The genome of the hydatid tapeworm Echinococcus …...The genome of the hydatid tapeworm Echinococcus granulosus Huajun Zheng 1 †, Wenbao Zhang 2 † , Liang Zhang 1,3 †, Zhuangzhi

The genome of the hydatid tapeworm Echinococcus granulosus

Huajun Zheng1†, Wenbao Zhang

2†§, Liang Zhang

1,3†, Zhuangzhi Zhang

4, Jun Li

5, Gang Lu

1,

Yongqiang Zhu1, Yuezhu Wang

1, Yin Huang

1, Jing Liu

3, Hui Kang

1, Jie Chen

1, Lijun Wang

1, Aojun

Chen1, Shuting Yu

1, Zhengchao Gao

1, Lei Jin

1, Wenyi Gu

1, Zhiqin Wang

1, Li Zhao

4, Baoxin Shi

4,

Hao Wen2, Renyong Lin

2, Malcolm K. Jones

5‡, Brona Brejova

6, Tomas Vinar

6, Guoping Zhao

1,3,

Donald P. McManus5§, Zhu Chen

1,7,8§, Yan Zhou

3§, Shengyue Wang

1,3,9§

†Authors contributed equally to this work.

§Corresponding authors E-mail: [email protected]; [email protected];

[email protected]; [email protected]; [email protected]

1Shanghai-Ministry of Science and Technology Key Laboratory of Health and Disease Genomics,

Chinese National Human Genome Center at Shanghai, 250 Bibo Road, Shanghai，201203, China.

2State Key Laboratory Incubation Base of Xinjiang Major Diseases Research, Clinical Medical

Research Institute, The First Affiliated Hospital of Xinjiang Medical University, 1 Liyushan Road,

Urumqi, Xinjiang, 830054, China.

3State Key Laboratory of Genetic Engineering, School of Life Sciences, Fudan University, 220

Handan Road, Shanghai, 200433, China.

4Veterinary Research Institute, Xinjiang Academy of Animal Sciences, 151 East-Kelamayi Street,

Urumqi, Xinjiang, 830000, China.

5Molecular Parasitology Laboratory, QIMR Berghofer Institute of Medical Research, 300 Herston

Road, Brisbane, Q4006, Australia. ‡, current address: School of Veterinary Sciences, The University

of Queensland, Queensland, Warrego Highway, Gatton, Qld, 4343, Australia.

6Department of Applied Informatics, Faculty of Mathematics, Physics, and Informatics, Comenius

University, Mlynska Dolina, 84248 Bratislava, Slovakia.

7State Key Laboratory of Medical Genomics and Shanghai Institute of Hematology, Ruijin Hospital,

School of Medicine, Shanghai Jiao Tong University, 197 Ruijin Road II, Shanghai, 200025, China.

8Key Laboratory of Systems Biomedicine (Ministry of Education), Shanghai Center for Systems

Biomedicine, Shanghai Jiao Tong University, 800 Dong Chuan Road, Shanghai 200240, China.

Nature Genetics: doi:10.1038/ng.2757

mailto:[email protected]



9School of Life Sciences and Technology, Tong Ji University, 1239 Siping Road, Shanghai, 200092,

China.


Supplementary Figures

Supplementary Figure 1. Alignment of E. granulosus scaffolds with mitochondrial sequences

and fosmids. The alignment was performed using mummer. Three Scaffolds matching at least two

fosmids were selected to display the syntenic relationship between scaffolds and fosmids. The eight

fosmids were completely contained in scaffolds, with five having no gaps and the other three each

having 1 or 2 gaps, representing 2.7% of the fosmid sequences.


Supplementary Figure 2. 17-mer volume histogram of 454 reads and Solexa reads. The volume

of 17-mers is plotted against the frequency at which they occur. The total error-free 17-mer number

of 454 reads is 2,093,425,941, and the volume peak is 13. The total error-free 17-mer number of

Solexa reads is 6,595,256,943, and the volume peak is 42. The genome size can be estimated as

total K-mer number/the volume peak.


Supplementary Figure 3. Distribution of gene number and average CDS length of genes with

different exon number (a), average length of intron in different position (b), micro-exon ratio

in different genes (c), and micro-exon number and relative position in E. granulosus genome

(d). In panel a, the gene number with different exons is plotted with a blue diamond, and the

average CDS length of each gene type is plotted with a red rectangle. In panel b, the data come

from genes with at least two introns and the number on the abscissa represents intron position from

5’ to 3’ of the gene structure. The number of genes harboring an intron in each position is plotted

with a red rectangle, and the average length of the 1st intron, 2

nd intron and so on, is plotted with a

blue diamond. In panel c, the total exon number of each micro-exon-containing gene is plotted with

a green line, and the corresponding micro-exon number ratio is plotted with a red line. In panel d,

the relative position of each micro-exon in the gene structure was plotted with 0.02 representing the

first exon, and 1.0 representing the last.


Supplementary Figure 4. Transcription association of operon genes in E. granulosus displayed

using hierarchical clustering. The log2-transformed RPKM (reads per kilobase per million

sequenced reads) value of each gene was clustered using Genesis 69

. The color scale indicates levels

of expression, with red corresponding to high expression levels and green corresponding to low.


Supplementary Figure 5. Prevalence of CpG dinucleotides in exons, introns and intergenic

regions of E. granulosus (a) and CDSs of other compared genomes (b). The observed/expected

(Obe/Exp) ratio of CpG dinucleotides was calculated based on G+C content.


Supplementary Figure 6. Distribution of protein domain families in E. granulosus compared

with schistosomes (S. japonicum and S. mansoni), parasitic nematodes (B. malayi and T.

spiralis), free-living nematodes (C. elegans and P. pacificus) and mammals (H.sapiens and C.

familiaris).


Supplementary Figure 7. Distribution of Pfam domains in E. granulosus compared with

schistosomes (S. japonicum and S. mansoni), parasitic nematodes (B. malayi and T. spiralis)

and free-living nematodes (C. elegans and P. pacificus). The numbers of Pfam domain-specific

(E-value < 0.01) or shared within taxa are shown in different areas.


Supplementary Figure 8. Complete synthesis pathway of alanine, aspartate and glutamate.

Green blocks represent genes present in the E. granulosus genome.


Supplementary Figure 9. GO enrichment analysis of the E. granulosus lost domains. Some of

the 495 E. granulosus lost domains have known classification in the Gene Ontology database. Their

GO identifiers are used for GO enrichment analysis with REVIGO. Each tetragonum in the figure

represents a GO ID, and its putative function is shown. The area of the tetragonum indicates the

number of domains which are relative to the GO ID, and tetragonums with same color have similar

function according to GO database.


Supplementary Figure 10. De novo cholesterol synthesis pathway in E. granulosus. Farnesyl-PP

synthesized in the Terpenoid backbone biosynthesis pathway (a) can be transformed into (S)-

Squalene-2,3-epoxide (b), which could be used as starter for steroid biosynthesis (c). But the key

enzyme hydroxymethylglutaryl-CoA reductase [EC: 1.1.1.34] in the Terpenoid backbone

biosynthesis pathway is absent in the E. granulosus genome, so mevalonate cannot be produced.

Three enzymes catalyzing Farnesyl-PP to (S)-Squalene-2,3-epoxide, and the majority of the

enzymes of the steroid biosynthesis pathway are absent in E. granulosus.


Supplementary Figure 11. Protein ortholog changes associated with the origin and evolution

of E. granulosus and the other six worms. The phylogenetic tree was built using concatenated

orthologs, and the number on each branch represent orthologs acquired (+) or lost (-) in the

evolutionary process.


Supplementary Figure 12. Correlation of fold-changes between EST sequencing and real time

PCR for 10 individual genes in the Adult, Onc, PSC and Cyst of E. granulosus. The gene

identifications are Eg_10819, EG_10917, EG_00147, EG_05614, EG_10290, EG_05613,

EG_01347, EG_06805, EG_02955 and EG_01525.

R² = 0.6383, P<0.0001, n=30


Supplementary Tables

Supplementary Table 1. Genome sequencing statistics

454 GS FLX

Single read

Solexa GA IIx

Pair-End (300 bp)

Solexa GA IIx

Mate-Pair (3kb)

Reads number 7,503,355 55,012,872 116,722,731

Average read length (bp) 378 2x120 2x35

Total bases 2,834,115,909 12,652,960,560 8,170,591,170

Coverage (x)* 18.7 83.5 53.9

* Based on the E. granulosus genome size of 151.6 Mb

Supplementary Table 2. E. granulosus genome assembly statistics

Total contigs Total contigs (>1kb) Scaffolds

Number 22,340 10,397 967

Total size (bp) 111,790,038 108,157,702 110,862,006

Average length (bp) 5,004 10,403 114,465

Largest length (bp) 255,553 255,553 3,893,204

N50 length (bp) 28,879 30,265 682,596

Supplementary Table 3. CEGMA scores for E. granulosus

Parasitic platyhelminthes Parasitic nematodes free-living nematodes

E. granulosus S. japonicum S. mansoni B. malayi T. spiralis C. elegans P. pacificus

Complete CEGs 210 126 136 223 232 240 181

CEGMA completeness (%) 84.68 50.81 54.84 89.92 93.55 96.77 72.98

Partial CEGs 221 198 197 236 234 246 205

CEGMA completeness (%) 89.11 79.84 79.44 95.16 94.35 99.19 82.66

Of the total of 248 CEGs, 79-99% are found in the seven species.


Supplementary Table 5. Repeat ratios in fosmids

Fosmid ID Length (bp) Repeats (bp) Repeat Ratio

Fosmid_49 32175 362 1.13%

Fosmid_02 27167 872 3.21%

Fosmid_45 37089 1211 3.27%

Fosmid_42 31635 1618 5.11%

Fosmid_19 24442 1283 5.25%

Fosmid_06 33162 1857 5.60%

Fosmid_03 43385 2462 5.67%

Fosmid_22 36060 2292 6.36%

Fosmid_08 42071 2920 6.94%

Fosmid_43 38768 3373 8.70%

Fosmid_13 30936 2785 9.00%

Fosmid_21 28547 3281 11.49%

Fosmid_30 39995 4788 11.97%

Fosmid_47 32509 4487 13.80%

Fosmid_04 35203 5182 14.72%

Fosmid_48 33702 32576 96.66%

Fosmid_27 30318 29474 97.22%

Fosmid_26 38050 37413 98.33%

Fosmid_05 27963 27590 98.67%

Total 643177 165826 25.78%


Supplementary Table 6. Variation in exon/intron size among genes

Exon

Number

Gene

Number

Average Exon

Length (bp)

Average Intron

Length (bp)

Average Gene

Length (bp)

Average CDS

Length (bp)

1 1,054 832 0 832 832

2 1,890 249 1,037 1,535 498

3 1,419 223 975 2,618 668

4 1,150 213 835 3,354 850

5 1,011 198 803 4,202 989

6 880 195 770 5,021 1,171

7 664 196 719 5,684 1,374

8 565 194 709 6,510 1,549

9 431 186 736 7,566 1,678

10 352 203 730 8,601 2,028

11 283 198 702 9,190 2,174

12 239 198 706 10,141 2,371

13 208 195 717 11,136 2,537

14 161 194 652 11,184 2,710

15 147 206 746 13,534 3,087

16 117 204 701 13,766 3,258

17 87 198 664 13,981 3,365

18 79 214 717 16,045 3,860

19 79 208 731 17,113 3,957

20 61 196 659 16,445 3,917

21 48 218 644 17,455 4,570

22 53 213 596 17,213 4,697

23 49 208 673 19,589 4,777

24 42 202 630 19,320 4,836

25 31 195 592 19,097 4,883

26 23 212 641 21,541 5,515

27 12 201 692 23,408 5,427

28 21 201 581 21,314 5,629

29 19 236 643 24,858 6,856

30 21 196 545 21,683 5,875

31 15 222 615 25,319 6,875

32 12 205 765 30,250 6,551

33 13 235 540 25,032 7,765

34 8 202 553 25,103 6,853

35 7 183 603 26,906 6,390

36 10 208 594 28,290 7,491

37 5 235 562 28,957 8,713

38 7 187 623 30,147 7,107

39 5 243 679 35,286 9,469

40 3 201 615 32,013 8,039

41 4 222 457 27,359 9,086

42 5 175 830 41,355 7,344

43 5 223 413 26,939 9,596

44 3 201 674 37,795 8,828


46 1 247 630 39,678 11,349

47 2 201 322 24,217 9,426

48 2 243 767 47,718 11,673

49 2 282 297 28,087 13,823

50 1 305 656 47,415 15,249

51 1 251 252 25,423 12,825

52 3 137 536 34,413 7,107

53 1 231 353 30,574 12,228

54 2 217 358 30,686 11,724

57 1 271 283 31,292 15,462

58 1 328 175 28,982 19,026

59 1 144 335 27,897 8,478

61 1 245 476 43,516 14,940

63 2 239 392 39,391 15,078

66 2 175 453 40,973 11,520

72 1 220 305 37,472 15,828

75 1 240 589 61,625 18,006

76 1 232 228 34,727 17,595

115 1 205 237 50,621 23,562

Total Length

(bp) 15,875,169 45,648,835 61,524,004 15,875,169


Supplementary Table 7. Predicted operons in the E. granulosus genome

Operon Gene ID Scaffold Strand Start End Gene description KO

Operon_01 EG_00522 EG_S00002 - 1436696 1447040 RNA-binding protein with serine-rich domain K14325

Operon_01 EG_00523 EG_S00002 - 1447603 1451733 Histone-lysine N-methyltransferase trr K09188

Operon_02 EG_00551 EG_S00002 - 1799256 1799903 GrpE protein homolog K03687

Operon_02 EG_00552 EG_S00002 - 1800468 1801214 conserved hypothetical protein

Operon_03 EG_01975 EG_S00008 + 904352 922061 DNA repair protein complementing XP-C cells homolog K10838

Operon_03 EG_01976 EG_S00008 + 922860 926417 Dynactin subunit K10428

Operon_04 EG_02049 EG_S00009 - 88660 123386 Titin

Operon_04 EG_02050 EG_S00009 - 123660 133584 Disorganized muscle protein

Operon_05 EG_03741 EG_S00020 - 922678 923635 Ran-specific GTPase-activating protein

Operon_05 EG_03742 EG_S00020 - 923760 930118 hypothetical protein


Operon_06 EG_05075 EG_S00035 + 431209 433101 Translation initiation factor eIF-2B subunit alpha K03239

Operon_06 EG_05076 EG_S00035 + 433831 435028 Ectonucleotide pyrophosphatase/phosphodiesterase family member

Operon_07 EG_06666 EG_S00061 - 254908 259750 Canalicular multispecific organic anion transporter

Operon_07 EG_06667 EG_S00061 - 260263 267171 Coiled-coil domain-containing protein

Operon_08 EG_07896 EG_S00090 + 20694 25329 conserved hypothetical protein

Operon_08 EG_07897 EG_S00090 + 26594 41691 Protocadherin-16



Operon_10 EG_10189 EG_S00197 - 26853 30129 Lipid phosphate phosphohydrolase

Operon_10 EG_10190 EG_S00197 - 36982 39167 Putative phosphatidate phosphatase


Supplementary Table 8. Expression of genes with the SL1 sequence in E.

granulosus

Gene ID Gene description Sequencing read number

Adult Onc PSC Cyst

EG_00111 NEDD8-conjugating enzyme UBE2F 43 5 12 9

EG_00161 U4/U6 small nuclear ribonucleoprotein Prp3 16 4 18 16

EG_00307 Deoxyhypusine synthase 15 0 1 16

EG_00310 Serine/threonine-protein phosphatase PP1-gamma catalytic subunit 18 0 12 14

EG_00452 E3 SUMO-protein ligase RanBP2 13 2 27 30

EG_00458 Fructose-bisphosphate aldolase 284 71 188 405

EG_00466 Pre-mRNA-splicing factor ATP-dependent RNA helicase PRP16 10 2 30 28

EG_00517 Ribosome-binding protein 1 (Ribosome receptor protein) 61 8 122 73

EG_00537 NTF2-related export protein 4 8 9 26

EG_00566 GPN-loop GTPase 7 0 1 5

EG_00601 Enhancer of rudimentary homolog 25 18 1 19

EG_00669 Tubulin--tyrosine ligase-like protein 14 2 14 12

EG_00711 U6 snRNA-associated Sm-like protein LSm6 37 2 6 15

EG_00720 DNA-directed RNA polymerase III subunit RPC9 17 9 9 16

EG_00768 Ribonuclease P/MRP protein subunit POP5 4 4 1 1

EG_00769 RING finger protein 4 0 2 3

EG_01226 Calmodulin 324 55 274 765

EG_01283 Immediate early response 3-interacting protein 60 14 2 11

EG_01323 Peripheral plasma membrane protein CASK 17 10 28 9

EG_01362 WD repeat-containing protein 24 1 11 18

EG_01376 Cytoplasmic dynein 1 heavy chain 21 0 106 42

EG_01411 hypothetical protein 20 7 10 8

EG_01465 Magnesium transporter NIPA2 27 0 47 10

EG_01470 ATP-dependent RNA helicase DDX51 37 14 42 24

EG_01532 Ran guanine nucleotide release factor 9 3 8 5

EG_01552 Cleavage and polyadenylation specificity factor subunit 6 14 9 17 5

EG_01692 conserved hypothetical protein 23 4 15 2


EG_01855 Pyrroline-5-carboxylate reductase 6 0 6 25

EG_02137 Nuclear pore complex protein Nup107 25 7 61 23


EG_02340 Surfeit locus protein 13 4 6 2

EG_02361 Serine/threonine-protein kinase svkA 5 0 8 9

EG_02387 Protein phosphatase 1 regulatory inhibitor subunit 16B 5 0 10 5

EG_02465 UBX domain-containing protein 27 4 9 12

EG_02467 Innexin unc-7 76 2 21 14

EG_02545 Exosome complex exonuclease RRP40 7 4 8 27

EG_02614 Glutaredoxin-related protein 10 0 1 5

EG_02670 Twinfilin-1 18 1 5 12

EG_02698 F-actin-capping protein subunit alpha 53 2 38 44

EG_02780 Mitotic spindle assembly checkpoint protein MAD2A 12 1 6 8

EG_02796 Protein YIPF1 26 6 11 11


EG_03026 Ras-related protein Rap-1b 33 4 11 40

EG_03057 UPF0631 protein C17orf108 homolog 23 7 2 5

EG_03086 DNA-directed RNA polymerases I, II, and III subunit RPABC5 2 1 1 1

EG_03121 Eukaryotic initiation factor 4A-III 33 25 29 49

EG_03465 Ubiquitin-like protein 49 6 3 13

EG_03601 BolA-like protein 47 17 4 25

EG_03812 EF-hand calcium-binding domain-containing protein 3 1 5 2


EG_04032 Pentatricopeptide repeat-containing protein 7 1 13 14

EG_04047 Pre-mRNA-processing factor 14 0 21 48

EG_04066 Protein chibby homolog 6 5 4 12

EG_04073 Peptidyl-prolyl cis-trans isomerase NIMA-interacting 4 1 3 15


EG_04191 snRNA-activating protein complex subunit 11 1 2 4


EG_04348 Peptidyl-prolyl cis-trans isomerase E 6 5 6 19

EG_04376 DnaJ homolog subfamily B member 54 46 32 59

EG_04400 Calcyphosin-like protein 12 3 4 2

EG_04404 Probable translation initiation factor eIF-2B subunit gamma 17 3 8 39

EG_04426 Asparagine synthetase domain-containing protein 15 3 15 16


EG_04451 Proteasome maturation protein 17 4 13 13



EG_04683 Protein preY, mitochondrial 17 2 1 2

EG_04706 Galactose-1-phosphate uridylyltransferase 36 3 5 18

EG_04736 Ubiquinone biosynthesis protein COQ9 7 3 4 18

EG_04745 Caspase-3 20 0 6 31

EG_04786 ADP-ribosylation factor-like protein 2 55 13 20 45


EG_04994 Neurogenic locus notch homolog protein 237 6 210 622

EG_05001 DNA replication complex GINS protein 10 2 4 16

EG_05076 Ectonucleotide pyrophosphatase/phosphodiesterase family member 20 2 13 22

EG_05103 Ubiquitin thioesterase zranb1-A 8 0 14 9


EG_05275 PQ-loop repeat-containing protein 8 1 4 10

EG_05309 Mitotic checkpoint protein BUB3 9 0 5 8

EG_05331 Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit

alpha isoform 46 1 22 8

EG_05332 UPF0636 protein C4orf41 homolog 3 0 9 9


EG_05455 Cytochrome b-c1 complex subunit 43 5 7 21

EG_05477 ATPase family AAA domain-containing protein 1-A 5 2 8 45





EG_05582 Nucleoside diphosphate kinase A 473 10 155 475


EG_05591 Inositol polyphosphate multikinase 7 2 5 29




EG_05824 Endophilin-B1 67 140 18 35


EG_06188 Phosphoglucomutase 53 5 38 35



EG_06219 Zinc finger and SCAN domain-containing protein 6 4 14 34

EG_06224 Oxysterol-binding protein-related protein 3 1 2 2


EG_06454 Replication protein A 14 kDa subunit 8 0 7 12

EG_06455 Cytochrome c oxidase copper chaperone 10 1 0 3

EG_06461 Protein phosphatase Slingshot homolog 27 13 11 19

EG_06467 Mediator of RNA polymerase II transcription subunit 0 0 1 3

EG_06519 39S ribosomal protein L14, mitochondrial 11 5 7 12

EG_06647 Developmentally-regulated GTP-binding protein 34 10 27 63




EG_06976 Circulating cathodic antigen 17 4 7 21

EG_06985 Protein SEC13 homolog 8 2 6 37

EG_07002 WD repeat-containing protein 6 1 5 17

EG_07009 Nicotinamide phosphoribosyltransferase 5 2 5 2


EG_07035 Probable zinc transporter protein DDB_G0283629 5 1 3 1

EG_07106 Fructose-1,6-bisphosphatase 99 2 23 30

EG_07180 Histone deacetylase 11 2 16 7

EG_07320 C2 domain-containing protein 2 0 18 0

EG_07338 Transcription initiation factor TFIID subunit 10 0 0 8


EG_07395 GTPase 19 1 10 19

EG_07427 Methyltransferase-like protein 12 6 31 18


EG_07509 D-tyrosyl-tRNA(Tyr) deacylase 2 1 1 5

EG_07539 LYR motif-containing protein 8 1 4 6


EG_07679 Intersectin-1 25 6 26 41

EG_07833 PQ-loop repeat-containing protein 6 2 1 2

EG_07876 ADP-ribosylation factor-like protein 5B 19 3 4 32

EG_07890 SET and MYND domain-containing protein 4 0 5 20


EG_07914 Activin receptor type-2A 9 10 15 22


EG_08116 Putative uncharacterized protein FLJ37770 30 0 13 155

EG_08150 Interferon regulatory factor 37 2 27 25

EG_08429 DNA/RNA-binding protein KIN17 7 2 4 6


EG_08441 Beclin-1 3 0 9 5

EG_08603 Protein zyg-11 homolog B 8 2 7 21

EG_08663 JmjC domain-containing protein 5 4 5 3

EG_08843 Synergin gamma 6 1 3 8

EG_08888 DNA polymerase epsilon subunit 3 1 1 3

EG_09017 U2 small nuclear ribonucleoprotein B'' 5 0 2 7


EG_09514 Protein XRP2 19 0 11 6

EG_09526 Neural Wiskott-Aldrich syndrome protein 6 0 0 6

EG_09600 Rhotekin 71 3 30 252

EG_09625 rpgr-interacting protein 1 related 4 1 13 7

EG_09627 PEST proteolytic signal-containing nuclear protein 9 2 7 5

EG_09673 Tetratricopeptide repeat protein 5 0 3 7

EG_09770 Acyl-protein thioesterase 42 14 22 52

EG_09972 Coiled-coil domain-containing protein 10 0 39 32


EG_10507 Reactive oxygen species modulator 8 0 0 2

EG_10765 Methyltransferase-like protein 1 0 0 0


EG_10919 Mitogen-activated protein kinase 19 0 27 2


EG_11250 endonuclease-reverse transcriptase 0 0 0 15


Supplementary Table 9. Blast results of E. granulosus repeats

Repeat Length

(bp) Hit Description

Copy

Number

contig00127 700 PREDICTED: Ailuropoda melanoleuca histone H3.2-like (LOC100471070), mRNA 2.74

contig01506 884 PREDICTED: Canis familiaris similar to Caldecrin precursor (Chymotrypsin C), transcript variant 4 (LOC478220),

mRNA 3.86

contig02711 648 PREDICTED: Canis familiaris similar to zymogen granule protein 16, transcript variant 1 (LOC479782), mRNA 2.90

contig02721 1887 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds 2.98

contig02812 1598 Echinococcus multilocularis species-specific diagnostic DNA probe 2.72

contig02836 3482 Taenia asiatica clone TaHC6-H9 mRNA sequence 2.10

contig02926 144 Echinococcus granulosus clone 25010 microsatellite sequence 7.00

contig03081 559 Echinococcus granulosus strain G1 Hsp70 pseudogene, complete sequence 3.51

contig03264 1530 E.granulosus EgBRep repetitive DNA element 4.44



contig04047 676 Echinococcus multilocularis EmCLP1 gene for cathepsin L-like proteinase, complete cds 5.72

contig04163 804 Homo sapiens chymotrypsinogen B1 (CTRB1), mRNA 17.27

contig05048 19858 Echinococcus multilocularis mpk2 gene for p38 MAP kinase MPK2 protein, exons 1-10, isolate H95 2.05

contig05170 1043 Echinococcus granulosus clone 5 EG95-7 pseudogene, complete sequence 3.54

contig05207 304 Taenia asiatica clone TaHC1-F4 mRNA sequence 2.67

contig05337 246 Echinococcus multilocularis EmAgB8/1 gene for antigen B 8-kDa-1, complete cds 3.76


contig05495 6879 Schistosoma japonicum isolate Anhui non-coing mRNA clone SJFCE2524.001|FSE001-P00024-O05 2.26


contig05757 6721 Echinococcus multilocularis EM95 vaccine antigen gene, complete cds 2.77



contig05875 4037 Taenia asiatica clone TaHC4-A8 mRNA sequence 2.00





contig06353 1350 Echinococcus granulosus isolate 14 BG 1/3 sequence 3.74



contig06559 388 Taenia asiatica clone TaHC11-D12 mRNA sequence 2.35

contig06781 586 Echinococcus granulosus isolate 7_g EG95 (eg95) gene, partial cds 5.23


contig06866 269 E.granulosus EgDRep repetitive DNA element 4.53



contig07107 291 Echinococcus granulosus tandemly repetitive element 3.18


contig07124 973 Echinococcus granulosus clone B1geno22 antigen B EgAgB8/1 subunit-like protein gene, partial cds 2.39

contig07125 305 Echinococcus granulosus clone B3N.2 antigen B3 mRNA, partial cds 2.16



contig07337 1756 Echinococcus granulosus genotype 1 mitochondrion, complete genome 63.19

contig07432 189 E.multilocularis U1 small nuclear RNA gene 81.26







contig08055 425 Echinococcus multilocularis EmAgB8/1 gene for antigen B 8-kDa-1, complete cds 2.50

contig08185 528 Echinococcus granulosus clone EgDSFIb 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1,

complete sequence; and 5.8S ribosomal RNA gene, partial sequence 10.08







contig09074 531 Taenia asiatica clone TaHC3-G5 mRNA sequence 4.59




contig09308 283 Taenia solium 17h gene, exons 1-7 2.67


contig09568 1431 Echinococcus multilocularis onco2 gene for putative hsp20, complete cds 2.13

contig09694 702 Homo sapiens FOSMID clone ABC12-46987300E12 from chromosome unknown, complete sequence 3.07


contig09929 2266 Echinococcus multilocularis clone EmCA90 microsatellite sequence 3.31

contig09947 341 Echinococcus granulosus ribosomal RNA promotor region and external transcribed spacer 2.34





contig10116 115 Taenia asiatica clone HC2-A10 cytoplasmic antigen 1 mRNA, complete cds 200.87

contig10142 637 Echinococcus granulosus isolate 7_b EG95 (eg95) gene, partial cds 3.16


contig10198 578 Echinococcus granulosus isolate sq3C 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

8.57





contig10405 295 Schistosoma japonicum isolate Anhui non-coing mRNA clone SJFCE2524.001|FSE001-P00024-O05 11.77


contig10546 186 Spathebothrium simplex 28S ribosomal RNA gene, complete sequence 139.92

contig10577 433 Taenia asiatica clone TaHC7-B1 mRNA sequence 3.23






contig10942 3102 Echinococcus granulosus EG95-1 (EG95-1) gene, complete cds 3.47




contig11118 510 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA24CG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito)

5.38

contig11147 443 Schistosoma mansoni genome sequence supercontig Smp_scaff000349 6.64


contig11193 144 Raillietina sp. 3 Nebraska 28S large subunit ribosomal RNA gene, partial sequence 3.01







contig11225 162 Echinococcus granulosus spliced leader sequence and spliced leader exon 215.62



contig11268 141 PREDICTED: Sus scrofa histone H2A type 1-like (LOC100155734), mRNA >gi|335308464|ref|XM_003361191.1|

PREDICTED: Sus scrofa histone H2A type 1-like (LOC100627582), mRNA 16.78


contig11320 110 Echinococcus granulosus clone 1 isolate sq2a 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

3.44




contig11376 3372 Echinococcus granulosus isolate DS12 NADH dehydrogenase subunit 1-like (NAD1) gene, partial sequence; mitochondrial

55.92


contig11401 1099 Taenia asiatica clone HC2-A10 cytoplasmic antigen 1 mRNA, complete cds 6.74






contig11491 492 Hymenolepididae sp. VH-2010 28S ribosomal RNA gene, partial sequence 15.11


contig11521 150 Echinococcus granulosus heat shock 70 kDa protein mRNA, complete cds 51.43




contig11576 244 Echinococcus granulosus 18S ribosomal RNA gene, complete sequence 78.84







contig11881 211 Raillietina dromaius 18S ribosomal RNA gene, complete sequence 3.12


contig12042 706 Echinococcus granulosus BG 1/3 sequence 8.01

contig12051 1341 Raillietina sonini 18S small subunit ribosomal RNA gene, partial sequence 11.82

contig12066 4424 Taenia asiatica clone HC14-G9 seryl-aminoacyl-tRNA synthetase 1 mRNA, partial cds 7.69










contig13014 1647 Penicillium decumbens strain JU-A10 18S ribosomal RNA gene, partial sequence 2.35





contig13293 105 Taenia solium U6 snRNA and U5 snRNA genes, complete sequence 2.40



contig13328 1273 PREDICTED: Callithrix jacchus histone H2A type 1-B/E-like (LOC100389983), mRNA 5.43




contig13467 451 Echinococcus multilocularis TSP3 mRNA, complete cds 13.32

contig13468 420 Echinococcus multilocularis TSP3 mRNA, complete cds 15.67





contig14302 676 PREDICTED: Canis familiaris similar to histone 2, H2ac (LOC483174), mRNA 6.48






contig14585 788 Echinococcus multilocularis EmCLP1 gene for cathepsin L-like proteinase, complete cds 3.61













contig15250 1448 Echinococcus multilocularis mRNA for serine protease inhibitor (serp1 gene) 2.66

contig15263 7056 Echinococcus multilocularis emY162 gene for EMY162 protein, complete cds 2.05










contig16429 171 Echinococcus granulosus clone EgDSFIb 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1,





contig16827 211 Echinococcus vogeli isolate 8H EG95 (eg95) pseudogene, partial sequence 8.29



contig17216 552 Taenia asiatica clone HC7-A4 solute carrier family 1-like protein mRNA, partial cds 3.35


contig17253 129 Echinococcus granulosus tandemly repetitive element 11.07




contig17409 206 Mesocestoides sp. AW-2007 28S large subunit ribosomal RNA gene, complete sequence 126.48



contig17555 371 Hymenolepis diminuta 28S large subunit ribosomal RNA gene, partial sequence 2.08

contig17556 620 Hymenolepis diminuta 28S large subunit ribosomal RNA gene, partial sequence 71.38

contig17558 1109 Echinococcus granulosus isolate sq2a clone 2 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2,

complete sequence; and 28S ribosomal RNA gene, partial sequence 2.01


contig17634 199 Pachybothrium hutsoni 28S large subunit ribosomal RNA gene, complete sequence 2.53



contig17708 119 Echinococcus granulosus 18S ribosomal RNA gene, partial sequence 154.24



contig17886 212 Raillietina tunetensis 28S large subunit ribosomal RNA gene, partial sequence 82.68



contig18136 161 Echinococcus granulosus isolate sq3C 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2,

complete sequence; and 28S ribosomal RNA gene, partial sequence 126.17


contig18155 611 Rattus norvegicus H2A histone family, member J (H2afj), mRNA >gi|163916272|gb|BC157816.1| Rattus norvegicus

H2A histone family, member J, mRNA (cDNA clone MGC:187833 IMAGE:9034669), complete cds 28.92




contig18301 236 Taenia asiatica clone TaHC5-H8 mRNA sequence 3.50



contig18346 125 Echinococcus granulosus from sheep 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete

sequence; and 5.8S ribosomal RNA gene, partial sequence 119.06


contig18419 527 Taenia asiatica clone HC7-A4 solute carrier family 1-like protein mRNA, partial cds 2.71






contig18806 376 Rattus norvegicus H2A histone family, member J (H2afj) 7.45

contig18809 117 Taenia hydatigena isolate 48 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

156.99



contig18903 274 Echinococcus granulosus partial 28S rRNA gene 68.57

contig18936 118 Echinococcus granulosus microsatellite Egmsca2 8.19

contig18944 550 Ovis aries chromosome X centromeric satellite I DNA sequence 11.25



contig19446 216 Echinococcus granulosus partial 28S rRNA gene 19.70


contig19515 1216 Echinococcus multilocularis EmmarepLZ (EmmarepLZ) mRNA, partial cds 2.86



contig19624 542 Taenia asiatica clone HC1-B5 amino acid permease mRNA, partial cds 2.94

contig19657 1338 Echinococcus canadensis isolate 624 EG95 (eg95) gene, complete cds 4.24











contig20212 114 Echinococcus felidis isolate 4 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete



contig20479 159 Echinococcus felidis isolate 2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete







contig20637 236 Mesocestoides sp. AW-2007 28S large subunit ribosomal RNA gene, complete sequence 3.92


contig20662 320 Echinococcus granulosus from water buffalo 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1,









contig21235 116 Spirometra sp. JL-2010 18S ribosomal RNA gene, partial sequence 126.84


contig21385 154 Echinococcus multilocularis spliced leader sequence and spliced leader exon 9.55


contig21631 184 Ovis aries chromosome X centromeric satellite I DNA sequence 19.25






contig21938 112 O.aries 1.714 satelite DNA 5.13

contig21945 108 Echinococcus multilocularis 28S large subunit ribosomal RNA gene, partial sequence 45.37



contig22010 121 Echinococcus granulosus repeat region sequence 13.19

contig22026 192 PREDICTED: Callithrix jacchus histone H2A type 1-B/E-like (LOC100389983), mRNA 13.42



contig22111 125 Echinococcus multilocularis 28S large subunit ribosomal RNA gene, partial sequence 3.02

contig22141 157 Schistosoma japonicum isolate Anhui non-coing mRNA clone SJFCE2524.002|FSE001-P00013-A08 52.34

contig22148 153 Echinococcus multilocularis mRNA for serine protease inhibitor (serp1 gene) 3.20


contig22339 702 Sheep satellite II DNA repeat unit 2.05


Supplementary Table 10. Distribution of SNPs in the E. granulosus genome

SNP Number SNP Frequency (No./Kb)

E. granulosus S. japonicum E. granulosus S. japonicum

Total genome 145,534 557,739 0.96 1.40

Exon 1,801 21,220 0.11 1.47

Intron 56,665 174,233 1.24 1.61

Intergenic region 87,068 362,286 0.97 1.32

Supplementary Table 11. SNP base substitution in the E. granulosus genome

Substitution Exon Intron Intergenic region Total

Transition A-G 742 19891 31116 51749(35.6%)

C-T 684 20821 30975 52480(36.1%)

Transversion

A-C 132 4496 7059 11687(8.0%)

A-T 50 3131 5562 8743(6.1%)

C-G 59 3642 5434 9135(6.3%)

G-T 134 4684 6922 11740(8.1%）

Total 1801 56665 87068 145534

Supplementary Table 12. SNP base substitution in the E. granulosus genome and

transcriptome

Substitution

type

Genomic

coding

region

Transcriptome

Cyst PSC Onc Adult

No. Ratio No. Ratio No. Ratio No. Ratio No. Ratio

Transition A-G 742 41.2% 596 40.1% 312 33.5% 229 40.7% 534 38.1%

C-T 684 38.0% 570 38.4% 391 42.0% 223 39.6% 526 37.6%

Transversion

A-C 132 7.3% 87 5.9% 68 7.3% 29 5.2% 85 4.9%

A-T 50 2.8% 66 4.4% 35 3.8% 32 5.7% 69 4.9%

C-G 59 3.3% 81 5.5% 70 7.5% 35 6.2% 92 6.6%

G-T 134 7.4% 84 5.7% 56 6.0% 15 2.7% 94 6.7%

Total 1801 100% 1485 100.0% 932 100.0% 563 100.0% 1400 100.0%


Supplementary Table 14. Pfam domain family distribution in nine species

Species Pfam domain number Taxa

Echinococcus granulosus 3405 3405 E. granulosus

Schistosoma japonicum 3332 3805 Schistosomes

Schistosoma mansoni 3550

Brugia malayi 3550 4076 Parasitic nematodes

Trichella spiralis 3448

Caenorhabditis elegans 4155 4611 Free-living nematodes

Pristionchus pacificus 3856

Homo sapiens 5323 5551 Mammalian hosts

Canis lupus familiaris 5184

Supplementary Table 15. Complete pathways in E. granulosus

Pathway KO No.

EMP 00010

TCA 00020

HMP 00030

Galactose metabolism 00052

Ala,Asp,Glu metabolism 00250

Glutathione metabolism 00480

Glycerolipid metabolism 00561

Pyruvate metabolism 00623

Lipoic acid metabolism 00785

Mannose metabolism 00051

MAPK signaling pathway 04010

ERBB signaling 04012

Calcium signaling 04020

Phosphatidylinositol 04070

mTOR 04150

WNT 04310

TGF-beta 04350

FOCAL adhesion 04510

Adherens junction 04520

Regulation of actin cytoskeleton 04810

Base excision repair 03410

nucleotide excision repair 03420

mismatch repair 03430

homologous recombination 03440

Non-homologous end-joining 03450


Supplementary Table 16. Pfam domains lost in E. granulosus

Pfam E. granulosus S. japonicum S. mansoni B. malayi T. spiralis P. pacificus C. elegans H. sapiens C. familiaris

