217–224.

26. Nairn, A. V., W. S. York, K. Harris, E. M. Hall, J. M. Pierce, and K. W.Moremen. 2008. Regulation of glycan structures in animal tissues: transcriptprofiling of glycan-related genes. J. Biol. Chem. 283:17298–17313.

27. Nerlich, A. G., U. Sauer, V. Kolm-Litty, E. Wagner, M. Koch, and E. D.Schleicher. 1998. Expression of glutamine:fructose-6-phosphate amidotrans-ferase in human tissues: evidence for high variability and distinct regulationin diabetes. Diabetes 47:170–178.

28. Orlean, P., and A. K. Menon. 2007. Thematic review series: lipid posttrans-lational modifications: GPI anchoring of protein in yeast and mammaliancells, or: how we learned to stop worrying and love glycophospholipids. J.Lipid Res. 48:993–1011.

29. Ortega-Barria, E., H. D. Ward, J. E. Evans, and M. E. Pereira. 1990. N-Acetyl-D-glucosamine is present in cysts and trophozoites of Giardia lamblia and serves asreceptor for wheat germ agglutinin. Mol. Biochem. Parasitol. 43:151–165.

30. Pugatsch, T., D. Mencher, and M. Wallach. 1989. Eimeria maxima: isolationof gametocytes and their immunogenicity in mice, rabbits, and chickens. Exp.Parasitol. 68:127–134.

31. Schaap, D., G. Arts, N. F. J. van Poppel, and A. N. Vermeulen. 2005. De novoribosome biosynthesis is transcriptionally regulated in Eimeria tenella, de-pendent on its life cycle stage. Mol. Biochem. Parasitol. 139:239–248.

32. Scholtyseck, E., H. Mehlhorn, and D. M. Hammond. 1971. Fine structure ofmacrogametes and oocysts of coccidia and related organisms. Z. Para-sitenkd. 37:1–43.

33. Shi, T. Y., X. Y. Liu, L. L. Hao, J. D. Li, A. N. Gh, M. H. Abdille, and X. Suo.2008. Transfected Eimeria tenella could complete its endogenous develop-ment in vitro. J. Parasitol. 94:978–980.

34. Shirley, M. W. 1995. Eimeria species and strains of chickens, p. 1–24. In J. Eckert, R.Braun, M. W. Shirley, and P. Coudert (ed.), Biotechnology: guidelines on tech-niques in coccidiosis research. European Commission, Luxembourg.

35. Stein, B., L. Stover, A. Gillem, K. Winters, J. H. Leet, and C. Chauret. 2006.The effect of lectins on Cryptosporidium parvum oocyst in vitro attachment tohost cells. J. Parasitol. 92:1–9.

36. Stephens, D. A. 1998. Coccidiosis, p. 591–593. In P. J. Delves and I. M. Roitt (ed.),Encyclopedia of immunology, 2nd ed. Academic Press, Inc., San Diego, CA.

37. Stotish, R. L., C. C. Wang, and M. Meyenhofer. 1978. Structure and com-position of the oocyst wall of Eimeria tenella. J. Parasitol. 64:1074–1081.

38. Stwora-Wojczyk, M. M., J. C. Kissinger, S. L. Spitalnik, and B. S. Wojczyk.2004. O glycosylation in Toxoplasma gondii: identification and analysis of afamily of UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferases. Int.J. Parasitol. 34:309–322.

39. Sun, C. H., D. Palm, A. G. McArthur, S. G. Svard, and F. D. Gillin. 2002. Anovel Myb-related protein involved in transcriptional activation of encysta-tion genes in Giardia lamblia. Mol. Microbiol. 46:971–984.

40. Tabares, E., D. Ferguson, J. Clark, P. E. Soon, K. L. Wan, and F. Tomley.2004. Eimeria tenella sporozoites and merozoites differentially express gly-cosylphosphatidylinositol-anchored variant surface proteins. Mol. Biochem.Parasitol. 135:123–132.

41. Tiede, A., C. Nischan, J. Schubert, and R. E. Schmidt. 2000. Characterisationof the enzymatic complex for the first step in glycosylphosphatidylinositolbiosynthesis. Int. J. Biochem. Cell Biol. 32:339–350.

42. Van Der Wel, H., H. R. Morris, M. Panico, T. Paxton, A. Dell, L. Kaplan, andC. M. West. 2002. Molecular cloning and expression of a UDP-N-acetylglu-cosamine (GlcNAc):hydroxyproline polypeptide GlcNAc-transferase that mod-ifies Skp1 in the cytoplasm of Dictyostelium. J. Biol. Chem. 277:46328–46337.

43. Wojciechowski, M., S. Milewski, J. Mazerski, and E. Borowski. 2005. Glu-cosamine-6-phosphate synthase, a novel target for antifungal agents. Molec-ular modeling studies in drug design. Acta Biochim. Pol. 52:647–653.

44. Yan, W., X. Liu, T. Shi, L. Hao, F. M. Tomley, and X. Suo. 2009. Stabletransfection of Eimeria tenella: constitutive expression of the YFP-YFP mol-ecule throughout the life cycle. Int. J. Parasitol. 39:109–117.

VOL. 9, 2010 GLYCOSYLATION IS UPREGULATED IN E. TENELLA GAMETOCYTES 135

on Novem

ber 19, 2020 by guesthttp://ec.asm

.org/D

ownloaded from