pfam00024 0 0 0 11 22 24 23 12 5

pfam00042 0 1 2 7 11 23 20 15 9

pfam00058 0 0 0 5 6 8 6 26 12

pfam00068 0 0 0 1 3 2 3 13 8

pfam00084 0 2 1 5 8 4 7 101 51

pfam00086 0 0 0 5 8 2 5 27 17

pfam00094 0 0 0 1 9 10 8 27 23

pfam00115 0 25 5 1 1 1 1 1 1

pfam00147 0 0 0 1 3 4 5 42 23

pfam00167 0 0 0 2 2 1 2 39 21

pfam00174 0 1 1 0 1 1 1 3 1

pfam00185 0 2 1 0 0 1 1 2 2

pfam00199 0 0 0 0 2 2 3 1 1

pfam00201 0 0 0 1 4 128 74 29 16

pfam00205 0 1 3 3 2 4 3 2 2

pfam00217 0 2 1 2 1 4 6 7 15

pfam00221 0 0 0 0 0 2 1 1 1

pfam00232 0 0 0 0 0 1 2 6 5

pfam00257 0 0 0 0 0 3 3 4 3

pfam00264 0 3 2 6 5 9 6 4 3

pfam00265 0 0 0 0 0 2 1 1 1

pfam00278 0 0 0 1 2 5 2 4 3

pfam00341 0 0 0 0 1 1 1 28 8

pfam00361 0 9 2 3 0 2 2 3 3

pfam00368 0 1 1 1 1 1 1 2 1

pfam00465 0 0 1 0 0 2 1 1 1

pfam00487 0 4 3 4 1 13 9 12 11

pfam00510 0 4 2 1 0 1 1 1 1

pfam00576 0 0 0 0 0 3 3 1 2

pfam00577 0 0 0 1 0 3 3 8 4

pfam00682 0 1 2 0 1 2 2 7 3

pfam00696 0 1 1 0 1 1 1 3 2

pfam00703 0 1 1 1 1 3 1 1 1

pfam00732 0 2 2 1 1 1 1 1 1

pfam00763 0 1 1 0 1 1 1 7 4

pfam00766 0 0 0 1 1 1 1 2 1

pfam00802 0 0 0 0 0 10 10 11 4

pfam00809 0 0 0 0 2 1 1 1 1

pfam00830 0 0 0 0 0 1 1 1 1

pfam00832 0 0 0 1 1 2 1 2 1

pfam00836 0 0 0 0 1 2 1 8 4

pfam00839 0 0 0 1 1 1 1 3 1

pfam00854 0 0 0 1 0 4 3 10 6

pfam00909 0 0 0 3 0 7 6 9 4

pfam00921 0 0 0 0 0 1 1 3 1

pfam00965 0 0 0 0 0 9 2 4 5

pfam00988 0 0 1 0 0 1 1 3 2

pfam01007 0 0 0 4 4 4 7 31 16

pfam01012 0 0 0 2 2 2 2 4 2

pfam01017 0 0 0 1 1 1 1 20 10

pfam01053 0 3 2 3 3 5 8 14 6

pfam01063 0 0 0 1 1 5 2 7 2

pfam01108 0 0 1 0 1 1 1 19 12

pfam01144 0 0 0 0 1 1 1 2 1

pfam01146 0 0 0 1 1 2 2 10 3

pfam01165 0 0 0 0 0 1 1 2 1

pfam01166 0 0 0 2 2 3 3 7 4

pfam01175 0 0 0 0 0 1 1 3 1

pfam01187 0 0 0 1 2 4 4 5 2

pfam01234 0 0 0 2 1 4 3 4 3

pfam01261 0 0 0 2 2 2 2 3 1


pfam01268 0 0 0 0 1 1 1 4 3

pfam01273 0 0 0 5 0 7 6 18 13

pfam01315 0 0 0 0 0 4 3 2 4

pfam01323 0 0 0 0 0 6 3 4 2

pfam01329 0 0 1 1 1 1 1 2 2

pfam01342 0 0 0 1 0 1 4 14 6

pfam01390 0 0 1 3 2 3 7 42 21

pfam01451 0 0 0 1 1 1 1 3 1

pfam01499 0 0 0 0 0 1 2 2 2

pfam01531 0 0 1 1 0 4 23 3 3

pfam01540 0 0 2 1 0 9 8 14 7

pfam01551 0 0 0 1 1 1 1 1 1

pfam01557 0 1 1 1 1 2 2 7 3

pfam01575 0 1 1 1 0 5 1 3 1

pfam01582 0 0 1 1 0 1 2 33 20

pfam01594 0 1 1 2 2 2 1 6 4

pfam01596 0 0 4 7 0 4 6 6 3

pfam01607 0 0 0 6 9 11 7 3 1

pfam01612 0 1 1 4 3 3 8 11 4

pfam01619 0 0 1 1 1 1 1 3 2

pfam01630 0 0 0 0 0 5 1 19 6

pfam01642 0 0 0 0 1 1 1 1 1

pfam01658 0 0 0 0 0 1 1 3 1

pfam01713 0 1 1 1 0 5 2 1 1

pfam01723 0 0 0 0 0 6 3 1 3

pfam01731 0 0 0 0 0 7 5 4 2

pfam01756 0 0 0 2 0 11 8 7 4

pfam01765 0 1 0 1 1 4 4 3 2

pfam01769 0 0 0 1 1 3 3 7 3

pfam01770 0 0 0 2 1 2 3 9 7

pfam01794 0 0 0 1 1 2 2 24 10

pfam01799 0 0 0 0 0 5 3 2 4

pfam01808 0 0 0 0 0 1 1 1 2

pfam01826 0 1 1 3 7 27 20 19 16

pfam01842 0 0 0 0 1 1 2 3 3

pfam01847 0 0 0 0 1 1 1 3 1

pfam01923 0 0 0 0 2 1 1 1 2

pfam01925 0 1 1 2 3 5 9 9 4

pfam01928 0 0 0 0 0 1 1 2 1

pfam01958 0 0 0 0 0 1 1 2 1

pfam01988 0 8 0 2 0 2 2 6 8

pfam02009 0 1 1 2 3 7 2 12 3

pfam02010 0 1 1 0 0 1 1 14 8

pfam02014 0 0 0 1 2 2 3 4 3

pfam02036 0 0 0 3 1 6 4 13 5

pfam02046 0 0 0 1 1 1 1 2 2

pfam02055 0 0 0 1 1 9 5 5 1

pfam02100 0 0 1 1 1 1 1 4 3

pfam02118 0 1 1 0 0 36 101 1 2

pfam02137 0 0 0 2 2 1 4 16 4

pfam02140 0 0 0 1 2 1 3 7 5

pfam02142 0 1 1 0 0 1 2 5 3

pfam02173 0 0 0 1 2 1 1 13 3

pfam02177 0 0 1 1 1 1 1 16 3

pfam02191 0 0 0 3 3 3 3 14 14

pfam02219 0 0 0 1 1 1 1 1 1

pfam02234 0 0 0 2 1 1 2 8 2

pfam02268 0 1 1 1 1 2 2 1 1

pfam02272 0 1 1 1 0 1 1 1 1

pfam02275 0 0 0 0 1 6 3 5 2

pfam02310 0 0 0 0 3 3 2 2 2

pfam02321 0 1 1 2 4 4 1 23 12

pfam02347 0 2 2 0 1 1 1 1 1

pfam02350 0 0 0 0 0 1 2 6 3


pfam02355 0 0 0 1 0 8 7 1 1

pfam02384 0 0 0 1 2 1 2 7 1

pfam02387 0 0 0 0 0 1 1 1 3

pfam02391 0 1 0 0 2 1 1 1 1

pfam02414 0 0 1 0 1 12 2 6 6

pfam02436 0 1 2 0 1 1 1 3 1

pfam02494 0 0 0 1 1 3 3 6 3

pfam02515 0 0 0 0 0 1 2 7 2

pfam02538 0 0 0 0 0 1 1 1 1

pfam02551 0 0 1 0 2 6 5 1 1

pfam02554 0 0 0 1 0 1 2 2 1

pfam02567 0 0 0 0 0 1 4 2 1

pfam02574 0 1 1 1 4 1 2 4 3

pfam02581 0 0 1 1 0 1 2 3 1

pfam02594 0 0 0 0 0 1 1 5 1

pfam02598 0 0 0 1 1 1 1 1 1

pfam02607 0 0 0 0 2 1 1 1 1

pfam02655 0 0 0 0 0 1 1 15 5

pfam02668 0 0 0 0 0 3 2 3 2

pfam02690 0 0 0 0 3 1 1 8 3

pfam02729 0 1 1 1 0 1 1 2 2

pfam02738 0 0 0 0 0 5 3 5 4

pfam02776 0 1 2 1 1 2 2 2 2

pfam02784 0 1 0 1 2 4 2 4 5

pfam02787 0 1 1 0 0 1 1 4 2

pfam02793 0 2 3 5 7 2 5 45 26

pfam02807 0 2 1 2 1 3 6 7 9

pfam02836 0 1 0 2 2 4 1 2 2

pfam02837 0 0 0 1 1 1 2 2 2

pfam02845 0 2 3 1 3 3 3 9 9

pfam02864 0 1 0 1 1 1 1 15 7

pfam02886 0 0 0 7 6 14 10 13 9

pfam02913 0 0 0 2 0 2 3 5 4

pfam02937 0 0 0 0 1 1 3 1 2

pfam02958 0 0 1 0 4 24 28 4 3

pfam03015 0 0 0 1 0 10 1 2 2

pfam03030 0 0 1 1 1 3 2 2 3

pfam03045 0 0 0 1 2 1 1 15 7

pfam03055 0 0 0 0 1 2 3 4 3

pfam03061 0 1 1 3 0 4 6 12 6

pfam03079 0 0 1 1 0 5 3 1 1

pfam03083 0 0 0 3 1 6 7 3 1

pfam03088 0 1 1 2 1 4 3 3 2

pfam03190 0 0 0 1 1 3 3 1 1

pfam03207 0 0 0 1 0 1 1 3 1

pfam03221 0 0 0 2 13 6 5 18 13

pfam03227 0 0 0 2 5 3 8 1 1

pfam03299 0 2 1 3 3 18 5 7 5

pfam03301 0 0 0 0 0 1 1 1 1

pfam03351 0 0 0 4 2 11 14 4 5

pfam03403 0 0 0 1 1 3 4 5 3

pfam03404 0 0 1 0 1 1 1 3 1

pfam03447 0 0 0 0 0 1 1 3 1

pfam03450 0 0 0 0 0 1 1 2 3

pfam03452 0 0 0 1 0 1 1 2 2

pfam03453 0 1 1 1 1 1 2 2 1

pfam03473 0 0 0 0 0 7 4 3 3

pfam03476 0 0 0 0 0 7 4 3 3

pfam03540 0 1 1 1 0 1 1 1 2

pfam03566 0 0 0 0 0 4 1 2 1

pfam03592 0 0 0 0 0 1 1 1 1

pfam03595 0 1 1 0 1 1 1 5 4

pfam03600 0 0 1 1 1 3 3 8 6

pfam03732 0 0 0 0 12 2 1 10 6


pfam03753 0 1 1 1 1 2 4 10 6

pfam03761 0 0 0 2 1 6 21 5 7

pfam03782 0 0 0 1 7 3 3 6 4

pfam03800 0 0 0 0 0 1 1 2 1

pfam03836 0 0 0 0 1 1 1 3 3

pfam03845 0 0 1 0 1 2 1 2 3

pfam03881 0 0 0 2 2 1 2 2 2

pfam03932 0 0 0 0 0 1 1 1 1

pfam03941 0 0 0 2 0 1 2 2 1

pfam03942 0 0 0 1 0 1 1 4 3

pfam03957 0 0 1 1 1 8 2 10 8

pfam03964 0 0 0 0 0 3 2 7 3

pfam03969 0 0 1 0 0 1 1 1 1

pfam04063 0 1 2 0 1 2 1 2 1

pfam04088 0 0 0 1 0 1 1 1 1

pfam04089 0 0 0 1 1 2 2 15 8

pfam04116 0 0 0 1 1 5 5 8 6

pfam04117 0 0 1 0 2 3 1 4 3

pfam04163 0 0 1 0 0 2 2 12 8

pfam04209 0 0 1 0 0 3 1 1 1

pfam04220 0 1 0 0 3 2 2 3 2

pfam04253 0 0 1 0 0 3 3 12 6

pfam04300 0 0 0 2 0 2 1 10 6

pfam04326 0 0 0 0 0 1 1 12 2

pfam04419 0 1 2 1 1 1 1 7 2

pfam04557 0 0 0 1 2 1 1 1 1

pfam04558 0 0 0 1 2 1 1 1 1

pfam04577 0 1 0 0 1 1 1 1 2

pfam04614 0 0 0 1 0 1 1 2 1

pfam04622 0 0 0 1 1 1 1 2 1

pfam04695 0 0 0 1 0 1 1 1 1

pfam04757 0 0 0 2 0 2 3 7 3

pfam04758 0 1 2 1 1 1 1 1 1

pfam04778 0 0 0 0 0 1 1 1 1

pfam04790 0 0 0 2 2 2 2 7 4

pfam04812 0 0 0 0 0 1 1 4 2

pfam04828 0 0 0 0 0 1 1 1 1

pfam04882 0 0 0 1 0 1 1 3 1

pfam04904 0 1 1 1 1 1 1 2 2

pfam04906 0 0 1 1 1 3 2 6 3

pfam04960 0 0 1 1 1 5 3 2 1

pfam04968 0 1 1 1 1 1 1 3 2

pfam04970 0 0 0 1 0 6 1 11 8

pfam04977 0 0 0 1 0 2 2 13 16

pfam05005 0 0 0 1 0 2 1 2 1

pfam05019 0 1 3 1 1 1 1 1 1

pfam05038 0 0 0 0 0 2 1 2 1

pfam05049 0 1 1 0 0 1 2 4 11

pfam05089 0 0 0 0 1 2 1 1 1

pfam05118 0 0 0 1 1 1 1 4 2

pfam05153 0 0 0 0 0 1 1 1 1

pfam05187 0 0 0 2 2 1 1 1 1

pfam05199 0 1 2 1 1 1 1 1 1

pfam05206 0 2 1 1 0 1 1 1 1

pfam05224 0 0 0 1 1 2 2 4 2

pfam05241 0 0 0 0 0 1 2 2 4

pfam05292 0 0 0 1 0 1 1 1 1

pfam05351 0 1 1 2 2 2 2 4 3

pfam05378 0 0 0 0 0 1 2 1 1

pfam05395 0 0 0 0 1 1 2 12 5

pfam05461 0 0 0 1 1 2 2 16 7

pfam05462 0 0 0 2 1 1 3 11 10

pfam05477 0 0 0 1 1 3 2 4 4

pfam05510 0 0 0 1 3 1 1 5 2


pfam05558 0 0 0 0 1 5 5 10 9

pfam05571 0 1 0 1 1 1 1 2 1

pfam05609 0 1 1 0 0 1 1 3 2

pfam05616 0 0 0 2 1 17 16 67 28

pfam05631 0 0 0 1 7 3 2 2 2

pfam05633 0 0 1 0 0 1 4 1 5

pfam05640 0 0 0 0 1 1 1 5 3

pfam05645 0 0 0 2 0 1 1 1 1

pfam05648 0 0 0 0 0 1 1 4 4

pfam05679 0 0 0 2 2 1 2 10 8

pfam05705 0 0 0 1 0 2 4 1 1

pfam05721 0 0 0 0 0 6 4 5 4

pfam05724 0 1 0 0 0 2 3 1 1

pfam05742 0 0 0 2 1 2 2 1 2

pfam05752 0 1 0 1 0 2 1 8 2

pfam05760 0 0 0 1 0 3 3 17 7

pfam05762 0 0 0 1 1 1 1 3 2

pfam05816 0 0 1 1 3 1 1 13 8

pfam05818 0 0 0 1 0 6 2 16 7

pfam05837 0 0 1 0 0 2 1 1 1

pfam05875 0 0 1 1 0 3 1 3 3

pfam05879 0 2 7 0 0 2 3 5 5

pfam05934 0 1 2 0 2 1 2 14 6

pfam05977 0 1 2 2 3 1 3 4 4

pfam05978 0 1 1 1 2 31 17 10 3

pfam05986 0 0 0 1 2 1 2 29 22

pfam05990 0 0 0 0 0 3 2 1 1

pfam05995 0 1 1 0 1 3 1 1 1

pfam06009 0 0 0 2 1 1 3 12 4

pfam06017 0 0 0 1 1 2 2 12 6

pfam06052 0 0 0 0 0 1 1 1 1

pfam06074 0 0 0 0 0 3 1 6 6

pfam06079 0 0 0 1 1 2 6 3 1

pfam06080 0 0 0 1 0 1 1 5 1

pfam06083 0 0 0 1 1 1 3 7 6

pfam06088 0 0 0 0 0 3 1 1 2

pfam06094 0 0 0 1 0 4 1 5 2

pfam06119 0 0 0 3 7 3 4 7 5

pfam06140 0 0 0 0 0 1 1 13 5

pfam06179 0 1 1 1 2 1 1 2 1

pfam06188 0 1 2 0 3 5 1 17 7

pfam06217 0 0 0 1 1 7 8 6 12

pfam06236 0 0 0 0 1 1 1 1 1

pfam06278 0 0 0 1 0 1 2 9 2

pfam06342 0 0 0 1 0 2 7 3 1

pfam06372 0 1 1 1 1 1 1 1 1

pfam06388 0 0 0 1 0 1 1 2 2

pfam06390 0 0 0 0 4 3 6 19 3

pfam06401 0 0 0 1 0 2 1 2 3

pfam06403 0 0 0 0 1 2 1 3 3

pfam06421 0 0 0 1 0 1 1 1 1

pfam06441 0 0 0 1 1 1 2 2 1

pfam06463 0 1 1 0 1 1 2 2 2

pfam06472 0 0 0 2 1 5 5 5 4

pfam06513 0 0 0 0 1 3 1 2 2

pfam06525 0 2 1 3 3 1 4 2 1

pfam06548 0 1 3 2 0 2 5 11 10

pfam06550 0 0 0 1 1 1 1 3 3

pfam06553 0 1 0 0 0 1 1 2 3

pfam06566 0 0 1 3 1 4 7 44 17

pfam06625 0 0 0 0 1 2 2 22 6

pfam06628 0 0 0 0 0 1 3 1 1

pfam06677 0 1 1 1 1 1 1 1 1

pfam06679 0 0 0 1 2 3 1 12 5


pfam06687 0 0 0 2 2 3 1 2 1

pfam06702 0 0 0 1 2 1 1 4 4

pfam06747 0 0 0 3 4 1 5 8 6

pfam06825 0 0 0 1 1 1 1 2 1

pfam06838 0 0 1 1 0 2 3 1 2

pfam06842 0 1 1 0 1 1 1 2 1

pfam06898 0 0 0 0 0 5 1 3 1

pfam06905 0 0 0 0 1 1 1 4 1

pfam06911 0 0 0 1 1 1 1 4 1

pfam06936 0 2 4 1 2 3 7 13 8

pfam06951 0 0 0 0 1 1 2 2 2

pfam06963 0 0 0 1 0 7 3 1 1

pfam07000 0 1 1 1 0 1 1 2 1

pfam07021 0 0 0 2 1 1 3 1 1

pfam07035 0 0 1 1 1 1 1 1 1

pfam07062 0 0 0 6 3 7 9 1 2

pfam07064 0 1 1 1 1 1 1 3 1

pfam07083 0 0 3 0 0 2 2 4 4

pfam07139 0 0 0 1 0 1 1 6 4

pfam07162 0 3 3 3 4 1 3 4 3

pfam07177 0 1 1 1 2 5 1 5 5

pfam07217 0 1 0 0 0 1 1 1 1

pfam07246 0 0 0 1 0 1 2 1 1

pfam07258 0 0 0 3 0 3 2 21 10

pfam07382 0 0 1 0 2 5 2 7 4

pfam07404 0 0 0 0 2 1 1 2 1

pfam07407 0 0 0 0 0 1 2 7 2

pfam07542 0 0 1 1 1 1 1 1 1

pfam07569 0 0 1 1 2 1 1 1 1

pfam07654 0 1 1 1 4 3 2 140 66

pfam07684 0 0 1 1 1 3 2 4 4

pfam07693 0 2 0 1 2 1 2 3 3

pfam07700 0 7 6 1 0 9 7 8 4

pfam07731 0 0 0 0 0 1 1 6 5

pfam07741 0 1 1 1 1 1 1 6 3

pfam07757 0 1 1 1 1 1 1 1 1

pfam07810 0 0 0 0 1 2 2 13 8

pfam07959 0 0 0 0 0 1 1 3 1

pfam07964 0 3 4 0 3 5 7 7 5

pfam07965 0 0 0 1 1 1 1 12 6

pfam07966 0 0 2 0 0 1 3 9 8

pfam07978 0 1 0 0 1 1 1 6 4

pfam07984 0 3 2 1 1 2 2 5 4

pfam07994 0 0 0 0 0 1 1 3 1

pfam07996 0 0 0 0 2 3 2 17 2

pfam08022 0 0 0 1 1 1 2 13 6

pfam08038 0 0 0 1 0 1 1 1 1

pfam08075 0 0 0 1 1 1 1 6 8

pfam08146 0 0 0 1 0 1 1 1 1

pfam08158 0 1 1 1 1 1 1 1 1

pfam08159 0 0 0 1 3 1 1 2 2

pfam08164 0 0 1 1 1 1 1 1 1

pfam08170 0 1 1 1 1 1 1 3 1

pfam08357 0 0 0 1 2 2 2 15 5

pfam08374 0 0 0 0 0 1 1 24 10

pfam08395 0 0 0 0 0 5 6 3 4

pfam08454 0 2 2 2 4 2 2 9 4

pfam08493 0 0 0 0 0 2 2 8 2

pfam08496 0 4 4 2 3 50 24 42 33

pfam08557 0 1 2 1 1 2 2 2 1

pfam08573 0 0 0 1 0 1 1 2 2

pfam08574 0 2 0 1 1 2 1 1 1

pfam08617 0 1 0 1 1 1 1 1 1

pfam08626 0 1 1 1 1 1 2 2 1


pfam08652 0 0 0 1 0 3 5 1 1

pfam08743 0 0 0 1 1 1 1 3 1

pfam08806 0 1 0 1 0 1 1 2 2

pfam08913 0 1 1 1 2 1 1 2 2

pfam09262 0 0 0 1 0 1 1 1 1

pfam09298 0 0 0 0 0 1 1 1 1

pfam09422 0 0 0 0 0 4 3 14 5

pfam09446 0 0 0 1 0 2 1 1 2

pfam09468 0 1 2 2 4 30 9 16 15

pfam09494 0 0 0 0 1 2 3 2 4

pfam09528 0 1 4 2 4 14 13 31 16

pfam09579 0 0 0 0 1 1 2 23 10

pfam09581 0 0 0 1 0 9 2 1 1

pfam09599 0 0 0 0 0 1 1 2 3

pfam09607 0 0 0 0 0 1 2 1 1

pfam09739 0 1 1 1 2 1 1 2 2

pfam09740 0 0 2 1 0 1 1 1 1

pfam09741 0 1 1 1 1 1 1 2 1

pfam09746 0 3 2 2 1 1 1 2 1

pfam09757 0 0 1 1 0 2 1 3 1

pfam09759 0 0 0 1 1 1 1 6 2

pfam09762 0 0 0 1 0 1 3 1 1

pfam09793 0 1 2 1 1 1 1 1 1

pfam09798 0 0 0 1 2 12 8 33 18

pfam09799 0 0 2 0 2 1 1 6 2

pfam09803 0 0 0 0 0 1 1 1 1

pfam09809 0 0 1 1 2 1 1 1 1

pfam09817 0 0 0 1 0 1 1 1 1

pfam09847 0 1 0 0 0 2 1 1 1

pfam10046 0 0 2 2 0 2 2 7 4

pfam10099 0 0 1 1 3 2 2 4 2

pfam10149 0 0 1 1 0 1 1 3 1

pfam10153 0 0 1 1 0 2 1 9 4

pfam10157 0 1 1 1 1 1 1 1 1

pfam10158 0 0 0 1 1 1 1 1 1

pfam10166 0 0 0 2 0 1 2 1 2

pfam10177 0 0 0 1 1 1 1 4 2

pfam10179 0 0 0 0 1 1 1 1 1

pfam10184 0 0 0 1 1 1 1 3 1

pfam10185 0 0 0 2 2 1 1 1 1

pfam10188 0 0 0 0 1 1 1 3 1

pfam10195 0 0 0 0 1 1 1 3 2

pfam10203 0 0 0 1 0 1 1 1 1

pfam10204 0 0 0 0 1 1 1 2 2

pfam10205 0 0 0 2 1 1 1 4 3

pfam10223 0 0 0 0 1 1 1 2 2

pfam10233 0 1 1 1 0 1 1 4 1

pfam10237 0 0 0 2 3 2 2 2 2

pfam10248 0 0 0 1 0 1 1 7 2

pfam10260 0 1 1 0 0 1 1 1 1

pfam10266 0 0 0 3 0 2 2 1 2

pfam10267 0 1 3 3 1 5 1 27 14

pfam10366 0 0 2 0 1 1 1 3 2

pfam10368 0 0 1 1 5 17 7 31 28

pfam10376 0 0 1 2 0 1 1 4 2

pfam10415 0 1 1 1 1 1 1 1 1

pfam10456 0 1 1 1 4 1 1 6 3

pfam10493 0 0 0 1 0 1 1 1 1

pfam10504 0 0 1 0 0 1 1 1 1

pfam10515 0 0 0 1 2 1 1 16 3

pfam10520 0 0 0 1 0 1 1 3 1

pfam10541 0 0 0 1 0 1 1 8 2

pfam10558 0 0 0 1 0 2 1 2 1

pfam10573 0 0 0 1 0 1 1 1 1


pfam10579 0 0 0 1 0 1 1 2 1

pfam10595 0 3 2 4 6 20 9 38 17

pfam10639 0 0 0 0 0 1 1 1 1

pfam10669 0 0 0 0 0 1 1 1 2

pfam11018 0 0 1 0 1 12 4 14 7

pfam11162 0 4 1 0 1 1 1 12 6

pfam11208 0 4 2 1 2 14 5 20 18

pfam11241 0 1 5 1 2 6 3 3 1

pfam11244 0 1 0 1 5 4 5 13 3

pfam11461 0 2 2 1 1 1 1 3 3

pfam11521 0 0 1 1 2 1 1 1 2

pfam11527 0 4 1 0 1 1 1 2 2

pfam11538 0 1 1 0 0 1 1 3 1

pfam11562 0 0 0 1 0 2 2 5 1

pfam11648 0 0 0 1 2 4 2 3 3

pfam11679 0 0 0 0 2 6 3 7 2

pfam11722 0 0 1 1 0 1 1 1 1

pfam11879 0 0 0 1 0 1 1 4 3

pfam11928 0 3 0 0 1 2 3 15 6

pfam12003 0 0 0 2 2 1 2 16 11

pfam12068 0 0 0 1 0 1 1 5 2

pfam12127 0 0 0 0 0 5 1 1 1

pfam12146 0 0 0 1 2 5 2 10 6

pfam12202 0 0 0 1 2 2 1 10 6

pfam12211 0 0 0 0 1 5 3 1 2

pfam12260 0 0 0 1 1 2 1 3 4

pfam12333 0 1 1 1 1 1 1 2 1

pfam12361 0 0 0 0 2 2 3 1 2

pfam12397 0 0 0 1 0 1 1 1 1

pfam12406 0 0 0 0 0 1 3 1 1

pfam12413 0 0 0 0 0 1 1 3 3

pfam12422 0 0 0 1 0 1 1 1 1

pfam12484 0 1 0 0 1 7 1 13 4

pfam12513 0 0 0 1 1 1 1 1 1

pfam12578 0 0 0 1 1 1 1 4 4

pfam12584 0 0 0 1 0 2 2 1 1

pfam12685 0 0 0 0 4 1 1 6 1

pfam12720 0 0 0 0 0 2 2 2 1

pfam12729 0 0 1 1 1 4 3 7 5

pfam12740 0 0 0 1 1 3 2 4 3

pfam12745 0 0 0 0 0 1 1 3 4

pfam12764 0 0 0 0 0 5 3 5 3

pfam12815 0 1 2 3 4 2 3 7 4

pfam12923 0 1 4 3 2 10 8 8 9

pfam12924 0 0 1 1 1 1 1 15 3

pfam12928 0 1 1 0 1 1 1 1 1

pfam12932 0 0 0 2 1 1 2 2 2

pfam12941 0 0 0 0 1 2 2 3 1

pfam12971 0 0 0 0 1 2 1 1 1

pfam12972 0 0 0 0 1 2 1 1 2


Supplementary Table 17. Gene distribution in KEGG Pathway

Pathway E. granulosus S. japonicum S. mansoni B. malayi T. spiralis C. elegans P. pacificus

KOs Genes KOs Genes KOs Genes KOs Genes KOs Genes KOs Genes KOs Genes

Cellular Processes 331 1913 329 1852 354 2011 351 1972 312 1854 347 1907 316 1744

Cell Communication 97 1097 94 1045 102 1152 94 1104 88 1062 82 1022 75 935

Cell Growth and Death 105 814 103 821 110 851 108 810 97 742 95 756 85 645

Cell Motility 52 620 47 541 53 627 48 584 49 560 38 549 38 473

Transport and Catabolism 145 530 144 476 156 570 163 551 139 543 186 591 169 583

Environmental Information Processing 241 1606 215 1491 252 1638 220 1558 231 1549 203 1487 194 1355

Membrane Transport 14 21 13 20 15 23 8 14 9 14 11 18 11 18

Signal Transduction 199 1487 174 1361 201 1488 188 1462 193 1433 163 1369 149 1219

Signaling Molecules and Interaction 38 163 36 159 46 185 31 139 39 159 37 158 40 159

Genetic Information Processing 689 1273 694 1230 731 1344 739 1355 650 1211 726 1343 605 1140

Folding, Sorting and Degradation 238 498 241 478 246 508 257 536 214 457 254 536 222 480

Replication and Repair 84 215 84 211 90 227 88 228 89 226 82 214 64 181

Transcription 145 279 144 255 149 284 155 294 134 258 153 298 128 246

Translation 260 388 262 383 283 422 280 411 249 373 279 410 225 333

Metabolism 500 1425 507 1400 550 1535 546 1580 504 1457 634 1860 610 1751

Amino Acid Metabolism 64 211 76 242 84 272 83 273 93 316 130 441 136 429

Biosynthesis of Other Secondary Metabolites 8 54 12 82 11 68 14 78 10 70 20 110 24 114

Carbohydrate Metabolism 115 453 112 453 126 500 117 487 125 493 143 593 134 561

Energy Metabolism 99 433 99 436 112 470 122 518 101 446 148 613 118 488

Glycan Biosynthesis and Metabolism 73 123 77 131 81 142 79 145 71 141 74 143 65 128

Lipid Metabolism 72 212 73 189 77 232 79 236 75 258 99 329 109 349

Metabolism of Cofactors and Vitamins 58 89 61 103 62 100 54 123 51 109 67 159 69 162

Metabolism of Other Amino Acids 33 114 30 97 32 120 38 139 40 151 52 218 53 219

Metabolism of Terpenoids and Polyketides 17 65 18 71 18 75 19 66 16 71 19 84 18 79

Nucleotide Metabolism 83 276 77 243 85 277 87 283 85 270 93 304 82 286


Xenobiotics Biodegradation and Metabolism 29 118 23 102 21 92 26 129 27 146 44 208 47 211

Organismal Systems 349 2150 338 2054 373 2225 337 2152 334 2057 338 2134 306 1958

Circulatory System 36 453 38 498 40 500 36 476 27 434 42 505 29 375

Development 44 648 41 548 47 649 47 674 44 612 37 625 34 547

Digestive System 56 469 58 517 62 561 48 474 59 517 55 509 53 522

Endocrine System 102 1086 98 1048 109 1132 108 1128 109 1081 101 1100 94 983

Environmental Adaptation 17 160 14 146 16 149 15 159 15 158 14 154 13 126

Excretory System 50 499 53 529 52 524 53 552 51 516 51 550 50 503

Immune System 112 1179 102 1025 115 1153 102 1146 104 1076 102 1114 95 1024

Nervous System 107 1146 111 1129 117 1198 109 1175 102 1116 113 1183 102 1071

Sensory System 18 177 15 212 16 188 14 218 14 206 16 216 18 249


Supplementary Table 18. KEGG pathway enrichment in E. granulosus

Pathway E. granulosus lost KOs All KOs in the pathway P-value FDR

Peroxisome [PATH:ko04146] 39 48 1.03E-18 2.68E-16

Valine, leucine and isoleucine degradation [PATH:ko00280] 25 34 6.23E-11 8.06E-09

Fatty acid metabolism [PATH:ko00071] 17 22 9.54E-09 8.24E-07

Retinol metabolism [PATH:ko00830] 10 13 5.05E-06 3.27E-04

Glycine, serine and threonine metabolism [PATH:ko00260] 15 24 7.03E-06 3.37E-04

Phenylpropanoid biosynthesis [PATH:ko00940] 7 8 8.46E-06 3.37E-04

Methane metabolism [PATH:ko00680] 14 22 9.12E-06 3.37E-04

Metabolism of xenobiotics by cytochrome P450

[PATH:ko00980] 8 10 1.55E-05 5.01E-04

Phenylalanine metabolism [PATH:ko00360] 11 17 4.50E-05 1.30E-03

Drug metabolism - cytochrome P450 [PATH:ko00982] 7 9 6.05E-05 1.57E-03

Tryptophan metabolism [PATH:ko00380] 15 28 1.11E-04 2.62E-03

Tyrosine metabolism [PATH:ko00350] 12 21 1.66E-04 3.30E-03

Styrene degradation [PATH:ko00643] 5 6 1.58E-04 3.30E-03

Pathway Class

Amino Acid Metabolism 97 177 1.21E-21 4.47E-20

Lipid Metabolism 60 145 1.98E-07 3.66E-06

Biosynthesis of Other Secondary Metabolites 19 31 1.04E-06 1.28E-05

Xenobiotics Biodegradation and Metabolism 30 61 2.10E-06 1.94E-05

Energy Metabolism 58 166 1.61E-04 1.19E-03

Metabolism of Other Amino Acids 27 65 2.84E-04 1.75E-03

Metabolism of Cofactors and Vitamins 38 106 1.00E-03 5.30E-03

Transport and Catabolism 74 239 1.71E-03 7.92E-03

A total of 2,671 KOs involved in different pathways were found in the seven worm taxa (E. granulosus, S. mansoni, S. japonicum, T. spiralis, B. malayi, C. elgans

and P. pacificus). Compared with the other six worms, E. granulosus lost 623 KOs, which means these KOs was absent in E. granulosus while exist in at least one

of the six taxas.


Supplementary Table 19. Proteases and their expression in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC) and

hydatid cyst membrane (Cyst) of E. granulosus

Gene ID Gene description* Localization

Adult vs

Onc

Adult vs

PSC

Adult vs

Cyst

Onc vs

PSC

Onc vs

Cyst

PSC vs

Cyst

EG_05345 Proteasome subunit beta type-1-A Extracellular Down Up - Up Up -

EG_01826 Proteasome subunit beta type-6 Intracellular Down - - Up Up -

EG_02081 Abhydrolase domain-containing protein 8 Intracellular Down - - Up Up -

EG_05810 Proteasome subunit beta type-7 Intracellular Down - - Up Up -

EG_02929 Putative aminopeptidase W07G4.4 Intracellular Up Up Up - - -

EG_07638 Cathepsin L Intracellular Up Up Up - - -

EG_08123 Cathepsin L Intracellular Up Up Up - - -

EG_02374 Carboxypeptidase D Extracellular - Down - Dwon - Up

EG_00303 Presenilin homolog Transmembrane - Down - Dwon - Up

EG_00916 Proprotein convertase subtilisin/kexin type 5 Transmembrane - Down - Dwon - Up

EG_03437 Endothelin-converting enzyme 1 Transmembrane - Down - Dwon - Up

EG_07480 Dipeptidyl aminopeptidase-like protein 6 Transmembrane - Down - Dwon - Up

EG_08001 Neurogenic locus notch protein homolog Transmembrane - Down - Dwon - Up

EG_03548 Probable ubiquitin carboxyl-terminal hydrolase FAF-X Intracellular - Down - Dwon - Up

EG_04722 subfamily M3A non-peptidase homologue (M03 family) Intracellular - Down - Dwon - Up

EG_05548 Insulin-degrading enzyme Intracellular - Down - Dwon - Up

EG_06617 Disintegrin and metalloproteinase domain-containing protein 11 Intracellular - Down - Dwon - Up

EG_07486 Puromycin-sensitive aminopeptidase Intracellular - - Down Dwon Down Down

EG_02699 Cathepsin L1 Extracellular - - Down - Down Down

EG_02056 Dihydropyrimidinase Intracellular - - Down - Down Down

EG_07358 Proteasome subunit beta type-5 Intracellular - - Down - Down Down

EG_08869 Glucosamine--fructose-6-phosphate aminotransferase [isomerizing] 1 Intracellular - - Down - Down Down

EG_06845 Paraplegin Transmembrane Down Down Down - - -

EG_05416 Lon protease homolog, mitochondrial Intracellular Down Down Down - - -

EG_05037 Proteasome subunit beta type-3 Intracellular Down - - - - -

EG_00902 Calpain-7 Intracellular Up Down - Dwon Down Up

EG_04862 Tryptase Transmembrane Up Up - Dwon Down Down

EG_07383 Protein DJ-1 Extracellular Up Up - - Down Down

EG_04209 Proteasome subunit alpha type-3 Intracellular Up Up - - Down Down


EG_00222 Cathepsin B Intracellular Up - Down Dwon Down -

EG_01660 Xaa-Pro aminopeptidase Extracellular Up - Up Dwon - Up

EG_00666 Tubulin alpha-1C chain Extracellular Up - Up - - -

EG_06280 Enteropeptidase Extracellular Up - - Dwon Down -

EG_02960 Dipeptidyl peptidase Intracellular Up - - Dwon Down -

EG_04488 Calpain Intracellular Up - - Dwon Down -

EG_04427 Prolyl endopeptidase Intracellular Up - - Dwon - Up

EG_02437 Protein BAT5 Extracellular Up - - Dwon - -

EG_04745 Caspase-3 Intracellular Up - - - Down Down

EG_01665 Proteasome subunit alpha type-4 Intracellular Up - - - Down -

EG_04365 Aminoacylase-1 Intracellular Up - - - Down -

EG_03340 AFG3-like protein Transmembrane - Down Down Dwon Down -

EG_00412 Calpain-A Intracellular - Down Down Dwon Down -

EG_07173 Lysosomal aspartic protease Intracellular - Down Down Dwon Down -

EG_05338 Calpain-3 Intracellular - Down Up Dwon - Up

EG_06708 Ubiquitin carboxyl-terminal hydrolase Intracellular - Down - Dwon Down -

EG_00600 Endoplasmic reticulum metallopeptidase Transmembrane - Down - Dwon - -

EG_00859 Ubiquitin carboxyl-terminal hydrolase Intracellular - Down - Dwon - -

EG_05359 Ubiquitin carboxyl-terminal hydrolase Intracellular - Down - Dwon - -

EG_06479 A disintegrin and metalloproteinase with thrombospondin motifs 20 Intracellular - Down - - - Up

EG_08035 Calpain-B Intracellular - Down - - - Up

EG_08923 Tripeptidyl-peptidase Intracellular - Down - - - Up

EG_01961 Tolloid-like protein Intracellular - Down - - - -

EG_06555 Presequence protease, mitochondrial Intracellular - Down - - - -

EG_08478 Probable ubiquitin carboxyl-terminal hydrolase FAF-X Intracellular - Down - - - -

EG_05679 Putative testis serine protease Extracellular - Up Up - - -

EG_09692 N(4)-(Beta-N-acetylglucosaminyl)-L-asparaginase (Fragment) Extracellular - Up Up - - -

EG_08012 Signal peptidase complex catalytic subunit SEC11C Transmembrane - Up - Up - Down

EG_06724 Proteasome subunit alpha type-6 Intracellular - Up - Up - Down

EG_01675 Signal peptidase complex subunit 3 Transmembrane - Up - Up - -

EG_02941 Ubiquitin carboxyl-terminal hydrolase isozyme L3 Intracellular - Up - Up - -

EG_01268 Signal peptidase complex subunit 1 Transmembrane - Up - - - Down

EG_01125 Proteasome subunit beta type-2 Intracellular - Up - - - Down

EG_06903 Probable mitochondrial-processing peptidase subunit alpha-1 Intracellular - - Down Dwon Down -

EG_08303 Protein NDRG1-A Intracellular - - Down Dwon Down -


EG_04322 Aspartyl aminopeptidase Transmembrane - - Down - Down -

EG_05901 Protein bicaudal D homolog Intracellular - - Down - Down -

EG_09023 FACT complex subunit spt16 Intracellular - - Down - Down -

EG_01576 Putative aminopeptidase W07G4.4 Extracellular - - Down - - Down

EG_04126 Mitochondrial-processing peptidase subunit beta Intracellular - - Down - - -

EG_04224 Bifunctional protein NCOAT Intracellular - - Down - - -

EG_04682 26S proteasome non-ATPase regulatory subunit 7 Intracellular - - Down - - -

EG_07978 Puromycin-sensitive aminopeptidase Intracellular - - Down - - -

EG_06860 Ubiquitin carboxyl-terminal hydrolase 16 Intracellular - - Up Dwon - Up

EG_06954 Ubiquitin carboxyl-terminal hydrolase 15 Intracellular - - Up Dwon - Up

EG_10419 Aminopeptidase N Transmembrane - - Up - - Up

EG_01426 Ubiquitin carboxyl-terminal hydrolase 15 Intracellular - - Up - - -

EG_03654 Abhydrolase domain-containing protein Intracellular - - - Dwon Down -

EG_08435 GMP synthase [glutamine-hydrolyzing] Intracellular - - - Dwon Down -

EG_07187 Ubiquitin carboxyl-terminal hydrolase 43 Intracellular - - - Dwon - Up

EG_01317 Nicalin-1 Intracellular - - - Dwon - -

EG_02952 Lysosomal Pro-X carboxypeptidase Intracellular - - - Dwon - -

EG_03293 Nardilysin Intracellular - - - Dwon - -

EG_00624 Probable signal peptidase complex subunit 2 Transmembrane - - - Up Up -

EG_09231 Ubiquitin thioesterase OTUB1 Intracellular - - - Up - Down

EG_01087 Cathepsin L Extracellular - - - Up - -

EG_06081 E3 ubiquitin-protein ligase RNF167 Transmembrane - - - - Down -

EG_02555 Leukotriene A-4 hydrolase Intracellular - - - - Down -

EG_03294 Nardilysin Intracellular - - - - Down -

EG_04632 Proteasome subunit alpha type-7-like Intracellular - - - - Down -

EG_05841 Mitochondrial-processing peptidase subunit alpha Intracellular - - - - Down -

EG_03528 Proteasome subunit beta type-4 (Fragment) Intracellular - - - - - Down

EG_01442 Leishmanolysin-like peptidase Extracellular - - - - - Up

EG_06738 Protein phosphatase methylesterase 1 Extracellular - - - - - Up

EG_00079 Gamma-glutamyltranspeptidase 1 Intracellular - - - - - Up

EG_05858 Ubiquitin carboxyl-terminal hydrolase 20 Intracellular - - - - - Up

EG_08653 Monoacylglycerol lipase ABHD12 Intracellular - - - - - Up

EG_09342 Ubiquitin carboxyl-terminal hydrolase 2 Intracellular - - - - - Up

EG_00432 N-acetylated-alpha-linked acidic dipeptidase Extracellular - - - - - -

EG_04348 Peptidyl-prolyl cis-trans isomerase E Extracellular - - - - - -


EG_05078 disintegrin and metalloproteinase domain-containing protein 10 [EC:3.4.24.81] Extracellular - - - - - -

EG_05339 Glutaminyl-peptide cyclotransferase-like protein Extracellular - - - - - -

EG_06444 Mitochondrial inner membrane protease subunit 1 Extracellular - - - - - -

EG_08450 Zinc metalloproteinase nas-29 Extracellular - - - - - -

EG_08814 Disco-interacting protein 2 homolog C Extracellular - - - - - -

EG_08973 ubiquitin carboxyl-terminal hydrolase 30 [EC:3.1.2.15] Extracellular - - - - - -

EG_09081 Ufm1-specific protease Extracellular - - - - - -

EG_10121 Lysosomal protective protein Extracellular - - - - - -

EG_10569 Nuclear pore complex protein Nup98 Extracellular - - - - - -

EG_00581 ADAM 17-like protease Transmembrane - - - - - -

EG_01021 Membrane-bound transcription factor site-2 protease Transmembrane - - - - - -

EG_01229 Mitochondrial intermediate peptidase Transmembrane - - - - - -

EG_01276 hypothetical protein Transmembrane - - - - - -

EG_01384 Disintegrin and metalloproteinase domain-containing protein 26A Transmembrane - - - - - -

EG_01487 Neuroligin-3 Transmembrane - - - - - -

EG_01511 Protein YME1 homolog Transmembrane - - - - - -

EG_02082 Signal peptide peptidase-like 2A Transmembrane - - - - - -

EG_02195 Cathepsin L-like proteinase Transmembrane - - - - - -

EG_02245 Presenilins-associated rhomboid-like protein, mitochondrial Transmembrane - - - - - -

EG_03001 CAAX prenyl protease 1 homolog Transmembrane - - - - - -

EG_03398 Putative polypeptide N-acetylgalactosaminyltransferase 10 Transmembrane - - - - - -

EG_03462 Rhomboid family member 1 Transmembrane - - - - - -

EG_05300 Gamma-secretase subunit pen-2 Transmembrane - - - - - -

EG_06269 Minor histocompatibility antigen H13 Transmembrane - - - - - -

EG_06385 Membrane-bound transcription factor site-1 protease Transmembrane - - - - - -

EG_06854 Potassium voltage-gated channel protein Shab Transmembrane - - - - - -

EG_07255 CAAX prenyl protease Transmembrane - - - - - -

EG_08552 Probable O-sialoglycoprotein endopeptidase Transmembrane - - - - - -

EG_08815 Matrix metalloproteinase-25 Transmembrane - - - - - -

EG_09968 Rhomboid-related protein 1 Transmembrane - - - - - -

EG_10235 Carboxypeptidase A2 Transmembrane - - - - - -

EG_00300 Proliferation-associated protein 2G4 Intracellular - - - - - -

EG_00531 Protein DDI1 homolog 2 Intracellular - - - - - -

EG_00543 Furin-like protease 1, isoforms 1/1-X/2 Intracellular - - - - - -

EG_00983 Cytosolic non-specific dipeptidase Intracellular - - - - - -


EG_01277 Methionine aminopeptidase Intracellular - - - - - -

EG_01320 Ubiquitin thioesterase OTU1 Intracellular - - - - - -

EG_01355 Threonine aspartase 1 Intracellular - - - - - -

EG_01372 COP9 signalosome complex subunit 5 Intracellular - - - - - -

EG_01472 Acylamino-acid-releasing enzyme Intracellular - - - - - -

EG_01700 GPI-anchor transamidase Intracellular - - - - - -

EG_02055 Dihydropyrimidinase-related protein 3-A Intracellular - - - - - -

EG_02100 Ubiquitin carboxyl-terminal hydrolase 8 Intracellular - - - - - -

EG_02103 Abhydrolase domain-containing protein FAM108C1 Intracellular - - - - - -

EG_02544 Dipeptidyl peptidase Intracellular - - - - - -

EG_02741 Xaa-Pro dipeptidase Intracellular - - - - - -

EG_02793 U4/U6.U5 tri-snRNP-associated protein Intracellular - - - - - -

EG_03291 Nardilysin Intracellular - - - - - -

EG_03297 Xaa-Pro dipeptidase Intracellular - - - - - -

EG_03485 Ubiquitin carboxyl-terminal hydrolase Intracellular - - - - - -

EG_03486 Proteasome subunit alpha type-5 Intracellular - - - - - -

EG_03587 Josephin-2 Intracellular - - - - - -

EG_03600 Separin Intracellular - - - - - -


EG_03819 Probable cyclin-H Intracellular - - - - - -

EG_03962 Calpain-5 Intracellular - - - - - -

EG_04057 Eukaryotic translation initiation factor 3 subunit H Intracellular - - - - - -

EG_04133 Caspase-2 Intracellular - - - - - -


EG_04298 C-terminal-binding protein Intracellular - - - - - -

EG_04511 STAM-binding protein-like Intracellular - - - - - -

EG_04646 Abhydrolase domain-containing protein Intracellular - - - - - -

EG_04707 Casein kinase I isoform alpha Intracellular - - - - - -

EG_04795 Cysteine protease ATG4B Intracellular - - - - - -

EG_04971 26S proteasome non-ATPase regulatory subunit 14 Intracellular - - - - - -

EG_04987 Putative serine/threonine-protein kinase haspin homolog Intracellular - - - - - -


EG_05067 Cytosolic carboxypeptidase-like protein 5 Intracellular - - - - - -

EG_05077 Disintegrin and metalloproteinase domain-containing protein 10 Intracellular - - - - - -

EG_05096 Ubiquitin thioesterase zranb1-A Intracellular - - - - - -


EG_05103 Ubiquitin thioesterase zranb1-A Intracellular - - - - - -

EG_05227 COP9 signalosome complex subunit 6 Intracellular - - - - - -

EG_05263 Actin-related protein 10 Intracellular - - - - - -

EG_05319 Glutathione gamma-glutamylcysteinyltransferase 3 Intracellular - - - - - -

EG_05556 Proteasome subunit alpha type-2 Intracellular - - - - - -

EG_05831 Sentrin-specific protease Intracellular - - - - - -

EG_05872 Melanotransferrin Intracellular - - - - - -

EG_05950 Autophagy-related protein Intracellular - - - - - -

EG_06059 Alpha-parvin Intracellular - - - - - -

EG_06060 Putative ATP-dependent Clp protease proteolytic subunit, mitochondrial Intracellular - - - - - -

EG_06292 PC3-like endoprotease variant B Intracellular - - - - - -

EG_06293 hypothetical protein Intracellular - - - - - -

EG_06483 Transmembrane protease serine Intracellular - - - - - -

EG_06624 Sentrin-specific protease Intracellular - - - - - -

EG_06739 Probable complex I intermediate-associated protein Intracellular - - - - - -


EG_07107 Cytosolic carboxypeptidase 2 Intracellular - - - - - -

EG_07149 Probable O-sialoglycoprotein endopeptidase Intracellular - - - - - -

EG_07313 Transposon Ty3-I Gag-Pol polyprotein Intracellular - - - - - -

EG_07483 Actin-related protein 3B Intracellular - - - - - -

EG_07730 Cytosol aminopeptidase Intracellular - - - - - -

EG_07830 Activating transcription factor 7-interacting protein 1 Intracellular - - - - - -

EG_07984 Putative aminopeptidase W07G4.4 Intracellular - - - - - -

EG_08071 Protease-associated domain-containing protein of 21 kDa Intracellular - - - - - -

EG_08121 Methionine aminopeptidase 1D, mitochondrial Intracellular - - - - - -

EG_08132 Cysteine protease ATG4C Intracellular - - - - - -

EG_08149 Transcription initiation factor TFIID subunit Intracellular - - - - - -

EG_08416 Desert hedgehog protein Intracellular - - - - - -

EG_08494 Ubiquitin carboxyl-terminal hydrolase isozyme L5 Intracellular - - - - - -

EG_08651 Pyroglutamyl-peptidase Intracellular - - - - - -

EG_08679 Cytosolic carboxypeptidase Intracellular - - - - - -

EG_08701 OTU domain-containing protein Intracellular - - - - - -

EG_08746 Neuroendocrine convertase Intracellular - - - - - -




EG_09110 Methionine aminopeptidase Intracellular - - - - - -


EG_09510 Ataxin-3 Intracellular - - - - - -


EG_09918 Eukaryotic translation initiation factor 3 subunit F Intracellular - - - - - -

EG_10155 Probable ubiquitin carboxyl-terminal hydrolase 3 Intracellular - - - - - -

EG_10264 Dipeptidyl peptidase 9 Intracellular - - - - - -


EG_10570 Probable Xaa-Pro aminopeptidase 3 Intracellular - - - - - -

EG_10634 Puromycin-sensitive aminopeptidase Intracellular - - - - - -




EG_11281 Carboxypeptidase A1 Intracellular - - - - - -

EG_11299 Carboxypeptidase A2 Intracellular - - - - - -

Genes with fold-changes greater or less than 2 were considered as genes up- or down-regulated in one stage compared with the other stage with P<0.00001.

Genes with no significant change are labeled with '-'.

*Proteases were identified using BLASTP against the MEROPS database (http://merops.sanger.ac.uk/) with Evalue < 1E-5


Supplementary Table 20. Protein transporters and their expression in adult worms (Adult), oncospheres (Onc), protoscoleces

(PSC) and hydatid cyst membrane (Cyst) of E. granulosus

Gene ID Gene description* IPR No.

Adult

vs

Onc

Adult

vs

PSC

Adult

vs

Cyst

Onc

vs

PSC

Onc

vs

Cyst

PSC

vs

Cyst

EG_00839 Catenin beta IPR000225 - Down Down Down Down -

EG_03928 Protein transport protein Sec23A IPR006895 - Down Down Down Down -

EG_04104 Clathrin heavy chain IPR000547 - Down Down Down Down -

EG_05606 Exportin-2 IPR001494 - Down Down Down Down -

EG_07111 Coatomer subunit beta' IPR001680 - Down Down Down Down -

EG_02349 Coatomer subunit alpha IPR001680 - - Down - Down -

EG_03491 Protein transport protein Sec61 subunit gamma IPR001901 Up Up Up - - Down

EG_04147 Probable ATP-dependent RNA helicase DDX6 IPR000547 Up Up Up - - -

EG_06713 Probable 39S ribosomal protein L45, mitochondrial IPR007379 Up Up Up - - -

EG_07612 Mitochondrial import inner membrane translocase subunit Tim13 IPR004217 Up Up Up - - -

EG_07734 Charged multivesicular body protein 4a IPR005024 Up - Up - - -

EG_07940 Charged multivesicular body protein 1b IPR005024 Up Up - - Down Down

EG_06040 AP-2 complex subunit beta IPR002553 Up Down - Down Down Up

EG_01017 Charged multivesicular body protein 1a IPR005024 Up Up - - Down -

EG_00524 Charged multivesicular body protein 2a IPR005024 Up - - Down Down -

EG_07655 Hepatocyte growth factor-regulated tyrosine kinase substrate IPR000306 Up - - - Down -

EG_08018 AP-3 complex subunit beta-1 IPR002553 - Down - Down Down -

EG_10065 Coatomer subunit delta IPR008968 - - - Down Down -

EG_00760 Secretory carrier-associated membrane protein IPR007273 - - - - Down -

EG_04197 Coatomer subunit gamma-2 IPR002553 - - - - Down -

EG_10420 Charged multivesicular body protein 5 IPR005024 - - - - Down -

EG_03879 Import inner membrane translocase subunit Tim10 IPR004217 - Up - Up Up -

EG_08134 Import receptor subunit TOM20 homolog IPR002056 Down - - Up - Down

EG_05791 Importin subunit alpha-2 IPR000225 - Up - Up - Down

EG_00360 Exocyst complex component IPR007191 - Down - Down - Up


EG_01111 Importin subunit alpha-3 IPR000225 - Down - Down - Up

EG_02328 Transportin-1 IPR001494 - Down - Down - Up

EG_06089 Protein stoned-B IPR008968 - Down - Down - Up

EG_07376 GPI inositol-deacylase IPR012908 - Down - Down - Up

EG_01439 Armadillo repeat-containing protein IPR000225 - - - - - Up

EG_07918 Protein transport protein Sec24B IPR006896 - - - - - Up

EG_00201 Protein transport protein Sec61 subunit alpha-like IPR002208 Up - - - - -

EG_00068 Importin subunit beta-1 IPR001494 - Down - Down - -

EG_00330 Coatomer subunit beta IPR001650 - Down - Down - -

EG_04422 AP-1 complex subunit gamma-1 IPR002553 - Down - Down - -

EG_06449 Mitochondrial import inner membrane translocase subunit tim-8 IPR004217 - Up - - - -

EG_00356 Signal recognition particle receptor subunit alpha homolog IPR000897 - - - Down - -

EG_05793 Conserved oligomeric Golgi complex subunit 3 IPR006671 - - - Down - -

EG_06448 AP-2 complex subunit alpha-2 IPR002553 - - - Down - -

EG_00163 Transmembrane protein 104 homolog IPR013057 - - - - - -

EG_00449 Beta-soluble NSF attachment protein IPR000744 - - - - - -

EG_00811 Vacuolar protein sorting-associated protein 16 homolog IPR006925 - - - - - -

EG_01086 Vesicle transport through interaction with t-SNAREs homolog 1A IPR007705 - - - - - -

EG_01595 Rab effector Noc2 IPR000306 - - - - - -

EG_01905 Charged multivesicular body protein IPR005024 - - - - - -

EG_01948 Secretory carrier-associated membrane protein IPR007273 - - - - - -

EG_02392 AP-2 complex subunit mu-1 IPR008968 - - - - - -

EG_02654 Proton-coupled amino acid transporter IPR013057 - - - - - -

EG_02958 Mitochondrial import inner membrane translocase subunit Tim16 IPR005341 - - - - - -

EG_03130 Mitochondrial import inner membrane translocase subunit TIM44 IPR004506 - - - - - -

EG_03284 Putative sodium-coupled neutral amino acid transporter IPR013057 - - - - - -


EG_03563 General vesicular transport factor p115 IPR006953 - - - - - -

EG_05697 Mitochondrial import receptor subunit TOM22 homolog IPR005683 - - - - - -

EG_06267 AP-3 complex subunit delta IPR002553 - - - - - -

EG_06414 Protein transport protein Sec24C IPR006895 - - - - - -


EG_06816 ADP-ribosylation factor-binding protein GGA1 IPR002014 - - - - - -

EG_06826 clathrin light chain IPR000996 - - - - - -

EG_06862 TOM1-like protein IPR002014 - - - - - -

EG_07826 Tumor susceptibility gene 101 protein IPR008883 - - - - - -


EG_08381 Mitochondrial import inner membrane translocase subunit tim9 IPR004217 - - - - - -

EG_08687 B-cell receptor-associated protein IPR008417 - - - - - -

EG_08836 Charged multivesicular body protein 7 IPR005024 - - - - - -

EG_08886 Charged multivesicular body protein 6 IPR005024 - - - - - -

EG_09511 Charged multivesicular body protein 2b IPR005024 - - - - - -

EG_10143 Clathrin light chain A IPR000996 - - - - - -

EG_10857 Translocation protein SEC62 IPR004728 - - - - - -

Genes with fold-changes greater or less than 2 were considered as genes up- or down-regulated in one stage compared with the other stage with P<0.00001.

Genes with no significant change are labeled with '-'.

*Protein transproters were identified based on KEGG classification.


Supplementary Table 21. Lipid metabolism and transporters in E. granulosus

Gene ID Gene description* Localization

Fatty acid biosynthesis

EG_09209 acetyl-CoA carboxylase / biotin carboxylase [EC:6.4.1.2 6.3.4.14] Intracellular

EG_04653 Biotin--protein ligase Intracellular

EG_06613 Elongation of very long chain fatty acids protein Transmembrane

EG_07298 Biotin--protein ligase Intracellular

EG_09746 Elongation of very long chain fatty acids protein Transmembrane

EG_01441 [acyl-carrier-protein] S-malonyltransferase [EC:2.3.1.39] Intracellular

EG_01443 3-oxoacyl-[acyl-carrier-protein] synthase II [EC:2.3.1.179] Intracellular

Fatty acid elongation in mitochondria

EG_03347 3-hydroxyacyl-CoA dehydrogenase [EC:1.1.1.35] Transmembrane

EG_03595 enoyl-CoA hydratase [EC:4.2.1.17] Transmembrane

EG_09361 mitochondrial trans-2-enoyl-CoA reductase [EC:1.3.1.38] Intracellular

EG_01013 palmitoyl-protein thioesterase [EC:3.1.2.22] Extracellular

Fatty acid metabolism (Beta oxidation)

EG_02595 acetyl-CoA C-acetyltransferase [EC:2.3.1.9] Intracellular

EG_03347 3-hydroxyacyl-CoA dehydrogenase [EC:1.1.1.35] Transmembrane

EG_03595 enoyl-CoA hydratase [EC:4.2.1.17] Transmembrane

EG_00707 Long-chain-fatty-acid--CoA ligase Intracellular

EG_00218 3-hydroxyacyl-CoA dehydrogenase type-2 Intracellular

EG_08967 Acyl-CoA dehydrogenase family member 9, mitochondrial Extracellular

EG_00708 Long-chain-fatty-acid--CoA ligase Intracellular

EG_02491 Acyl-CoA synthetase family member 4 homolog Extracellular

EG_04702 Tyrocidine synthase Intracellular

EG_08814 Disco-interacting protein 2 homolog C Extracellular

EG_02438 long-chain acyl-CoA synthetase [EC:6.2.1.3] Transmembrane

EG_03656 long-chain acyl-CoA synthetase [EC:6.2.1.3] Intracellular

EG_04798 long-chain acyl-CoA synthetase [EC:6.2.1.3] Intracellular

EG_06760 long-chain acyl-CoA synthetase [EC:6.2.1.3] Transmembrane

EG_03415 aldehyde dehydrogenase (NAD+) [EC:1.2.1.3] Intracellular


Synthesis and degradation of ketone bodies

EG_09386 hydroxymethylglutaryl-CoA synthase [EC:2.3.3.10] Intracellular


Steroid biosynthesis

EG_06785 delta14-sterol reductase [EC:1.3.1.70] Transmembrane

EG_01880 Probable phosphomevalonate kinase Intracellular

EG_03356 Geranylgeranyl pyrophosphate synthase Intracellular

EG_04743 Isopentenyl-diphosphate Delta-isomerase Extracellular

EG_05311 Decaprenyl-diphosphate synthase subunit Intracellular

EG_05510 Mevalonate kinase Intracellular

EG_05723 Farnesyl pyrophosphate synthase Intracellular

EG_09205 Diphosphomevalonate decarboxylase Intracellular

EG_07639 Lipase member M Intracellular

EG_10760 lysosomal acid lipase/cholesteryl ester hydrolase [EC:3.1.1.13] Intracellular

EG_11290 bile salt-stimulated lipase [EC:3.1.1.3 3.1.1.13] Intracellular


EG_03337 sterol O-acyltransferase [EC:2.3.1.26] Transmembrane

Steroid hormone biosynthesis

EG_05002 20alpha-hydroxysteroid dehydrogenase [EC:1.1.1.149] Intracellular

EG_09849 20alpha-hydroxysteroid dehydrogenase [EC:1.1.1.149] Intracellular

EG_04368 3-oxo-5-alpha-steroid 4-dehydrogenase 3 [EC:1.3.99.5] Transmembrane

Glycerolipid metabolism

EG_00508 glycerate kinase [EC:2.7.1.31] Intracellular



EG_00241 aldehyde reductase [EC:1.1.1.21] Intracellular



EG_03866 alcohol dehydrogenase (NADP+) [EC:1.1.1.2] Extracellular

EG_09993 glycerol kinase [EC:2.7.1.30] Intracellular

EG_09159 glycerol-3-phosphate O-acyltransferase 3/4 [EC:2.3.1.15] Transmembrane

EG_01862 lysophosphatidate acyltransferase [EC:2.3.1.51] Transmembrane

EG_01864 lysophosphatidate acyltransferase [EC:2.3.1.51] Intracellular

EG_07790 lysocardiolipin and lysophospholipid acyltransferase [EC:2.3.1.- 2.3.1.51] Transmembrane

EG_07462 lysophospholipid acyltransferase 1/2 [EC:2.3.1.51 2.3.1.-] Transmembrane


EG_02584 lysophospholipid acyltransferase [EC:2.3.1.51 2.3.1.23 2.3.1.-] Transmembrane

EG_09388 phosphatidate phosphatase [EC:3.1.3.4] Transmembrane

EG_00832 diacylglycerol kinase [EC:2.7.1.107] Intracellular


EG_02006 diacylglycerol O-acyltransferase 1 [EC:2.3.1.20 2.3.1.75 2.3.1.76] Transmembrane

EG_01767 2-acylglycerol O-acyltransferase 2-A Transmembrane

EG_01971 Sn1-specific diacylglycerol lipase beta Transmembrane

EG_02833 Lipase, class 3 Transmembrane

EG_11290 bile salt-stimulated lipase [EC:3.1.1.3 3.1.1.13] Intracellular

EG_08025 alpha-galactosidase [EC:3.2.1.22] Transmembrane

Glycerophospholipid metabolism

EG_04665 glycerol-3-phosphate dehydrogenase (NAD+) [EC:1.1.1.8] Intracellular

EG_09089 glycerol-3-phosphate dehydrogenase (NAD(P)+) [EC:1.1.1.94] Extracellular

EG_02161 glycerol-3-phosphate dehydrogenase [EC:1.1.5.3] Transmembrane

EG_09159 glycerol-3-phosphate O-acyltransferase 3/4 [EC:2.3.1.15] Transmembrane

EG_01862 lysophosphatidate acyltransferase [EC:2.3.1.51] Transmembrane

EG_01864 lysophosphatidate acyltransferase [EC:2.3.1.51] Intracellular

EG_07790 lysocardiolipin and lysophospholipid acyltransferase [EC:2.3.1.- 2.3.1.51] Transmembrane







EG_06663 phospholipase D [EC:3.1.4.4] Intracellular

EG_06664 phospholipase D [EC:3.1.4.4] Extracellular

EG_01241 phospholipase A2 [EC:3.1.1.4] Intracellular

EG_10138 lysophosphatidylcholine acyltransferase / lyso-PAF acetyltransferase [EC:2.3.1.23

2.3.1.67] Transmembrane


EG_09212 lysophospholipase III [EC:3.1.1.5] Intracellular

EG_04730 lysophospholipase II [EC:3.1.1.5] Intracellular

EG_04021 lysophospholipid hydrolase [EC:3.1.1.5] Transmembrane

EG_03641 choline O-acetyltransferase [EC:2.3.1.6] Transmembrane

EG_07877 acetylcholinesterase [EC:3.1.1.7] Transmembrane

EG_00847 choline/ethanolamine kinase [EC:2.7.1.32 2.7.1.82] Intracellular

EG_01712 choline-phosphate cytidylyltransferase [EC:2.7.7.15] Intracellular

EG_02510 ethanolaminephosphotransferase [EC:2.7.8.1] Transmembrane


EG_08198 ethanolamine kinase [EC:2.7.1.82] Intracellular

EG_05698 ethanolamine-phosphate cytidylyltransferase [EC:2.7.7.14] Intracellular

EG_07555 phosphatidate cytidylyltransferase [EC:2.7.7.41] Transmembrane

EG_08024 phosphatidylserine synthase 1 [EC:2.7.8.-] Transmembrane

EG_06127 phosphatidylserine decarboxylase [EC:4.1.1.65] Transmembrane

EG_02771 CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase [EC:2.7.8.5] Intracellular

EG_02238 cardiolipin synthase [EC:2.7.8.-] Transmembrane

EG_00135 monolysocardiolipin acyltransferase [EC:2.3.1.-] Intracellular

EG_01049 lysophospholipid acyltransferase 7 [EC:2.3.1.-] Transmembrane

Phosphatidylinositol synthesis

EG_00138 Phosphatidylinositol 4-kinase alpha Intracellular

EG_03783 Phosphatidylinositol 3-kinase catalytic subunit type 3 Intracellular

EG_03896 Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha isoform Intracellular

EG_05933 Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing subunit alpha Intracellular

EG_06619 Phosphatidylinositol 4-kinase beta Transmembrane

EG_08148 CDP-diacylglycerol--inositol 3-phosphatidyltransferase [EC:2.7.8.11] Transmembrane

Ether lipid metabolism





EG_06663 phospholipase D [EC:3.1.4.4] Intracellular

EG_06664 phospholipase D [EC:3.1.4.4] Extracellular

EG_10138 lysophosphatidylcholine acyltransferase / lyso-PAF acetyltransferase [EC:2.3.1.23

2.3.1.67] Transmembrane


EG_02090 1-alkyl-2-acetylglycerophosphocholine esterase [EC:3.1.1.47] Intracellular

EG_04096 1-alkyl-2-acetylglycerophosphocholine esterase [EC:3.1.1.47] Intracellular

Sphingolipid metabolism

EG_07406 serine palmitoyltransferase [EC:2.3.1.50] Transmembrane

EG_09456 serine palmitoyltransferase [EC:2.3.1.50] Intracellular

EG_06452 LAG1 longevity assurance homolog Transmembrane

EG_06583 neutral ceramidase [EC:3.5.1.23] Intracellular

EG_02326 sphingomyelin phosphodiesterase 2 [EC:3.1.4.12] Transmembrane


EG_07693 sphingosine kinase [EC:2.7.1.91] Intracellular

EG_02861 sphinganine-1-phosphate aldolase [EC:4.1.2.27] Transmembrane

EG_06715 ceramide glucosyltransferase [EC:2.4.1.80] Transmembrane

EG_08364 beta-galactosidase [EC:3.2.1.23] Transmembrane

EG_08025 alpha-galactosidase [EC:3.2.1.22] Transmembrane


Arachidonic acid metabolism


EG_05964 arachidonate 12-lipoxygenase (R-type) [EC:1.13.11.-] Intracellular

EG_06748 glutathione peroxidase [EC:1.11.1.9] Extracellular

EG_00079 gamma-glutamyltranspeptidase [EC:2.3.2.2] Intracellular

EG_02555 leukotriene-A4 hydrolase [EC:3.3.2.6] Intracellular

EG_04038 carbonyl reductase (NADPH) [EC:1.1.1.184] Intracellular

Linoleic acid metabolism


alpha-Linolenic acid metabolism


Biosynthesis of unsaturated fatty acids

EG_09395 beta-keto reductase [EC:1.1.1.-] Transmembrane

EG_04347 3-hydroxy acyl-CoA dehydratase [EC:4.2.1.-] Transmembrane

EG_03533 enoyl reductase [EC:1.3.1.-] Transmembrane

Transporter

EG_06342 Apolipoprotein A-I-binding protein Intracellular

EG_07314 ATP-binding cassette sub-family A member Transmembrane

EG_06334 ATP-binding cassette sub-family G member Transmembrane

EG_04945 Fatty acid-binding protein homolog 1 Intracellular




EG_00683 Long-chain fatty acid transport protein Intracellular

EG_00019 Low-density lipoprotein receptor-related protein Transmembrane

EG_02231 Low-density lipoprotein receptor-related protein Extracellular

EG_02234 Low-density lipoprotein receptor-related protein Intracellular

EG_03592 Low-density lipoprotein receptor-related protein Extracellular







EG_07933 Phosphatidylinositol transfer protein alpha isoform Intracellular

EG_04528 Phosphatidylinositol transfer protein beta isoform Intracellular

EG_00802 Platelet glycoprotein Transmembrane

EG_03396 Platelet glycoprotein 4 Transmembrane

EG_09887 Platelet glycoprotein 4 Transmembrane

EG_04311 Probable phospholipid-transporting ATPase IA Transmembrane

EG_00704 Probable phospholipid-transporting ATPase IF (Fragment) Transmembrane

EG_10165 Probable phospholipid-transporting ATPase IIB Transmembrane

EG_08798 Probable phospholipid-transporting ATPase VD Transmembrane

EG_03952 Putative phospholipid-transporting ATPase 12 Transmembrane

EG_00705 Putative phospholipid-transporting ATPase 8 Transmembrane

EG_07922 SEC14-like protein 4 Intracellular

Other

EG_02179 Hormone-sensitive lipase Intracellular

EG_06343 YjeF N-terminal domain-containing protein Intracellular


EG_00802 Platelet glycoprotein Transmembrane

EG_04531 Proactivator polypeptide Intracellular

EG_01922 Lysosome membrane protein 2 Transmembrane

EG_01923 Scavenger receptor class B member 1 Transmembrane

* The gene classification was based on the KEGG database.


Supplementary Table 22. Enriched domains in E. granulosus and in other eight species

a. In each of the families, the numbers found in E. granulosus are double the average number of the four other parasites

b. Numbers found in E. granulosus and othre 4 parasites are twice more than the average number of the two free-living nematodes

Pfam ID Annotation E. granulosus S. japonicum S. mansoni B. malayi T. spiralis P. pacificus C. elegans H. sapiens C. familiaris

a.

pfam05596 Taeniidae_ag, Taeniidae antigen. 8 0 0 0 0 0 0 0 0

pfam00012 HSP70, Hsp70 protein. 50 10 12 18 14 90 48 74 58

pfam03247 Prothymosin, Prothymosin/parathymosin

family. 31 17 8 3 9 26 22 114 64

pfam00644 PARP, Poly(ADP-ribose) polymerase

catalytic domain. 13 4 4 3 2 9 3 23 15

pfam03360 Glyco_transf_43, Glycosyltransferase family

43. 8 1 1 2 1 3 7 4 3

pfam00091 Tubulin, Tubulin/FtsZ family, GTPase

domain. 29 15 18 13 6 14 16 30 41

pfam03953 Tubulin_C, Tubulin C-terminal domain. 28 13 14 12 6 15 17 24 51

pfam00375 SDF, Sodium:dicarboxylate symporter family. 10 3 3 2 3 11 8 12 7

pfam01477 PLAT, PLAT/LH2 domain. 7 2 4 3 2 2 4 30 21

b.

pfam00028 Cadherin, Cadherin domain. 49 65 51 14 17 18 12 218 99

pfam01221 Dynein_light, Dynein light chain type 1. 48 35 29 4 7 5 5 5 4

pfam03028 Dynein_heavy, Dynein heavy chain and

region D6 of dynein motor. 15 22 15 2 3 3 3 18 16

pfam00582 Usp, Universal stress protein family. 13 7 8 0 0 0 0 0 0

pfam08266 Cadherin_2, Cadherin-like. 12 8 8 1 1 0 0 130 51

pfam03185 CaKB, Calcium-activated potassium channel,

beta subunit. 3 3 1 0 0 0 0 9 4

pfam08385 DHC_N1, Dynein heavy chain, N-terminal

region 1. 12 13 9 1 2 3 3 21 11


Supplementary Table 23. The expression of Hsp70 genes in E. granulosus

Gene ID

EST read number Adult vs Onc Adult vs PSC Adult vs Cyst Onc vs PSC Onc vs Cyst PSC vs Cyst

Adult Onc PSC Cyst log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

EG_00425 8 0 4 18 2.29 8.49E-02 0.29 7.31E-01 -1.37 2.03E-02 PSC only PSC only -3.65 9.25E-04 -1.66 1.72E-02

EG_01545 30 9 23 16 0.02 9.59E-01 -0.33 4.06E-01 0.71 1.02E-01 -0.35 5.04E-01 0.69 2.12E-01 1.04 2.48E-02

EG_02639 20 3 12 25 1.02 1.29E-01 0.03 9.56E-01 -0.52 2.30E-01 -1.00 2.18E-01 -1.54 1.76E-02 -0.55 2.62E-01

EG_02640 13 1 8 10 1.99 4.44E-02 -0.01 9.89E-01 0.18 7.61E-01 -2.00 9.02E-02 -1.80 9.30E-02 0.19 7.77E-01

EG_04534 24 0 1 0 3.87 1.24E-04 3.88 1.97E-05 5.39 8.55E-07 PSC only PSC only both zero both zero PSC only PSC only

EG_04536 0 0 0 0 both zero both zero both zero both zero both zero both zero both zero both zero both zero both zero both zero both zero

EG_04903 16 2 5 5 1.29 1.03E-01 0.97 1.49E-01 1.48 2.96E-02 -0.32 7.76E-01 0.20 8.55E-01 0.51 5.70E-01

EG_05042 91 215 74 173 -2.95 1.91E-77 -0.41 6.41E-02 -1.12 6.80E-10 2.54 3.11E-47 1.83 1.39E-40 -0.71 1.84E-04


EG_05223 1 0 0 0 Adult only Adult only Adult only Adult only Adult only Adult only both zero both zero both zero both zero both zero both zero


EG_06252 6 0 5 5 1.87 1.89E-01 -0.45 6.04E-01 0.07 9.38E-01 -2.32 1.41E-01 -1.80 2.35E-01 0.51 5.70E-01


EG_06658 68 10 41 84 1.05 4.20E-03 0.02 9.40E-01 -0.50 3.28E-02 -1.03 1.91E-02 -1.55 1.20E-05 -0.52 4.86E-02

EG_06932 82 16 135 154 0.64 3.89E-02 -1.43 3.05E-13 -1.10 9.04E-09 -2.07 9.61E-13 -1.75 1.09E-10 0.32 5.47E-02



EG_07332 18 2 16 1 1.46 5.73E-02 -0.54 2.69E-01 3.97 5.89E-05 -2.00 1.66E-02 2.52 1.17E-01 4.51 8.21E-06

EG_07753 6 1 4 7 0.87 4.67E-01 -0.12 8.91E-01 -0.42 6.02E-01 -1.00 4.77E-01 -1.29 2.72E-01 -0.29 7.39E-01




EG_08691 3 0 1 0 Adult only Adult only 0.88 5.66E-01 Adult only Adult only PSC only PSC only both zero both zero PSC only PSC only


EG_08820 50 0 108 156 4.93 4.26E-09 -1.82 8.19E-15 -1.84 2.39E-17 -6.75 2.47E-20 -6.77 6.11E-26 -0.02 9.25E-01

EG_08863 209 968 1042 2045 -3.92 0.00E+00 -3.03 4.80E-233 -3.49 0.00E+00 0.90 1.54E-47 0.44 3.19E-18 -0.46 2.72E-18

EG_08960 0 1 1 4 Onc only Onc only PSC only PSC only Cyst only Cyst only 1.00 6.12E-01 -0.48 7.21E-01 -1.49 2.99E-01

EG_08970 9 0 0 0 2.46 5.66E-02 3.46 1.21E-02 3.97 4.50E-03 both zero both zero both zero both zero both zero both zero

EG_09244 31 1 5 0 3.24 4.62E-05 1.92 7.35E-04 5.76 2.06E-08 -1.32 3.20E-01 Onc only Onc only 3.84 1.72E-02







EG_10172 0 0 0 1 both zero both zero both zero both zero Cyst only Cyst only both zero both zero Cyst only Cyst only Cyst only Cyst only






EG_10487 6 5 3 3 -1.45 7.05E-02 0.29 7.66E-01 0.80 4.16E-01 1.74 8.36E-02 2.26 2.01E-02 0.51 6.60E-01

EG_10493 7 0 5 1 2.09 1.27E-01 -0.22 7.87E-01 2.61 3.71E-02 -2.32 1.41E-01 Cyst only Cyst only 2.84 3.62E-02

EG_10561 61 74 98 1469 -1.99 3.23E-18 -1.39 1.09E-09 -4.79 0.00E+00 0.60 5.21E-03 -2.79 4.44E-156 -3.39 1.63E-234


EG_10808 1 0 4 1 Adult only Adult only -2.71 5.66E-02 -0.20 9.24E-01 PSC only PSC only Cyst only Cyst only 2.51 7.91E-02






Note: Hsp70, heat shock protein 70; Adult, adult worm; Onc, oncosphere; PSC, protoscolex; Cyst, hydatid cyst membrane.


Supplementary Table 24. The genes of E. granulosus present in orthologs of platyhelminth and nematode parasites

Gene ID



normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

EG_00733 8 5 5 2 -1.04 1.65E-01 -0.03 9.69E-01 1.80 7.65E-02 1.00 2.57E-01 2.84 8.17E-03 1.84 1.07E-01

EG_01461 37 1 7 14 3.50 4.35E-06 1.69 7.27E-04 1.21 4.72E-03 -1.80 1.39E-01 -2.29 2.04E-02 -0.49 4.50E-01

EG_02379 6 1 15 11 0.87 4.67E-01 -2.03 1.86E-03 -1.07 1.35E-01 -2.90 3.93E-03 -1.94 6.41E-02 0.96 8.88E-02

EG_02766 30 16 6 28 -0.81 4.43E-02 1.61 3.29E-03 -0.10 8.00E-01 2.42 1.31E-04 0.71 8.68E-02 -1.71 2.37E-03

EG_02905 17 4 11 15 0.37 5.67E-01 -0.08 8.82E-01 -0.01 9.77E-01 -0.46 5.54E-01 -0.39 5.71E-01 0.07 9.07E-01

EG_03091 6 3 17 15 -0.71 4.34E-01 -2.21 4.71E-04 -1.52 2.18E-02 -1.50 4.32E-02 -0.80 2.76E-01 0.69 1.70E-01

EG_03173 7 1 6 2 1.09 3.43E-01 -0.49 5.38E-01 1.61 1.26E-01 -1.58 2.12E-01 0.52 7.47E-01 2.10 5.37E-02

EG_03429 4 0 0 1 Adult only Adult only Adult only Adult only 1.80 2.10E-01 both zero both zero Cyst only Cyst only Cyst only Cyst only

EG_03696 8 0 9 10 2.29 8.49E-02 -0.88 2.03E-01 -0.52 4.48E-01 -3.17 1.99E-02 -2.80 2.81E-02 0.36 5.82E-01

EG_03784 3 0 0 4 Adult only Adult only Adult only Adult only -0.61 5.77E-01 both zero both zero Cyst only Cyst only Cyst only Cyst only


EG_03806 1 0 14 4 Adult only Adult only -4.52 1.38E-05 -2.20 1.28E-01 -3.80 1.79E-03 Cyst only Cyst only 2.32 1.71E-03

EG_03848 1 0 2 0 Adult only Adult only -1.71 3.12E-01 Adult only Adult only PSC only PSC only both zero both zero PSC only PSC only


EG_04400 12 3 4 2 0.29 7.08E-01 0.88 2.51E-01 2.39 9.45E-03 0.59 5.80E-01 2.10 8.48E-02 1.51 2.09E-01



EG_05039 20 4 28 23 0.61 3.32E-01 -1.19 3.84E-03 -0.40 3.67E-01 -1.80 3.06E-03 -1.01 1.03E-01 0.80 4.72E-02

EG_05089 140 45 33 101 -0.08 7.18E-01 1.38 1.65E-08 0.28 1.40E-01 1.45 5.31E-06 0.35 1.30E-01 -1.10 3.62E-05


EG_05745 11 0 16 16 2.75 2.51E-02 -1.25 2.35E-02 -0.74 1.88E-01 -4.00 6.92E-04 -3.48 2.16E-03 0.51 3.10E-01

EG_05747 3 0 29 5 Adult only Adult only -3.98 1.44E-09 -0.93 3.68E-01 -4.85 1.73E-06 -1.80 2.35E-01 3.05 1.71E-07

EG_05951 10 0 11 20 2.61 3.77E-02 -0.85 1.73E-01 -1.20 2.74E-02 -3.46 7.55E-03 -3.80 3.96E-04 -0.35 5.07E-01

EG_06047 21 3 1 8 1.09 1.01E-01 3.68 8.75E-05 1.20 3.45E-02 2.59 8.53E-02 0.10 9.05E-01 -2.49 3.89E-02

EG_06057 4 7 5 2 -2.52 2.01E-03 -1.03 2.78E-01 0.80 5.07E-01 1.49 6.73E-02 3.33 7.55E-04 1.84 1.07E-01


EG_06729 8 0 16 13 2.29 8.49E-02 -1.71 4.24E-03 -0.90 1.60E-01 -4.00 6.92E-04 -3.18 7.79E-03 0.81 1.27E-01


EG_07193 26 9 1 10 -0.18 7.03E-01 3.99 7.32E-06 1.18 1.97E-02 4.17 2.62E-04 1.37 2.75E-02 -2.81 1.36E-02

EG_07366 5 1 2 0 0.61 6.28E-01 0.61 5.88E-01 3.13 5.37E-02 0.00 9.98E-01 Onc only Onc only PSC only PSC only


EG_07746 15 0 6 6 3.19 4.87E-03 0.61 3.48E-01 1.13 8.86E-02 -2.58 8.64E-02 -2.07 1.54E-01 0.51 5.34E-01

EG_07882 2 1 0 7 -0.71 6.51E-01 Adult only Adult only -2.00 5.73E-02 Onc only Onc only -1.29 2.72E-01 -3.29 2.60E-02


EG_08131 4 18 0 1 -3.88 1.67E-09 Adult only Adult only 1.80 2.10E-01 6.17 6.67E-08 5.69 8.48E-10 Cyst only Cyst only

EG_08722 4 1 24 12 0.29 8.29E-01 -3.29 2.90E-07 -1.78 2.15E-02 -3.58 6.29E-05 -2.07 4.39E-02 1.51 2.06E-03

EG_08916 3 2 3 3 -1.13 3.47E-01 -0.71 5.41E-01 -0.20 8.68E-01 0.42 7.40E-01 0.93 4.44E-01 0.51 6.60E-01


EG_09349 2 0 1 1 Adult only Adult only 0.29 8.63E-01 0.80 6.39E-01 PSC only PSC only Cyst only Cyst only 0.51 8.00E-01


EG_09378 7 1 2 4 1.09 3.43E-01 1.10 2.91E-01 0.61 4.90E-01 0.00 9.98E-01 -0.48 7.21E-01 -0.49 6.86E-01

EG_10122 19 4 8 10 0.53 4.00E-01 0.54 3.46E-01 0.73 1.83E-01 0.00 9.96E-01 0.20 7.96E-01 0.19 7.77E-01

EG_10571 33 4 5 6 1.33 1.62E-02 2.01 3.30E-04 2.26 3.08E-05 0.68 4.66E-01 0.93 2.79E-01 0.25 7.72E-01


Supplementary Table 25. Orthologs among the different lineages based on OrthoMCL

Parasite Free-living Nematodes

Platyhelminthes Nematoda

S. japonicum S. mansoni E. granulosus T.spiralis B.malayi C.elegan P. pacificus

Total Gene Number 13,469 10,852 11,325 15,808 11,508 19,762 23,500

Orthologs Group 4,223 3689 6697

Gene Number 7,599 6,407 6,039 6,387 4,490 8,615 13,397

Unique Gene Number 1,184 1,436 4,029 8,972 4,807 7,850 9,746

Schistosomes Parasite

Orthologs Group 6,017 2,552

Gene Number 10,326 8,802 3,788 4,484 3,061

Unique Gene Number 1,215 1,374 5,430 8,985 4,620

Orthologs Group 1,835

Gene Number 3,558 2,852 2,940 3,451 2,263 2,422 4,127

A unique gene was defined as that having no hit in aother genome under the criteria 1E-5 using BlastP.


Supplementary Table 26. GO enrichment of parasitism-associated genes

GO-ID Term Category FDR P-Value #Test #Ref #not

AnnotTest

#not

AnnotRef TestSeqs

GO:0005509 calcium ion binding F 0.0112087 1.97E-04 4 51 21 4493 EG_03849, EG_03848, EG_04400, EG_05187

GO:0006996 organelle

organization P 0.0233271 7.04E-04 9 478 16 4066

EG_03849, EG_03848, EG_07746, EG_02379,

EG_05951, EG_05039, EG_07193, EG_06874,

EG_07703

GO:0006464 cellular protein

modification process P 0.0329643 0.0015922 8 427 17 4117

EG_07746, EG_02379, EG_03429, EG_05951,

EG_05039, EG_07193, EG_06874, EG_07703

GO:0050789 regulation of

biological process P 0.0329643 0.0018659 15 1365 10 3179

EG_03849, EG_03848, EG_07746, EG_02379,

EG_02905, EG_06249, EG_05951, EG_05039,

EG_07193, EG_06874, EG_08722, EG_03696,

EG_03806, EG_07703, EG_05187


Supplementary Table 30. E. granulosus genes associated with bile acids

E. granulosus Gene ID Annotation E value Identity

putative nuclear bile acid receptors of E. granulosus

EG_00780 VDR [gi|18859543|ref|NP_570994.1| Danio rerio] 2.00E-36 24.50%

EG_08428 VDR [gi|323714265|ref|NP_001017536.1| Homo sapiens] 2.00E-23 23.89%

EG_00119 FXR [gi|345326686|ref|XP_001506579.2| Ornithorhynchus anatinus] 8.00E-26 20.18%

EG_04405 FXR [gi|345326686|ref|XP_001506579.2| Ornithorhynchus anatinus] 7.00E-21 23.68%

EG_06875 RXR [gi|242019940|ref|XP_002430416.1| Pediculus humanus corporis] 2.00E-65 20.67%

EG_02914 FXR [gi|145944492|gb|ABP98947.1| Leucoraja erinacea] 2.00E-22 14.29%

EG_01863 FXR [gi|354483461|ref|XP_003503911.1| Cricetulus griseus] 3.00E-22 7.86%

EG_05526 FXR [gi|365176242|gb|AEW68001.1| Halocynthia roretzi] 2.00E-21 5.67%



putative bile acid transportors of E. granulosus

EG_05139 sodium-bile acid cotransporter [gi|256089218|ref|XP_002580711.1| Schistosoma mansoni] 1.00E-41 38.71%

EG_05140 ileal sodium/bile acid cotransporter [gi|358255751|dbj|GAA57409.1| Clonorchis sinensis] 6.00E-37 27.89%



EG_07062 sodium-bile acid cotransporter related [gi|256073666|ref|XP_002573150.1| Schistosoma mansoni] 3.00E-58 17.52%

other putative bile acid metabolism related genes of E. granulosus

EG_00781 SREBP-1 [gi|358336587|dbj|GAA55053.1| Clonorchis sinensis] 1.00E-15 12.75%

EG_01291 bile acid beta-glucosidase-related [gi|353232147|emb|CCD79502.1| Schistosoma mansoni] 1.00E-178 38.21%

EG_06717 bile acid beta-glucosidase-related [gi|256082537|ref|XP_002577511.1| Schistosoma mansoni] 1.00E-120 38.01%

EG_08377 dihydrodiol dehydrogenase 2; bile acid binding protein [gi|148231135|ref|NP_001079568.1| Xenopus laevis] 3.00E-85 42.86%




The listed putative nuclear bile acid receptors of E. granulosus were homologues to known BA receptors such as FXR, VDR, and RXR with the E-value

threshold less than 1E-20. The BA transportors and other BA metabolism related genes found in E. granulosus were also listed in this table.


Supplementary Table 32. Expression of genes associated with cell differentiation in adult worms (Adult), oncospheres (Onc),

protoscoleces (PSC) and hydatid cyst membrane (Cyst) of E. granulosus

Gene ID



normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_chan

ge)

normalized

p-value log2(Fold_change)

normalized p-value

EG_10560 367 354 1655 4301 -1.66 1.21E-63 -2.88 0.00E+00 -3.75 0.00E+00 -1.22 6.10E-66 -2.08 0.00E+00 -0.86 2.21E-110

EG_11215 1022 291 297 1205 0.10 2.17E-01 1.07 3.11E-36 -0.43 1.20E-12 0.97 2.68E-17 -0.53 1.02E-11 -1.51 1.85E-74

EG_01226 324 55 274 765 0.85 1.93E-07 -0.47 5.89E-05 -1.43 8.45E-56 -1.31 2.01E-13 -2.28 1.01E-65 -0.97 1.20E-24

EG_05582 473 10 155 475 3.85 5.95E-65 0.90 1.57E-13 -0.20 3.11E-02 -2.95 8.94E-21 -4.05 1.64E-69 -1.10 2.75E-19

EG_04994 237 6 210 622 3.59 7.15E-32 -0.53 7.01E-05 -1.59 9.92E-53 -4.12 2.26E-35 -5.18 9.25E-

100 -1.05 4.00E-23

EG_03128 386 235 107 269 -1.00 2.47E-20 1.14 5.22E-16 0.33 4.08E-03 2.14 3.07E-42 1.32 3.61E-28 -0.82 1.47E-07

EG_06727 74 43 47 218 -0.93 1.96E-04 -0.05 8.36E-01 -1.75 2.89E-22 0.88 3.01E-03 -0.82 2.16E-05 -1.70 2.85E-17

EG_04531 59 36 77 133 -1.00 2.94E-04 -1.09 7.96E-06 -1.37 2.62E-10 -0.09 7.35E-01 -0.37 1.09E-01 -0.27 1.72E-01

EG_00620 132 63 17 78 -0.65 1.00E-03 2.25 1.37E-14 0.56 5.32E-03 2.89 6.18E-17 1.21 1.11E-07 -1.68 5.12E-07

EG_01834 124 5 50 55 2.92 8.44E-15 0.60 7.92E-03 0.98 1.30E-05 -2.32 3.27E-06 -1.94 3.47E-05 0.38 1.78E-01

EG_08102 87 4 51 82 2.73 3.35E-10 0.06 8.03E-01 -0.11 6.20E-01 -2.67 3.55E-07 -2.84 2.47E-10 -0.17 4.96E-01

EG_09743 37 23 32 111 -1.03 3.10E-03 -0.50 1.45E-01 -1.78 2.66E-12 0.53 1.65E-01 -0.75 5.06E-03 -1.28 1.03E-06

EG_01108 14 2 87 57 1.09 1.80E-01 -3.34 8.23E-23 -2.22 6.93E-09 -4.44 3.95E-16 -3.31 1.41E-08 1.12 3.16E-06

EG_03132 17 1 77 44 2.37 1.02E-02 -2.89 5.39E-18 -1.57 5.76E-05 -5.26 3.51E-15 -3.94 1.06E-07 1.32 6.35E-07

EG_03683 27 14 38 44 -0.77 7.19E-02 -1.20 7.11E-04 -0.90 9.52E-03 -0.44 2.90E-01 -0.13 7.27E-01 0.30 3.40E-01


EG_10291 38 18 9 56 -0.64 8.33E-02 1.37 3.40E-03 -0.75 1.19E-02 2.00 3.05E-04 -0.12 7.25E-01 -2.12 6.64E-07

EG_09712 8 3 94 10 -0.30 7.25E-01 -4.26 1.13E-28 -0.52 4.48E-01 -3.97 2.30E-16 -0.22 7.89E-01 3.75 1.19E-24

EG_08001 10 0 83 16 2.61 3.77E-02 -3.76 9.42E-24 -0.87 1.27E-01 -6.37 3.23E-16 -3.48 2.16E-03 2.89 6.92E-18

EG_10137 27 16 10 50 -0.96 1.99E-02 0.72 1.44E-01 -1.08 1.26E-03 1.68 2.51E-03 -0.13 7.26E-01 -1.81 2.39E-05

EG_00674 32 10 25 27 -0.04 9.36E-01 -0.35 3.50E-01 0.05 8.95E-01 -0.32 5.24E-01 0.09 8.57E-01 0.40 3.11E-01

EG_08150 37 2 27 25 2.50 9.60E-05 -0.25 4.77E-01 0.37 3.16E-01 -2.75 1.67E-04 -2.13 3.07E-03 0.62 1.16E-01

EG_07936 18 0 46 26 3.46 1.42E-03 -2.06 3.68E-08 -0.73 9.76E-02 -5.52 1.04E-09 -4.18 3.20E-05 1.34 1.03E-04

EG_01543 25 3 53 8 1.35 3.49E-02 -1.79 7.33E-08 1.45 7.52E-03 -3.14 1.83E-08 0.10 9.05E-01 3.24 3.67E-13


EG_02959 11 3 34 25 0.16 8.37E-01 -2.34 3.16E-07 -1.38 5.83E-03 -2.50 6.11E-05 -1.54 1.76E-02 0.96 1.07E-02

EG_09643 19 0 23 31 3.53 9.46E-04 -0.98 2.51E-02 -0.90 2.93E-02 -4.52 2.65E-05 -4.44 4.03E-06 0.08 8.32E-01


EG_01489 37 18 2 15 -0.67 6.81E-02 3.50 3.26E-07 1.11 8.36E-03 4.17 2.43E-07 1.78 1.56E-04 -2.39 5.66E-03

EG_08260 37 6 22 7 0.91 6.10E-02 0.04 9.13E-01 2.21 1.40E-05 -0.87 1.36E-01 1.30 8.41E-02 2.17 1.64E-04


EG_00135 22 1 20 21 2.75 1.53E-03 -0.57 1.93E-01 -0.13 7.71E-01 -3.32 3.97E-04 -2.87 1.27E-03 0.44 3.21E-01

EG_06857 8 0 46 10 2.29 8.49E-02 -3.23 1.86E-12 -0.52 4.48E-01 -5.52 1.04E-09 -2.80 2.81E-02 2.72 5.20E-10

EG_08145 12 0 18 34 2.87 1.66E-02 -1.29 1.36E-02 -1.70 1.81E-04 -4.17 2.70E-04 -4.57 1.18E-06 -0.40 3.21E-01

EG_01914 52 2 4 2 2.99 3.73E-07 2.99 1.58E-08 4.51 1.67E-12 0.00 9.97E-01 1.52 2.61E-01 1.51 2.09E-01

EG_08217 10 2 26 20 0.61 4.93E-01 -2.09 3.04E-05 -1.20 2.74E-02 -2.70 2.57E-04 -1.80 1.75E-02 0.89 3.53E-02

EG_08696 10 1 36 11 1.61 1.28E-01 -2.56 2.99E-08 -0.33 5.97E-01 -4.17 2.58E-07 -1.94 6.41E-02 2.22 9.49E-07

EG_09709 14 1 14 25 2.09 3.09E-02 -0.71 1.87E-01 -1.03 2.85E-02 -2.80 6.19E-03 -3.13 2.52E-04 -0.32 4.90E-01

EG_01506 21 4 16 11 0.68 2.74E-01 -0.32 5.00E-01 0.74 1.58E-01 -1.00 1.55E-01 0.06 9.37E-01 1.05 5.78E-02

EG_05753 21 4 9 18 0.68 2.74E-01 0.51 3.44E-01 0.03 9.53E-01 -0.17 8.38E-01 -0.65 3.20E-01 -0.49 3.91E-01

EG_01391 6 3 14 2 -0.71 4.34E-01 -1.93 3.62E-03 1.39 2.04E-01 -1.22 1.17E-01 2.10 8.48E-02 3.32 1.61E-04


EG_07113 0 0 3 1 both zero both zero PSC only PSC only Cyst only Cyst only PSC only PSC only Cyst only Cyst only 2.10 1.72E-01


Supplementary Table 33. Genes associated with segmentation in E. granulosus

Gene ID EST reads number

Gene description* Adult Onc PSC Cyst

Nuclear recetor

EG_10234 3 11 8 2 ftz-f1 nuclear receptor-like protein

Hox

EG_01310 0 0 2 0 homeobox protein abdominal

EG_01311 1 0 0 0 homeodomain protein

EG_02112 6 0 0 1 hox protein smox1

EG_02118 0 0 3 5 antennapedia-like homeobox protein

Wnt

EG_03800 1 0 1 4 wingless-related mmtv integration site 5a

EG_00103 2 1 1 1 wingless-type mmtv integration site family member 5a

EG_08565 2 0 1 0 wnt related

EG_03062 0 0 3 1 protein wnt-2b

EG_10512 2 0 2 2 wingless-type mmtv integration site member 1

EG_03061 0 0 3 0 wingless-type mmtv integration site member 4

Arm

EG_02121 33 2 3 1 rtdr1-prov protein

EG_05791 28 9 2 20 importin subunit alpha-2

EG_01111 12 0 25 11 importin subunit alpha-4

EG_00068 11 0 24 15 karyopherin beta 1

EG_01439 8 0 12 2 armadillo repeat-containing protein 4

EG_05086 4 0 31 19 adenomatosis polyposis coli 2

EG_00839 3 0 33 38 beta-catenin protein

EG_09654 3 0 7 1 armadillo segment polarity

Dsh

EG_04068 8 0 17 10 segment polarity protein dishevelled homolog dvl-3-like

EG_02768 4 1 12 19 axin1 protein

EG_07621 1 0 9 18 axin1 protein

EG_02357 2 0 5 9 segment polarity protein dishevelled-like protein dvl-3

Nanos homolog 1

EG_01635 0 0 0 0 nanos homolog 1

EG_04615 0 0 3 3 nanos-like protein

Tailless

EG_03279 0 0 0 0 tailless

Pair-rule

EG_01216 0 0 0 1 Runt-related transcription factor

EG_07706 0 0 0 0 Paired box protein Pax-6 *Gene description was based on BLASTP againt SwissProt and NCBI NR database

Note: Adult, adult worm; Onc, oncosphere; PSC, protoscolex; Cyst, hydatid cyst membrane


Supplementary Table 34. Expression of genes associated with reproduction in

adult worms (Adult), oncospheres (Onc), protoscoleces (PSC) and hydatid cyst

membrane (Cyst) of E. granulosus

Gene ID EST reads number

Gene description Adult Onc PSC Cyst

Meiosis

EG_00251 56 7 28 18 Fimbrin

EG_00255 46 2 0 18 cyclin-dependent kinase subunit 30a

EG_04555 18 0 21 16 calcineurin a

EG_02489 10 2 0 0 homologous-pairing protein 2 homolog

EG_07425 9 0 5 15 mre11 meiotic recombination 11 homolog a

EG_04509 7 0 13 4 meiotic recombination protein rec8 homolog

EG_01385 5 0 2 7 rad51 homolog c ( cerevisiae)

EG_08324 3 0 1 8 cyclin dependent kinase 1

EG_03500 2 0 8 9 dead deah box

Spermatogenesis

EG_01542 37 20 18 16 ruvb-like 1

EG_09888 30 0 2 2 subfamily member 13

EG_00325 16 12 10 11 family with sequence similarity member a

EG_01572 16 8 26 9 serine threonine-protein kinase ulk3

EG_07763 13 1 9 13 homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like

protein

EG_01759 12 1 11 11 wd repeat domain 33

EG_02470 9 0 10 2 dynein light chain axonemal

EG_07006 9 0 11 8 lag1 longevity assurance homolog 5

EG_02958 8 1 1 4 mitochondrial import inner membrane translocase subunit tim16

EG_08978 7 1 10 8 heterogeneous nuclearribonucleoprotein a2

EG_00284 6 0 23 9 proteasome activator complex subunit 4-like

EG_04777 4 2 7 5 intraflagellar transport protein 81 homolog

EG_07393 4 2 5 0 DNA ligase III

EG_02054 2 0 11 5 beta heavy chain of outer-arm axonemal dynein atpase

Fertilization

EG_00782 7 1 9 10 Homer protein homolog

EG_02718 7 0 0 0 sperm autoantigenic protein 17

EG_07295 5 0 1 0 axonemal dynein light chain p33

EG_00661 2 0 0 1 sperm associated antigen 1

EG_02296 1 0 0 0 kelch-like protein 10

PP1

EG_00391 3 0 1 2 Protein Phosphatase 1 (formerly 2c)-like

EG_02612 8 1 4 15 Protein Phosphatase

EG_08827 7 0 11 22 Protein Phosphatase 1b


Supplementary Table 35. Genes involved in the meiotic pathway and expressed in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC) and


Gene ID

EST reads number Adult vs Onc Adult vs Psc Adult vs Cyst Onc vs Psc Onc vs Cyst Psc vs Cyst


normalized p-value

log2(Fold_chan

ge)

normalized

p-value

log2(Fold_chan

ge)

normalized

p-value

log2(Fold_chan

ge)

normalized

p-value

log2(Fold_chan

ge)

normalized

p-value

log2(Fold_chan

ge)

normalized

p-value

EG_00251 56 7 28 18 1.29 2.29E-03 0.29 3.62E-01 1.44 6.67E-05 -1.00 6.00E-02 0.16 7.85E-01 1.15 7.05E-03

EG_00255 46 2 0 18 2.81 3.54E-06 5.81 2.37E-10 1.16 2.29E-03 Onc only Onc only -1.65 3.41E-02 -4.66 6.77E-05

EG_00791 22 35 7 11 -2.38 2.24E-11 0.94 9.84E-02 0.80 1.19E-01 3.33 3.02E-11 3.19 1.40E-13 -0.14 8.40E-01

EG_01044 8 0 12 16 2.29 8.49E-02 -1.29 4.39E-02 -1.20 4.85E-02 -3.58 4.66E-03 -3.48 2.16E-03 0.10 8.56E-01



EG_01539 15 16 1 8 -1.81 1.51E-04 3.20 1.74E-03 0.71 2.48E-01 5.00 4.33E-07 2.52 9.17E-06 -2.49 3.89E-02

EG_02489 10 2 0 0 0.61 4.93E-01 3.61 7.19E-03 4.13 2.46E-03 Onc only Onc only Onc only Onc only both zero both zero

EG_03030 11 0 3 5 2.75 2.51E-02 1.17 1.65E-01 0.94 2.08E-01 PSC only PSC only -1.80 2.35E-01 -0.22 8.28E-01




EG_03712 5 4 9 4 -1.39 1.17E-01 -1.56 4.48E-02 0.13 8.95E-01 -0.17 8.38E-01 1.52 1.12E-01 1.68 4.16E-02

EG_03754 14 2 29 36 1.09 1.80E-01 -1.76 8.49E-05 -1.56 2.92E-04 -2.85 7.00E-05 -2.65 5.22E-05 0.20 5.71E-01

EG_04509 7 0 13 4 2.09 1.27E-01 -1.60 1.38E-02 0.61 4.90E-01 -3.70 2.88E-03 NA NA 2.21 3.31E-03

EG_04528 8 2 3 5 0.29 7.60E-01 0.71 4.37E-01 0.48 5.51E-01 0.42 7.40E-01 0.20 8.55E-01 -0.22 8.28E-01

EG_04555 18 0 21 16 3.46 1.42E-03 -0.93 4.10E-02 -0.03 9.59E-01 -4.39 6.66E-05 -3.48 2.16E-03 0.91 5.53E-02

EG_07425 9 0 5 15 2.46 5.66E-02 0.14 8.58E-01 -0.93 1.19E-01 -2.32 1.41E-01 -3.39 3.32E-03 -1.07 1.19E-01

EG_07933 21 3 15 35 1.09 1.01E-01 -0.22 6.39E-01 -0.93 1.72E-02 -1.32 8.49E-02 -2.03 6.82E-04 -0.71 9.37E-02

EG_08324 3 0 1 8 Adult only Adult only 0.88 5.66E-01 -1.61 8.03E-02 PSC only PSC only -2.48 6.60E-02 -2.49 3.89E-02


Supplementary Table 36. Signaling pathways in E. granulosus

Gene ID Description* Localization

Two-component system

EG_03839 alkaline phosphatase [EC:3.1.3.1] Transmembrane

EG_08266 alkaline phosphatase [EC:3.1.3.1] Intracellular

EG_02492 cytochrome c oxidase subunit XV assembly protein Transmembrane

EG_02017 malate dehydrogenase (oxaloacetate-decarboxylating) [EC:1.1.1.38] Intracellular

EG_06409 malate dehydrogenase (oxaloacetate-decarboxylating) [EC:1.1.1.38] Intracellular

EG_02120 glutamine synthetase [EC:6.3.1.2] Intracellular


MAPK signaling pathway

EG_02129 voltage-dependent calcium channel L type alpha-1C Transmembrane

EG_00598 voltage-dependent calcium channel R type alpha-1E Transmembrane

EG_00561 voltage-dependent calcium channel alpha-2/delta-4 Intracellular

EG_04487 voltage-dependent calcium channel beta, invertebrate Intracellular

EG_04421 protein kinase A [EC:2.7.11.11] Intracellular


EG_03545 classical protein kinase C [EC:2.7.11.13] Intracellular

EG_04555 protein phosphatase 3, catalytic subunit [EC:3.1.3.16] Intracellular

EG_02455 protein phosphatase 3, regulatory subunit Intracellular


EG_07109 Ras-specific guanine nucleotide-releasing factor 2 Intracellular

EG_03501 Rap guanine nucleotide exchange factor (GEF) 2 Intracellular

EG_03329 epidermal growth factor receptor [EC:2.7.10.1] Extracellular

EG_05468 epidermal growth factor receptor [EC:2.7.10.1] Transmembrane

EG_04208 fibroblast growth factor receptor 2 [EC:2.7.10.1] Transmembrane

EG_09709 growth factor receptor-binding protein 2 Intracellular

EG_05640 son of sevenless Intracellular

EG_06185 GTPase KRas Intracellular

EG_02047 Ras-related protein M-Ras Intracellular

EG_04277 B-Raf proto-oncogene serine/threonine-protein kinase [EC:2.7.11.1] Intracellular

EG_07687 mitogen-activated protein kinase kinase 1 [EC:2.7.12.2] Extracellular

EG_00106 extracellular signal-regulated kinase 1/2 [EC:2.7.11.24] Intracellular

EG_01966 p90 ribosomal S6 kinase [EC:2.7.11.1] Intracellular

EG_06766 serum response factor Intracellular

EG_00662 microtubule-associated protein tau Intracellular


EG_06011 TGF-beta receptor type-1 [EC:2.7.11.30] Transmembrane

EG_07105 Ras-related C3 botulinum toxin substrate 3 Intracellular

EG_00052 cell division control protein 42 Intracellular

EG_04745 caspase 3 [EC:3.4.22.56] Intracellular

EG_02787 evolutionarily conserved signaling intermediate in Toll pathways Intracellular

EG_01274 mitogen-activated protein kinase kinase kinase kinase 3 [EC:2.7.11.1] Intracellular

EG_02362 p21-activated kinase 1 [EC:2.7.11.1] Intracellular


EG_07202 serine/threonine kinase 3 [EC:2.7.11.5] Intracellular

EG_07703 mitogen-activated protein kinase kinase kinase 1 [EC:2.7.11.25] Intracellular





EG_05936 thousand and one amino acid protein kinase [EC:2.7.11.1] Intracellular

EG_05607 mitogen-activated protein kinase kinase 4 [EC:2.7.12.2] Transmembrane

EG_04146 mitogen-activated protein kinase kinase 7 [EC:2.7.12.2] Intracellular

EG_08326 mitogen-activated protein kinase 8 interacting protein 3 Intracellular

EG_04458 filamin Intracellular

EG_02997 proto-oncogene C-crk Extracellular

EG_01582 beta-arrestin Intracellular

EG_08217 c-Jun N-terminal kinase [EC:2.7.11.24] Intracellular

EG_10922 p38 MAP kinase [EC:2.7.11.24] Extracellular

EG_00520 mitogen-activated protein kinase-activated protein kinase 2 [EC:2.7.11.1] Intracellular

EG_02613 RAC serine/threonine-protein kinase [EC:2.7.11.1] Intracellular

EG_05830 dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] Intracellular

EG_07162 dual specificity phosphatase [EC:3.1.3.16 3.1.3.48] Extracellular




EG_03722 protein phosphatase 5 [EC:3.1.3.16] Intracellular

EG_08827 protein phosphatase 1B (formerly 2C) [EC:3.1.3.16] Intracellular

EG_08863 heat shock 70kDa protein 1/8 Intracellular

EG_04929 ecotropic virus integration site 1 protein Intracellular

EG_00726 nemo like kinase [EC:2.7.11.24] Intracellular

ErbB signaling pathway



EG_06207 calcium/calmodulin-dependent protein kinase (CaM kinase) II [EC:2.7.11.17] Intracellular


EG_02348 E3 ubiquitin-protein ligase CBL [EC:6.3.2.19] Intracellular

EG_05827 PTK2 protein tyrosine kinase 2 [EC:2.7.10.2] Extracellular

EG_02997 proto-oncogene C-crk Extracellular

EG_00334 NCK adaptor protein Intracellular




EG_05607 mitogen-activated protein kinase kinase 4 [EC:2.7.12.2] Transmembrane

EG_04146 mitogen-activated protein kinase kinase 7 [EC:2.7.12.2] Intracellular


EG_06889 neuregulin 2 Transmembrane

EG_07164 receptor tyrosine-protein kinase erbB-4 [EC:2.7.10.1] Transmembrane

EG_03174 src homology 2 domain-containing transforming protein C Intracellular







EG_03896 phosphatidylinositol-4,5-bisphosphate 3-kinase [EC:2.7.1.153] Intracellular

EG_06563 phosphoinositide-3-kinase, regulatory subunit Intracellular


EG_00240 FKBP12-rapamycin complex-associated protein Intracellular


EG_05763 p70 ribosomal S6 kinase [EC:2.7.11.1] Extracellular

EG_08339 eukaryotic translation initiation factor 4E binding protein 1 Intracellular

EG_02624 glycogen synthase kinase 3 beta [EC:2.7.11.26] Intracellular


Wnt signaling pathway

EG_05657 porcupine Transmembrane

EG_00103 wingless-type MMTV integration site family, member 5 Intracellular

EG_01435 secreted frizzled-related protein 2 Extracellular

EG_07145 frizzled 1/7 Transmembrane

EG_06283 frizzled 4 Transmembrane

EG_01918 frizzled 9/10 Transmembrane

EG_00019 low density lipoprotein receptor-related protein 5/6 Transmembrane

EG_06884 casein kinase 1, epsilon [EC:2.7.11.1] Intracellular

EG_02357 dishevelled Intracellular

EG_04797 casein kinase II subunit alpha [EC:2.7.11.1] Intracellular

EG_06820 casein kinase II subunit beta Intracellular



EG_00839 catenin (cadherin-associated protein), beta 1 Intracellular

EG_05086 adenomatosis polyposis coli protein Intracellular

EG_06234 protein phosphatase 2 (formerly 2A), regulatory subunit A Intracellular

EG_05331 protein phosphatase 2 (formerly 2A), regulatory subunit B' Intracellular

EG_09037 protein phosphatase 2 (formerly 2A), regulatory subunit B' Transmembrane

EG_09643 protein phosphatase 2 (formerly 2A), catalytic subunit [EC:3.1.3.16] Intracellular

EG_01275 casein kinase 1, alpha [EC:2.7.11.1] Intracellular



EG_02768 axin 1 Intracellular

EG_07621 axin 1 Intracellular

EG_05129 transcription factor 7-like 1 Intracellular

EG_09910 transcription factor 7-like 1 Intracellular

EG_04822 lymphoid enhancer-binding factor 1 Extracellular

EG_04298 C-terminal binding protein Intracellular

EG_00424 groucho Intracellular

EG_01534 E1A/CREB-binding protein [EC:2.3.1.48] Intracellular


EG_01542 RuvB-like protein 1 (pontin 52) Intracellular

EG_03247 SMAD, mothers against DPP 2/3 Intracellular

EG_08649 SMAD, mothers against DPP 4 Intracellular

EG_00726 nemo like kinase [EC:2.7.11.24] Intracellular

EG_02547 cyclin D2 Intracellular

EG_00303 presenilin 1 [EC:3.4.23.-] Transmembrane



EG_00808 E3 ubiquitin-protein ligase SIAH1 [EC:6.3.2.19] Intracellular

EG_02169 S-phase kinase-associated protein 1 Intracellular

EG_03035 transducin (beta)-like 1 Intracellular

EG_09165 F-box and WD-40 domain protein 1/11 Intracellular

EG_07015 cullin 1 Intracellular

EG_00753 RING-box protein 1 Intracellular


EG_01894 vang-like Transmembrane

EG_03745 Ras homolog gene family, member A Intracellular



EG_07203 Rho-associated, coiled-coil containing protein kinase [EC:2.7.11.1] Intracellular



EG_00105 phospholipase C, beta [EC:3.1.4.11] Intracellular






EG_04551 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent Intracellular

Notch signaling pathway

EG_03907 delta Transmembrane

EG_04727 delta Transmembrane

EG_03160 jagged Transmembrane

EG_02945 recombining binding protein suppressor of hairless Intracellular

EG_02357 dishevelled Intracellular

EG_01408 numb Intracellular

EG_00581 disintegrin and metalloproteinase domain-containing protein 17 [EC:3.4.24.86] Transmembrane

EG_00303 presenilin 1 [EC:3.4.23.-] Transmembrane

EG_05300 presenilin enhancer 2 Transmembrane

EG_10236 anterior pharynx defective 1 Transmembrane



EG_00518 histone acetyltransferase [EC:2.3.1.48] Intracellular

EG_09353 SNW domain-containing protein 1 Intracellular

EG_04298 C-terminal binding protein Intracellular

EG_00424 groucho Intracellular

EG_08462 nuclear receptor co-repressor 2 Intracellular

EG_05298 CBF1 interacting corepressor Intracellular

EG_03724 histone deacetylase 1/2 [EC:3.5.1.98] Intracellular

EG_03033 Notch Transmembrane

EG_09449 Notch Transmembrane

Hedgehog signaling pathway

EG_08416 desert hedgehog Intracellular

EG_02418 patched 1 Transmembrane

EG_06701 suppressor of fused Intracellular

EG_05370 zinc finger protein GLI Intracellular

EG_00103 wingless-type MMTV integration site family, member 5 Intracellular

EG_04779 bone morphogenetic protein 2/4 Intracellular









EG_06602 casein kinase 1, gamma [EC:2.7.11.1] Transmembrane

EG_06884 casein kinase 1, epsilon [EC:2.7.11.1] Intracellular

EG_09165 F-box and WD-40 domain protein 1/11 Intracellular

TGF-beta signaling pathway

EG_08605 noggin Extracellular

EG_04779 bone morphogenetic protein 2/4 Intracellular

EG_06011 TGF-beta receptor type-1 [EC:2.7.11.30] Transmembrane

EG_00134 activin receptor type-1 [EC:2.7.11.30] Intracellular

EG_00742 SMAD, mothers against DPP 1/5/8 Extracellular

EG_03247 SMAD, mothers against DPP 2/3 Intracellular

EG_08649 SMAD, mothers against DPP 4 Intracellular

EG_04359 MAD, mothers against decapentaplegic interacting protein Intracellular

EG_09132 retinoblastoma-like Intracellular

EG_07253 E2F transcription factor 4/5 Intracellular



EG_07780 paired-like homeodomain transcription factor 2 Intracellular

EG_00753 RING-box protein 1 Intracellular

EG_07015 cullin 1 Intracellular

EG_02169 S-phase kinase-associated protein 1 Intracellular





EG_07203 Rho-associated, coiled-coil containing protein kinase [EC:2.7.11.1] Intracellular


EG_06234 protein phosphatase 2 (formerly 2A), regulatory subunit A Intracellular

EG_09643 protein phosphatase 2 (formerly 2A), catalytic subunit [EC:3.1.3.16] Intracellular

VEGF signaling pathway










EG_04551 nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent Intracellular

EG_05827 PTK2 protein tyrosine kinase 2 [EC:2.7.10.2] Extracellular

EG_04203 paxillin Intracellular

EG_00052 cell division control protein 42 Intracellular

EG_10922 p38 MAP kinase [EC:2.7.11.24] Extracellular

EG_00520 mitogen-activated protein kinase-activated protein kinase 2 [EC:2.7.11.1] Intracellular





Jak-STAT signaling pathway

EG_00574 Janus kinase 2 [EC:2.7.10.2] Transmembrane




EG_04527 suppressor of cytokine signaling 7 Intracellular

EG_06980 proto-oncogene serine/threonine-protein kinase Pim-1 [EC:2.7.11.1] Intracellular

EG_02547 cyclin D2 Intracellular

EG_08242 signal transducing adaptor molecule Intracellular

EG_09741 protein inhibitor of activated STAT Transmembrane

EG_02348 E3 ubiquitin-protein ligase CBL [EC:6.3.2.19] Intracellular

EG_03758 protein tyrosine phosphatase, non-receptor type 11 [EC:3.1.3.48] Intracellular






Calcium signaling pathway

EG_04067 solute carrier family 8 (sodium/calcium exchanger) Transmembrane

EG_00223 Ca2+ transporting ATPase, plasma membrane [EC:3.6.3.8] Transmembrane



EG_00434 muscarinic acetylcholine receptor M3 Transmembrane

EG_06134 5-hydroxytryptamine receptor 7 Transmembrane

EG_04343 guanine nucleotide binding protein (G protein), alpha polypeptide, olfactory type Intracellular

EG_01447 adenylate cyclase 9 [EC:4.6.1.1] Transmembrane



EG_00836 Ca2+ transporting ATPase, sarcoplasmic/endoplasmic reticulum [EC:3.6.3.8] Transmembrane

EG_06085 Ca2+ transporting ATPase, sarcoplasmic/endoplasmic reticulum [EC:3.6.3.8] Transmembrane

EG_02129 voltage-dependent calcium channel L type alpha-1C Transmembrane

EG_00598 voltage-dependent calcium channel R type alpha-1E Transmembrane

EG_01440 purinergic receptor P2X, ligand-gated ion channel 4 Transmembrane

EG_02600 purinergic receptor P2X, ligand-gated ion channel 4 Transmembrane

EG_09047 ryanodine receptor, invertebrate Transmembrane

EG_07340 metabotropic glutamate receptor 1/5 Transmembrane

EG_05456 tachykinin receptor 3 Transmembrane

EG_07666 thyrotropin-releasing hormone receptor Transmembrane

EG_07668 thyrotropin-releasing hormone receptor Transmembrane



EG_07164 receptor tyrosine-protein kinase erbB-4 [EC:2.7.10.1] Transmembrane

EG_08246 guanine nucleotide binding protein (G protein), alpha 11 Intracellular



EG_07477 voltage-dependent anion channel protein 2 Intracellular

EG_03392 solute carrier family 25 (mitochondrial carrier Transmembrane

EG_01226 calmodulin Intracellular

EG_05948 phosphorylase kinase gamma subunit [EC:2.7.11.19] Intracellular

EG_03964 phosphorylase kinase alpha/beta subunit Intracellular

EG_05885 phosphorylase kinase alpha/beta subunit Transmembrane

EG_05091 myosin-light-chain kinase [EC:2.7.11.18] Intracellular






EG_02083 calcium/calmodulin-dependent 3',5'-cyclic nucleotide phosphodiesterase [EC:3.1.4.17] Intracellular

EG_01761 1D-myo-inositol-triphosphate 3-kinase [EC:2.7.1.127] Transmembrane


Phosphatidylinositol signaling system

EG_00138 phosphatidylinositol 4-kinase [EC:2.7.1.67] Intracellular

EG_06619 phosphatidylinositol 4-kinase [EC:2.7.1.67] Transmembrane

EG_06161 phosphatidylinositol 4-kinase type 2 [EC:2.7.1.67] Intracellular

EG_00885 1-phosphatidylinositol-4-phosphate 5-kinase [EC:2.7.1.68] Intracellular



EG_01761 1D-myo-inositol-triphosphate 3-kinase [EC:2.7.1.127] Transmembrane

EG_01752 inositol-1,3,4-trisphosphate 5/6-kinase / inositol-tetrakisphosphate 1-kinase [EC:2.7.1.159

2.7.1.134] Intracellular

EG_03783 phosphatidylinositol 3-kinase [EC:2.7.1.137] Intracellular




EG_05933 phosphatidylinositol-4-phosphate 3-kinase [EC:2.7.1.154] Intracellular

EG_07555 phosphatidate cytidylyltransferase [EC:2.7.7.41] Transmembrane

EG_08148 CDP-diacylglycerol--inositol 3-phosphatidyltransferase [EC:2.7.8.11] Transmembrane

EG_02506 myo-inositol-1(or 4)-monophosphatase [EC:3.1.3.25] Intracellular

EG_03116 phosphatidylinositol-bisphosphatase [EC:3.1.3.36] Intracellular

EG_09836 phosphatidylinositol-bisphosphatase [EC:3.1.3.36] Intracellular

EG_01192 phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase [EC:3.1.3.67] Intracellular

EG_01551 inositol-1,4,5-trisphosphate 5-phosphatase [EC:3.1.3.56] Intracellular

EG_05943 inositol polyphosphate-4-phosphatase [EC:3.1.3.66] Intracellular




EG_01226 calmodulin Intracellular

mTOR signaling pathway



EG_10565 3-phosphoinositide dependent protein kinase-1 [EC:2.7.11.1] Intracellular


EG_06080 G protein beta subunit-like Intracellular

EG_00240 FKBP12-rapamycin complex-associated protein Intracellular

EG_07620 regulatory associated protein of mTOR Intracellular


EG_06300 translation initiation factor 4B Intracellular

EG_06727 small subunit ribosomal protein S6e Intracellular

EG_08339 eukaryotic translation initiation factor 4E binding protein 1 Intracellular

EG_00049 translation initiation factor 4E Intracellular

EG_01572 unc51-like kinase [EC:2.7.11.1] Extracellular

EG_03447 unc51-like kinase [EC:2.7.11.1] Intracellular


EG_01966 p90 ribosomal S6 kinase [EC:2.7.11.1] Intracellular


* The gene classification was based on KEGG database

EG_08787 serine/threonine-protein kinase 11 [EC:2.7.11.9] Intracellular

EG_03984 calcium binding protein 39 Intracellular

EG_03655 5'-AMP-activated protein kinase, catalytic alpha subunit [EC:2.7.11.11] Intracellular



Supplementary Table 37. Receptors in the E. granulosus genome

Gene ID Description* Class

EG_00047 hypothetical protein G Protein-Coupled Receptors

EG_00434 Muscarinic acetylcholine receptor M5 G Protein-Coupled Receptors

EG_00499 5-hydroxytryptamine receptor 1A G Protein-Coupled Receptors

EG_00539 Orexin receptor G Protein-Coupled Receptors

EG_00585 Probable G-protein coupled receptor G Protein-Coupled Receptors

EG_00654 FMRFamide receptor G Protein-Coupled Receptors

EG_00873 G protein-coupled receptor 158 G Protein-Coupled Receptors

EG_00877 5-hydroxytryptamine receptor G Protein-Coupled Receptors

EG_01208 conserved hypothetical protein G Protein-Coupled Receptors


EG_01417 conserved hypothetical protein G Protein-Coupled Receptors

EG_01547 Putative neuropeptide Y receptor G Protein-Coupled Receptors


EG_01723 Neuropeptide S receptor G Protein-Coupled Receptors


EG_01746 G-protein coupled receptor fragment G Protein-Coupled Receptors

EG_01843 Kappa-type opioid receptor G Protein-Coupled Receptors


EG_01918 frizzled 9/10 G Protein-Coupled Receptors

EG_02040 Growth hormone secretagogue receptor G Protein-Coupled Receptors

EG_02068 peptide (allatostatin/somatostatin)-like receptor G Protein-Coupled Receptors

EG_02175 Neuropeptide Y receptor G Protein-Coupled Receptors

EG_02268 Pyroglutamylated RFamide peptide receptor G Protein-Coupled Receptors

EG_02461 rhodopsin-like orphan GPCR G Protein-Coupled Receptors


EG_02706 G protein-coupled receptor G Protein-Coupled Receptors


EG_02974 partitioning defective protein 3 G Protein-Coupled Receptors

EG_03193 peptide (allatostatin/somatostatin)-like receptor G Protein-Coupled Receptors

EG_03510 Pyroglutamylated RFamide peptide receptor G Protein-Coupled Receptors







EG_05286 metabotropic glutamate receptor 2/3 G Protein-Coupled Receptors


EG_05456 Tachykinin-like peptides receptor G Protein-Coupled Receptors

EG_05480 Allatostatin-A receptor G Protein-Coupled Receptors




EG_06283 frizzled 4 G Protein-Coupled Receptors




EG_06561 G-protein coupled receptor fragment G Protein-Coupled Receptors

EG_06687 Cardioacceleratory peptide receptor G Protein-Coupled Receptors

EG_06944 Alpha-1A adrenergic receptor G Protein-Coupled Receptors

EG_07113 partitioning defective protein 3 G Protein-Coupled Receptors

EG_07145 frizzled 1/7 G Protein-Coupled Receptors




*Cytokine receptors and Nuclear receptors were defined based on KEGG classification, and GPCRs were

identified by searching IPR domain (IPR000276) in addition to KEGG classification

EG_07666 Thyrotropin-releasing hormone receptor G Protein-Coupled Receptors


EG_07838 G protein-coupled receptor 133 G Protein-Coupled Receptors

EG_07906 Probable muscarinic acetylcholine receptor gar-2 G Protein-Coupled Receptors





EG_09487 Neuropeptide FF receptor G Protein-Coupled Receptors

EG_09488 Cholecystokinin receptor G Protein-Coupled Receptors

EG_09734 Neuropeptides capa receptor G Protein-Coupled Receptors


EG_03329 epidermal growth factor receptor [EC:2.7.10.1] Cytokine receptors

EG_05468 epidermal growth factor receptor [EC:2.7.10.1] Cytokine receptors

EG_07164 receptor tyrosine-protein kinase erbB-4 [EC:2.7.10.1] Cytokine receptors

EG_02146 insulin-like growth factor 1 receptor [EC:2.7.10.1] Cytokine receptors

EG_02635 insulin-like growth factor 1 receptor [EC:2.7.10.1] Cytokine receptors

EG_01967 proto-oncogene tyrosine-protein kinase ROS [EC:2.7.10.1] Cytokine receptors

EG_04208 fibroblast growth factor receptor 2 [EC:2.7.10.1] Cytokine receptors

EG_02729 anaplastic lymphoma kinase [EC:2.7.10.1] Cytokine receptors

EG_04765 receptor tyrosine kinase-like orphan receptor 1 [EC:2.7.10.1] Cytokine receptors

EG_06011 TGF-beta receptor type-1 [EC:2.7.11.30] Cytokine receptors

EG_00134 activin receptor type-1 [EC:2.7.11.30] Cytokine receptors

EG_08053 thyroid hormone receptor alpha Nuclear receptors

EG_00780 nuclear receptor subfamily 1 group D member 3 Nuclear receptors

EG_08428 nuclear receptor subfamily 1 group I Nuclear receptors

EG_06875 hepatocyte nuclear factor 4-gamma Nuclear receptors

EG_01863 testicular receptor 4 Nuclear receptors

EG_03279 nuclear receptor subfamily 2 group E member 1 Nuclear receptors

EG_00119 COUP transcription factor 1 Nuclear receptors

EG_02914 nuclear receptor subfamily 4 group A member 2 Nuclear receptors



EG_04794 nuclear receptor subfamily 0 group A Nuclear receptors

EG_06786 nuclear receptor subfamily 0 group A Nuclear receptors


Supplementary Table 38. Genes involved in cell communication and expressed in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC) and


Gene ID

Sequencing read number Adult vs Onc Adult vs PSC Adult vs Cyst Onc vs PSC Onc vs Cyst PSC vs Cyst

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

Adult Onc PSC Cyst

EG_00052 28 3 14 16 1.51 1.49E-02 0.29 5.19E-01 0.61 1.67E-01 -1.22 1.17E-01 -0.90 2.16E-01 0.32 5.39E-01


EG_00105 6 0 31 8 1.87 1.89E-01 -3.08 1.55E-08 -0.61 4.30E-01 -4.95 7.09E-07 -2.48 6.60E-02 2.47 1.31E-06

EG_00106 12 0 29 13 2.87 1.66E-02 -1.98 2.05E-05 -0.31 5.90E-01 -4.85 1.73E-06 -3.18 7.79E-03 1.67 2.74E-04

EG_00149 2 0 8 0 Adult only Adult only -2.71 7.03E-03 Adult only Adult only -3.00 3.24E-02 both zero both zero 4.51 1.61E-03

EG_00238 3 2 8 4 -1.13 3.47E-01 -2.12 1.93E-02 -0.61 5.77E-01 -1.00 3.15E-01 0.52 6.48E-01 1.51 7.53E-02

EG_00285 4 0 6 2 Adult only Adult only -1.29 1.54E-01 0.80 5.07E-01 -2.58 8.64E-02 Cyst only Cyst only 2.10 5.37E-02

EG_00310 18 0 12 14 3.46 1.42E-03 -0.12 8.13E-01 0.17 7.44E-01 -3.58 4.66E-03 -3.29 5.08E-03 0.29 6.04E-01


EG_00360 19 6 47 20 -0.05 9.30E-01 -2.02 4.19E-08 -0.27 5.60E-01 -1.97 4.77E-05 -0.22 7.04E-01 1.75 1.77E-06

EG_00615 0 0 9 0 both zero both zero -4.88 4.07E-04 both zero both zero -3.17 1.99E-02 both zero both zero 4.68 7.52E-04

EG_00632 0 0 9 4 both zero both zero -4.88 4.07E-04 Cyst only Cyst only -3.17 1.99E-02 Cyst only Cyst only 1.68 4.16E-02

EG_00635 78 6 90 205 1.99 8.46E-07 -0.92 3.04E-05 -1.59 1.72E-18 -2.90 1.60E-12 -3.58 1.34E-28 -0.67 1.03E-04

EG_00666 27 1 6 1 3.04 2.21E-04 1.46 9.51E-03 4.56 3.39E-07 -1.58 2.12E-01 1.52 4.27E-01 3.10 1.66E-02

EG_00667 14 0 0 0 3.09 7.34E-03 4.10 9.11E-04 4.61 2.32E-04 both zero

both

zero both zero both zero both zero both zero

EG_00670 45 22 20 65 -0.68 4.18E-02 0.46 2.09E-01 -0.73 8.80E-03 1.14 8.26E-03 -0.04 8.85E-01 -1.19 4.30E-04

EG_00676 48 0 1 1 4.87 9.21E-09 4.88 1.71E-10 5.39 3.37E-12 PSC only

PSC

only Cyst only Cyst only 0.51 8.00E-01

EG_00677 90 0 11 10 5.78 1.54E-15 2.32 8.89E-11 2.97 1.29E-15 -3.46 7.55E-03 -2.80 2.81E-02 0.65 2.97E-01

EG_00718 11 6 8 11 -0.84 2.03E-01 -0.25 7.04E-01 -0.20 7.51E-01 0.59 4.33E-01 0.64 3.37E-01 0.05 9.35E-01

EG_00726 2 1 7 4 -0.71 6.51E-01 -2.52 1.54E-02 -1.20 3.24E-01 -1.80 1.39E-01 -0.48 7.21E-01 1.32 1.33E-01

EG_00773 3 0 1 2 Adult only Adult only 0.88 5.66E-01 0.39 7.65E-01 PSC only

PSC

only Cyst only Cyst only -0.49 7.75E-01


EG_00903 4 1 11 4 0.29 8.29E-01 -2.17 5.46E-03 -0.20 8.48E-01 -2.46 2.40E-02 -0.48 7.21E-01 1.97 1.21E-02


EG_01108 14 2 87 57 1.09 1.80E-01 -3.34 8.23E-23 -2.22 6.93E-09 -4.44 3.95E-16 -3.31 1.41E-08 1.12 3.16E-06

EG_01192 8 0 10 9 2.29 8.49E-02 -1.03 1.25E-01 -0.37 6.02E-01 -3.32 1.23E-02 -2.65 4.31E-02 0.67 3.11E-01

EG_01301 65 1 14 24 4.31 7.09E-11 1.51 3.86E-05 1.24 1.28E-04 -2.80 6.19E-03 -3.07 3.78E-04 -0.26 5.77E-01



EG_01323 17 10 28 9 -0.95 6.82E-02 -1.43 8.97E-04 0.72 2.13E-01 -0.48 3.20E-01 1.67 7.06E-03 2.15 2.29E-05




EG_01384 4 1 9 3 0.29 8.29E-01 -1.88 2.20E-02 0.22 8.41E-01 -2.17 5.82E-02 -0.07 9.63E-01 2.10 1.81E-02

EG_01394 2 0 4 1 Adult only Adult only -1.71 1.53E-01 0.80 6.39E-01 PSC only

PSC


EG_01421 28 7 80 21 0.29 5.68E-01 -2.22 2.70E-14 0.22 5.95E-01 -2.51 6.98E-10 -0.07 9.03E-01 2.44 1.08E-14

EG_01447 27 5 57 16 0.72 1.91E-01 -1.79 2.56E-08 0.56 2.11E-01 -2.51 1.99E-07 -0.16 8.02E-01 2.35 1.87E-10

EG_01453 4 13 18 25 -3.41 1.04E-06 -2.88 3.01E-05 -2.84 1.05E-05 0.53 2.91E-01 0.57 2.01E-01 0.04 9.28E-01

EG_01505 7 1 20 10 1.09 3.43E-01 -2.22 1.42E-04 -0.71 3.14E-01 -3.32 3.97E-04 -1.80 9.30E-02 1.51 4.92E-03

EG_01517 0 0 8 8 both zero both zero -4.71 9.22E-04 -4.20 3.60E-03 -3.00 3.24E-02 -2.48 6.60E-02 0.51 4.73E-01



EG_01574 0 0 4 0 both zero both zero PSC only PSC only both zero both zero PSC only

PSC

only both zero both zero PSC only PSC only

EG_01602 33 1 22 5 3.33 2.10E-05 -0.12 7.49E-01 2.53 8.81E-06 -3.46 1.58E-04 -0.80 5.29E-01 2.65 2.22E-05


EG_01710 15 9 17 6 -0.98 7.62E-02 -0.89 7.69E-02 1.13 8.86E-02 0.09 8.77E-01 2.10 2.83E-03 2.02 1.55E-03

EG_01801 1 0 3 1 Adult only Adult only -2.29 1.33E-01 -0.20 9.24E-01 PSC only

PSC



PSC



PSC



PSC


EG_02061 11 0 10 12 2.75 2.51E-02 -0.57 3.57E-01 -0.32 5.94E-01 -3.32 1.23E-02 -3.07 1.19E-02 0.25 6.82E-01


EG_02139 4 1 14 25 0.29 8.29E-01 -2.52 6.15E-04 -2.84 1.05E-05 -2.80 6.19E-03 -3.13 2.52E-04 -0.32 4.90E-01

EG_02146 13 1 54 13 1.99 4.44E-02 -2.76 1.47E-12 -0.20 7.30E-01 -4.75 7.91E-11 -2.18 3.00E-02 2.57 6.53E-11

EG_02362 1 1 7 2 -1.71 3.61E-01 -3.52 4.43E-03 -1.20 4.85E-01 -1.80 1.39E-01 0.52 7.47E-01 2.32 2.66E-02

EG_02513 6 0 17 6 1.87 1.89E-01 -2.21 4.71E-04 -0.20 8.14E-01 -4.08 4.31E-04 -2.07 1.54E-01 2.02 1.55E-03

EG_02537 6 0 23 6 1.87 1.89E-01 -2.65 6.33E-06 -0.20 8.14E-01 -4.52 2.65E-05 -2.07 1.54E-01 2.45 3.29E-05


PSC




PSC


EG_02613 17 0 54 11 3.37 2.15E-03 -2.38 7.58E-11 0.43 4.32E-01 -5.75 3.62E-11 -2.94 1.83E-02 2.81 7.29E-12

EG_02624 2 0 4 2 Adult only Adult only -1.71 1.53E-01 -0.20 8.92E-01 PSC only PSC Cyst only Cyst only 1.51 2.09E-01


only


EG_02933 9 0 3 10 2.46 5.66E-02 0.88 3.21E-01 -0.35 6.00E-01 PSC only

PSC

only -2.80 2.81E-02 -1.22 1.57E-01



EG_02997 25 25 17 24 -1.71 4.99E-06 -0.15 7.30E-01 -0.14 7.40E-01 1.56 3.45E-04 1.58 4.35E-05 0.02 9.71E-01

EG_02998 57 6 57 13 1.53 4.38E-04 -0.71 7.73E-03 1.94 7.06E-07 -2.24 1.10E-06 0.40 5.31E-01 2.65 9.03E-12


EG_03167 4 1 1 1 0.29 8.29E-01 1.29 3.64E-01 1.80 2.10E-01 1.00 6.12E-01 1.52 4.27E-01 0.51 8.00E-01


PSC


EG_03247 10 0 11 7 2.61 3.77E-02 -0.85 1.73E-01 0.32 6.50E-01 -3.46 7.55E-03 -2.29 1.01E-01 1.17 8.80E-02

EG_03281 32 21 14 10 -1.11 2.70E-03 0.48 2.68E-01 1.48 2.09E-03 1.59 8.89E-04 2.59 2.46E-07 1.00 8.95E-02

EG_03301 97 0 275 73 5.89 1.27E-16 -2.21 5.30E-45 0.21 3.34E-01 -8.10 1.48E-44 -5.67 2.86E-13 2.43 2.85E-46


EG_03333 2 1 1 2 -0.71 6.51E-01 0.29 8.63E-01 -0.20 8.92E-01 1.00 6.12E-01 0.52 7.47E-01 -0.49 7.75E-01


EG_03519 12 3 39 4 0.29 7.08E-01 -2.41 2.46E-08 1.39 7.27E-02 -2.70 7.56E-06 1.10 2.82E-01 3.80 3.29E-11

EG_03545 8 3 10 3 -0.30 7.25E-01 -1.03 1.25E-01 1.22 1.85E-01 -0.73 3.87E-01 1.52 1.68E-01 2.25 9.26E-03

EG_03579 1 0 1 0 Adult only Adult only -0.71 7.24E-01 Adult only Adult only PSC only

PSC


EG_03676 5 1 16 17 0.61 6.28E-01 -2.39 3.82E-04 -1.96 3.48E-03 -3.00 2.49E-03 -2.57 6.29E-03 0.43 3.92E-01

EG_03745 6 0 19 10 1.87 1.89E-01 -2.37 1.15E-04 -0.93 2.03E-01 -4.24 1.69E-04 -2.80 2.81E-02 1.44 8.27E-03

EG_03896 2 1 17 4 -0.71 6.51E-01 -3.80 5.09E-06 -1.20 3.24E-01 -3.08 1.57E-03 -0.48 7.21E-01 2.60 2.24E-04

EG_03922 12 0 17 24 2.87 1.66E-02 -1.21 2.27E-02 -1.20 1.57E-02 -4.08 4.31E-04 -4.07 7.37E-05 0.02 9.71E-01


PSC




PSC


EG_03985 19 0 19 10 3.53 9.46E-04 -0.71 1.24E-01 0.73 1.83E-01 -4.24 1.69E-04 -2.80 2.81E-02 1.44 8.27E-03

EG_03990 35 1 21 47 3.42 9.57E-06 0.03 9.42E-01 -0.62 5.24E-02 -3.39 2.50E-04 -4.04 3.11E-08 -0.65 7.25E-02

EG_03991 14 77 19 47 -4.17 3.48E-37 -1.15 2.09E-02 -1.94 1.38E-06 3.02 3.61E-21 2.23 1.27E-19 -0.79 3.22E-02


PSC



EG_04203 0 6 4 5 -5.30 2.03E-04 PSC only PSC only -3.52 3.00E-02 1.59 7.57E-02 1.78 2.90E-02 0.19 8.41E-01


EG_04277 2 1 3 5 -0.71 6.51E-01 -1.29 3.14E-01 -1.52 1.86E-01 -0.58 7.00E-01 -0.80 5.29E-01 -0.22 8.28E-01



EG_04315 14 0 13 14 3.09 7.34E-03 -0.60 2.71E-01 -0.20 7.20E-01 -3.70 2.88E-03 -3.29 5.08E-03 0.41 4.60E-01

EG_04395 120 65 111 333 -0.83 3.29E-05 -0.60 1.42E-03 -1.67 5.27E-31 0.23 2.79E-01 -0.84 9.62E-08 -1.07 2.07E-13

EG_04421 25 10 48 19 -0.39 4.07E-01 -1.65 1.35E-06 0.20 6.46E-01 -1.26 2.93E-03 0.59 2.50E-01 1.85 5.03E-07

EG_04449 1 0 0 6 Adult only Adult only Adult only Adult only -2.78 3.27E-02 both zero

both

zero -2.07 1.54E-01 -3.07 4.58E-02


EG_04458 15 1 78 31 2.19 2.15E-02 -3.09 2.59E-19 -1.24 4.63E-03 -5.28 2.29E-15 -3.44 2.17E-05 1.84 1.63E-10

EG_04717 7 0 5 7 2.09 1.27E-01 -0.22 7.87E-01 -0.20 8.00E-01 -2.32 1.41E-01 -2.29 1.01E-01 0.03 9.73E-01

EG_04734 1 1 6 1 -1.71 3.61E-01 -3.29 1.03E-02 -0.20 9.24E-01 -1.58 2.12E-01 1.52 4.27E-01 3.10 1.66E-02

EG_04793 11 1 19 21 1.75 9.02E-02 -1.50 4.61E-03 -1.13 3.09E-02 -3.24 6.28E-04 -2.87 1.27E-03 0.37 4.15E-01

EG_04797 58 4 50 64 2.14 8.22E-06 -0.49 7.07E-02 -0.34 1.96E-01 -2.64 5.38E-07 -2.48 2.00E-07 0.16 5.58E-01


EG_04977 10 1 35 46 1.61 1.28E-01 -2.52 6.12E-08 -2.40 5.11E-08 -4.12 4.06E-07 -4.01 4.68E-08 0.12 7.09E-01

EG_05061 2 0 0 0 Adult only Adult only Adult only Adult only Adult only Adult only both zero

both


EG_05063 7 0 7 21 2.09 1.27E-01 -0.71 3.51E-01 -1.78 2.35E-03 -2.80 5.29E-02 -3.87 2.60E-04 -1.07 6.54E-02

EG_05077 1 0 0 2 Adult only Adult only Adult only Adult only -1.20 4.85E-01 both zero

both

zero Cyst only Cyst only Cyst only Cyst only


EG_05091 5 5 24 6 -1.71 4.12E-02 -2.97 9.87E-07 -0.46 5.99E-01 -1.26 3.54E-02 1.26 1.24E-01 2.51 1.69E-05


PSC


EG_05190 20 0 23 23 3.61 6.29E-04 -0.91 3.59E-02 -0.40 3.67E-01 -4.52 2.65E-05 -4.01 1.12E-04 0.51 2.24E-01

EG_05304 8 0 19 7 2.29 8.49E-02 -1.96 6.29E-04 0.00 9.97E-01 -4.24 1.69E-04 -2.29 1.01E-01 1.95 1.04E-03


PSC


EG_05468 8 1 16 9 1.29 2.49E-01 -1.71 4.24E-03 -0.37 6.02E-01 -3.00 2.49E-03 -1.65 1.34E-01 1.34 2.15E-02



EG_05647 72 1 75 51 4.46 4.63E-12 -0.77 1.05E-03 0.30 2.48E-01 -5.22 8.28E-15 -4.15 6.09E-09 1.07 3.20E-05


PSC




EG_05821 149 26 149 93 0.81 7.09E-04 -0.71 1.64E-05 0.48 9.84E-03 -1.51 1.59E-09 -0.32 2.39E-01 1.19 1.54E-10

EG_05827 19 10 14 6 -0.79 1.19E-01 -0.27 5.90E-01 1.47 1.86E-02 0.52 3.67E-01 2.26 1.01E-03 1.74 9.42E-03

EG_05828 12 2 20 14 0.87 3.04E-01 -1.45 4.63E-03 -0.42 4.61E-01 -2.32 3.25E-03 -1.29 1.20E-01 1.03 3.77E-02


EG_05875 12 0 7 6 2.87 1.66E-02 0.07 9.18E-01 0.80 2.50E-01 -2.80 5.29E-02 -2.07 1.54E-01 0.74 3.55E-01


EG_05954 26 3 33 6 1.40 2.64E-02 -1.05 4.57E-03 1.92 8.68E-04 -2.46 9.22E-05 0.52 5.76E-01 2.97 3.59E-08

EG_06011 5 0 10 23 1.61 2.81E-01 -1.71 2.38E-02 -2.40 1.17E-04 -3.32 1.23E-02 -4.01 1.12E-04 -0.69 1.86E-01

EG_06059 6 1 5 9 0.87 4.67E-01 -0.45 6.04E-01 -0.78 2.99E-01 -1.32 3.20E-01 -1.65 1.34E-01 -0.33 6.69E-01

EG_06099 51 5 13 29 1.64 4.91E-04 1.26 1.43E-03 0.62 5.95E-02 -0.37 5.92E-01 -1.02 6.43E-02 -0.64 1.61E-01

EG_06100 79 26 25 64 -0.11 6.93E-01 0.95 1.61E-03 0.11 6.54E-01 1.06 6.82E-03 0.22 4.65E-01 -0.84 8.47E-03

EG_06182 14 2 27 26 1.09 1.80E-01 -1.66 2.79E-04 -1.09 1.97E-02 -2.75 1.67E-04 -2.18 2.15E-03 0.57 1.48E-01


EG_06234 5 0 5 21 1.61 2.81E-01 -0.71 4.30E-01 -2.27 3.72E-04 -2.32 1.41E-01 -3.87 2.60E-04 -1.56 1.38E-02

EG_06344 14 2 74 18 1.09 1.80E-01 -3.11 1.60E-18 -0.56 2.75E-01 -4.21 1.30E-13 -1.65 3.41E-02 2.55 2.51E-14



EG_06563 3 0 5 9 Adult only Adult only -1.45 1.57E-01 -1.78 4.64E-02 -2.32 1.41E-01 -2.65 4.31E-02 -0.33 6.69E-01

EG_06617 5 0 35 10 1.61 2.81E-01 -3.52 1.97E-10 -1.20 1.19E-01 -5.12 1.21E-07 -2.80 2.81E-02 2.32 7.05E-07

EG_06730 0 0 1 1 both zero both zero PSC only PSC only Cyst only Cyst only PSC only

PSC



PSC


EG_06820 32 21 25 61 -1.11 2.70E-03 -0.35 3.50E-01 -1.13 2.39E-04 0.75 6.88E-02 -0.02 9.49E-01 -0.77 1.70E-02

EG_06839 0 8 1 0 -5.71 1.67E-05 PSC only PSC only both zero both zero 4.00 6.73E-04 5.52 4.37E-05 PSC only PSC only

EG_06841 8 0 9 12 2.29 8.49E-02 -0.88 2.03E-01 -0.78 2.31E-01 -3.17 1.99E-02 -3.07 1.19E-02 0.10 8.75E-01




EG_07105 8 0 8 11 2.29 8.49E-02 -0.71 3.18E-01 -0.65 3.25E-01 -3.00 3.24E-02 -2.94 1.83E-02 0.05 9.35E-01

EG_07113 0 0 3 1 both zero both zero PSC only PSC only Cyst only Cyst only PSC only

PSC


EG_07171 32 6 31 21 0.70 1.64E-01 -0.66 6.40E-02 0.41 3.03E-01 -1.36 1.09E-02 -0.29 6.12E-01 1.08 7.27E-03



PSC




EG_07583 45 0 1 0 4.78 2.94E-08 4.78 7.13E-10 6.30 1.71E-11 PSC only

PSC



EG_07687 13 5 9 13 -0.33 6.12E-01 -0.18 7.70E-01 -0.20 7.30E-01 0.16 8.38E-01 0.14 8.36E-01 -0.02 9.78E-01


PSC


EG_07741 5 0 9 13 1.61 2.81E-01 -1.56 4.48E-02 -1.57 2.83E-02 -3.17 1.99E-02 -3.18 7.79E-03 -0.02 9.78E-01



EG_08084 28 2 33 15 2.09 2.27E-03 -0.95 9.45E-03 0.71 1.17E-01 -3.04 1.21E-05 -1.39 8.87E-02 1.65 1.19E-04

EG_08217 10 2 26 20 0.61 4.93E-01 -2.09 3.04E-05 -1.20 2.74E-02 -2.70 2.57E-04 -1.80 1.75E-02 0.89 3.53E-02

EG_08246 5 2 5 12 -0.39 7.11E-01 -0.71 4.30E-01 -1.46 4.64E-02 -0.32 7.76E-01 -1.07 2.16E-01 -0.75 3.03E-01

EG_08301 282 179 243 1836 -1.06 2.72E-17 -0.49 6.80E-05 -2.90 0.00E+00 0.56 3.87E-05 -1.84

1.09E-

118 -2.40

4.21E-

208

EG_08324 3 0 1 8 Adult only Adult only 0.88 5.66E-01 -1.61 8.03E-02 PSC only

PSC

only -2.48 6.60E-02 -2.49 3.89E-02

EG_08512 25 0 18 29 3.93 8.24E-05 -0.24 5.90E-01 -0.41 2.97E-01 -4.17 2.70E-04 -4.34 9.20E-06 -0.17 6.81E-01

EG_08610 0 0 2 5 both zero both zero PSC only PSC only -3.52 3.00E-02 PSC only

PSC

only -1.80 2.35E-01 -0.81 4.78E-01

EG_08623 6 0 12 12 1.87 1.89E-01 -1.71 1.33E-02 -1.20 8.75E-02 -3.58 4.66E-03 -3.07 1.19E-02 0.51 3.79E-01


EG_08659 3 2 4 5 -1.13 3.47E-01 -1.12 2.98E-01 -0.93 3.68E-01 0.00 9.97E-01 0.20 8.55E-01 0.19 8.41E-01


EG_08757 105 28 70 444 0.19 4.48E-01 -0.12 5.68E-01 -2.28 1.39E-60 -0.32 2.86E-01 -2.47 1.70E-42 -2.15 2.74E-45


PSC


EG_09069 628 0 90 104 8.58 1.49E-82 2.09 3.68E-58 2.40 3.93E-79 -6.49 2.17E-17 -6.18 3.48E-18 0.31 1.38E-01


PSC



PSC


EG_09156 5 3 9 7 -0.98 3.06E-01 -1.56 4.48E-02 -0.68 4.17E-01 -0.58 5.04E-01 0.30 7.40E-01 0.88 2.23E-01

EG_09295 15 0 47 42 3.19 4.87E-03 -2.36 1.52E-09 -1.68 3.59E-05 -5.55 6.82E-10 -4.87 4.64E-08 0.68 2.60E-02

EG_09507 3 1 3 23 -0.13 9.28E-01 -0.71 5.41E-01 -3.13 9.33E-06 -0.58 7.00E-01 -3.01 5.67E-04 -2.42 5.55E-04

EG_09526 6 0 0 6 1.87 1.89E-01 2.88 5.97E-02 -0.20 8.14E-01 both zero

both

zero -2.07 1.54E-01 -3.07 4.58E-02

EG_09643 19 0 23 31 3.53 9.46E-04 -0.98 2.51E-02 -0.90 2.93E-02 -4.52 2.65E-05 -4.44 4.03E-06 0.08 8.32E-01

EG_09705 4 0 0 0 Adult only Adult only Adult only Adult only Adult only Adult only both zero

both


EG_09709 14 1 14 25 2.09 3.09E-02 -0.71 1.87E-01 -1.03 2.85E-02 -2.80 6.19E-03 -3.13 2.52E-04 -0.32 4.90E-01

EG_09727 2 0 1 0 Adult only Adult only 0.29 8.63E-01 Adult only Adult only PSC only

PSC




PSC



EG_10565 2 0 0 1 Adult only Adult only Adult only Adult only 0.80 6.39E-01 both zero

both


EG_10650 481 126 164 461 0.22 6.65E-02 0.84 1.93E-12 -0.13 1.53E-01 0.62 1.55E-04 -0.35 4.02E-03 -0.98 1.09E-15

EG_10782 6 0 0 0 1.87 1.89E-01 2.88 5.97E-02 3.39 2.86E-02 both zero

both



Supplementary Table 39. Genes associated with the neuroendocrine and nervous system and expressed in adult worms (Adult), oncospheres (Onc),

protoscoleces (PSC) and hydatid cyst membrane (Cyst) of E. granulosus

Gene ID

EST reads number Adult vs Onc Adult vs PSC Adult vs Cyst Onc vs PSC Onc vs Cyst PSC vs Cyst


normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

EG_00031 7 3 2 4 -0.49 5.75E-01 1.10 2.91E-01 0.61 4.90E-01 1.59 2.09E-01 1.10 2.82E-01 -0.49 6.86E-01

EG_00037 5 6 7 15 -1.98 1.37E-02 -1.19 1.48E-01 -1.78 1.01E-02 0.78 3.15E-01 0.20 7.52E-01 -0.59 3.54E-01

EG_00051 1 0 1 2 Adult only Adult only -0.71 7.24E-01 -1.20 4.85E-01 PSC only PSC



EG_00122 0 0 0 0

both zero both zero both zero both zero both zero both zero both zero

both


EG_00133 25 2 51 19 1.93 6.24E-03 -1.74 2.39E-07 0.20 6.46E-01 -3.67 3.96E-09 -1.73 2.45E-02 1.94 9.15E-08

EG_00217 0 0 0 0


both


EG_00226 9 0 0 1 2.46 5.66E-02 3.46 1.21E-02 2.97 1.15E-02 both zero both



EG_00261 92 76 20 106 -1.44 2.41E-12 1.49 1.15E-06 -0.40 5.12E-02 2.93 2.44E-20 1.04 2.56E-07 -1.89 2.23E-10


EG_00360 19 6 47 20 -0.05 9.30E-01 -2.02 4.19E-08 -0.27 5.60E-01 -1.97 4.77E-05 -0.22 7.04E-01 1.75 1.77E-06

EG_00368 1 0 0 1 Adult only Adult only Adult only Adult only -0.20 9.24E-01 both zero both



EG_00420 8 0 14 12 2.29 8.49E-02 -1.52 1.41E-02 -0.78 2.31E-01 -3.80 1.79E-03 -3.07 1.19E-02 0.74 1.90E-01


EG_00446 5 0 39 26 1.61 2.81E-01 -3.67 8.61E-12 -2.57 2.00E-05 -5.28 2.10E-08 -4.18 3.20E-05 1.10 2.19E-03

EG_00449 25 11 6 24 -0.53 2.51E-01 1.35 1.88E-02 -0.14 7.40E-01 1.88 6.85E-03 0.39 4.07E-01 -1.49 1.10E-02

EG_00480 10 0 17 39 2.61 3.77E-02 -1.47 8.07E-03 -2.16 2.50E-06 -4.08 4.31E-04 -4.77 1.55E-07 -0.68 8.63E-02

EG_00505 10 8 18 45 -1.39 2.66E-02 -1.56 4.55E-03 -2.37 9.00E-08 -0.17 7.72E-01 -0.97 2.63E-02 -0.81 3.31E-02

EG_00585 4 0 4 2 Adult only Adult only -0.71 4.80E-01 0.80 5.07E-01 PSC only PSC




EG_00633 20 10 4 9 -0.71 1.53E-01 1.61 1.64E-02 0.96 8.55E-02 2.33 3.14E-03 1.67 7.06E-03 -0.66 4.27E-01

EG_00654 0 1 2 0 Onc only Onc only PSC only PSC only both zero both zero 0.00 9.98E-01 Onc only Onc only PSC only PSC only

EG_00662 14 0 15 19 3.09 7.34E-03 -0.81 1.26E-01 -0.64 2.08E-01 -3.90 1.11E-03 -3.73 6.05E-04 0.17 7.26E-01

EG_00684 10 1 33 19 1.61 1.28E-01 -2.43 2.52E-07 -1.12 4.11E-02 -4.04 1.01E-06 -2.73 2.84E-03 1.31 1.20E-03

EG_00719 4 0 1 3 Adult only Adult only 1.29 3.64E-01 0.22 8.41E-01 PSC only PSC


EG_00762 46 3 51 16 2.23 4.83E-05 -0.86 2.97E-03 1.33 6.86E-04 -3.08 4.37E-08 -0.90 2.16E-01 2.19 7.80E-09






EG_00876 1 1 0 1 -1.71 3.61E-01 Adult only Adult only -0.20 9.24E-01 Onc only Onc only 1.52 4.27E-01 Cyst only Cyst only

EG_00877 0 0 1 0 both zero both zero PSC only PSC only both zero both zero PSC only PSC


EG_00882 12 1 19 11 1.87 6.35E-02 -1.37 7.99E-03 -0.07 9.08E-01 -3.24 6.28E-04 -1.94 6.41E-02 1.30 1.44E-02

EG_00903 4 1 11 4 0.29 8.29E-01 -2.17 5.46E-03 -0.20 8.48E-01 -2.46 2.40E-02 -0.48 7.21E-01 1.97 1.21E-02


EG_00945 2 0 3 0 Adult only Adult only -1.29 3.14E-01 Adult only Adult only PSC only PSC


EG_00957 2 0 1 0 Adult only Adult only 0.29 8.63E-01 Adult only Adult only PSC only PSC



EG_01000 18 3 12 28 0.87 2.08E-01 -0.12 8.13E-01 -0.83 5.28E-02 -1.00 2.18E-01 -1.70 6.89E-03 -0.71 1.34E-01

EG_01004 5 0 37 6 1.61 2.81E-01 -3.60 4.13E-11 -0.46 5.99E-01 -5.21 5.02E-08 -2.07 1.54E-01 3.14 2.17E-09

EG_01013 12 1 4 15 1.87 6.35E-02 0.88 2.51E-01 -0.52 3.53E-01 -1.00 4.77E-01 -2.39 1.38E-02 -1.39 5.54E-02

EG_01027 2 25 7 46 -5.36 3.20E-14 -2.52 1.54E-02 -4.72 7.42E-13 2.84 1.81E-07 0.64 5.15E-02 -2.20 4.04E-06


only -1.80 2.35E-01 -1.81 1.82E-01

EG_01081 0 1 3 0 Onc only Onc only PSC only PSC only both zero both zero -0.58 7.00E-01 Onc only Onc only PSC only PSC only

EG_01101 9 14 4 8 -2.35 2.71E-05 0.46 5.74E-01 -0.03 9.71E-01 2.81 1.03E-04 2.33 7.43E-05 -0.49 5.68E-01

EG_01108 14 2 87 57 1.09 1.80E-01 -3.34 8.23E-23 -2.22 6.93E-09 -4.44 3.95E-16 -3.31 1.41E-08 1.12 3.16E-06

EG_01143 1 0 0 0 Adult only Adult only Adult only Adult only Adult only Adult only both zero both


EG_01147 1 1 2 0 -1.71 3.61E-01 -1.71 3.12E-01 Adult only Adult only 0.00 9.98E-01 Onc only Onc only PSC only PSC only

EG_01188 21 8 32 16 -0.32 5.38E-01 -1.32 8.51E-04 0.20 6.79E-01 -1.00 4.43E-02 0.52 3.61E-01 1.51 3.75E-04

EG_01192 8 0 10 9 2.29 8.49E-02 -1.03 1.25E-01 -0.37 6.02E-01 -3.32 1.23E-02 -2.65 4.31E-02 0.67 3.11E-01

EG_01255 8 2 10 24 0.29 7.60E-01 -1.03 1.25E-01 -1.78 1.15E-03 -1.32 1.59E-01 -2.07 4.38E-03 -0.75 1.45E-01

EG_01285 7 0 1 2 2.09 1.27E-01 2.10 8.95E-02 1.61 1.26E-01 PSC only PSC



only -2.07 1.54E-01 -1.07 3.25E-01



EG_01367 21 9 4 11 -0.49 3.32E-01 1.68 1.12E-02 0.74 1.58E-01 2.17 7.16E-03 1.23 4.24E-02 -0.95 2.29E-01

EG_01408 14 4 17 7 0.09 8.91E-01 -0.99 5.32E-02 0.80 2.14E-01 -1.08 1.16E-01 0.71 3.92E-01 1.79 3.42E-03

EG_01464 17 0 11 7 3.37 2.15E-03 -0.08 8.82E-01 1.08 7.87E-02 -3.46 7.55E-03 -2.29 1.01E-01 1.17 8.80E-02


EG_01502 38 3 30 16 1.95 6.89E-04 -0.37 2.87E-01 1.05 1.03E-02 -2.32 3.13E-04 -0.90 2.16E-01 1.42 1.02E-03

EG_01506 21 4 16 11 0.68 2.74E-01 -0.32 5.00E-01 0.74 1.58E-01 -1.00 1.55E-01 0.06 9.37E-01 1.05 5.78E-02




EG_01525 36 1 183 86 3.46 6.45E-06 -3.05 1.06E-42 -1.45 1.07E-07 -6.51 1.15E-33 -4.91 4.96E-15 1.60 6.97E-19

EG_01528 20 0 12 9 3.61 6.29E-04 0.03 9.56E-01 0.96 8.55E-02 -3.58 4.66E-03 -2.65 4.31E-02 0.93 1.39E-01

EG_01532 9 3 8 5 -0.13 8.76E-01 -0.54 4.35E-01 0.65 4.07E-01 -0.41 6.46E-01 0.78 4.21E-01 1.19 1.39E-01

EG_01547 9 1 8 5 1.46 1.79E-01 -0.54 4.35E-01 0.65 4.07E-01 -2.00 9.02E-02 -0.80 5.29E-01 1.19 1.39E-01


EG_01582 6 1 5 5 0.87 4.67E-01 -0.45 6.04E-01 0.07 9.38E-01 -1.32 3.20E-01 -0.80 5.29E-01 0.51 5.70E-01


EG_01632 1 1 5 1 -1.71 3.61E-01 -3.03 2.41E-02 -0.20 9.24E-01 -1.32 3.20E-01 1.52 4.27E-01 2.84 3.62E-02

EG_01641 7 0 2 2 2.09 1.27E-01 1.10 2.91E-01 1.61 1.26E-01 PSC only PSC Cyst only Cyst only 0.51 7.20E-01


only



EG_01715 48 2 18 71 2.87 1.68E-06 0.71 5.68E-02 -0.76 4.37E-03 -2.17 7.40E-03 -3.63 5.18E-11 -1.47 1.48E-05

EG_01723 0 0 0 0


both





EG_01734 0 0 0 0


both


EG_01746 0 1 3 0 Onc only Onc only PSC only PSC only both zero both zero -0.58 7.00E-01 Onc only Onc only PSC only PSC only



EG_01784 0 0 0 0


both


EG_01798 22 2 27 32 1.75 1.66E-02 -1.00 1.36E-02 -0.74 6.29E-02 -2.75 1.67E-04 -2.48 2.37E-04 0.27 4.72E-01

EG_01834 124 5 50 55 2.92 8.44E-15 0.60 7.92E-03 0.98 1.30E-05 -2.32 3.27E-06 -1.94 3.47E-05 0.38 1.78E-01



EG_01884 7 0 9 15 2.09 1.27E-01 -1.07 1.33E-01 -1.29 4.20E-02 -3.17 1.99E-02 -3.39 3.32E-03 -0.22 7.07E-01

EG_01895 10 1 17 24 1.61 1.28E-01 -1.47 8.07E-03 -1.46 4.85E-03 -3.08 1.57E-03 -3.07 3.78E-04 0.02 9.71E-01

EG_01901 8 3 7 10 -0.30 7.25E-01 -0.52 4.82E-01 -0.52 4.48E-01 -0.22 8.14E-01 -0.22 7.89E-01 0.00 9.99E-01

EG_01920 12 0 15 25 2.87 1.66E-02 -1.03 6.03E-02 -1.25 1.04E-02 -3.90 1.11E-03 -4.13 4.85E-05 -0.22 6.27E-01

EG_01924 11 0 11 17 2.75 2.51E-02 -0.71 2.42E-01 -0.82 1.35E-01 -3.46 7.55E-03 -3.57 1.41E-03 -0.11 8.35E-01

EG_01934 14 1 36 12 2.09 3.09E-02 -2.07 1.04E-06 0.03 9.62E-01 -4.17 2.58E-07 -2.07 4.39E-02 2.10 2.28E-06

EG_01938 0 0 1 4 both zero both zero PSC only PSC only Cyst only Cyst only PSC only PSC


EG_01947 5 2 4 9 -0.39 7.11E-01 -0.39 6.84E-01 -1.04 1.85E-01 0.00 9.97E-01 -0.65 4.82E-01 -0.66 4.27E-01

EG_01966 21 0 34 16 3.68 4.18E-04 -1.40 3.04E-04 0.20 6.79E-01 -5.08 1.87E-07 -3.48 2.16E-03 1.60 1.33E-04




EG_02025 0 0 0 0


both


EG_02040 5 0 12 6 1.61 2.81E-01 -1.97 6.32E-03 -0.46 5.99E-01 -3.58 4.66E-03 -2.07 1.54E-01 1.51 2.94E-02

EG_02055 12 0 8 13 2.87 1.66E-02 -0.12 8.47E-01 -0.31 5.90E-01 -3.00 3.24E-02 -3.18 7.79E-03 -0.19 7.68E-01


zero -1.80 2.35E-01 -2.81 8.11E-02

EG_02083 8 2 11 7 0.29 7.60E-01 -1.17 7.50E-02 0.00 9.97E-01 -1.46 1.12E-01 -0.29 7.70E-01 1.17 8.80E-02


EG_02095 16 1 104 20 2.29 1.48E-02 -3.41 2.34E-27 -0.52 2.83E-01 -5.70 4.12E-20 -2.80 1.90E-03 2.89 4.87E-22

EG_02098 15 7 3 9 -0.61 2.95E-01 1.61 3.77E-02 0.54 3.65E-01 2.23 1.61E-02 1.16 8.82E-02 -1.07 2.28E-01

EG_02120 108 20 133 211 0.72 8.95E-03 -1.01 3.78E-08 -1.16 2.44E-12 -1.73 3.57E-10 -1.88 1.97E-15 -0.15 3.30E-01









EG_02267 0 0 0 0


both






EG_02315 12 1 10 7 1.87 6.35E-02 -0.45 4.63E-01 0.58 3.87E-01 -2.32 3.74E-02 -1.29 2.72E-01 1.03 1.42E-01



EG_02335 10 0 12 6 2.61 3.77E-02 -0.97 1.09E-01 0.54 4.59E-01 -3.58 4.66E-03 -2.07 1.54E-01 1.51 2.94E-02

EG_02362 1 1 7 2 -1.71 3.61E-01 -3.52 4.43E-03 -1.20 4.85E-01 -1.80 1.39E-01 0.52 7.47E-01 2.32 2.66E-02

EG_02378 0 0 0 0


both


EG_02392 22 2 16 10 1.75 1.66E-02 -0.25 5.91E-01 0.94 7.50E-02 -2.00 1.66E-02 -0.80 3.73E-01 1.19 3.63E-02



EG_02477 12 1 3 8 1.87 6.35E-02 1.29 1.16E-01 0.39 5.50E-01 -0.58 7.00E-01 -1.48 1.92E-01 -0.90 3.24E-01



EG_02513 6 0 17 6 1.87 1.89E-01 -2.21 4.71E-04 -0.20 8.14E-01 -4.08 4.31E-04 -2.07 1.54E-01 2.02 1.55E-03

EG_02529 38 5 1 14 1.21 1.65E-02 4.54 2.06E-08 1.25 3.34E-03 3.33 1.20E-02 0.03 9.61E-01 -3.29 1.65E-03

EG_02547 4 0 1 1 Adult only Adult only 1.29 3.64E-01 1.80 2.10E-01 PSC only PSC


EG_02600 4 1 4 8 0.29 8.29E-01 -0.71 4.80E-01 -1.20 1.63E-01 -1.00 4.77E-01 -1.48 1.92E-01 -0.49 5.68E-01





EG_02697 7 1 41 17 1.09 3.43E-01 -3.26 2.48E-11 -1.48 1.68E-02 -4.35 2.67E-08 -2.57 6.29E-03 1.78 5.95E-06

EG_02702 7 0 4 12 2.09 1.27E-01 0.10 9.10E-01 -0.97 1.48E-01 PSC only PSC

only -3.07 1.19E-02 -1.07 1.64E-01



EG_02706 0 1 0 1 Onc only Onc only both zero both zero Cyst only Cyst only Onc only Onc only 1.52 4.27E-01 Cyst only Cyst only




EG_02728 11 3 16 25 0.16 8.37E-01 -1.25 2.35E-02 -1.38 5.83E-03 -1.41 6.08E-02 -1.54 1.76E-02 -0.13 7.74E-01

EG_02768 4 1 12 19 0.29 8.29E-01 -2.29 2.66E-03 -2.44 4.00E-04 -2.58 1.53E-02 -2.73 2.84E-03 -0.15 7.74E-01

EG_02845 0 0 0 0


both






EG_02938 5 2 3 2 -0.39 7.11E-01 0.03 9.78E-01 1.13 3.26E-01 0.42 7.40E-01 1.52 2.61E-01 1.10 3.96E-01

EG_02945 0 1 3 7 Onc only Onc only PSC only PSC only -4.00 7.22E-03 -0.58 7.00E-01 -1.29 2.72E-01 -0.71 4.54E-01


EG_02990 34 0 36 58 4.37 2.22E-06 -0.79 1.98E-02 -0.97 1.58E-03 -5.17 7.78E-08 -5.34 8.61E-11 -0.17 5.60E-01






EG_03083 4 2 1 6 -0.71 5.23E-01 1.29 3.64E-01 -0.78 3.97E-01 2.00 2.29E-01 -0.07 9.48E-01 -2.07 1.09E-01

EG_03132 17 1 77 44 2.37 1.02E-02 -2.89 5.39E-18 -1.57 5.76E-05 -5.26 3.51E-15 -3.94 1.06E-07 1.32 6.35E-07


EG_03167 4 1 1 1 0.29 8.29E-01 1.29 3.64E-01 1.80 2.10E-01 1.00 6.12E-01 1.52 4.27E-01 0.51 8.00E-01





EG_03193 0 0 0 0


both



EG_03232 2 0 0 1 Adult only Adult only Adult only Adult only 0.80 6.39E-01 both zero both


EG_03233 8 0 10 19 2.29 8.49E-02 -1.03 1.25E-01 -1.44 1.29E-02 -3.32 1.23E-02 -3.73 6.05E-04 -0.41 4.49E-01

EG_03275 13 4 22 16 -0.01 9.85E-01 -1.47 2.67E-03 -0.49 3.56E-01 -1.46 2.44E-02 -0.48 4.75E-01 0.97 3.73E-02




EG_03353 8 1 36 13 1.29 2.49E-01 -2.88 3.62E-09 -0.90 1.60E-01 -4.17 2.58E-07 -2.18 3.00E-02 1.98 5.18E-06


EG_03384 6 1 5 13 0.87 4.67E-01 -0.45 6.04E-01 -1.31 5.59E-02 -1.32 3.20E-01 -2.18 3.00E-02 -0.86 2.25E-01



EG_03438 15 8 23 31 -0.81 1.55E-01 -1.33 4.47E-03 -1.24 4.63E-03 -0.52 3.34E-01 -0.44 3.65E-01 0.08 8.32E-01

EG_03439 2 1 46 21 -0.71 6.51E-01 -5.23 7.46E-16 -3.59 7.41E-06 -4.52 2.81E-09 -2.87 1.27E-03 1.64 5.87E-06

EG_03454 0 0 0 0


both


EG_03458 11 0 27 13 2.75 2.51E-02 -2.00 3.47E-05 -0.44 4.59E-01 -4.75 4.27E-06 -3.18 7.79E-03 1.57 7.98E-04




EG_03482 6 1 14 3 0.87 4.67E-01 -1.93 3.62E-03 0.80 4.16E-01 -2.80 6.19E-03 -0.07 9.63E-01 2.74 5.79E-04


only -2.65 4.31E-02 -1.66 9.19E-02

EG_03561 5 4 5 3 -1.39 1.17E-01 -0.71 4.30E-01 0.54 6.01E-01 0.68 4.66E-01 1.93 5.95E-02 1.25 2.24E-01




EG_03650 7 1 26 25 1.09 3.43E-01 -2.60 1.98E-06 -2.03 2.87E-04 -3.70 2.51E-05 -3.13 2.52E-04 0.57 1.55E-01

EG_03681 9 0 9 12 2.46 5.66E-02 -0.71 2.90E-01 -0.61 3.34E-01 -3.17 1.99E-02 -3.07 1.19E-02 0.10 8.75E-01

EG_03689 7 0 27 18 2.09 1.27E-01 -2.66 9.55E-07 -1.56 1.04E-02 -4.75 4.27E-06 -3.65 9.25E-04 1.10 1.08E-02

EG_03724 10 4 8 8 -0.39 6.00E-01 -0.39 5.65E-01 0.13 8.53E-01 0.00 9.96E-01 0.52 5.19E-01 0.51 4.73E-01

EG_03727 2 2 5 3 -1.71 1.97E-01 -2.03 7.24E-02 -0.78 5.49E-01 -0.32 7.76E-01 0.93 4.44E-01 1.25 2.24E-01

EG_03774 41 2 9 8 2.64 2.24E-05 1.48 1.26E-03 2.16 6.32E-06 -1.17 2.25E-01 -0.48 6.14E-01 0.68 3.25E-01



EG_03880 12 0 16 19 2.87 1.66E-02 -1.12 3.74E-02 -0.86 1.02E-01 -4.00 6.92E-04 -3.73 6.05E-04 0.27 5.84E-01



EG_03959 4 1 7 6 0.29 8.29E-01 -1.52 8.27E-02 -0.78 3.97E-01 -1.80 1.39E-01 -1.07 3.82E-01 0.74 3.55E-01

EG_03974 2 0 0 0 Adult only Adult only Adult only Adult only Adult only Adult only both zero both both zero both zero both zero both zero


zero

EG_03989 5 1 16 14 0.61 6.28E-01 -2.39 3.82E-04 -1.68 1.71E-02 -3.00 2.49E-03 -2.29 2.04E-02 0.71 1.77E-01




EG_04002 3 1 7 8 -0.13 9.28E-01 -1.93 3.97E-02 -1.61 8.03E-02 -1.80 1.39E-01 -1.48 1.92E-01 0.32 6.64E-01

EG_04047 14 0 21 48 3.09 7.34E-03 -1.29 7.68E-03 -1.97 8.24E-07 -4.39 6.66E-05 -5.07 4.27E-09 -0.68 5.87E-02

EG_04077 3 1 1 2 -0.13 9.28E-01 0.88 5.66E-01 0.39 7.65E-01 1.00 6.12E-01 0.52 7.47E-01 -0.49 7.75E-01

EG_04079 16 3 6 18 0.70 3.25E-01 0.71 2.72E-01 -0.37 4.60E-01 0.00 9.96E-01 -1.07 1.30E-01 -1.07 8.80E-02

EG_04123 69 3 11 4 2.81 1.35E-08 1.94 4.05E-07 3.91 5.00E-15 -0.87 2.92E-01 1.10 2.82E-01 1.97 1.21E-02





EG_04277 2 1 3 5 -0.71 6.51E-01 -1.29 3.14E-01 -1.52 1.86E-01 -0.58 7.00E-01 -0.80 5.29E-01 -0.22 8.28E-01


EG_04326 0 0 0 1 both zero both zero both zero both zero Cyst only Cyst only both zero both


EG_04327 0 3 3 2 Onc only Onc only PSC only PSC only Cyst only Cyst only 1.00 3.80E-01 2.10 8.48E-02 1.10 3.96E-01

EG_04343 3 1 17 5 -0.13 9.28E-01 -3.21 1.96E-05 -0.93 3.68E-01 -3.08 1.57E-03 -0.80 5.29E-01 2.28 6.29E-04




EG_04429 41 15 57 18 -0.26 4.86E-01 -1.18 4.17E-05 0.99 1.11E-02 -0.92 1.18E-02 1.26 7.71E-03 2.18 1.15E-09







EG_04524 0 0 0 0


both











EG_04744 5 2 7 2 -0.39 7.11E-01 -1.19 1.48E-01 1.13 3.26E-01 -0.80 4.33E-01 1.52 2.61E-01 2.32 2.66E-02

EG_04745 20 0 6 31 3.61 6.29E-04 1.03 9.05E-02 -0.83 4.27E-02 -2.58 8.64E-02 -4.44 4.03E-06 -1.86 7.11E-04












EG_04809 0 0 0 0


both


EG_04842 0 0 0 0


both




EG_04848 6 0 6 12 1.87 1.89E-01 -0.71 3.88E-01 -1.20 8.75E-02 -2.58 8.64E-02 -3.07 1.19E-02 -0.49 4.84E-01

EG_04884 5 0 9 9 1.61 2.81E-01 -1.56 4.48E-02 -1.04 1.85E-01 -3.17 1.99E-02 -2.65 4.31E-02 0.51 4.46E-01

EG_04929 0 0 0 0


both



EG_04994 237 6 210 622 3.59 7.15E-32 -0.53 7.01E-05 -1.59 9.92E-53 -4.12 2.26E-35 -5.18 9.25E-

100 -1.05 4.00E-23

EG_05000 22 8 1 19 -0.25 6.22E-01 3.75 5.32E-05 0.02 9.71E-01 4.00 6.73E-04 0.27 6.19E-01 -3.73 1.17E-04

EG_05047 0 0 0 0


both
















EG_05261 43 4 99 87 1.71 9.50E-04 -1.91 1.52E-14 -1.21 3.28E-06 -3.62 3.19E-16 -2.92 3.68E-11 0.70 8.58E-04



EG_05304 8 0 19 7 2.29 8.49E-02 -1.96 6.29E-04 0.00 9.97E-01 -4.24 1.69E-04 -2.29 1.01E-01 1.95 1.04E-03








EG_05466 18 3 9 13 0.87 2.08E-01 0.29 6.06E-01 0.27 5.99E-01 -0.58 5.04E-01 -0.60 4.34E-01 -0.02 9.78E-01





EG_05585 0 1 0 0 Onc only Onc only both zero both zero both zero both zero Onc only Onc only Onc only Onc only both zero both zero





EG_05783 9 1 1 3 1.46 1.79E-01 2.46 3.40E-02 1.39 1.20E-01 1.00 6.12E-01 -0.07 9.63E-01 -1.07 4.86E-01

EG_05827 19 10 14 6 -0.79 1.19E-01 -0.27 5.90E-01 1.47 1.86E-02 0.52 3.67E-01 2.26 1.01E-03 1.74 9.42E-03







EG_05876 3 4 15 1 -2.13 3.48E-02 -3.03 9.40E-05 1.39 3.69E-01 -0.90 2.05E-01 3.52 9.17E-03 4.42 1.73E-05

EG_05904 9 8 10 16 -1.54 1.66E-02 -0.86 1.87E-01 -1.03 8.13E-02 0.68 3.03E-01 0.52 3.61E-01 -0.16 7.73E-01













EG_06015 16 20 5 7 -2.04 4.50E-06 0.97 1.49E-01 1.00 1.11E-01 3.00 1.61E-06 3.03 4.67E-08 0.03 9.73E-01

EG_06016 26 1 8 10 2.99 3.26E-04 0.99 6.10E-02 1.18 1.97E-02 -2.00 9.02E-02 -1.80 9.30E-02 0.19 7.77E-01


EG_06104 60 0 18 2 5.19 9.43E-11 1.03 3.37E-03 4.71 1.98E-14 -4.17 2.70E-04 Cyst only Cyst only 3.68 8.29E-06





EG_06207 5 0 17 8 1.61 2.81E-01 -2.47 1.85E-04 -0.87 2.81E-01 -4.08 4.31E-04 -2.48 6.60E-02 1.60 6.91E-03

EG_06242 0 0 0 10 both zero both zero both zero both zero -4.52 9.18E-04 both zero both

zero -2.80 2.81E-02 -3.81 4.90E-03

EG_06254 0 0 0 0


both


EG_06269 12 6 7 29 -0.71 2.68E-01 0.07 9.18E-01 -1.47 1.86E-03 0.78 3.15E-01 -0.75 1.51E-01 -1.54 4.16E-03

EG_06340 19 9 27 19 -0.64 2.21E-01 -1.22 3.98E-03 -0.20 6.76E-01 -0.58 2.47E-01 0.44 4.05E-01 1.02 1.64E-02


zero -2.29 1.01E-01 -3.29 2.60E-02
















only -2.29 1.01E-01 -0.71 4.54E-01

EG_06654 9 3 14 23 -0.13 8.76E-01 -1.35 2.48E-02 -1.55 3.94E-03 -1.22 1.17E-01 -1.42 3.20E-02 -0.20 6.72E-01

EG_06680 2 1 4 4 -0.71 6.51E-01 -1.71 1.53E-01 -1.20 3.24E-01 -1.00 4.77E-01 -0.48 7.21E-01 0.51 6.12E-01

EG_06707 46 9 65 59 0.64 1.24E-01 -1.21 8.81E-06 -0.55 4.95E-02 -1.85 4.44E-06 -1.19 2.67E-03 0.65 1.11E-02

EG_06760 17 4 27 35 0.37 5.67E-01 -1.38 1.52E-03 -1.24 2.71E-03 -1.75 4.38E-03 -1.61 3.70E-03 0.14 7.03E-01


EG_06762 6 0 4 5 1.87 1.89E-01 -0.12 8.91E-01 0.07 9.38E-01 PSC only PSC

only -1.80 2.35E-01 0.19 8.41E-01


only -2.07 1.54E-01 -2.07 1.09E-01


EG_06793 4 3 3 2 -1.30 1.98E-01 -0.29 7.85E-01 0.80 5.07E-01 1.00 3.80E-01 2.10 8.48E-02 1.10 3.96E-01

EG_06796 5 0 6 9 1.61 2.81E-01 -0.97 2.58E-01 -1.04 1.85E-01 -2.58 8.64E-02 -2.65 4.31E-02 -0.07 9.24E-01

EG_06798 0 0 0 0


both




EG_06839 0 8 1 0 -5.71 1.67E-05 PSC only PSC only both zero both zero 4.00 6.73E-04 5.52 4.37E-05 PSC only PSC only

EG_06889 5 1 6 4 0.61 6.28E-01 -0.97 2.58E-01 0.13 8.95E-01 -1.58 2.12E-01 -0.48 7.21E-01 1.10 2.30E-01

EG_06941 7 7 7 1 -1.71 1.57E-02 -0.71 3.51E-01 2.61 3.71E-02 1.00 1.80E-01 4.33 2.29E-04 3.32 7.62E-03






EG_06992 6 0 9 7 1.87 1.89E-01 -1.29 8.10E-02 -0.42 6.02E-01 -3.17 1.99E-02 -2.29 1.01E-01 0.88 2.23E-01

EG_07043 17 1 15 16 2.37 1.02E-02 -0.53 2.93E-01 -0.11 8.30E-01 -2.90 3.93E-03 -2.48 9.33E-03 0.42 4.13E-01

EG_07085 15 0 23 10 3.19 4.87E-03 -1.33 4.47E-03 0.39 5.03E-01 -4.52 2.65E-05 -2.80 2.81E-02 1.72 9.66E-04

EG_07086 20 2 32 14 1.61 3.11E-02 -1.39 5.18E-04 0.32 5.22E-01 -3.00 1.88E-05 -1.29 1.20E-01 1.71 1.05E-04







EG_07161 7 2 3 10 0.09 9.23E-01 0.51 5.85E-01 -0.71 3.14E-01 0.42 7.40E-01 -0.80 3.73E-01 -1.22 1.57E-01




EG_07204 9 3 35 16 -0.13 8.76E-01 -2.67 2.23E-08 -1.03 8.13E-02 -2.54 4.04E-05 -0.90 2.16E-01 1.64 7.86E-05

EG_07287 7 0 28 7 2.09 1.27E-01 -2.71 4.58E-07 -0.20 8.00E-01 -4.80 2.72E-06 -2.29 1.01E-01 2.51 3.37E-06















EG_07503 28 4 16 23 1.09 5.80E-02 0.10 8.22E-01 0.09 8.27E-01 -1.00 1.55E-01 -1.01 1.03E-01 -0.01 9.83E-01


only -2.07 1.54E-01 -0.07 9.38E-01





EG_07666 0 0 0 0


both




EG_07706 0 0 0 0


both



EG_07740 79 48 65 173 -0.99 3.18E-05 -0.43 7.16E-02 -1.33 1.94E-12 0.57 3.23E-02 -0.33 9.72E-02 -0.90 4.80E-06


only -3.39 3.32E-03 -2.39 5.66E-03


only -1.80 2.35E-01 -0.81 4.78E-01

EG_07805 1 1 5 1 -1.71 3.61E-01 -3.03 2.41E-02 -0.20 9.24E-01 -1.32 3.20E-01 1.52 4.27E-01 2.84 3.62E-02

EG_07810 4 3 13 4 -1.30 1.98E-01 -2.41 1.29E-03 -0.20 8.48E-01 -1.11 1.61E-01 1.10 2.82E-01 2.21 3.31E-03





EG_07907 16 3 41 82 0.70 3.25E-01 -2.07 1.95E-07 -2.55 4.70E-14 -2.77 3.24E-06 -3.25 1.47E-11 -0.49 6.73E-02



EG_07921 17 4 26 9 0.37 5.67E-01 -1.32 2.56E-03 0.72 2.13E-01 -1.70 6.24E-03 0.35 6.55E-01 2.04 7.82E-05



EG_08001 10 0 83 16 2.61 3.77E-02 -3.76 9.42E-24 -0.87 1.27E-01 -6.37 3.23E-16 -3.48 2.16E-03 2.89 6.92E-18








EG_08158 14 0 49 23 3.09 7.34E-03 -2.52 1.48E-10 -0.91 5.81E-02 -5.61 2.93E-10 -4.01 1.12E-04 1.60 4.34E-06

EG_08217 10 2 26 20 0.61 4.93E-01 -2.09 3.04E-05 -1.20 2.74E-02 -2.70 2.57E-04 -1.80 1.75E-02 0.89 3.53E-02

EG_08246 5 2 5 12 -0.39 7.11E-01 -0.71 4.30E-01 -1.46 4.64E-02 -0.32 7.76E-01 -1.07 2.16E-01 -0.75 3.03E-01


EG_08260 37 6 22 7 0.91 6.10E-02 0.04 9.13E-01 2.21 1.40E-05 -0.87 1.36E-01 1.30 8.41E-02 2.17 1.64E-04

EG_08271 7 3 2 27 -0.49 5.75E-01 1.10 2.91E-01 -2.14 9.66E-05 1.59 2.09E-01 -1.65 9.45E-03 -3.24 1.42E-05






EG_08337 7 1 10 10 1.09 3.43E-01 -1.22 7.83E-02 -0.71 3.14E-01 -2.32 3.74E-02 -1.80 9.30E-02 0.51 4.22E-01





EG_08434 1 1 12 5 -1.71 3.61E-01 -4.29 7.00E-05 -2.52 6.47E-02 -2.58 1.53E-02 -0.80 5.29E-01 1.78 1.46E-02

EG_08459 11 0 21 6 2.75 2.51E-02 -1.64 1.45E-03 0.68 3.42E-01 -4.39 6.66E-05 -2.07 1.54E-01 2.32 1.22E-04



only -2.65 4.31E-02 -1.07 2.28E-01

EG_08499 7 1 5 31 1.09 3.43E-01 -0.22 7.87E-01 -2.34 1.03E-05 -1.32 3.20E-01 -3.44 2.17E-05 -2.12 2.22E-04








EG_08555 18 5 51 54 0.13 8.25E-01 -2.21 1.39E-09 -1.78 1.07E-06 -2.35 2.20E-06 -1.91 4.80E-05 0.43 1.23E-01



EG_08584 0 0 0 0


both


EG_08601 6 2 8 13 -0.13 8.99E-01 -1.12 1.41E-01 -1.31 5.59E-02 -1.00 3.15E-01 -1.18 1.62E-01 -0.19 7.68E-01

EG_08609 5 3 22 4 -0.98 3.06E-01 -2.85 4.51E-06 0.13 8.95E-01 -1.87 7.12E-03 1.10 2.82E-01 2.97 6.84E-06



EG_08679 8 9 9 9 -1.88 3.47E-03 -0.88 2.03E-01 -0.37 6.02E-01 1.00 1.28E-01 1.52 1.71E-02 0.51 4.46E-01


EG_08747 11 1 2 8 1.75 9.02E-02 1.75 5.93E-02 0.26 6.91E-01 0.00 9.98E-01 -1.48 1.92E-01 -1.49 1.42E-01









EG_08954 36 13 5 0 -0.24 5.45E-01 2.14 9.70E-05 5.97 1.55E-09 2.38 6.34E-04 6.22 1.99E-07 3.84 1.72E-02

EG_08990 177 15 0 34 1.85 1.59E-12 7.76 2.44E-32 2.18 3.55E-21 5.91 7.84E-07 0.34 4.01E-01 -5.57 2.26E-08

EG_08991 29 12 1 17 -0.44 3.11E-01 4.15 1.67E-06 0.58 1.84E-01 4.59 1.61E-05 1.02 4.44E-02 -3.57 3.37E-04






EG_09165 8 0 5 8 2.29 8.49E-02 -0.03 9.69E-01 -0.20 7.86E-01 -2.32 1.41E-01 -2.48 6.60E-02 -0.16 8.38E-01

EG_09183 6 1 8 5 0.87 4.67E-01 -1.12 1.41E-01 0.07 9.38E-01 -2.00 9.02E-02 -0.80 5.29E-01 1.19 1.39E-01

EG_09206 11 1 7 16 1.75 9.02E-02 -0.06 9.33E-01 -0.74 1.88E-01 -1.80 1.39E-01 -2.48 9.33E-03 -0.68 2.75E-01

EG_09207 0 0 0 0


both



only -2.07 1.54E-01 -2.07 1.09E-01

EG_09254 0 0 0 0


both




EG_09292 6 3 8 4 -0.71 4.34E-01 -1.12 1.41E-01 0.39 6.72E-01 -0.41 6.46E-01 1.10 2.82E-01 1.51 7.53E-02

EG_09368 3 5 2 3 -2.45 1.02E-02 -0.12 9.23E-01 -0.20 8.68E-01 2.33 3.67E-02 2.26 2.01E-02 -0.07 9.56E-01

EG_09408 5 0 8 15 1.61 2.81E-01 -1.39 8.26E-02 -1.78 1.01E-02 -3.00 3.24E-02 -3.39 3.32E-03 -0.39 5.20E-01

EG_09487 0 0 0 0 both zero both zero both zero both zero both zero both zero both zero both both zero both zero both zero both zero


zero





EG_09507 3 1 3 23 -0.13 9.28E-01 -0.71 5.41E-01 -3.13 9.33E-06 -0.58 7.00E-01 -3.01 5.67E-04 -2.42 5.55E-04






EG_09648 20 0 46 73 3.61 6.29E-04 -1.91 1.64E-07 -2.06 3.88E-10 -5.52 1.04E-09 -5.67 2.86E-13 -0.15 5.66E-01




EG_09851 14 2 11 20 1.09 1.80E-01 -0.36 5.27E-01 -0.71 1.54E-01 -1.46 1.12E-01 -1.80 1.75E-02 -0.35 5.07E-01

EG_09854 0 1 0 4 Onc only Onc only both zero both zero Cyst only Cyst only Onc only Onc only -0.48 7.21E-01 Cyst only Cyst only

EG_09907 0 0 0 0


both



only -3.29 5.08E-03 -1.29 8.04E-02

EG_09972 10 0 39 32 2.61 3.77E-02 -2.67 3.44E-09 -1.87 1.01E-04 -5.28 2.10E-08 -4.48 2.67E-06 0.80 1.89E-02



EG_10233 12 1 12 4 1.87 6.35E-02 -0.71 2.22E-01 1.39 7.27E-02 -2.58 1.53E-02 -0.48 7.21E-01 2.10 6.35E-03

EG_10263 8 1 5 3 1.29 2.49E-01 -0.03 9.69E-01 1.22 1.85E-01 -1.32 3.20E-01 -0.07 9.63E-01 1.25 2.24E-01

EG_10291 38 18 9 56 -0.64 8.33E-02 1.37 3.40E-03 -0.75 1.19E-02 2.00 3.05E-04 -0.12 7.25E-01 -2.12 6.64E-07



EG_10379 6 0 12 10 1.87 1.89E-01 -1.71 1.33E-02 -0.93 2.03E-01 -3.58 4.66E-03 -2.80 2.81E-02 0.78 2.04E-01



EG_10417 2 2 6 8 -1.71 1.97E-01 -2.29 3.37E-02 -2.20 3.12E-02 -0.58 5.85E-01 -0.48 6.14E-01 0.10 8.98E-01

EG_10509 50 6 18 30 1.35 2.85E-03 0.76 3.71E-02 0.54 9.81E-02 -0.58 3.45E-01 -0.80 1.23E-01 -0.22 5.95E-01



EG_11133 104 32 11 31 -0.01 9.58E-01 2.53 2.35E-13 1.55 9.71E-09 2.54 2.60E-08 1.56 4.28E-06 -0.98 3.73E-02


Supplementary Table 40. Genes associated with the sensory system and expressed in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC)

and hydatid cyst membrane (Cyst) of E. granulosus


Gene ID* Adult Onc PSC Cyst log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_chang

e)

normalized

p-value log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

EG_04940 2 125 13 1 -7.68 1.62E-59 -3.41 1.28E-04 0.80 6.39E-01 4.27 1.14E-42 8.48 6.28E-50 4.21 7.72E-05

EG_01715 48 2 18 71 2.87 1.68E-06 0.71 5.68E-02 -0.76 4.37E-03 -2.17 7.40E-03 -3.63 5.18E-11 -1.47 1.48E-05

EG_03132 17 1 77 44 2.37 1.02E-02 -2.89 5.39E-18 -1.57 5.76E-05 -5.26 3.51E-15 -3.94 1.06E-07 1.32 6.35E-07

EG_04429 41 15 57 18 -0.26 4.86E-01 -1.18 4.17E-05 0.99 1.11E-02 -0.92 1.18E-02 1.26 7.71E-03 2.18 1.15E-09

EG_05260 18 0 41 58 3.46 1.42E-03 -1.90 8.71E-07 -1.88 1.49E-07 -5.35 8.85E-09 -5.34 8.61E-11 0.01 9.63E-01

EG_08600 21 0 56 25 3.68 4.18E-04 -2.12 6.05E-10 -0.45 2.94E-01 -5.80 1.58E-11 -4.13 4.85E-05 1.68 4.00E-07


EG_01269 72 0 4 8 5.46 1.07E-12 3.46 1.31E-12 2.97 8.60E-13 PSC only PSC only -2.48 6.60E-02 -0.49 5.68E-01

EG_01798 22 2 27 32 1.75 1.66E-02 -1.00 1.36E-02 -0.74 6.29E-02 -2.75 1.67E-04 -2.48 2.37E-04 0.27 4.72E-01

EG_10096 70 0 3 4 5.42 2.24E-12 3.84 3.76E-13 3.93 2.86E-15 PSC only PSC only Cyst only Cyst only 0.10 9.28E-01

EG_02369 5 0 35 35 1.61 2.81E-01 -3.52 1.97E-10 -3.00 8.36E-08 -5.12 1.21E-07 -4.61 7.84E-07 0.51 1.33E-01

EG_07086 20 2 32 14 1.61 3.11E-02 -1.39 5.18E-04 0.32 5.22E-01 -3.00 1.88E-05 -1.29 1.20E-01 1.71 1.05E-04

EG_00684 10 1 33 19 1.61 1.28E-01 -2.43 2.52E-07 -1.12 4.11E-02 -4.04 1.01E-06 -2.73 2.84E-03 1.31 1.20E-03

EG_02529 38 5 1 14 1.21 1.65E-02 4.54 2.06E-08 1.25 3.34E-03 3.33 1.20E-02 0.03 9.61E-01 -3.29 1.65E-03

EG_04745 20 0 6 31 3.61 6.29E-04 1.03 9.05E-02 -0.83 4.27E-02 -2.58 8.64E-02 -4.44 4.03E-06 -1.86 7.11E-04

EG_03689 7 0 27 18 2.09 1.27E-01 -2.66 9.55E-07 -1.56 1.04E-02 -4.75 4.27E-06 -3.65 9.25E-04 1.10 1.08E-02

EG_06654 9 3 14 23 -0.13 8.76E-01 -1.35 2.48E-02 -1.55 3.94E-03 -1.22 1.17E-01 -1.42 3.20E-02 -0.20 6.72E-01


EG_07085 15 0 23 10 3.19 4.87E-03 -1.33 4.47E-03 0.39 5.03E-01 -4.52 2.65E-05 -2.80 2.81E-02 1.72 9.66E-04

EG_04088 9 4 17 16 -0.54 4.78E-01 -1.63 4.42E-03 -1.03 8.13E-02 -1.08 1.16E-01 -0.48 4.75E-01 0.60 2.28E-01

EG_05321 15 3 12 15 0.61 4.01E-01 -0.39 4.81E-01 -0.20 7.10E-01 -1.00 2.18E-01 -0.80 2.76E-01 0.19 7.29E-01

EG_01408 14 4 17 7 0.09 8.91E-01 -0.99 5.32E-02 0.80 2.14E-01 -1.08 1.16E-01 0.71 3.92E-01 1.79 3.42E-03

EG_01924 11 0 11 17 2.75 2.51E-02 -0.71 2.42E-01 -0.82 1.35E-01 -3.46 7.55E-03 -3.57 1.41E-03 -0.11 8.35E-01

EG_06623 7 0 18 14 2.09 1.27E-01 -2.07 5.54E-04 -1.20 6.50E-02 -4.17 2.70E-04 -3.29 5.08E-03 0.88 8.46E-02

EG_03989 5 1 16 14 0.61 6.28E-01 -2.39 3.82E-04 -1.68 1.71E-02 -3.00 2.49E-03 -2.29 2.04E-02 0.71 1.77E-01


EG_02315 12 1 10 7 1.87 6.35E-02 -0.45 4.63E-01 0.58 3.87E-01 -2.32 3.74E-02 -1.29 2.72E-01 1.03 1.42E-01

EG_09507 3 1 3 23 -0.13 9.28E-01 -0.71 5.41E-01 -3.13 9.33E-06 -0.58 7.00E-01 -3.01 5.67E-04 -2.42 5.55E-04

EG_02083 8 2 11 7 0.29 7.60E-01 -1.17 7.50E-02 0.00 9.97E-01 -1.46 1.12E-01 -0.29 7.70E-01 1.17 8.80E-02

EG_09408 5 0 8 15 1.61 2.81E-01 -1.39 8.26E-02 -1.78 1.01E-02 -3.00 3.24E-02 -3.39 3.32E-03 -0.39 5.20E-01


EG_04343 3 1 17 5 -0.13 9.28E-01 -3.21 1.96E-05 -0.93 3.68E-01 -3.08 1.57E-03 -0.80 5.29E-01 2.28 6.29E-04




EG_06992 6 0 9 7 1.87 1.89E-01 -1.29 8.10E-02 -0.42 6.02E-01 -3.17 1.99E-02 -2.29 1.01E-01 0.88 2.23E-01




EG_07316 5 3 4 8 -0.98 3.06E-01 -0.39 6.84E-01 -0.87 2.81E-01 0.59 5.80E-01 0.10 9.05E-01 -0.49 5.68E-01

EG_00903 4 1 11 4 0.29 8.29E-01 -2.17 5.46E-03 -0.20 8.48E-01 -2.46 2.40E-02 -0.48 7.21E-01 1.97 1.21E-02




EG_04002 3 1 7 8 -0.13 9.28E-01 -1.93 3.97E-02 -1.61 8.03E-02 -1.80 1.39E-01 -1.48 1.92E-01 0.32 6.64E-01

EG_03959 4 1 7 6 0.29 8.29E-01 -1.52 8.27E-02 -0.78 3.97E-01 -1.80 1.39E-01 -1.07 3.82E-01 0.74 3.55E-01

EG_01582 6 1 5 5 0.87 4.67E-01 -0.45 6.04E-01 0.07 9.38E-01 -1.32 3.20E-01 -0.80 5.29E-01 0.51 5.70E-01

EG_03561 5 4 5 3 -1.39 1.17E-01 -0.71 4.30E-01 0.54 6.01E-01 0.68 4.66E-01 1.93 5.95E-02 1.25 2.24E-01


EG_02600 4 1 4 8 0.29 8.29E-01 -0.71 4.80E-01 -1.20 1.63E-01 -1.00 4.77E-01 -1.48 1.92E-01 -0.49 5.68E-01





EG_08079 4 0 4 3 Adult only Adult only -0.71 4.80E-01 0.22 8.41E-01 PSC only PSC only Cyst only Cyst only 0.93 3.93E-01



EG_01285 7 0 1 2 2.09 1.27E-01 2.10 8.95E-02 1.61 1.26E-01 PSC only PSC only Cyst only Cyst only -0.49 7.75E-01

EG_01295 2 0 2 6 Adult only Adult only -0.71 6.18E-01 -1.78 1.04E-01 PSC only PSC only -2.07 1.54E-01 -1.07 3.25E-01






EG_10568 2 1 3 1 -0.71 6.51E-01 -1.29 3.14E-01 0.80 6.39E-01 -0.58 7.00E-01 1.52 4.27E-01 2.10 1.72E-01






EG_05059 3 0 0 1 Adult only Adult only Adult only Adult only 1.39 3.69E-01 both zero both zero Cyst only Cyst only Cyst only Cyst only

EG_05252 3 1 0 0 -0.13 9.28E-01 Adult only Adult only Adult only Adult only Onc only Onc only Onc only Onc only both zero both zero


EG_00051 1 0 1 2 Adult only Adult only -0.71 7.24E-01 -1.20 4.85E-01 PSC only PSC only Cyst only Cyst only -0.49 7.75E-01




EG_01522 0 0 3 0 both zero both zero PSC only PSC only both zero both zero PSC only PSC only both zero both zero PSC only PSC only

















* All the sensory genes were revealed depending on GO classification.


Supplementary Table 41. Extracellular proteins in the E. granulosus genome

Gene ID Gene description

EG_00003 hypothetical protein


EG_00010 45 kDa antigen (Fragment)

EG_00020 Glycosyltransferase-like protein LARGE2

EG_00028 WD repeat-containing protein 11

EG_00061 Mediator of RNA polymerase II transcription subunit 20

EG_00121 conserved hypothetical protein

EG_00141 Kazal-type serine protease inhibitor domain-containing protein 1




EG_00197 ATP-dependent RNA helicase DDX19A

EG_00213 Segmentation protein even-skipped

EG_00248 F-box only protein 28

EG_00249 39S ribosomal protein L30, mitochondrial


EG_00287 Cell division protein kinase 16

EG_00296 Venom allergen 5

EG_00297 Calumenin-B


EG_00333 Intraflagellar transport protein 80 homolog


EG_00360 Exocyst complex component 4

EG_00370 DNA replication licensing factor MCM8


EG_00425 Stress-70 protein, mitochondrial

EG_00428 T-complex protein 1 subunit delta

EG_00432 N-acetylated-alpha-linked acidic dipeptidase 2

EG_00452 E3 SUMO-protein ligase RanBP2

EG_00457 Cytochrome b5 domain-containing protein 2 homolog






EG_00566 GPN-loop GTPase 2

EG_00568 EF-hand calcium-binding domain-containing protein 2

EG_00576 Mothers against decapentaplegic homolog 5


EG_00642 Plancitoxin-1

EG_00666 Tubulin alpha-1C chain






EG_00742 Mothers against decapentaplegic homolog 1


EG_00761 E3 ubiquitin-protein ligase CBL-B


EG_00803 Protein FAM188A

EG_00838 Histidyl-tRNA synthetase, cytoplasmic


EG_00871 40S ribosomal protein S25

EG_00872 N-acetyltransferase 9-like protein


EG_00886 UDP-glucose 6-dehydrogenase

EG_00888 Probable protein disulfide-isomerase A6

EG_00892 Pyruvate kinase isozymes M1/M2

EG_00910 PI-PLC X domain-containing protein 3



EG_00934 Neurogenic locus Notch protein


EG_00980 Rotatin

EG_01013 Palmitoyl-protein thioesterase 1


EG_01083 Procollagen galactosyltransferase 1

EG_01087 Cathepsin L

EG_01096 Vigilin

EG_01101 Survival of motor neuron-related-splicing factor 30


EG_01131 U6 snRNA-associated Sm-like protein LSm5

EG_01158 Spermidine synthase

EG_01222 Ubiquitin-like modifier-activating enzyme 6



EG_01260 Ankyrin repeat domain-containing protein 17

EG_01283 Immediate early response 3-interacting protein 1

EG_01291 Non-lysosomal glucosylceramidase

EG_01307 Transforming growth factor-beta-induced protein ig-h3

EG_01311 Homeobox protein abdominal-A

EG_01335 Protocadherin-11 X-linked


EG_01360 Cell division control protein 6 homolog



EG_01432 Cell cycle checkpoint control protein RAD9A


EG_01435 Secreted frizzled-related protein 2

EG_01442 Leishmanolysin-like peptidase


EG_01493 Transposon Ty3-I Gag-Pol polyprotein



EG_01502 6-phosphogluconate dehydrogenase, decarboxylating


EG_01541 Endoplasmic reticulum lectin 1


EG_01553 Translation initiation factor eIF-2B subunit beta

EG_01572 Serine/threonine-protein kinase ULK3

EG_01574 Protocadherin beta-14

EG_01576 Putative aminopeptidase W07G4.4


EG_01641 ral guanine nucleotide dissociation stimulator ralgds


EG_01649 Protein misato homolog 1


EG_01660 Xaa-Pro aminopeptidase 1

EG_01666 Intron-binding protein aquarius






EG_01778 Papilin

EG_01801 Protocadherin-11 X-linked



EG_01837 Zinc finger HIT domain-containing protein 1

EG_01855 Pyrroline-5-carboxylate reductase 3


EG_01866 PHD and RING finger domain-containing protein 1



EG_01930 Netrin-A

EG_01932 Ribonuclease Z, mitochondrial

EG_01965 C3 and PZP-like alpha-2-macroglobulin domain-containing protein 8

EG_01984 GG10341 gene product from transcript GG10341-RA


EG_01997 Murinoglobulin-2




EG_02097 similar to pol polyprotein


EG_02122 Zinc finger A20 and AN1 domain-containing stress-associated protein 9

EG_02149 Protein boule-like

EG_02190 Max dimerization protein 1

EG_02209 Histone-lysine N-methyltransferase E(z)

EG_02231 Contactin-1


EG_02251 Retinoic acid receptor RXR-gamma-A


EG_02266 Vacuolar protein sorting-associated protein 53 homolog




EG_02339 Ras-specific guanine nucleotide-releasing factor RalGPS2


EG_02374 Carboxypeptidase D


EG_02415 Procollagen-lysine,2-oxoglutarate 5-dioxygenase 2




EG_02437 Protein BAT5

EG_02458 Anosmin-1



EG_02491 Acyl-CoA synthetase family member 4 homolog



EG_02517 Golgi resident protein GCP60

EG_02550 Cleft lip and palate transmembrane protein 1


EG_02566 Lamin Dm0

EG_02572 GDP-fucose protein O-fucosyltransferase 2

EG_02598 Serine protease HTRA2, mitochondrial

EG_02612 jnk stimulatory phosphatase-related


EG_02640 Hypoxia up-regulated protein 1


EG_02666 THO complex subunit 1

EG_02682 UPF0556 protein C19orf10 homolog

EG_02683 Tensin-1


EG_02699 Cathepsin L1



EG_02721 Tissue alpha-L-fucosidase

EG_02725 Collagen alpha-3(VI) chain







EG_02903 ER degradation-enhancing alpha-mannosidase-like 1




EG_02954 Cytoplasmic dynein 2 heavy chain 1

EG_02958 Mitochondrial import inner membrane translocase subunit Tim16

EG_02997 Adapter molecule Crk

EG_03003 Maf-like protein Teth514_2136

EG_03006 Cell division protein kinase 14

EG_03016 LIM/homeobox protein Lhx9

EG_03017 Probable protein disulfide-isomerase ER-60

EG_03034 mRNA-capping enzyme




EG_03125 serine protease inhibitor

EG_03131 Geranylgeranyl transferase type-1 subunit beta

EG_03140 26S protease regulatory subunit 6A




EG_03163 S-adenosyl-L-methionine-dependent methyltransferase ftsjd2




EG_03226 Protein SDA1 homolog

EG_03257 ATP-binding cassette sub-family E member 1


EG_03276 Uncharacterized protein C6orf170 homolog


EG_03308 Neuropilin and tolloid-like protein 1

EG_03322 Transmembrane protein 129

EG_03329 Receptor tyrosine-protein kinase erbB-4

EG_03363 COBW domain-containing protein 1


EG_03397 Protein cereblon

EG_03420 U3 small nucleolar RNA-associated protein 14

EG_03428 Stromal cell-derived factor 2-like protein 1

EG_03430 Ras-related protein Rab-10

EG_03449 Transformation/transcription domain-associated protein

EG_03465 Ubiquitin-like protein 5

EG_03480 Four-domain proteases inhibitor



EG_03571 FK506-binding protein 2

EG_03592 Basement membrane-specific heparan sulfate proteoglycan core protein

EG_03614 Hydroxyacylglutathione hydrolase, mitochondrial

EG_03651 Lysosomal-trafficking regulator

EG_03668 similar to glycosaminoglycan N-acetylglucosaminyl N-deacetylase/N-sulfotransferase



EG_03729 26S protease regulatory subunit 4



EG_03787 Histone H4

EG_03832 Folate receptor beta

EG_03840 Alkaline phosphatase, tissue-nonspecific isozyme



EG_03866 Alcohol dehydrogenase [NADP+] B


EG_03871 Collagen alpha-1(XXIV) chain

EG_03881 Beta-1,3-galactosyltransferase 5 (Fragment)


EG_03885 asparagine-rich antigen

EG_03888 Antigen B

EG_03898 Tyrosine-protein kinase ABL2

EG_03899 Tyrosine-protein kinase ABL1

EG_03905 Tubulin-specific chaperone B


EG_03939 Nucleolar complex protein 2 homolog




EG_03969 Protocadherin-19

EG_04006 Triple functional domain protein

EG_04012 RPE-spondin

EG_04054 Putative ankyrin repeat protein RF_0381




EG_04106 Vasohibin-2



EG_04145 Tensin-4

EG_04160 Adenosine kinase 2

EG_04173 Glucose-6-phosphate 1-dehydrogenase

EG_04231 ATP-dependent DNA helicase 2 subunit 2

EG_04234 NAD kinase






EG_04281 CREB-binding protein

EG_04288 WD40 repeat-containing protein SMU1

EG_04296 Phorbol ester/diacylglycerol-binding protein unc-13

EG_04297 Tubulin beta chain

EG_04307 RNA pseudouridylate synthase domain-containing protein 1




EG_04348 Peptidyl-prolyl cis-trans isomerase E

EG_04370 Histone-lysine N-methyltransferase SETD2


EG_04374 Fatty-acid amide hydrolase 1

EG_04384 NEDD4-like E3 ubiquitin-protein ligase WWP1

EG_04404 Probable translation initiation factor eIF-2B subunit gamma


EG_04415 Prolyl 4-hydroxylase subunit alpha-1

EG_04418 3'(2'),5'-bisphosphate nucleotidase 1

EG_04422 AP-1 complex subunit gamma-1

EG_04430 DNA replication complex GINS protein PSF3



EG_04461 Neutral alpha-glucosidase AB





EG_04525 Acetylcholinesterase




EG_04611 Resact receptor



EG_04643 WD repeat and FYVE domain-containing protein 3

EG_04644 WD repeat and FYVE domain-containing protein 3

EG_04645 Apolipophorins

EG_04701 Alpha- and gamma-adaptin-binding protein p34

EG_04743 Isopentenyl-diphosphate Delta-isomerase 1


EG_04793 Laminin subunit gamma-3


EG_04814 GLIPR1-like protein 1


EG_04822 Protein pangolin, isoform J

EG_04836 Putative transferase C1orf69 homolog, mitochondrial


EG_04891 Retinal guanylyl cyclase 2




EG_04928 Pre-mRNA-splicing factor ISY1 homolog







EG_05074 2-aminoethanethiol dioxygenase

EG_05078 disintegrin and metalloproteinase domain-containing protein 10 [EC:3.4.24.81]

EG_05092 Suppressor of lurcher protein 1

EG_05099 Suppressor of lurcher protein 1





EG_05213 Retrovirus-related Pol polyprotein from transposon 17.6


EG_05229 Exportin-1



EG_05278 GPI transamidase component PIG-T


EG_05312 DnaJ homolog subfamily B member 11


EG_05339 Glutaminyl-peptide cyclotransferase-like protein

EG_05342 Tubulin alpha-3 chain

EG_05345 Proteasome subunit beta type-1-A

EG_05356 Transforming growth factor-beta-induced protein ig-h3


EG_05389 Translocon-associated protein subunit delta




EG_05482 Dendrotoxin-K (Fragment)

EG_05488 Kelch-like ECH-associated protein 1



EG_05542 Origin recognition complex subunit 2


EG_05597 Guanine nucleotide-binding protein subunit gamma-1




EG_05639 Serine/threonine-protein kinase N2

EG_05674 Protocadherin gamma-A10

EG_05679 Putative testis serine protease 5

EG_05684 Serine/threonine-protein phosphatase 6 regulatory subunit 3

EG_05689 Centrosomal protein of 97 kDa



EG_05745 Transforming growth factor-beta receptor-associated protein 1

EG_05747 Transforming growth factor-beta receptor-associated protein 1

EG_05763 Ribosomal protein S6 kinase beta-1





EG_05820 putative kazal-type serine protease inhibitor domain protein

EG_05827 Focal adhesion kinase 1

EG_05837 laminin gamma-3 chain




EG_05873 Protein FAM116B


EG_05884 Ribose-phosphate pyrophosphokinase 1

EG_05939 DNA-directed RNA polymerase III subunit RPC10

EG_05941 Homeobox protein Meis1


EG_05987 LisH domain-containing protein ARMC9


EG_06008 Alpha-tocopherol transfer protein-like





EG_06095 Ankyrin repeat domain-containing protein 10

EG_06111 Irregular chiasm C-roughest protein

EG_06115 Iron/zinc purple acid phosphatase-like protein











EG_06280 Enteropeptidase


EG_06295 WD repeat-containing protein 7


EG_06324 Putative ATP-dependent RNA helicase DHX33

EG_06331 UDP-glucose 6-dehydrogenase

EG_06351 Cell division cycle protein 123 homolog

EG_06372 Peroxidasin homolog

EG_06374 Peroxidasin







EG_06441 U6 snRNA-associated Sm-like protein LSm8

EG_06444 Mitochondrial inner membrane protease subunit 1

EG_06461 Protein phosphatase Slingshot homolog 1

EG_06475 60S ribosomal protein L18





EG_06569 16 kDa calcium-binding protein

EG_06585 Methyltransferase-like protein 2

EG_06604 ATP-dependent rRNA helicase spb4


EG_06658 78 kDa glucose-regulated protein

EG_06664 Phospholipase D2


EG_06730 Protocadherin 18

EG_06738 Protein phosphatase methylesterase 1

EG_06744 DNA repair and recombination protein RAD54-like (Fragment)

EG_06746 Intraflagellar transport protein 140 homolog


EG_06748 Glutathione peroxidase

EG_06754 Threonyl-tRNA synthetase, cytoplasmic

EG_06776 U2 small nuclear ribonucleoprotein A'


EG_06797 LIM/homeobox protein Lhx1


EG_06805 AntigenB

EG_06810 Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 2


EG_06828 Nitrilase and fragile histidine triad fusion protein NitFhit


EG_06842 Reticulocalbin-1

EG_06850 39S ribosomal protein L3, mitochondrial


EG_06872 Diacylglycerol kinase zeta



EG_06932 Heat shock 70 kDa protein 4

EG_06934 Transmembrane protein 131

EG_06952 BR serine/threonine-protein kinase 2

EG_06953 BR serine/threonine-protein kinase 2


EG_07001 Growth hormone-regulated TBC protein 1-A

EG_07048 Complement C1q tumor necrosis factor-related protein 3



EG_07099 Peptidase inhibitor R3HDML





EG_07152 Splicing factor 3B subunit 1

EG_07157 ADAMTS-like protein 3

EG_07162 Dual specificity protein phosphatase 1

EG_07163 Receptor tyrosine-protein kinase erbB-4


EG_07178 Histone deacetylase 10


EG_07238 Propionyl-CoA carboxylase alpha chain, mitochondrial

EG_07242 Trypsin inhibitor



EG_07266 Kunitz-type serine protease inhibitor BmTI-A (Fragments)

EG_07268 Isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial


EG_07316 ATP-binding cassette sub-family A member 7




EG_07383 Protein DJ-1


EG_07396 28S ribosomal protein S14, mitochondrial




EG_07468 Kelch-like protein 18

EG_07474 Acetylcholinesterase

EG_07485 Centromere/kinetochore protein zw10 homolog


EG_07509 D-tyrosyl-tRNA(Tyr) deacylase



EG_07562 Thiosulfate sulfurtransferase/rhodanese-like domain-containing protein 1





EG_07597 Selenocysteine-specific elongation factor

EG_07641 Inositol monophosphatase 3


EG_07646 Receptor-type tyrosine-protein phosphatase F


EG_07648 Receptor-type tyrosine-protein phosphatase F

EG_07654 Chronic lymphocytic leukemia deletion region gene 6 protein




EG_07687 Dual specificity mitogen-activated protein kinase kinase 1 (Fragment)




EG_07721 Uncharacterized protein yfeX


EG_07739 Mitogen-activated protein kinase scaffold protein 1



EG_07778 Transforming protein v-Fos/v-Fox

EG_07798 DNA excision repair protein ERCC-6

EG_07801 Glutamate receptor, ionotropic kainate 2

EG_07834 Serine/threonine-protein phosphatase PGAM5, mitochondrial






EG_07925 Dihydropteridine reductase

EG_07944 serine-type protease inhibitor








EG_08030 Electrogenic sodium bicarbonate cotransporter 1


EG_08086 Probable beta-D-xylosidase 2



EG_08107 Calreticulin

EG_08108 Calreticulin

EG_08111 Protein notum homolog

EG_08119 Rac GTPase-activating protein 1

EG_08169 Ovarian cancer-associated gene 2 protein homolog

EG_08188 Enkurin


EG_08202 Endoplasmic reticulum resident protein 44





EG_08320 GLIPR1-like protein 1

EG_08367 SAGA-associated factor 29 homolog




EG_08410 Tegument antigen

EG_08447 DnaJ homolog subfamily C member 25 homolog

EG_08450 Zinc metalloproteinase nas-29


EG_08498 Leucine-rich repeat and death domain-containing protein LOC401387 homolog

EG_08499 Lysosomal alpha-glucosidase

EG_08512 Collagen alpha-1(IV) chain

EG_08532 Pantothenate kinase 4

EG_08543 Exostosin-like 3

EG_08549 Dynamin-3



EG_08605 Noggin-3





EG_08654 Lysyl oxidase homolog 2




EG_08713 Uncharacterized protein SJCHGC09766

EG_08716 WAP, kazal, immunoglobulin, kunitz and NTR domain-containing protein 2


EG_08721 Venom basic protease inhibitor 2

EG_08725 Ectonucleotide pyrophosphatase/phosphodiesterase family member 4









EG_08814 Disco-interacting protein 2 homolog C





EG_08916 Peptidylprolyl isomerase-like 5

EG_08924 Uncharacterized protein F21D5.5

EG_08944 Protein disulfide-isomerase

EG_08950 Protein 4.1


EG_08967 Acyl-CoA dehydrogenase family member 9, mitochondrial


EG_08973 ubiquitin carboxyl-terminal hydrolase 30 [EC:3.1.2.15]


EG_09006 Fused toxin protein


EG_09008 Protein AMBP


EG_09022 Huntingtin





EG_09081 Ufm1-specific protease 2

EG_09089 Glycerol-3-phosphate dehydrogenase [NAD+], cytoplasmic


EG_09122 origin recognition complex subunit


EG_09138 Protein lin-54


EG_09217 5'-3' exoribonuclease 1





EG_09327 Zonadhesin




EG_09390 myo inositol monophosphatase






EG_09450 Sushi, nidogen and EGF-like domain-containing protein 1

EG_09490 Spondin-1

EG_09498 Coproporphyrinogen-III oxidase, mitochondrial




EG_09569 Glucosidase 2 subunit beta





EG_09673 Tetratricopeptide repeat protein 5

EG_09685 ADP-ribosylation factor

EG_09692 N(4)-(Beta-N-acetylglucosaminyl)-L-asparaginase (Fragment)

EG_09705 Tubulin alpha-1C chain

EG_09743 collagen, type XV, alpha 1

EG_09747 epidermal growth factor

EG_09763 Vacuolar protein sorting-associated protein 45







EG_09832 Cadmium metallothionein precursor (MT-Cd) (Cd-MT)



EG_09890 Protein F37C4.5



EG_09931 Protein canopy homolog 4







EG_09998 Ectonucleotide pyrophosphatase/phosphodiesterase family member 5




EG_10054 Actin-2


EG_10065 Coatomer subunit delta



EG_10096 Amyloid beta A4 protein





EG_10121 Lysosomal protective protein





EG_10234 Nuclear receptor subfamily 5 group A member 2



EG_10301 Heat shock cognate 70 kDa protein 4





EG_10348 60S ribosomal protein L24

EG_10355 Ankyrin repeat and death domain-containing protein ENSP00000345065


EG_10430 Bifunctional heparan sulfate N-deacetylase/N-sulfotransferase 2






EG_10512 Proto-oncogene Wnt-1





EG_10536 Tyrosine-protein kinase SPK-1




EG_10569 Nuclear pore complex protein Nup98















EG_10732 Deoxynucleoside kinase















EG_10858 Protein argonaute-2





EG_10919 Mitogen-activated protein kinase 14

EG_10921 Coatomer subunit zeta-1

EG_10922 Mitogen-activated protein kinase 14














































Supplementary Table 42. Highly up-regulated secreted proteins in adult worms (Adult),

oncospheres (Onc), protoscoleces (PSC) and hydatid cyst membrane (Cyst) of E. granulosus

Gene ID Adult Onc PSC Cyst Gene description

a. PSC

EG_00360 19 6 47 20 exocyst complex component 4

EG_02458 2 1 18 1 kallmann syndrome 1 sequence

EG_03276 11 4 32 7 protein broad-minded-like

EG_03651 3 1 19 0 beige beach

EG_04409 0 0 27 0 glutamate receptor nmda

EG_04645 9 2 66 5 apolipophorin precursor protein

EG_05747 3 0 29 5

transforming growth factor-beta receptor-associated

protein 1

EG_05820 5 3 37 2 agrin

EG_05842 24 1 47 13 hypothetical protein [Schistosoma mansoni]

EG_06934 7 4 42 6 transmembrane protein 131

EG_07157 19 0 45 21 adamts-like 3

EG_07163 4 0 21 3 epidermal growth factor receptor

b. Adult

EG_00682 86 0 0 0 chorion class high-cysteine protein 12-like

precursor

EG_00761 70 0 1 2 e3 ubiquitin-protein ligase cbl-b

EG_02251 501 0 5 1 retinoid x receptor alpha

EG_03871 113 0 25 11 virulence-associated trimeric autotransporter

EG_07148 165 0 10 16 hypothetical protein

EG_07242 46 0 1 5 serine protease inhibitor

EG_07562 65 0 5 2 heat shock protein 67b2

EG_08238 199 0 1 0 diagnostic antigen gp50



EG_08713 113 0 5 13 cadmium metallothionein precursor (mt-cd) (cd-mt)

EG_08716 155 0 0 0 kunitz-type protease inhibitor 3-like

EG_08725 97 0 0 0 ectonucleotide pyrophosphatase phosphodiesterase

5 ( function)


EG_10089 276 0 0 1 low molecular weight antigen 2

EG_10096 70 0 3 4 kunitz domain-containing


EG_10316 60 0 0 0 chorion class high-cysteine protein 12-like

precursor

c. Onc

EG_00010 1 533 0 0 host-protective antigen


EG_03017 51 49 29 50 protein disulfide-isomerase a3

EG_03592 64 61 24 36 low-density lipoprotein receptor


EG_05345 48 55 11 42 proteasome ( macropain) beta 1

EG_08543 12 29 4 0 exostoses -like 3


EG_08721 6 108 0 0

serine protease inhibitor- with kunitz and wap

domains 1


EG_10234 3 11 8 2 ftz-f1 nuclear receptor-like protein

d. Cyst

EG_00428 88 4 31 58 t-complex protein 1 subunit delta

EG_02566 18 1 29 46 lamin dm0-like

EG_02699 3 0 5 31 cathepsin l-like cysteine Peptidase

EG_05639 19 0 38 31 serine threonine-protein kinase n2

EG_06280 20 0 17 38 mastin precursor


EG_06748 167 9 57 116 phospholipid-hydroperoxide glutathione peroxidase

EG_06754 87 1 92 183 threonyl-trna isoform a

EG_06805 1 0 1 1920 antigen B subunit 1

EG_06932 82 16 135 154 heat shock 70kda protein 4

EG_08002 0 0 91 153 eg19 antigen

EG_08512 25 0 18 29 collagen alpha-1 chain



EG_09327 1 0 13 57 Zonadhesin

EG_09490 17 2 14 51 spon-1 protein

EG_09802 29 0 0 30 hypothetical protein [Schistosoma mansoni]


Supplementary Table 43. Expression of genes associated with immune defense in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC) and


Gene ID



normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

log2(Fold_change)

normalized p-value

Toll-lke



EG_02516 14 6 6 13 -0.49 4.28E-01 0.51 4.39E-01 -0.09 8.73E-01 1.00 2.14E-01 0.40 5.31E-01 -0.60 3.77E-01


leucine-rich repeat proteins

EG_04654 144 0 63 18 6.46 1.24E-23 0.48 1.88E-02 2.80 9.10E-23 -5.97 9.01E-13 -3.65 9.25E-04 2.32 2.84E-11

EG_02969 14 5 29 12 -0.23 7.25E-01 -1.76 8.49E-05 0.03 9.62E-01 -1.53 7.28E-03 0.26 7.10E-01 1.79 1.38E-04

EG_00948 7 0 20 7 2.09 1.27E-01 -2.22 1.42E-04 -0.20 8.00E-01 -4.32 1.06E-04 -2.29 1.01E-01 2.03 5.67E-04

EG_09790 13 0 17 11 2.99 1.11E-02 -1.10 3.55E-02 0.05 9.38E-01 -4.08 4.31E-04 -2.94 1.83E-02 1.14 3.70E-02


EG_04751 8 7 14 5 -1.52 2.67E-02 -1.52 1.41E-02 0.48 5.51E-01 0.00 9.94E-01 2.00 1.07E-02 2.00 4.28E-03

EG_01685 8 0 10 18 2.29 8.49E-02 -1.03 1.25E-01 -1.37 2.03E-02 -3.32 1.23E-02 -3.65 9.25E-04 -0.33 5.45E-01

EG_01650 8 0 10 7 2.29 8.49E-02 -1.03 1.25E-01 0.00 9.97E-01 -3.32 1.23E-02 -2.29 1.01E-01 1.03 1.42E-01

EG_05561 11 0 10 5 2.75 2.51E-02 -0.57 3.57E-01 0.94 2.08E-01 -3.32 1.23E-02 -1.80 2.35E-01 1.51 4.68E-02

EG_02334 9 2 8 7 0.46 6.16E-01 -0.54 4.35E-01 0.17 8.17E-01 -1.00 3.15E-01 -0.29 7.70E-01 0.71 3.40E-01

EG_00582 0 1 8 2 Onc only Onc only -4.71 9.22E-04 Cyst only Cyst only -2.00 9.02E-02 0.52 7.47E-01 2.51 1.30E-02


EG_01620 5 1 6 1 0.61 6.28E-01 -0.97 2.58E-01 2.13 1.19E-01 -1.58 2.12E-01 1.52 4.27E-01 3.10 1.66E-02




EG_02086 13 1 4 1 1.99 4.44E-02 0.99 1.85E-01 3.51 1.09E-03 -1.00 4.77E-01 1.52 4.27E-01 2.51 7.91E-02

EG_07506 0 0 2 6 both zero both zero PSC only PSC only -3.78 1.46E-02 PSC only PSC only -2.07 1.54E-01 -1.07 3.25E-01


EG_06827 0 0 2 3 both zero both zero PSC only PSC only Cyst only Cyst only PSC only PSC only Cyst only Cyst only -0.07 9.56E-01






EG_11325 0 0 0 0

TNF receptor

EG_01677 26 0 27 27 3.99 5.50E-05 -0.76 5.05E-02 -0.25 5.28E-01 -4.75 4.27E-06 -4.24 2.11E-05 0.51 1.87E-01



EG_01001 4 0 2 8 Adult only Adult only 0.29 8.08E-01 -1.20 1.63E-01 PSC only PSC only -2.48 6.60E-02 -1.49 1.42E-01

nf-kappa-b inhibitor

EG_09312 12 2 10 4 0.87 3.04E-01 -0.45 4.63E-01 1.39 7.27E-02 -1.32 1.59E-01 0.52 6.48E-01 1.84 2.26E-02

tumor necrosis factor


EG_07048 0 0 1 2 both zero both zero PSC only PSC only Cyst only Cyst only PSC only PSC only Cyst only Cyst only -0.49 7.75E-01

EG_04252 11 3 0 3 0.16 8.37E-01 3.75 4.27E-03 1.68 4.83E-02 Onc only Onc only 1.52 1.68E-01 Cyst only Cyst only


EG_03411 0 0 0 0

IL

EG_08150 37 2 27 25 2.50 9.60E-05 -0.25 4.77E-01 0.37 3.16E-01 -2.75 1.67E-04 -2.13 3.07E-03 0.62 1.16E-01


Glycan

EG_05022 46 16 183 52 -0.19 5.98E-01 -2.70 6.04E-38 -0.37 2.01E-01 -2.51 1.05E-20 -0.18 6.08E-01 2.33 6.00E-30


mannosyltransferase

EG_00931 9 3 9 7 -0.13 8.76E-01 -0.71 2.90E-01 0.17 8.17E-01 -0.58 5.04E-01 0.30 7.40E-01 0.88 2.23E-01

EG_01475 18 14 4 10 -1.35 4.13E-03 1.46 3.42E-02 0.65 2.41E-01 2.81 1.03E-04 2.00 3.07E-04 -0.81 3.15E-01


EG_02999 12 3 4 10 0.29 7.08E-01 0.88 2.51E-01 0.07 9.12E-01 0.59 5.80E-01 -0.22 7.89E-01 -0.81 3.15E-01

EG_04226 8 0 7 11 2.29 8.49E-02 -0.52 4.82E-01 -0.65 3.25E-01 -2.80 5.29E-02 -2.94 1.83E-02 -0.14 8.40E-01


EG_00436 1 1 2 6 -1.71 3.61E-01 -1.71 3.12E-01 -2.78 3.27E-02 0.00 9.98E-01 -1.07 3.82E-01 -1.07 3.25E-01

EG_07702 5 0 0 5 1.61 2.81E-01 2.61 1.02E-01 -0.20 8.30E-01 both zero both zero -1.80 2.35E-01 -2.81 8.11E-02

Prostaglandins

EG_06011 5 0 10 23 1.61 2.81E-01 -1.71 2.38E-02 -2.40 1.17E-04 -3.32 1.23E-02 -4.01 1.12E-04 -0.69 1.86E-01

EG_08217 10 2 26 20 0.61 4.93E-01 -2.09 3.04E-05 -1.20 2.74E-02 -2.70 2.57E-04 -1.80 1.75E-02 0.89 3.53E-02

EG_01663 10 7 8 25 -1.20 6.47E-02 -0.39 5.65E-01 -1.52 3.07E-03 0.81 2.62E-01 -0.32 5.44E-01 -1.13 3.58E-02

CXC

EG_09138 2 3 8 6 -2.30 5.53E-02 -2.71 7.03E-03 -1.78 1.04E-01 -0.41 6.46E-01 0.52 5.76E-01 0.93 2.27E-01

Lipooxygenase





EG_07840 0 0 0 0



EG_02555 16 0 8 20 3.29 3.23E-03 0.29 6.26E-01 -0.52 2.83E-01 -3.00 3.24E-02 -3.80 3.96E-04 -0.81 1.56E-01

Chemoattractants

EG_09475 48 11 6 38 0.41 2.93E-01 2.29 2.66E-06 0.14 6.49E-01 1.88 6.85E-03 -0.27 5.22E-01 -2.15 3.69E-05

defense response to bacterium

EG_11172 16 2 44 20 1.29 1.03E-01 -2.17 2.73E-08 -0.52 2.83E-01 -3.46 9.13E-08 -1.80 1.75E-02 1.65 8.86E-06

EG_10393 32 7 41 35 0.48 3.23E-01 -1.07 1.40E-03 -0.32 3.57E-01 -1.55 1.31E-03 -0.80 9.58E-02 0.74 2.40E-02

EG_03651 3 1 19 0 -0.13 9.28E-01 -3.37 4.03E-06 Adult only Adult only -3.24 6.28E-04 Onc only Onc only 5.76 5.82E-07

EG_01052 102 9 15 87 1.79 1.54E-07 2.06 1.55E-10 0.03 8.71E-01 0.27 6.45E-01 -1.75 1.16E-06 -2.02 1.90E-09

EG_03926 118 77 25 68 -1.10 1.11E-08 1.53 2.02E-08 0.60 5.32E-03 2.63 1.50E-18 1.70 3.87E-14 -0.93 3.17E-03

EG_10878 0 0 0 0

EG_07454 0 0 0 0

EG_06615 26 1 21 43 2.99 3.26E-04 -0.40 3.35E-01 -0.92 8.95E-03 -3.39 2.50E-04 -3.91 1.60E-07 -0.52 1.59E-01

EG_08145 12 0 18 34 2.87 1.66E-02 -1.29 1.36E-02 -1.70 1.81E-04 -4.17 2.70E-04 -4.57 1.18E-06 -0.40 3.21E-01

EG_02074 3 1 5 2 -0.13 9.28E-01 -1.45 1.57E-01 0.39 7.65E-01 -1.32 3.20E-01 0.52 7.47E-01 1.84 1.07E-01

EG_00272 8 2 6 10 0.29 7.60E-01 -0.29 7.00E-01 -0.52 4.48E-01 -0.58 5.85E-01 -0.80 3.73E-01 -0.22 7.59E-01

macroglobulin

EG_01997 6 0 4 17 1.87 1.89E-01 -0.12 8.91E-01 -1.70 8.10E-03 PSC only PSC only -3.57 1.41E-03 -1.57 2.56E-02

Immunoglobulin and immune system associate

EG_08038 10 0 25 14 2.61 3.77E-02 -2.03 5.87E-05 -0.68 2.51E-01 -4.64 1.06E-05 -3.29 5.08E-03 1.35 3.91E-03

EG_01338 6 2 31 4 -0.13 8.99E-01 -3.08 1.55E-08 0.39 6.72E-01 -2.95 2.92E-05 0.52 6.48E-01 3.47 1.08E-08




Cytokine


EG_00802 6 0 8 11 1.87 1.89E-01 -1.12 1.41E-01 -1.07 1.35E-01 -3.00 3.24E-02 -2.94 1.83E-02 0.05 9.35E-01

EG_01922 13 1 5 7 1.99 4.44E-02 0.67 3.44E-01 0.70 2.90E-01 -1.32 3.20E-01 -1.29 2.72E-01 0.03 9.73E-01



EG_04551 6 1 27 13 0.87 4.67E-01 -2.88 3.22E-07 -1.31 5.59E-02 -3.75 1.58E-05 -2.18 3.00E-02 1.57 7.98E-04





EG_08018 11 0 28 20 2.75 2.51E-02 -2.06 1.81E-05 -1.06 4.56E-02 -4.80 2.72E-06 -3.80 3.96E-04 1.00 1.63E-02


Supplementary Table 44. Genes binding rule-of-five (Ro5) compliant drugs in E. granulosus

Gene ID Gene Discription* InterPro

entry IntePro name

EG_07392 [Pyruvate dehydrogenase [lipoamide]] kinase IPR003594 ATPase-like, ATP-binding domain

EG_02535 Glycogen phosphorylase, muscle form IPR000811 Glycosyl transferase, family 35

EG_05162 Tyrosine-protein kinase Fyn IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_09209 Acetyl-CoA carboxylase IPR000022 Carboxyl transferase

EG_07474 Acetylcholinesterase IPR002018 Carboxylesterase, type B


EG_08499 Lysosomal alpha-glucosidase IPR000322 Glycoside hydrolase, family 31

EG_05798

FMRFamide-activated amiloride-sensitive sodium

channel IPR001873 Na+ channel, amiloride-sensitive

EG_09920 Adenine phosphoribosyltransferase IPR000836 Phosphoribosyltransferase

EG_07260 Adenosine deaminase IPR001365 Adenosine/AMP deaminase domain

EG_08262 AMP deaminase IPR001365 Adenosine/AMP deaminase domain

EG_01141 Adenylate cyclase IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_08046 Ca(2+)/calmodulin-responsive adenylate cyclase IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase



EG_05480 Allatostatin-A receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_02721 Tissue alpha-L-fucosidase IPR000933 Glycoside hydrolase, family 29

EG_08871 Alpha-mannosidase IPR000602 Glycoside hydrolase, family 38, core

EG_03902



EG_05520 Na+ channel, amiloride-sensitive IPR001873 Na+ channel, amiloride-sensitive

EG_05521



EG_06322



EG_06641 amiloride-sensitive sodium channel-related IPR001873 Na+ channel, amiloride-sensitive

EG_03052 Lysine-specific histone demethylase IPR002937 Amine oxidase

EG_10256 Protein VPRBP IPR001873 Na+ channel, amiloride-sensitive

EG_05374 Aromatic-L-amino-acid decarboxylase IPR002129 Pyridoxal phosphate-dependent decarboxylase

EG_01160 Serine-protein kinase ATM IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_06856 ATP-binding cassette sub-family B member protein IPR001140 ABC transporter, transmembrane domain

EG_08975 ATP-binding cassette sub-family B member protein IPR001140 ABC transporter, transmembrane domain

EG_00512 Multidrug resistance protein IPR001140 ABC transporter, transmembrane domain


EG_00476 Tyrosine-protein kinase ABL1 IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain


EG_07475 Cholinesterase IPR002018 Carboxylesterase, type B

EG_05154 Tubulin beta-1 chain IPR002060 Squalene/phytoene synthase

EG_11290 Bile salt-activated lipase IPR002018 Carboxylesterase, type B

EG_07671 Protein farnesyltransferase subunit beta IPR001330 Prenyltransferase/squalene oxidase

EG_10356

Calcium/calmodulin-dependent 3',5'-cyclic nucleotide

phosphodiesterase IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_01190

cAMP and cAMP-inhibited cGMP 3',5'-cyclic


EG_05712 cAMP-specific 3',5'-cyclic phosphodiesterase IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_07248 Carbonic anhydrase IPR001148 Alpha carbonic anhydrase

EG_05704 Carbonic anhydrase IPR001148 Alpha carbonic anhydrase

EG_11281 Carboxypeptidase A1 IPR000834 Peptidase M14, carboxypeptidase A



EG_02374 Carboxypeptidase D IPR000834 Peptidase M14, carboxypeptidase A

EG_04498 Carnitine O-palmitoyltransferase 1, liver isoform IPR000542 Acyltransferase ChoActase/COT/CPT

EG_06687 Cardioacceleratory peptide receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_05730 Sepiapterin reductase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_03641 Choline O-acetyltransferase IPR000542 Acyltransferase ChoActase/COT/CPT

EG_07971 FMRFamide receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_03363 COBW domain-containing protein IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_01989 cAMP-specific 3',5'-cyclic phosphodiesterase IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_01673 NADH-cytochrome b5 reductase IPR001433 Oxidoreductase FAD/NAD(P)-binding

EG_07107 Cytosolic carboxypeptidase IPR000834 Peptidase M14, carboxypeptidase A

EG_00981 Epidermal retinol dehydrogenase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_09587 Dihydrofolate reductase IPR001796 Dihydrofolate reductase domain

EG_07925 Dihydropteridine reductase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_04559 DNA topoisomerase 2-alpha IPR002205 DNA topoisomerase, type IIA, subunit A/C-terminal

EG_06214 DNA-dependent protein kinase catalytic subunit IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_09525 Aromatic-L-amino-acid decarboxylase IPR002129 Pyridoxal phosphate-dependent decarboxylase

EG_04334 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_00780 Ecdysone-induced protein 75B, isoforms C/D IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_05679 Putative testis serine protease IPR001254 Peptidase S1/S6, chymotrypsin/Hap

EG_10371 Ephrin type-A receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_05467 Tyrosine-protein kinase transforming protein erbB IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_09023 FACT complex subunit spt16 IPR000994 Peptidase M24, structural domain

EG_05067 Cytosolic carboxypeptidase-like protein IPR000834 Peptidase M14, carboxypeptidase A

EG_04208 Basic fibroblast growth factor receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_00574 Fibroblast growth factor receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_05248 Peptidyl-prolyl cis-trans isomerase FKBP1A IPR001179 Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain

EG_10157 FK506-binding protein IPR001179 Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain




EG_00240 Target of rapamycin IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_05827 Focal adhesion kinase IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_07106 Fructose-1,6-bisphosphatase

IPR000146

Fructose-1,6-bisphosphatase class 1/Sedoheputulose-1,7-

bisphosphatase

EG_10234 Nuclear receptor subfamily 5 group A member IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_00499 5-hydroxytryptamine receptor 1A IPR000276 GPCR, rhodopsin-like, 7TM

EG_00011 Retrovirus-related Pol polyprotein from transposon IPR000477 Reverse transcriptase

EG_06501 Retrovirus-related Pol polyprotein from transposon IPR000477 Reverse transcriptase

EG_04461 Neutral alpha-glucosidase AB IPR000322 Glycoside hydrolase, family 31

EG_01379 Geranylgeranyl transferase type-2 subunit alpha IPR002088 Protein prenyltransferase, alpha subunit

EG_05683 Glutamate receptor IPR001320 Ionotropic glutamate receptor


EG_01528 Glutamate receptor delta-2 subunit IPR001320 Ionotropic glutamate receptor

EG_07805 Glutamate receptor, ionotropic kainate IPR001320 Ionotropic glutamate receptor




EG_04408 Glutamate [NMDA] receptor subunit epsilon-2 IPR001320 Ionotropic glutamate receptor


EG_06544 Glycogen phosphorylase, brain form IPR000811 Glycosyl transferase, family 35

EG_06545 Glycogen phosphorylase, muscle form IPR000811 Glycosyl transferase, family 35



EG_01547 Putative neuropeptide Y receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_01868 Probable G-protein coupled receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_09488 Cholecystokinin receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_00434 Muscarinic acetylcholine receptor M5 IPR000276 GPCR, rhodopsin-like, 7TM

EG_07906 Probable muscarinic acetylcholine receptor gar-2 IPR000276 GPCR, rhodopsin-like, 7TM

EG_11186 Speract receptor IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_07452 Guanylyl cyclase GC-E IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_07451 Retinal guanylyl cyclase IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_06875 Hepatocyte nuclear factor 4-alpha IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_08632

High affinity cGMP-specific 3',5'-cyclic

phosphodiesterase 9A IPR002073 3'5'-cyclic nucleotide phosphodiesterase, catalytic domain

EG_04406 Ecdysone-induced protein IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_00218 3-hydroxyacyl-CoA dehydrogenase type-2 IPR002198 Short-chain dehydrogenase/reductase SDR

EG_06015 Hypoxanthine-guanine phosphoribosyltransferase IPR000836 Phosphoribosyltransferase

EG_06016 Hypoxanthine-guanine phosphoribosyltransferase IPR000836 Phosphoribosyltransferase

EG_03922 Integrin beta-7 IPR002369 Integrin beta subunit, N-terminal

EG_11251 LINE-1 reverse transcriptase homolog IPR000477 Reverse transcriptase

EG_08887 Lysine-specific histone demethylase IPR002937 Amine oxidase

EG_03619 Lysosomal alpha-mannosidase IPR000602 Glycoside hydrolase, family 38, core

EG_04862 Tryptase IPR001254 Peptidase S1/S6, chymotrypsin/Hap

EG_06280 Enteropeptidase IPR001254 Peptidase S1/S6, chymotrypsin/Hap


EG_06852 Atrial natriuretic peptide receptor IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_09110 Methionine aminopeptidase IPR000994 Peptidase M24, structural domain

EG_01277 Methionine aminopeptidase IPR000994 Peptidase M24, structural domain

EG_00462 Methionine synthase reductase IPR001433 Oxidoreductase FAD/NAD(P)-binding

EG_08121 Methionine aminopeptidase 1D, mitochondrial IPR000994 Peptidase M24, structural domain

EG_02228 Mitogen-activated protein kinase kinase kinase IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain




EG_09216 Multidrug resistance-associated protein 1 IPR001140 ABC transporter, transmembrane domain

EG_07334 Canalicular multispecific organic anion transporter IPR001140 ABC transporter, transmembrane domain

EG_05624 Uncharacterized sodium-dependent transporter MJ1319 IPR000175 Sodium:neurotransmitter symporter

EG_00155 NADPH--cytochrome P450 reductase IPR001433 Oxidoreductase FAD/NAD(P)-binding

EG_10956 Atrial natriuretic peptide receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_01487 Neuroligin-3 IPR002018 Carboxylesterase, type B

EG_02175 Neuropeptide Y receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_09487 Neuropeptide FF receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_02268 Pyroglutamylated RFamide peptide receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_01723 Neuropeptide S receptor IPR000276 GPCR, rhodopsin-like, 7TM






EG_02015 Glutamate [NMDA] receptor subunit zeta-1 IPR001320 Ionotropic glutamate receptor

EG_01863 Nuclear receptor subfamily 2 group C IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_04794 Knirps-related protein IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_08428 Nuclear hormone receptor family member nhr-48 IPR000536 Nuclear hormone receptor, ligand-binding, core


EG_05526 Nuclear receptor subfamily 5 group A IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_00119 Steroid receptor seven-up, isoforms B/C IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_00539 Orexin receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_01440 P2X purinoceptor IPR001429 P2X purinoreceptor


EG_02741 Xaa-Pro dipeptidase IPR000994 Peptidase M24, structural domain

EG_03297 Xaa-Pro dipeptidase IPR000994 Peptidase M24, structural domain

EG_00446 Peptidyl-glycine alpha-amidating monooxygenase A

IPR000323

Copper type II, ascorbate-dependent monooxygenase, N-

terminal

EG_07018 Peptidyl-prolyl cis-trans isomerase FKBP4 IPR001179 Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain

EG_04539 Peroxidasin IPR002007 Haem peroxidase, animal

EG_06371 Peroxidasin homolog IPR002007 Haem peroxidase, animal


EG_05641 Histone lysine demethylase PHF8 IPR002198 Short-chain dehydrogenase/reductase SDR

EG_02040 Growth hormone secretagogue receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_06619 Phosphatidylinositol 4-kinase beta IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_00138 Phosphatidylinositol 4-kinase alpha IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_06161 Phosphatidylinositol 4-kinase type 2-beta IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_02083

Calcium/calmodulin-dependent 3',5'-cyclic nucleotide


EG_03783 Phosphatidylinositol 3-kinase catalytic subunit IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_06748 Glutathione peroxidase IPR000889 Glutathione peroxidase

EG_05884 Ribose-phosphate pyrophosphokinase IPR000836 Phosphoribosyltransferase

EG_07019 DNA primase small subunit IPR002755 DNA primase, small subunit

EG_04427 Prolyl endopeptidase IPR001375 Peptidase S9, prolyl oligopeptidase, catalytic domain

EG_05893 Propionyl-CoA carboxylase beta chain, mitochondrial IPR000022 Carboxyl transferase

EG_05890 Propionyl-CoA carboxylase beta chain, mitochondrial IPR000022 Carboxyl transferase

EG_02831

Protein farnesyltransferase/geranylgeranyltransferase

type-1 subunit alpha IPR002088 Protein prenyltransferase, alpha subunit

EG_02061 Integrin-linked protein kinase IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_03938 N-terminal kinase-like protein IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_06734 Kinase suppressor of Ras IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_02678 Atrial natriuretic peptide receptor IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_09514 Protein XRP2 IPR001763 Rhodanese-like

EG_01967 Protein sevenless IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain


EG_03510 Pyroglutamylated RFamide peptide receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_09734 Neuropeptides capa receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_04277 Serine/threonine-protein kinase B-raf IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_08146 Ran GTPase-activating protein IPR001604 DNA/RNA non-specific endonuclease

EG_04891 Retinal guanylyl cyclase IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_06571 Guanylyl cyclase GC-E IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_02251 Retinoic acid receptor RXR-gamma-A IPR000536 Nuclear hormone receptor, ligand-binding, core

EG_07570 Retrovirus-related Pol polyprotein IPR000477 Reverse transcriptase

EG_09604 serine/threonine protein kinase IPR000477 Reverse transcriptase


EG_01293 Ribonucleoside-diphosphate reductase large subunit IPR000788 Ribonucleotide reductase large subunit, C-terminal

EG_05478 Adenosylhomocysteinase A IPR000043 Adenosylhomocysteinase

EG_05348 S-adenosylmethionine decarboxylase proenzyme IPR001985 S-adenosylmethionine decarboxylase

EG_04800 Serine/threonine-protein kinase atr IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_02427 Serine/threonine-protein kinase SMG1 IPR000403 Phosphatidylinositol 3-/4-kinase, catalytic domain

EG_06134 5-hydroxytryptamine receptor IPR000276 GPCR, rhodopsin-like, 7TM


EG_05393 Sodium-dependent serotonin transporter IPR000175 Sodium:neurotransmitter symporter

EG_05623 Uncharacterized sodium-dependent transporter IPR000175 Sodium:neurotransmitter symporter

EG_01729 Sodium- and chloride-dependent glycine transporter IPR000175 Sodium:neurotransmitter symporter

EG_01731 Sodium- and chloride-dependent glycine transporter IPR000175 Sodium:neurotransmitter symporter

EG_05625 Uncharacterized sodium-dependent transporter IPR000175 Sodium:neurotransmitter symporter

EG_02861 Sphingosine-1-phosphate lyase IPR002129 Pyridoxal phosphate-dependent decarboxylase

EG_06237 Tyrosine-protein kinase IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_09395 Estradiol 17-beta-dehydrogenase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_06483 Transmembrane protease serine IPR001254 Peptidase S1/S6, chymotrypsin/Hap

EG_01933 Superoxide dismutase [Cu-Zn] IPR001424 Superoxide dismutase, copper/zinc binding domain

EG_05456 Tachykinin-like peptides receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_01143 Sodium- and chloride-dependent GABA transporter IPR000175 Sodium:neurotransmitter symporter

EG_03457 Centrosomal protein of 41 kDa IPR001763 Rhodanese-like

EG_04394 Thymidine phosphorylase IPR000312 Glycosyl transferase, family 3

EG_05276 Thymidylate synthase IPR000398 Thymidylate synthase

EG_07666 Thyrotropin-releasing hormone receptor IPR000276 GPCR, rhodopsin-like, 7TM



EG_02729 ALK tyrosine kinase receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain



EG_01387 Fibroblast growth factor receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain


EG_02691 Macrophage colony-stimulating factor 1 receptor IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_09704 Tyrosine-protein kinase CSK IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_10676 Tyrosine-protein kinase STK IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_10678 Tyrosine-protein kinase STK IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_04765 Tyrosine-protein kinase transmembrane receptor ROR1 IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_03855 Uncharacterized oxidoreductase SSP1627 IPR002198 Short-chain dehydrogenase/reductase SDR

EG_05048 Glutamate receptor U1 IPR001320 Ionotropic glutamate receptor

EG_05049 Glutamate receptor U1 IPR001320 Ionotropic glutamate receptor

EG_05388 Uridine 5'-monophosphate synthase IPR000836 Phosphoribosyltransferase

EG_07365 WW domain-containing oxidoreductase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_10570 Probable Xaa-Pro aminopeptidase IPR000994 Peptidase M24, structural domain

EG_04130 YY1-associated factor IPR001876 Zinc finger, RanBP2-type

EG_04135 YY1-associated factor IPR001876 Zinc finger, RanBP2-type

EG_00047 hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM


EG_01208 conserved hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM


EG_01417 conserved hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM

EG_01746 G-protein coupled receptor fragment IPR000276 GPCR, rhodopsin-like, 7TM

EG_01843 Kappa-type opioid receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_02068 peptide (allatostatin/somatostatin)-like receptor IPR000276 GPCR, rhodopsin-like, 7TM

EG_02461 rhodopsin-like orphan GPCR IPR000276 GPCR, rhodopsin-like, 7TM



EG_03193 peptide (allatostatin/somatostatin)-like receptor IPR000276 GPCR, rhodopsin-like, 7TM





EG_06944 Alpha-1A adrenergic receptor IPR000276 GPCR, rhodopsin-like, 7TM




EG_08784 conserved hypothetical protein IPR000712 Apoptosis regulator, Bcl-2, BH

EG_02143 Phenmedipham hydrolase IPR002018 Carboxylesterase, type B

EG_08546 Para-nitrobenzyl esterase IPR002018 Carboxylesterase, type B

EG_01295 Probable G-protein coupled receptor IPR000832 GPCR, family 2, secretin-like

EG_07810

EGF, latrophilin and seven transmembrane domain-

containing protein IPR000832 GPCR, family 2, secretin-like

EG_02585 glutamate receptor, ionotropic, invertebrate IPR001320 Ionotropic glutamate receptor

EG_00409 conserved hypothetical protein IPR001873 Na+ channel, amiloride-sensitive



EG_04460 acid sensing ion channel 4 pituitary IPR001873 Na+ channel, amiloride-sensitive

EG_11272 amiloride-sensitive sodium channel-related IPR001873 Na+ channel, amiloride-sensitive

EG_10199

Protein prenyltransferase alpha subunit repeat-containing

protein IPR002088 Protein prenyltransferase, alpha subunit

EG_01493 Transposon Ty3-I Gag-Pol polyprotein IPR000477 Reverse transcriptase

EG_01838 Retrovirus-related Pol polyprotein from transposon 297 IPR000477 Reverse transcriptase

EG_05213 Retrovirus-related Pol polyprotein from transposon 17.6 IPR000477 Reverse transcriptase

EG_06406 Retrovirus-related Pol polyprotein from transposon 297 IPR000477 Reverse transcriptase

EG_05136 Galectin-3-binding protein A IPR001190 Speract/scavenger receptor


EG_02706 G protein-coupled receptor IPR000276 GPCR, rhodopsin-like, 7TM




EG_06561 G-protein coupled receptor fragment IPR000276 GPCR, rhodopsin-like, 7TM


EG_00300 Proliferation-associated protein IPR000994 Peptidase M24, structural domain

EG_01276 hypothetical protein IPR001254 Peptidase S1/S6, chymotrypsin/Hap

EG_07480 Dipeptidyl aminopeptidase-like protein IPR001375 Peptidase S9, prolyl oligopeptidase, catalytic domain

EG_10264 Dipeptidyl peptidase IPR001375 Peptidase S9, prolyl oligopeptidase, catalytic domain

EG_01968 Alkylated DNA repair protein alkB homolog IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_04019 Probable protein kinase-like protein SgK071 homolog IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_07434 hypothetical protein IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_07447 1,5-anhydro-D-fructose reductase IPR001245 Serine-threonine/tyrosine-protein kinase catalytic domain

EG_03181 Carnitine O-palmitoyltransferase IPR000542 Acyltransferase ChoActase/COT/CPT

EG_06271 Apoptosis regulator BAX IPR000712 Apoptosis regulator, Bcl-2, BH

EG_11148 Guanylate cyclase IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase

EG_01347 Multidrug resistance-associated protein IPR001140 ABC transporter, transmembrane domain

EG_00472 Carbonic anhydrase-related protein IPR001148 Alpha carbonic anhydrase



EG_02882 Peptidyl-prolyl cis-trans isomerase FKBP8 IPR001179 Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain


EG_08654 Lysyl oxidase homolog IPR001190 Speract/scavenger receptor

EG_03131 Geranylgeranyl transferase type-1 subunit beta IPR001330 Prenyltransferase/squalene oxidase

EG_00883 NADPH-dependent diflavin oxidoreductase IPR001433 Oxidoreductase FAD/NAD(P)-binding


EG_04645 Apolipophorins IPR001747 Lipid transport protein, N-terminal

EG_07562

Thiosulfate sulfurtransferase/rhodanese-like domain-

containing protein IPR001763 Rhodanese-like

EG_04584 hypothetical protein IPR001873 Na+ channel, amiloride-sensitive

EG_05096 Ubiquitin thioesterase zranb1-A IPR001876 Zinc finger, RanBP2-type

EG_05103 Ubiquitin thioesterase zranb1-A IPR001876 Zinc finger, RanBP2-type


EG_00703

tRNA (adenine-N(1)-)-methyltransferase catalytic

subunit TRMT61A IPR002198 Short-chain dehydrogenase/reductase SDR

EG_02372 Retinol dehydrogenase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_02767 Estradiol 17-beta-dehydrogenase IPR002198 Short-chain dehydrogenase/reductase SDR

EG_04036 Carbonyl reductase [NADPH] IPR002198 Short-chain dehydrogenase/reductase SDR



EG_07430 Dehydrogenase/reductase SDR family member IPR002198 Short-chain dehydrogenase/reductase SDR

EG_05140 Solute carrier family 10 protein IPR002657 Bile acid:sodium symporter

EG_05141 Ileal sodium/bile acid cotransporter IPR002657 Bile acid:sodium symporter

EG_05592 Ileal sodium/bile acid cotransporter IPR002657 Bile acid:sodium symporter

EG_06417 Translocator protein IPR004307 TspO/MBR-related protein

*These genes were identified based on InterPro domains that had been shown to bind rule-of-five (Ro5) compliant drugs.


Supplementary Table 45. Druggable target genes in E. granulosus

Gene ID Sequence Reads

Gene Description IPR No. IntePro name OrthoMCL

Group Adult Onc PSC Cyst

EG_00047 2 1 0 0 hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM OG5_246110

EG_00434 1 0 7 2 Muscarinic acetylcholine receptor M5 IPR000276 GPCR, rhodopsin-like, 7TM OG5_137787

EG_00539 2 1 1 1 Orexin receptor type IPR000276 GPCR, rhodopsin-like, 7TM OG5_245824

EG_00585 4 0 4 2 Probable G-protein coupled receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_138410

EG_00654 0 1 2 0 FMRFamide receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_174096

EG_01208 1 0 1 0 conserved hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM OG5_220988


EG_01417 0 0 2 2 conserved hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM OG5_134114

EG_01547 9 1 8 5 Putative neuropeptide Y receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_152424

EG_01746 0 1 3 0 G-protein coupled receptor fragment IPR000276 GPCR, rhodopsin-like, 7TM OG5_246305

EG_01843 0 0 1 0 Kappa-type opioid receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_246110


EG_02040 5 0 12 6 Growth hormone secretagogue receptor type 1 IPR000276 GPCR, rhodopsin-like, 7TM OG5_174096

EG_02068 2 0 0 5 peptide (allatostatin/somatostatin)-like receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_166850

EG_02268 2 0 10 2 Pyroglutamylated RFamide peptide receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_208249

EG_02461 0 0 1 0 rhodopsin-like orphan GPCR IPR000276 GPCR, rhodopsin-like, 7TM OG5_246460



EG_03193 0 0 0 0 peptide (allatostatin/somatostatin)-like receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_166850

EG_03510 0 0 2 0 Pyroglutamylated RFamide peptide receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_246001



EG_04846 1 0 1 0 Neuropeptide Y receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_246001

EG_06242 0 0 0 10 Neuropeptide Y receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_140045


EG_06560 0 0 0 1 Neuropeptide Y receptor type 5 IPR000276 GPCR, rhodopsin-like, 7TM OG5_245986

EG_06944 0 1 3 5 Alpha-1A adrenergic receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_142634

EG_07190 1 0 0 0 hypothetical protein IPR000276 GPCR, rhodopsin-like, 7TM OG5_194641

EG_07906 3 0 8 0 Probable muscarinic acetylcholine receptor gar-2 IPR000276 GPCR, rhodopsin-like, 7TM OG5_137787

EG_08220 1 0 5 0 GH16314 gene product from transcript GH16314-RA IPR000276 GPCR, rhodopsin-like, 7TM OG5_134114


EG_08861 1 0 0 1 Neuropeptide S receptor IPR000276 GPCR, rhodopsin-like, 7TM OG5_166850

EG_01863 5 0 9 9 Nuclear receptor subfamily 2 group C member 2 IPR000536 Nuclear hormone receptor, ligand-binding, OG5_207882


core

EG_04794 5 0 15 2 Knirps-related protein

IPR000536

Nuclear hormone receptor, ligand-binding,

core OG5_152436

EG_08428 5 0 18 7 Nuclear hormone receptor family member nhr-48

IPR000536

Nuclear hormone receptor, ligand-binding,

core OG5_217915

EG_06483 11 1 2 5 Transmembrane protease IPR001254 Peptidase S1/S6, chymotrypsin/Hap OG5_166843

EG_07107 1 0 8 0 Cytosolic carboxypeptidase IPR000834 Peptidase M14, carboxypeptidase A OG5_245904

EG_00574 0 0 13 1 Fibroblast growth factor receptor

IPR001245

Serine-threonine/tyrosine-protein kinase

catalytic domain OG5_185072

EG_02691 3 0 7 13 Macrophage colony-stimulating factor 1 receptor

IPR001245



EG_02729 2 0 11 11 ALK tyrosine kinase receptor

IPR001245



EG_06852 4 0 10 0 Atrial natriuretic peptide receptor IPR001054 Adenylyl cyclase class-3/4/guanylyl cyclase OG5_156265

EG_05704 3 0 2 3 Carbonic anhydrase IPR001148 Alpha carbonic anhydrase OG5_211882

EG_03052 1 0 0 1 Lysine-specific histone demethylase IPR002937 Amine oxidase OG5_165011

EG_08784 2 1 13 21 conserved hypothetical protein IPR000712 Apoptosis regulator, Bcl-2, BH OG5_185068

EG_02143 1 0 1 0 Phenmedipham hydrolase IPR002018 Carboxylesterase, type B OG5_144285

EG_07475 1 0 3 3 Cholinesterase IPR002018 Carboxylesterase, type B OG5_176990

EG_08546 8 0 14 9 Para-nitrobenzyl esterase IPR002018 Carboxylesterase, type B OG5_144285

EG_01295 2 0 2 6 Probable G-protein coupled receptor IPR000832 GPCR, family 2, secretin-like OG5_206420

EG_07810 4 3 13 4

EGF, latrophilin and seven transmembrane domain-containing

protein IPR000832 GPCR, family 2, secretin-like OG5_246864

EG_02585 24 0 9 17 glutamate receptor, ionotropic, invertebrate IPR001320 Ionotropic glutamate receptor OG5_152157

EG_00409 4 0 1 0 conserved hypothetical protein IPR001873 Na+ channel, amiloride-sensitive OG5_180971



EG_03902 2 0 6 3 FMRFamide-activated amiloride-sensitive sodium channel IPR001873 Na+ channel, amiloride-sensitive OG5_145150

EG_04460 0 0 1 1 acid sensing ion channel 4 pituitary IPR001873 Na+ channel, amiloride-sensitive OG5_180971





EG_06641 0 0 0 0 amiloride-sensitive sodium channel-related IPR001873 Na+ channel, amiloride-sensitive OG5_145150

EG_11272 0 0 1 0 amiloride-sensitive sodium channel-related IPR001873 Na+ channel, amiloride-sensitive OG5_145150

EG_10199 3 3 1 4

Protein prenyltransferase alpha subunit repeat-containing

protein IPR002088 Protein prenyltransferase, alpha subunit OG5_185818

EG_00011 4 0 10 4 Retrovirus-related Pol polyprotein from transposon IPR000477 Reverse transcriptase OG5_126567

EG_01493 12 0 28 16 Transposon Ty3-I Gag-Pol polyprotein IPR000477 Reverse transcriptase OG5_126567






EG_05623 2 0 1 0 Uncharacterized sodium-dependent transporter IPR000175 Sodium:neurotransmitter symporter OG5_149315



EG_05136 4 0 1 1 Galectin-3-binding protein A IPR001190 Speract/scavenger receptor OG5_226769

Note: Adult, adult worm; Onc, oncosphere; PSC, protoscolex; Cyst, hydatid cyst membrane


Supplementary Table 46. Channels in the E. granulosus genome

Gene ID Gene description*

1.Ligand Gated Ion Channels

Cys-loop superfamily

GABA-A

EG_07095 gamma-aminobutyric acid (GABA) A receptor beta-1

Glycine

EG_05956 glycine receptor alpha-1



Anionic glutamate

EG_06588 glutamate receptor, anionic, invertebrate

EG_06589 glutamate receptor, anionic, invertebrate

Acetylcholine (nicotinic)

EG_01697 Neuronal acetylcholine receptor subunit alpha-2

EG_02659 nicotinic acetylcholine receptor, invertebrate



EG_04748 Neuronal acetylcholine receptor subunit beta-3


EG_07339 Neuronal acetylcholine receptor subunit alpha-3

Glutamate-gated cation channels

Glutamate (ionotropic), non-NMDA

EG_05683 glutamate receptor, ionotropic, AMPA 3

EG_07800 glutamate receptor, ionotropic, kainate 2

EG_07805 glutamate receptor, ionotropic, kainate 2

EG_10379 glutamate receptor, ionotropic, invertebrate

Glutamate (ionotropic), NMDA

EG_02009 Glutamate [NMDA] receptor subunit 1

EG_04408 glutamate receptor, ionotropic, N-methyl-D-aspartate 2, invertebrate

Epithelial and related Na+ channels

Epithelial sodium channel (SCNN)

EG_03902 nonvoltage-gated sodium channel 1 beta

EG_06322 nonvoltage-gated sodium channel 1 gamma

ATP-gated cation channel (P2X)

EG_01440 purinergic receptor P2X, ligand-gated ion channel 4

EG_02600 purinergic receptor P2X, ligand-gated ion channel 4

Othesr


EG_01279 cGMP-gated cation channel alpha-1


EG_03004 Cyclic nucleotide-gated channel cone photoreceptor subunit alpha

EG_05521 FMRFamide-activated amiloride-sensitive sodium channel

EG_05822 Cyclic nucleotide-gated cation channel beta-1

2.Voltage-gated cation channels

Na+ channel, SCN alpha, NaV1.x


EG_00692 voltage-gated sodium channel type III alpha

Ca2+ channel, CACN alpha-1, CaVx.x

EG_07405 Voltage-dependent L-type calcium channel subunit alpha-1D

EG_08501 Muscle calcium channel subunit alpha-1

EG_02129 voltage-dependent calcium channel L type alpha-1C

EG_00598 voltage-dependent calcium channel R type alpha-1E

Ca2+ channel, CACN alpha-2 delta

EG_00561 voltage-dependent calcium channel alpha-2/delta-4

Ca2+ channel, CACN beta

EG_04487 voltage-dependent calcium channel beta, invertebrate

K+ channel, KCNA, Kv1.x (Shaker)

EG_00107 Potassium voltage-gated channel subfamily A member 6

EG_05738 potassium voltage-gated channel Shaker-related subfamily A member 1

K+ channel, KCNB, Kv2.x (Shab)

EG_06854 potassium voltage-gated channel Shab-related subfamily B member 2

K+ channel, KCNC, Kv3.x (Shaw)

EG_00831 potassium voltage-gated channel Shaw-related subfamily C, invertebrate

K+ channel, KCND, Kv4.x (Shal)

EG_03099 potassium voltage-gated channel Shal-related subfamily D member 1


EG_03808 Potassium voltage-gated channel subfamily D member 3


K+ channel, KCNH, Kv10-12.x (Ether-a-go-go)

EG_00464 potassium voltage-gated channel Eag-related subfamily H member 4

EG_01928 potassium voltage-gated channel Eag-related subfamily H member 7

EG_01147 potassium voltage-gated channel Eag-related subfamily H, invertebrate

K+ channel, KCNK, K2px.x

EG_00645 Potassium channel subfamily K member 18

EG_00689 potassium channel subfamily K member 6

EG_02404 potassium channel subfamily K, invertebrate

EG_05667 TWiK family of potassium channels protein

EG_08277 Potassium channel subfamily K member 18

K+ channel, KCNQ, Kv7.x (KQT-like)

EG_05754 potassium voltage-gated channel KQT-like subfamily member 5

K+ channel, KCNM, KCa1.x

EG_02963 Small conductance calcium-activated potassium channel protein

EG_03683 Calcium-activated potassium channel subunit alpha-1

EG_06404 Calcium-activated potassium channel subunit alpha-1

EG_07380 potassium large conductance calcium-activated channel subfamily M alpha member 1

Related to voltage-gated cation channels

Cyclic nucleotide-gated channel (CNG)

EG_01279 cGMP-gated cation channel alpha-1

EG_03004 cyclic nucleotide gated channel alpha 3

EG_03248 Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel 4

EG_05822 cyclic nucleotide gated channel beta 1

Ryanodine receptor (RYR)

EG_09047 ryanodine receptor, invertebrate

Transient receptor potential family, TRPC (Classical)

EG_00433 transient receptor potential cation channel subfamily C, invertebrate

Transient receptor potential family, TRPM (Melastatin/Long TRP)


EG_09962 transient receptor potential cation channel subfamily M member 3

EG_07364 transient receptor potential cation channel subfamily M member 4

Transient receptor potential family, TRPA (ANKTM1)

EG_01784 transient receptor potential cation channel subfamily A member 1

Transient receptor potential family, TRPP (Polycystin)

EG_05182 polycystin 2L1

Transient receptor potential family, TRPML (Mucolipin)

EG_09642 mucolipin 3

3. Chloride channels

CLCN chloride channel

EG_01476 chloride channel 3

EG_03636 chloride channel 7

Nucleotide sensitive chloride channel

EG_02405 chloride channel, nucleotide-sensitive, 1A

Chloride intracellular channel

EG_05648 chloride intracellular channel 1

EG_04447 chloride intracellular channel 5

Related to neurotransmitter transporters

Neurotransmitter transporters

EG_05393 solute carrier family 6 (neurotransmitter transporter, serotonin) member 4

EG_01729 solute carrier family 6 (neurotransmitter transporter, glycine) member 5

EG_01731 solute carrier family 6 (neurotransmitter transporter, glycine) member 5

4.Non-ion channels

Aquaporins

EG_04164 aquaporin-4

EG_04162 aquaporin rerated protein, invertebrate

EG_04157 aquaporin PIP

EG_04161 aquaporin NIP

Aquaglyceroporins or glycerol-uptake facilitators



*Channel proteins were idenetified based on KEGG classification.


Supplementary Table 47. Vaccine candidates for intermediate hosts against E. granulosus

infection with genes expressed in adult worms (Adult), oncospheres (Onc), protoscoleces (PSC)

and hydatid cyst membrane (Cyst)

Gene ID Sequencing read number

Gnen description Adult Onc PSC Cyst


EG_05614 2 806 0 0 eg95

EG_07993 3 554 0 0 diagnostic antigen gp50

EG_00010 1 533 0 0 host-protective antigen

EG_08805 2 481 0 0 eg95


EG_10541 4 266 1 5 eg95

EG_08098 1 222 0 0 gli pathogenesis-related 1

EG_06806 1733 209 21 83 antigen B3

EG_06928 1 185 0 0 eg95


EG_04940 2 125 13 1 novel hemicentin protein

EG_08721 6 108 0 0 serine protease inhibitor- with kunitz and wap domains 1

EG_04657 18 98 30 50 reticulon-4 (neurite outgrowth inhibitor)

EG_00394 0 72 0 0 e74-like factor 2 (ets domain transcription factor)



EG_03592 64 61 24 36 low-density lipoprotein receptor

EG_05345 48 55 11 42 proteasome ( macropain) beta 1

EG_00715 146 33 69 154 tetraspanin 1-TSP6 [Echinococcus multilocularis]

EG_11122 0 30 0 0 eg95

EG_06751 2 27 0 0 eg95

EG_10281 79 24 12 12 eg95



Supplementary Table 48. Candidates for serodiagnosis tool development for cystic

echinococcosis with genes expressed in adult worms (Adult), oncospheres (Onc), protoscoleces

(PSC) and hydatid cyst membrane (Cyst) of E. granulosus

Gene ID Sequencing read number

Gene description Adult Onc PSC Cyst

EG_10560 367 354 1655 4301 heat shock protein hsp 90-alpha-like

EG_08863 209 968 1042 2045 heat shock protein 8

EG_06805 1 0 1 1920 antigen B subunit 1

EG_02642 506 616 354 1341 elongation factor 1 alpha

EG_09055 211 93 45 1051 ferritin

EG_07484 344 1 262 941 phosphoenolpyruvate carboxykinase

EG_01226 324 55 274 765 calmodulin 3b (phosphorylase delta)

EG_02955 63 32 110 492 citrate synthase

EG_05325 233 52 144 490 glyceraldehyde-3-phosphate dehydrogenase

EG_01667 212 91 296 485 elongation factor 2

EG_00209 257 111 63 415 thioredoxin peroxidase

EG_08628 278 4 54 387 malate cytoplasmic

EG_04249 44 3 120 352 cd53 antigen

EG_03078 51 221 296 338 major egg antigen/HSP20

EG_03566 51 3 110 323 proteinase inhibitor inhibitor of -containing protein

EG_03136 119 30 93 319 heat shock protein 60

EG_07685 156 10 135 304 enolase

EG_01163 178 677 145 302 antigen ii 3, EG10

EG_02924 84 4 10 254 ornithine aminotransferase

EG_09600 71 3 30 252 rhotekin

EG_04862 209 5 61 250 mastin precursor/antigen 5

EG_01261 151 6 48 196 permease 1 heavy chain

EG_06754 87 1 92 183 threonyl-trna isoform a

EG_07276 211 181 20 182 glutathione s-transferase mu 2

EG_02604 107 19 51 181 ---NA---

EG_10196 763 0 298 177 tetraspanin 1

EG_07010 112 16 53 162 malate dehydrogenase

EG_06932 82 16 135 154 heat shock 70kda protein 4


EG_08002 0 0 91 153 eg19 antigen

EG_08521 572 30 29 150 tegument antigen (i a)


Supplementary Note

Genome sequencing and annotation

Genome sequencing and assembly

A total of 22,340 contigs, ranging from 100 bp to 255,553 bp, were assembled from 2.7 giga-bases

(Gb) of 454 GS FLX shotgun sequences using Newbler V2.3. To increase the quality of the

sequence, 12.6 Gb of Solexa pair-end reads were mapped to the contigs. Totally, 967 scaffolds with

a length of 110.8 Mb were obtained by combining with 8.17 Gb of Illuimina mate-pair reads.

To search for underrepresented sequences in the genome, the 454 long read coverage-based

method was used to identify repetitive sequences (repeats) in the contigs. The total 22,340 contigs

sized 111.8 Mb gave an average coverage of 26.9 based on the sequencing reads; therefore, any

contig with coverage more than 54 (two times of average coverage) was considered as a repeat.

Thus a total of 13,158 contigs were identified as repeats, with copy number ranging from 2 to 666

(Supplementary Table 4). Among them, only 1,216 contigs, sized 2.4Mb, were assembled into the

scaffolds. The other repeat contigs as orphans, with a total size of 3.6 Mb, were not assembled into

the scaffolds,. Taking the copy numbers of repeats into account, the total size of repeat sequences is

45.86 Mb. Thus, we estimated that the total size of the draft genome of E. granulosus is 151.6 Mb

including 105.75 Mb of unique contigs (similar to the E. granulosus genome sequenced by Tsai et

al.1) and 45.86 Mb of repeats, which accounts for almost one third (30.25%) of the genome.

We estimated the size of the genome based on k-mer frequencies in Solexa reads and 454 reads,

separately. Occurrence of 17-nucleotide was counted using Jellyfish2, and a 17-nucleotide depth

distribution was used to calculate the size of the genome, which suggested a size of 161 Mb using

454 reads and 157 Mb using Solexa reads (Supplementary Fig. 2).

Ninety-seven percent of the complete mitochondrial sequence3 was matched to the assembled

contigs. To further validate the quality of genome sequencing, a fosmid library was constructed and

19 randomly selected fosmid clones with a size range 30-45 kb were sequenced. In total 625 kb

(97.3%) fosmid sequences were covered by the assembled contigs (Supplementary Fig. 1). In


addition, 540,913 (96.2%) of the 561,998 ESTs were detected in the genome contigs. The overall

validation results showed that more than 96% of the E. granulosus genome sequence was

represented in the draft. The completeness of E. granulosus genome scaffolds was also assessed with

CEGMA4. There are 221, or 89% of core eukaryotic genes (CEGs) found in E. granulosus, which is more

than those of the two schistosomes (79-80%) and a little lower than that of T. spiralis (94%)

(Supplementary Table 3).

Repetitive sequences

Among the 13,158 repeat units, 9,376 had a low copy number (2-10) in a total size of 21.7 Mb, and

3,782 were moderately repetitive sequences in a total size of 24.2 Mb. Of these repeat units, only

933 matched to known sequences, including Eg18S and 28S ribosomal RNA (rRNA) genes,

microsatellite sequences, Hsp70 pseudogenes and some known E. granulosus repetitive DNA

elements (EgBRep) (Supplementary Table 9). In the 19 sequenced fosmids, 165,826 bp could be

masked using these repeat units, accounting for 25.8% of the whole sequences. This fraction was

consistent with the estimated repeat content of the whole genome. However, we found that the

repeat ratio among the 19 fosmids was largely variable; four fosmids were almost completely

composed of repeats (96%-99%), whereas the other 15 had a repeat ratio less than 15%

(Supplementary Table 5), indicating that the repeats in the E. granulosus genome are not evenly

distributed.

We did not identify any complete retrotransposons in E. granulosus, in contrast to

schistosomes, whose genomes contain 20% of retrotransposons5,6

. Only segments of 40 contigs

showed short matches with four different Gag-Pol proteins, indicating the presence of small size,

truncated retrotransposon sequences in the E. granulosus genome, a situation similar to nematodes,

where they cover only 0.5%-1.7% of the genomes of the parasitic B. malayi7and T. spiralis

8 and the

free-living C. elegans9 and P. pacificus

10. These results suggest that parasites such as schistosomes,

with active free-living miracidial and cercarial stages, might have evolved more complicated

genomes through expansion of retrotransposons to adapt to their complex living environment. We

identified 40,025 microsatellite loci, 21,529 minisatellite loci and 42 satellite loci in the E.

granulosus genome, constituting 766,971 bp, 1,122,063 bp and 34,354 bp, respectively.


In the assembled 110.8Mb scaffolds, we revealed a total of 980 repeat families, accounting for

6% of the E. granulosus scaffolds in size, less than that (7.6%) in the E. granulosus genome

reported by Tsai et al.1 .

GC and CpG content

E. granulosus genome had an overall GC content of 42.1% with 49.3%, 40.1% and 40.9% in exons,

introns and intergenic regions, respectively. It was the highest GC contents in both genome and

coding regions among all the compared parasites and free-living nematodes (Table 1). The CpG

dinucleotide content of E. granulosus genes was under-represented compared with that expected

from mononucleotide frequencies (observed CpG/expected CpG ratio=0.83). The observed

CpG/expected CpG ratio in genes was similar among the worms, from 0.80 (schistosomes) to 1 (T.

spiralis), which is much higher than the ratio in mammals (0.44 in Homo sapiens and 0.48 in Canis

lupus familiaris) (Supplementary Fig. 5). This means that DNA methylation occurs in a low

frequency in worms than in mammals, since methylated cytosine mutates to thymine at a high rate

and thus caused CpG deficiency. This hypothesis was supported by two facts. One is that we found

only one DNA (cytosine-5-)-methyltransferase gene (DNMT3B, EG_07014, K00558) in the E.

granulosus genome (Supplementary Table 13), whereas 10 DNMT genes are present in the human

genome. Another fact is that DNA methylation was seldom reported in parasites, partly due to the

low methylation ratio. But both DNMT3B and methyl-CpG-binding domain protein (MBD,

EG_02905, K11590) existed in the E. granulosus genome, indicating a possible functional role of

DNA methylation. Indeed, cytosine methylation in the S. mansoni genome was recently reported11

,

which revealed that DNA methylation regulated schistosome oviposition and was associated with

repetitive regions. Further, the observed CpG/expected CpG ratio in intergenic regions (0.74) and

introns (0.76) was smaller than exons (0.83), indicating that non-coding region of E. granulosus had

higher methylated modification.

Single nucleotide polymorphisms (SNPs)

All the Solexa reads were mapped on the E. granulosus genome using bowtie212

. SNPs were called

using samtools13

, with the following parameters: variation frequency was set >40% with at least 10


reads covering SNP sites, and the base quality of both reference site and variation site was >20.

Although the genome was sequenced with material from a single E. granulosus cyst (originating

from a single egg and thus a clone), we found 145,534 SNP sites, with a density of about 0.96

SNPs/kb. This is higher than expected when comparing the density of SNPs (1.4 SNPs/kb) in the

genome of S. japonicum sequenced using a polyclonal DNA source5 (Supplementary Table 10).

The distribution of SNPs in the E. granulosus genome was uneven, with 1 SNP per 1,124 bp in

exons, 1 SNP per 806 bp in introns, and 1 SNP per 1,035 bp in intergenic regions. Indeed, we found

SNPs in only 8,234 exons, compared with SNPs in 15,283 introns. Most substitutions were A/G

(35.6%) and C/T (36.1%), similar to S. japonicum (Supplementary Table 11)14

. A comparison of

the SNP frequency between genome and transcriptome (Supplementary Table 12) revealed that the

A-T and C-G transversion ratios in the transcriptome of four life stages were higher than at the

genome level.

Gene characteristics

Incorporating extrinsic information (EST and protein alignments, etc.), Exonhunter15

and two other

prediction programs (GeneMark.hmm16

and Augustus17

) were utilized to identify 11,325 protein

encoding genes, which spanned 64.1 Mb (42.3%) of the genome with an average gene density of 75

genes per Mb. The average gene size was 5,657 bp, with 6.5 exons per gene and an average CDS

size of 1,401 bp (Supplementary Fig. 3a). The intron size distribution in E. granulosus was almost

union from the 5’ to 3’ end, with the intron size at 5’ end slightly larger (Supplementary Fig. 3b).

This is not like schistosomes which have a skewed size distribution, with the 5’ end introns smaller

than the 3’ end introns. Tsai et al. predicted 10,231 E. granulosus genes1, and the difference in

number was mainly due to the different prediction method employed, as they used the E.

multilocularis gene set as reference.

Micro-exon genes (MEGs) have been found in S.mansoni, with the micro-exons occupying

75% of the coding sequences in the MEGs6. In the E. granulosus genome, we found 1,723 micro-

exons (2.3%), whose size was less than 36bp, with the smallest size being 12bp. These exons are

scattered in 1,527 genes with the largest gene having 13 micro-exons dispersed in the other 39


conventional exons. The largest micro-exon ratio only reached 66% in a gene having three exons

(Supplementary Fig. 3c). And not like S.mansoni, near 1/3 (537) micro-exons located in the last

exon of E. granulosus gene structure instead of locating in the middle of gene (Supplementary Fig.

3d). A total of 1,054 genes were predicted without introns (Supplementary Table 6).

The coding sequences were about 15.8Mb (10.4%) in the genome, with a largest CDS

(EG_05022) of 23,562 bp, composed of 115 exons. It encodes a protein with 28% identity to the

basement membrane-specific heparan sulfate proteoglycan core protein of Clonorchis sinensis. The

coding genes span 64.1 Mb across the genome, with the largest gene being 61,625 bp (EG_01689),

encoding Dynein heavy chain 2. The average exon and intron sizes were 214 bp and 726 bp,

respectively (Table 1). The intron size is only half of that found in schistosomes but much larger

than other worms, and this also contributes to the smaller size of the E. granulosus genome relative

to the schistosomes genomes.

Operons and trans-splicing had been widely reported in C.elegans18,19

. To identify functional

operons in E. granulosus genome, we screened genes with same transcriptional orientation and less

than 1kb intergenic distances. This method revealed 1,324 genes in 620 operons. While clustering

analysis of these genes’ expression data only validated co-transcription of 21 genes in 10 operons

(Supplementary Table 7, Supplementary Fig. 4). Then all the EST sequences were mapped on

predicted CDS, and 5’ UTR regions were selected and clustered to identify spliced leader (SL).

Then one conserved domain-‘CACCGTTAATCGGTCCTTACCTTGCAATTTTGTATG’ was

revealed, similar to the SL1 sequence previously reported in E. granulosus 20

. The SL1 sequence of

E. granulosus is located in contig17689, which is predicted to repeat 168 times in the genome

(Supplementary Table 4). This is consistent with the fact that C.elegans contains 110 SL1 RNA

genes21

. But the ESTs containing SL1 in E. granulosus genome only represented 159 genes

(Supplementary Table 8), this might be caused by the 5’-CAP capture method in cDNA library

construction, which cannot efficiently capture mRNAs with a SL sequence22

.

The E. granulosus genome contains 10% of protein coding sequences, twice than that found in

the schistosomes, but it is notable that the coding region ratio in the parasitic Platyhelminthes is


lower than that in nematodes. This is in accord with the higher ratio of repeats found in the former

group. The gene density (genes per Mb) in E. granulosus is the highest reported to date for any

Platyhelminth, although it is still lower than that in nematodes. Whereas the introns in E.

granulosus were smaller in size than those found in schistosomes, the Platyhelminthes have a

significantly larger intronic size (652~1758 bp) than is found in nematodes (69-217 bp) (Table 1),

even though the total coding size of both groups of worms is similar.

BLASTP searches revealed that 7,336 (64.8%) E. granulosus proteins have homology with

known proteins. Combined with 8,336 (73.6%) genes matched to known ESTs, a total of 9,270

(81.8%) protein coding genes were supported by the coding and expression evidence.

InterProScan23

assigned the proteins to 5,802 IPR domains, and Blast2GO24

assigned 5,010 GO

terms to 4,569 E. granulosus proteins. The 2,231 transmembrane proteins are predicted by

TMHMM25

, and the 1,748 secreted proteins are predicted by TargetP and SignalP26

. Among the

potential secreted proteins, 809 without transmembrane region and GPI anchor (predicted by

PredGPI27

) are identified as extracellular proteins.

Comparative genomics and features associated with parasitism

An hmmpfam search was run with threshold E-value less than 1E-2, and 6,428 Pfam domain

families were identified in E. granulosus, schistosomes (S. japonicum and S. mansoni), parasitic

nematodes (B. malayi and T. spiralis), non-prarasitic nematodes (C. elegans and P. pacificus) and

mammals (H. sapiens and C. familiaris)28

. There are 3,405 domains found in E. granulosus, with

similar number of domains found in other four parasitic species and less than those of the two free-

living nematodes (Supplementary Table 14). E. granulosus shares 2,872 (82.8%) domains with the

other four taxa (Supplementary Fig. 6). We found E. granulosus lost 495 Pfam domains by

compared with the two free-living nematodes and two mammals, their relative GO identifiers are

used for GO enrichment analysis with REVIGO29

. The result shows the lost domain families are

related to some metabolism, biosynthesis, oxidation-reduction processes, and etc. (Supplementary

Fig. 9, Supplementary Table 16).


KEGG Orthology (KO) analysis showed that a total of 4,327 were revealed in seven different

worms, with 2,577 belonging to E. granulosus (Supplementary Table 13). Among them, 1,069

KOs were shared by all the species, and 134 KOs were E. granulosus-unique. In addition, 1,750

KOs were E. granulosus lost, and 124 of them existed in all the other worms except in E.

granulosus. A total of 2,671 KOs were found involved in different KEGG pathways.

We also measured protein orthologs across the Platyhelminthes and nematoda based on

OrthoMCL30

using an inflation index of I=1.5, and assigned proteins of the seven taxa into 14,306

ortholog groups. Among them 1,835 ortholog groups were common among the seven taxa, 1,116

ortholog groups were unique for Platyhelminthes, 1,270 ortholog groups were unique for nematode,

33 parasites unique ortholog groups, and 351 ortholog groups were unique for E. granulosus

(Supplementary Table 25, Supplementary Fig. 11).

Genes associated with parasitism

E. granulosus shares 3,161 (91.1%) of its domains with schistosomes, and the ratio is slightly

higher than when compared with those of the two other parasitic (T.spiralis and B.malayi, 88.4%)

and the two free-living nematodes (C.elegans and P.pacificus, 89.7%). We found that the number of

domains was variable between the Platyhelminthes (E. granulosus and schistosomes) and the

nematodes (Supplementary Fig. 7), implying some different strategies in adaptation to differing

environments and the parasite life style. For the 76 domains specifically shared among the E.

granulosus genome and the other sequenced helminth parasite genomes and 39 E. granulosus

specific domains (Supplementary Fig. 7), most of them except EgAgB are also existed in the two

mammals, H. sapiens and C. familiaris. And we do not find functional annotations of these domains

imply a common association with the parasitic lifestyle.

However, 33 ortholog groups are present in E. granulosus and the other four parasites that are

absent from the free-living nematodes, suggesting these genes may be associated with parasitism.

These ortholog groups contain 42 E. granulosus genes (Supplementary Table 24), with five only

expressed in adult worm and cyst stages. GO enrichment analysis revealed these genes enriched in

calcium ion binding category (Supplementary Table 26). These 42 E. granulosus genes include


one protein similar to CD151 antigen (tetraspainin), an extracellular alpha- and gamma-adaptin-

binding protein (AAGAB), which involves in membrane trafficking and plays a chaperone role

such as preventing soluble adaptors from co-assembling with soluble clathrin, or helping to

remove the adaptors from the coated vesicle. The AAGAB encoded by E. granulosus might

regulate the clathrin-coated vesicles formation.

These also include two genes (EG_05745 and EG_05747) encoding TGF-beta receptor-

associated protein (TGFBRAP). This protein is known to be a Smad4 chaperone, as it binds

exclusively to either the TGF-beta receptor or to Smad4. Smad4 is the common mediator of the

Smad signaling Pathway. E. granulosus encodes an extracellular TGFBRAP and might utilize it to

regulate the cell cycle and apoptosis in its mammalian hosts. Strikingly, EG_05747 is up-regulated

in protoscolex, while EG_05089, which encodes a transmembrane Bax inhibitor shown to suppress

apoptosis, was down-regulated (Supplementary Table 27).

E. granulosus encodes seven peptidylprolyl isomerases (PPIases) with about 60% identity to

human cyclophilin A. PPIase catalyses the cis–trans isomerisation of peptide bonds with proline

residues in polypeptide chains and thus functions as a protein folding chaperon31

. As an

extracellular protein, E. granulosus may use these PPIases to regulate the host immune system by

modulating host proteins32

.

Bidirectional development

Gene expression and bidirectional development of the PSC

To profile gene expression in E. granulosus, we employed the 454 GS FLX system and sequenced

561,998 ESTs/reads including 199,502 from Adult, 73,452 from Onc, 121,508 from PSC and

167,536 from the Cyst with an average length of 300 bp. These ESTs represented 8,336 predicted E.

granulosus genes (Supplementary Table 28). We used real time PCR to confirm the expression of

10 genes in the four distinct parasite stages which showed a high level of correlation (R2=0.64)

(Supplementary Fig. 12). A total of 1,156 genes were significantly up- or down- regulated in one

stage relative to the other three stages (Supplementary Table 27).


Gene expression during the development of PSC to Adult

There were 212 genes up-regulated in Adult compared with these transcripts in PSC and Onc (Fig 2,

Supplementary Table 29). These genes accounted for 2.5% of the total transcribed genes and

comprised 26.7% of the total transcript reads in adult E. granulosus. GO enrichment analysis found

these up-regulated genes enriched in peptidase inhibitor activity (GO:0030414, FDR=4.4E-2).

Besides genes for normal metabolic process (34 genes), the up-regulated genes were associated with

sexual reproduction (11 genes involved in spermatid development, fertilization, sex differentiation

and embryonic morphogenesis), signalling (nine genes), vesicle-mediated transport (10 genes),

nervous system development (nine genes), proteolysis (eight genes), oxidation-reduction process

(seven genes), auxin metabolic process (six genes) and response to stimulus (21 genes), which were

a different set of genes from those in PSC. Adult expressed 73 genes against stress responses

including 10 genes that were significantly up-regulated. There were three genes specifically

expressed in Adult - calcium-binding protein, thioredoxin glutathione reductase and histone h4.

We also identified seven genes encoding multidrug resistance proteins that were expressed in

Adult and PSC. This family of proteins functions as bile salt transporters33

. Based on BLASTP

result to NCBI nr database, 10 genes are annotated as nuclear receptors (Supplementary Table 30),

and they have sequence similarity (Evalue<1E-20) with known receptors which might bind bile acid

such as FXR and VDR. In addition, we identified five genes encoding sodium/bile acid co-

transporters (ASBTs)34

, suggesting that these bile acid/salt transporters may play a key role in

transporting bile salts during adult development, triggered by the presence of bile. Of note, a gene

(EG_00147) encoding acyl-CoA-binding protein (ACBP) was highly expressed in Adult. ACBP is

an essential gene for handling fatty acids, fatty acid derivatives and phospholipids35-40

, suggesting a

key role in lipid metabolism. ACBP has been identified in mammals as a neuropeptide which

inhibits diazepam binding to the GABA (γ aminobutyric acid) receptor and is also known as

diazepam binding inhibitor (DNI)/endozepine (EP)41

.

Given that mature Adult reside within the crypts of Lieberkühn in a particular region of the

anterior quarter of the dog small intestine, chemotaxis molecules may help in site selection along


the gut. E. granulosus has transcripts for neuropeptide f (Npf, EG_05085）and its receptor (NpfR,

EG_02175) in Adult and PSC, indicating that these two stages may have an Npf signalling system

to aid in food searching and acquisition42

. Several genes encoding polycystins (EG_02749,

EG_02750, EG_04516, EG_08325 and EG_09368) are expressed in PSC. Polycystin is involved in

the neuropeptide signalling pathway43

, suggesting that in the early stages of adult development, E.

granulosus produces sensory structures to sense fluid motion in the dog intestine.

Genes up-regulated during development of Cyst

To identify genes putatively associated with the development of PSC into the cystic stage

(‘secondary’ hydatidosis), we compared transcripts from the Cyst with those in PSC. There were

225 genes significantly up-regulated in the Cyst (Supplementary Table 31a) and enrichment

analysis showed that these genes are associated with DNA packaging and cellular component

biogenesis. Among the 356 Cyst down-regulated genes (Supplementary Table 31b), lipoxygenase

(EG_03468), neurexin (EG_01881), erc protein 2 (EG_02145) and kelch-like 10 (EG_05746), are

putatively associated with nerve and male gonad/spermatid development.

The hydatid cyst develops from an Onc following a primary infection. Compared with the Onc,

350 genes were significantly up-regulated in Cyst (Fig. 2, Supplementary Table 31c), including 57

genes containing signaling peptides. These secreted proteins could therefore serve as important

messengers for “cross-talk” between the larval parasite and its host. To this end, EgAgB could be

one of the key proteins involved in controlling host immune responses44,45

. The EgAgB gene family

has several genes encoding secreted proteins46

which are present at high concentration in hydatid

cyst fluid47

. It has been determined also that these antigens are found circulating at high

concentration in CE patient blood48-52

. EgAgB is a serine protease inhibitor with strong

chemoattractant activity53,54

. It has been shown that EgAgB skews the Th1/Th2 cytokine ratio

towards a preferentially immunopathology-associated Th2 polarization (which benefits parasite

survival)54

, interferes with monocyte differentiation, modulates DC maturation45

, and inhibits PMN

recruitment and chemotaxis54

.

With regard to the possible mechanism underlying the parasite’s exploitation of nutrients from


its mammalian hosts, at least seven cathepsin genes were identified with EST reads in each of the

stages. Cathepsin I was highly expressed in the Cyst, suggesting the larval cyst produces this

protease in order to digest host proteins as considerable quantities of host plasma proteins are

present in hydatid cyst fluid47

.

Signaling pathways and immune responses

Genes involved in cross-talk between host and parasite

E. granulosus possesses several complete signaling pathways (Supplementary Table 36) although

the factors/ligands are absent in the genome. It has been shown that E. granulosus insulin receptors

bind human insulin, indicating the parasite may also exploit host growth factors as developmental

signals55

. Predicted components of the Calcium, ErbB, VEGF, Ras–Raf–MAPK and TGF-β–SMAD

signaling pathways (including FGFR and EGFR), including 12 extracellular proteins, also share

high sequence identity with their mammalian orthologs (>50% identity). This further supports the

concept that E. granulosus utilizes host growth factors as developmental signals or for regulating

host signaling pathways for its own benefit.

The E. granulosus genome also encodes five integrins and eight other cell surface adhesion

proteins involved in ECM-receptor interaction. As well, 192 proteins, including paxillin, vinculin,

talin, alpha and beta-catenin, were identified that participate in cell communication and regulation

of the actin cytoskeleton (Supplementary Table 38). These proteins may be responsible for the

selective and specific acquisition of host proteins. For instance, cholecystokinin (CCK) is a peptide

hormone of the gastrointestinal system responsible for stimulating the digestion of fat and protein;

pyrokinins are neuropeptides that mediate visceral muscle contractile activity; and adiponectin

shows similarity to the complement 1Q factors and to insulin–sensitizing hormone. These proteins

might also play roles in E. granulosus cyst germinal cell formation as we found that actin gene

(EG_08301), tubulin alpha-1C chain gene (EG_08757) and tyrosine-protein kinase Fyn gene

(EG_09507) were significantly up-regulated in germinal cells (Supplementary Table 38). Both

actin gene and tyrosine-protein kinase Fyn gene may participate in adherens junction formation and


focal adhesion, and tubulin alpha-1C chain gene is likely involved in gap junction formation.

Neuroendocrine and nervous system

We did not find genes encoding hormones produced by hypothalamus-like cells, such as

thyrotropin-releasing hormone (TRH), corticotrophin-releasing hormone (CRH), gonadotropin-

releasing hormone (GnRH), growth-hormone-releasing hormone (GHRH), and prolactin-releasing

hormone (PRH), or by pituitary-like cells, such as thyroid-stimulating hormone (TSH),

adrenocorticotropic hormone (ACTH), follicle-stimulating hormone (FSH), and luteinizing

hormone (LH). Two putative receptors of the hypothalamic–pituitary–thyroid axis were, however,

found in E. granulosus (EG_07666 and EG_08053). Since no hormone genes associated with the

relevant receptors were found, these putative neuroendocrine receptors might accept the hormones

from the host and regulate growth and development in E. granulosus, which also is the case with S.

japonicum56

.

In addition, we identified 92 genes encoding sensory system elements (Supplementary Table

40). It is of interest that five described LOXHD1 (lipoxygenase homology domain-containing

protein 1) genes (EG_03468, EG_03469, EG_03470, EG_03471 and EG_07842), which are

associated with building hearing sensors57

, were expressed in the PSC and adult of E. granulosus.

Given that E. granulosus is unlikely to require hearing sensors in its mammalian hosts, these likely

perform a different function(s) associated with the nervous system. Putative sensory components for

equilibrium/balance, mechanical stimulation, pain and temperature are also transcribed in E.

granulosus.

Regulation of immunological responses

As indicated above, EgAgB is an E. granulosus-specific gene family in the nine compared taxa.

These genes encode secreted proteins which have a range of functions including skewing the

Th1/Th2 cytokine ratio towards a preferentially immunopathology-associated Th2 polarization,

which benefits parasite survival54

; interfering with monocyte differentiation, modulating DC

maturation45

; and inhibiting PMN recruitment and chemotaxis54

and effector T cell activity;

alternatively activating macrophages, and inducing dendritic cells44

. EgAgB proteins are present at


high concentration in hydatid cyst fluid47

and are found circulating at high concentration in CE

patient blood49,50

. EgAgB is also a serine protease inhibitor with strong chemoattractant activity54

.

One hundred and twelve KEGG orthology terms found in E. granulosus are involved in the

immune system. Of these, four were not found in other worms and include the enzyme NFAT

(EG_04551), which is involved in the B and T cell receptor signaling pathway and in natural killer

cell mediated cytotoxicity. This component was significantly up-regulated in the protoscolex

relative to the other three stages (Supplementary Table 43). Similarly, RFX (EG_03236), which

was only expressed in the adult and cyst germinal cells, is unique to E. granulosus and is involved

in antigen processing and the presentation pathway. WAVE (EG_10005), which is involved in Fc

gamma R-mediated phagocytosis, is also unique to E. granulosus, and was expressed in all the

stages except the Onc.

Seven venom allergen-like 6 proteins, which also regulate host immune responses, and a range

of protease inhibitors including 6 serpins are present in E. granulosus. Serpins, which are secreted

by a range of parasites, are recognized as key components that inhibit host protease attack and are

implicated in parasite survival58

.

We identified 13 extracellular proteins in E. granulosus which are synonymous with the

mammalian immune system. EG_01997 encodes an extracellular alpha-2-macroglobulin, which

was the only enzyme present in E. granulosus which participates in the complement and

coagulation cascades. A total of seven components of these cascades were found in the other worm

taxa, but each species possesses different enzymes, indicating that these systems are likely

degenerate in worms. Another two predicted genes (EG_02699 and EG_08018) encode proteins

with 46% identity to human cathepsin L1 and 56% identity with human calreticulin, respectively.

These proteins participate in the MHCI pathway of antigen processing and presentation

(Supplementary Table 43).

Innate immunity and microbe invasion

Innate immunity is an important and universal mechanism based on studies of model organisms

such as Drosophila and C. elegans59

. Recent work has identified a variety of different defense


response molecules including MAPKs in C. elegans60-66

. It is noteworthy eight genes encoding

MAPKs are present in the E. granulosus genome suggesting employment of a MAPK-related

signalling cascade as a key component in its innate immune response61,62

.

Toll-like receptor is apparently conserved as a molecular player in activating innate

immunity63,65,66

. However, unlike schistosomes, we did not identify any gene associated with the

Toll-like receptor pathway in the E. granulosus genome. Interestingly, the parasite has complete

pathways to allow microbes to enter its cells. These include pathways of bacterial invasion of

epithelial cells through the Zipper model of invasion, one for pathogenic Escherichia coli infection

and a pathway of epithelial cell signalling in Helicobacter pylori infection.

Drug target gene prediction

Druggable proteins of E. granulosus were firstly identified based on InterPro domains that had been

shown to bind rule-of-five (Ro5) compliant drugs67

, which revealed 309 E. granulosus proteins,

including 56 GPCRs, 28 protein kinases, 22 peptidases, 10 nuclear hormone receptor, etc

(Supplementary Table 44). As parasite genes that lack orthologs in their hosts are desirable as

selective targets68

, we then exclude E. granulosus proteins having orthologs in H. sapiens or C.

familiaris based on OrthoMCL groups definition30

. Finally we obtained 72 E. granulosus proteins

as potential drug targets (Supplementary Table 45), including 32 GPCRs, 11 Na+ channel protein,

three nuclear hormone receptors, two peptidases and three protein kinases. Taking account of gene

expression level, 41 genes expression in CM, which is the infection phase in human, might be the

most promising drug targets.


References

1. Tsai, I.J. et al. The genomes of four tapeworm species reveal adaptations to parasitism.

Nature 496, 57-63 (2013).

2. Marcais, G. & Kingsford, C. A fast, lock-free approach for efficient parallel counting of

occurrences of k-mers. Bioinformatics 27, 764-70 (2011).

3. Le, T.H. et al. Complete mitochondrial genomes confirm the distinctiveness of the horse-

dog and sheep-dog strains of Echinococcus granulosus. Parasitology 124, 97-112. (2002).

4. Parra, G., Bradnam, K. & Korf, I. CEGMA: a pipeline to accurately annotate core genes in

eukaryotic genomes. Bioinformatics 23, 1061-7 (2007).

5. Zhou, Y. et al. The Schistosoma japonicum genome reveals features of host-parasite

interplay. Nature 460, 345-51 (2009).

6. Berriman, M. et al. The genome of the blood fluke Schistosoma mansoni. Nature 460, 352-8

(2009).

7. Ghedin, E. et al. Draft genome of the filarial nematode parasite Brugia malayi. Science 317,

1756-60 (2007).

8. Mitreva, M. et al. The draft genome of the parasitic nematode Trichinella spiralis. Nat

Genet 43, 228-35 (2011).

9. Genome sequence of the nematode C. elegans: a platform for investigating biology. Science

282, 2012-8 (1998).

10. Dieterich, C. et al. The Pristionchus pacificus genome provides a unique perspective on

nematode lifestyle and parasitism. Nat Genet 40, 1193-8 (2008).

11. Geyer, K.K. et al. Cytosine methylation regulates oviposition in the pathogenic blood fluke

Schistosoma mansoni. Nat Commun 2, 424 (2011).

12. Langmead, B. & Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9,

357-9 (2012).

13. Li, H. et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25, 2078-9

(2009).

14. Liu, F. et al. New perspectives on host-parasite interplay by comparative transcriptomic and

proteomic analyses of Schistosoma japonicum. PLoS Pathog 2, e29 (2006).

15. Brejova, B. et al. Finding genes in Schistosoma japonicum: annotating novel genomes with

help of extrinsic evidence. Nucleic Acids Res 37, e52 (2009).

16. Lomsadze, A., Ter-Hovhannisyan, V., Chernoff, Y.O. & Borodovsky, M. Gene

identification in novel eukaryotic genomes by self-training algorithm. Nucleic Acids Res 33,

6494-506 (2005).

17. Stanke, M. & Waack, S. Gene prediction with a hidden Markov model and a new intron

submodel. Bioinformatics 19 Suppl 2, ii215-25 (2003).

18. Blumenthal, T. et al. A global analysis of Caenorhabditis elegans operons. Nature 417, 851-

4 (2002).

19. Allen, M.A., Hillier, L.W., Waterston, R.H. & Blumenthal, T. A global analysis of C.

elegans trans-splicing. Genome Res 21, 255-64 (2011).

20. Brehm, K., Jensen, K. & Frosch, M. mRNA trans-splicing in the human parasitic cestode

Echinococcus multilocularis. J Biol Chem 275, 38311-8 (2000).

21. Blumenthal, T. Trans-splicing and operons. WormBook, 1-9 (2005).

22. Parkinson, J. et al. A Transcriptomic Analysis of Echinococcus granulosus Larval Stages:

Implications for Parasite Biology and Host Adaptation. PLoS Negl Trop Dis 6, e1897 (2012).

23. Quevillon, E. et al. InterProScan: protein domains identifier. Nucleic Acids Res 33, W116-

20 (2005).

24. Conesa, A. & Gotz, S. Blast2GO: A comprehensive suite for functional analysis in plant

genomics. Int J Plant Genomics 2008, 619832 (2008).

25. Emanuelsson, O., Brunak, S., von Heijne, G. & Nielsen, H. Locating proteins in the cell

using TargetP, SignalP and related tools. Nat Protoc 2, 953-71 (2007).

26. Petersen, T.N., Brunak, S., von Heijne, G. & Nielsen, H. SignalP 4.0: discriminating signal

peptides from transmembrane regions. Nat Methods 8, 785-6 (2011).

27. Pierleoni, A., Martelli, P.L. & Casadio, R. PredGPI: a GPI-anchor predictor. BMC


Bioinformatics 9, 392 (2008).

28. Punta, M. et al. The Pfam protein families database. Nucleic Acids Res 40, D290-301 (2012).

29. Supek, F., Bosnjak, M., Skunca, N. & Smuc, T. REVIGO summarizes and visualizes long

lists of gene ontology terms. PLoS One 6, e21800 (2011).

30. Chen, F., Mackey, A.J., Stoeckert, C.J., Jr. & Roos, D.S. OrthoMCL-DB: querying a

comprehensive multi-species collection of ortholog groups. Nucleic Acids Res 34, D363-8

(2006).

31. Bell, A., Monaghan, P. & Page, A.P. Peptidyl-prolyl cis-trans isomerases (immunophilins)

and their roles in parasite biochemistry, host-parasite interaction and antiparasitic drug

action. Int J Parasitol 36, 261-76 (2006).

32. Kanehisa, M., Goto, S., Kawashima, S., Okuno, Y. & Hattori, M. The KEGG resource for

deciphering the genome. Nucleic Acids Res 32, D277-80 (2004).

33. Hirohashi, T., Suzuki, H., Takikawa, H. & Sugiyama, Y. ATP-dependent transport of bile

salts by rat multidrug resistance-associated protein 3 (Mrp3). J Biol Chem 275, 2905-10

(2000).

34. Giacomini, K.M. et al. Membrane transporters in drug development. Nat Rev Drug Discov 9,

215-36 (2010).

35. Gaigg, B. et al. Depletion of acyl-coenzyme A-binding protein affects sphingolipid

synthesis and causes vesicle accumulation and membrane defects in Saccharomyces

cerevisiae. Mol Biol Cell 12, 1147-60 (2001).

36. Milne, K.G. & Ferguson, M.A. Cloning, expression, and characterization of the acyl-CoA-

binding protein in African trypanosomes. J Biol Chem 275, 12503-8 (2000).

37. Faergeman, N.J. et al. Acyl-CoA binding proteins; structural and functional conservation

over 2000 MYA. Mol Cell Biochem 299, 55-65 (2007).

38. Sandberg, M.B. et al. The gene encoding acyl-CoA-binding protein is subject to metabolic

regulation by both sterol regulatory element-binding protein and peroxisome proliferator-

activated receptor alpha in hepatocytes. J Biol Chem 280, 5258-66 (2005).

39. Helledie, T. et al. Role of adipocyte lipid-binding protein (ALBP) and acyl-coA binding

protein (ACBP) in PPAR-mediated transactivation. Mol Cell Biochem 239, 157-64 (2002).

40. Cavagnari, B.M., Sterin-Speziale, N., Affanni, J.M., Knudsen, J. & Santome, J.A. Acyl-

CoA-binding protein in the armadillo Harderian gland: its primary structure and possible

role in lipid secretion. Biochim Biophys Acta 1545, 314-25 (2001).

41. Guidotti, A. et al. Isolation, characterization, and purification to homogeneity of an

endogenous polypeptide with agonistic action on benzodiazepine receptors. Proc Natl Acad

Sci U S A 80, 3531-5 (1983).

42. Shen, P. & Cai, H.N. Drosophila neuropeptide F mediates integration of chemosensory

stimulation and conditioning of the nervous system by food. J Neurobiol 47, 16-25 (2001).

43. Nauli, S.M. et al. Polycystins 1 and 2 mediate mechanosensation in the primary cilium of

kidney cells. Nat Genet 33, 129-37 (2003).

44. Siracusano, A. et al. Molecular cross-talk in host-parasite relationships: The intriguing

immunomodulatory role of Echinococcus antigen B in cystic echinococcosis. Int J Parasitol

38, 1371-6 (2008).

45. Rigano, R. et al. Echinococcus granulosus antigen B impairs human dendritic cell

differentiation and polarizes immature dendritic cell maturation towards a Th2 cell response.

Infect Immun 75, 1667-78 (2007).

46. Zhang, W. et al. The Echinococcus granulosus antigen B gene family comprises at least 10

unique genes in five subclasses which are differentially expressed. PLoS Negl Trop Dis 4,

e784 (2010).

47. Aziz, A. et al. Proteomic characterisation of Echinococcus granulosus hydatid cyst fluid

from sheep, cattle and humans. J Proteomics (2011).

48. Craig, P.S. & Nelson, G.S. The detection of circulating antigen in human hydatid disease.

Ann Trop Med Parasitol 78, 219-27. (1984).

49. Gottstein, B. An immunoassay for the detection of circulating antigens in human

echinococcosis. Am J Trop Med Hyg 33, 1185-91. (1984).


50. Craig, P.S. Detection of specific circulating antigen, immune complexes and antibodies in

human hydatidosis from Turkana (Kenya) and Great Britain, by enzyme-immunoassay.

Parasite Immunol 8, 171-88. (1986).

51. Schantz, P.M. Circulating antigen and antibody in hydatid disease. N Engl J Med 318, 1469-

70. (1988).

52. Liu, D., Rickard, M.D. & Lightowlers, M.W. Assessment of monoclonal antibodies to

Echinococcus granulosus antigen 5 and antigen B for detection of human hydatid circulating

antigens. Parasitology 106, 75-81. (1993).

53. Shepherd, J.C., Aitken, A. & McManus, D.P. A protein secreted in vivo by Echinococcus

granulosus inhibits elastase activity and neutrophil chemotaxis. Mol Biochem Parasitol 44,

81-90. (1991).

54. Rigano, R. et al. Modulation of human immune response by Echinococcus granulosus

antigen B and its possible role in evading host defenses. Infect Immun 69, 288-96. (2001).

55. Konrad, C., Kroner, A., Spiliotis, M., Zavala-Gongora, R. & Brehm, K. Identification and

molecular characterisation of a gene encoding a member of the insulin receptor family in

Echinococcus multilocularis. Int J Parasitol 33, 301-12. (2003).

56. Guarner, F. & Malagelada, J.R. Gut flora in health and disease. Lancet 361, 512-9 (2003).

57. Grillet, N. et al. Mutations in LOXHD1, an evolutionarily conserved stereociliary protein,

disrupt hair cell function in mice and cause progressive hearing loss in humans. Am J Hum

Genet 85, 328-37 (2009).

58. Molehin, A.J., Gobert, G.N. & McManus, D.P. Serine protease inhibitors of parasitic

helminths. Parasitology 139, 681-95 (2012).

59. Pradel, E. & Ewbank, J.J. Genetic models in pathogenesis. Annu Rev Genet 38, 347-63

(2004).

60. Darby, C., Cosma, C.L., Thomas, J.H. & Manoil, C. Lethal paralysis of Caenorhabditis

elegans by Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 96, 15202-7 (1999).

61. Huffman, D.L. et al. Mitogen-activated protein kinase pathways defend against bacterial

pore-forming toxins. Proc Natl Acad Sci U S A 101, 10995-1000 (2004).

62. Kim, D.H. et al. A conserved p38 MAP kinase pathway in Caenorhabditis elegans innate

immunity. Science 297, 623-6 (2002).

63. Millet, A.C. & Ewbank, J.J. Immunity in Caenorhabditis elegans. Curr Opin Immunol 16,

4-9 (2004).

64. Nicholas, H.R. & Hodgkin, J. The ERK MAP kinase cascade mediates tail swelling and a

protective response to rectal infection in C. elegans. Curr Biol 14, 1256-61 (2004).

65. Schulenburg, H., Kurz, C.L. & Ewbank, J.J. Evolution of the innate immune system: the

worm perspective. Immunol Rev 198, 36-58 (2004).

66. Sifri, C.D., Begun, J. & Ausubel, F.M. The worm has turned--microbial virulence modeled

in Caenorhabditis elegans. Trends Microbiol 13, 119-27 (2005).

67. Hopkins, A.L. & Groom, C.R. The druggable genome. Nat Rev Drug Discov 1, 727-30

(2002).

68. Doyle, M.A., Gasser, R.B., Woodcroft, B.J., Hall, R.S. & Ralph, S.A. Drug target prediction

and prioritization: using orthology to predict essentiality in parasite genomes. BMC

Genomics 11, 222 (2010).

69. Sturn, A., Quackenbush, J. & Trajanoski, Z. Genesis: cluster analysis of microarray data.

Bioinformatics 18, 207-8 (2002).


Documents

The genome of the hydatid tapeworm Echinococcus …...The genome of the hydatid tapeworm Echinococcus granulosus Huajun Zheng 1 †, Wenbao Zhang 2 † , Liang Zhang 1,3 †, Zhuangzhi