Environmental Toxicology and Chemistry, Vol. 30, No. 3, pp. 640–649, 2011# 2010 SETAC

Printed in the USADOI: 10.1002/etc.423

THE EFFECTS OF ENVIRONMENTAL LOW-DOSE IRRADIATION ON

TOLERANCE TO CHEMOTHERAPEUTIC AGENTS

ERIC K. HOWELL,y SERGEY P. GASCHAK,z KENNETH D. W. GRIFFITH,y and BRENDA E. RODGERS*yyDepartment of Biological Sciences and the Center for Environmental Radiation Studies, Texas Tech University, Lubbock, Texas, USA

zInternational Radioecology Laboratory, Slavutych, Ukraine

(Submitted 12 July 2010; Returned for Revision 30 August 2010; Accepted 22 September 2010)

* T(brenda

Pub(wileyo

Abstract—The nuclear disaster at Chernobyl, Ukraine, in April of 1986 continues to impact the environment on many different levels.Studies of epidemiological, environmental, and genetic impacts have been prolific since the accident, revealing interesting resultsconcerning the effects of radiation. The long-tailed field mouse, Apodemus flavicollis, was collected from distinct localities near theChernobyl site and evaluated based on in vivo responses to the current clinically employed chemotherapeutic agents bleomycin (BLM)and vinblastine (VBL), as well as the immune modulator lipopolysaccharide (LPS). Maximum tolerable doses of three different cancerdrugs were administered to the rodents from three different lifestyles: native mice living and reproducing in a radioactive environment,native mice living and reproducing in an uncontaminated region, and laboratory-reared mice (Mus musculus BALB/c) with a knownsensitivity to the chemical agents tested. The endpoints employed include micronucleus formation, immune cell induction, differentialgene expression, and chemotherapeutic side effects such as lethargy and weight loss. In accordance with the well-studied phenomenontermed radio-adaptation, we observed varied tolerance to chemotherapeutic treatment dependent on history of ionizing radiationexposure. The results of the present study demonstrate a differential response to chemotherapeutic treatment with respect to previouslevels of radiation exposure, suggesting a potential benefit associated with low-dose radiation exposure. Data reported herein could havea profound impact on the development of novel cancer treatments involving low-dose ionizing radiation. Environ. Toxicol. Chem.2011;30:640–649. # 2010 SETAC

Keywords—Chernobyl Chemotherapy Low-dose radiation Radio-adaptation Apodemus flavicollis

INTRODUCTION

On April 26, 1986, human error led to an explosion in reactor4 of the Chernobyl Nuclear Power Plant, releasing disastrousquantities of radiation into the region. In accordance with theInternational Nuclear Event Scale, this event is considered bythe International Atomic Energy Agency to be the worst nuclearaccident to date [1]. Radioactive releases estimated at 150 to200 million Curies (5.6–7.4� 1018 Bq) were swept by windcurrents over northern Ukraine, Belarus, and farther into Europe[2–6]. The surrounding fauna and flora were exposed to doserates of ionizing radiation calculated as high as 100 Gray (Gy)/dalong the plume lines [7]. However, current dose rates in themost contaminated regions surrounding the Chernobyl NuclearPower Plant measure only 86 mGy/d [8]. For the past 24 years,the way mankind views radiation has been shaped byChernobyl; unfortunately, these views have often been shapedlargely by misinformation in public forums, not by science.Today, this expectedly disaster-stricken region is flourishingwith a diversity of life and has become a natural laboratory forthe study of the effects of ionizing radiation.

With the natural decay of much of the original contamina-tion, the environment is ideal for the investigation of the effectsof chronic, low-dose radiation exposures. This region hasbecome a natural laboratory for which there is no substitute.Continuous, chronic ionizing radiation exposures cannot beduplicated in a laboratory [9]. The radiation exposures in theChernobyl Exclusion Zone (CEZ) are unique for research in thatthey are continuous, whole-body exposures, as opposed to the

o whom correspondence may be addressed.rodgers@ttu.edu).

lished online 6 December 2010 in Wiley Online Librarynlinelibrary.com).

640

fractionated doses administered in so-called chronic exposurelaboratory investigations [10]. In addition to the external expo-sures administered in the laboratory, environmental exposuresinclude inhalation and ingestion of radionuclides through food,soil, and water. Both external and internal pathways contributeto the total absorbed radiation dose [11]. Furthermore, multi-generational effects of chronic exposures can be explored as aresult of continuous habitation and reproduction in a contami-nated environment. Ionizing radiation has been largely acceptedas detrimental to exposed organisms at high, acute doses.However, recent data suggest that low-dose radiation exposureshave an array of effects. The U.S. Department of Energyconsiders doses of ionizing radiation less than 0.1 Gy as lowdose ([12]; http://www.sc.doe.gov/ober/BSSD/lowdose.html).Although the effects of low-dose radiation are not completelyunderstood, the highest radiation doses and dose rates in muchof the CEZ presently fall within the range of low-dose expo-sures as defined by the U.S. Department of Energy.

The linear non-threshold model proposes that biologicaldamage caused by radiation dose is both cumulative and linear,which implies that any ionizing radiation exposure, regardlessof dose or dose rate, is potentially harmful. Conversely, recentdata suggest that low doses of radiation, administered overextended periods, may actually benefit the exposed organism[13]. Radio-adaptive responses have been observed at a widerange of doses (0.01–0.5 Gy) and dose rates (0.01–1.0 Gy/min)[14]. Our hypothesis, that animals inhabiting areas of low-doseradiation contamination would demonstrate a tolerance to theeffects of chemotherapeutic agents, was based on previousreports of radio-adaptation and the associated benefit to theorganism from exposure to low-dose radiation. Herein wereport the results of a study designed to test this hypothesis,using the endpoints of differential immune response, DNA

Tolerance to chemotherapy after low-dose radiation exposure Environ. Toxicol. Chem. 30, 2011 641

damage, and gene expression. The most significant impact ofthe present study may be in cancer research by determiningwhether low doses of radiation exposure before chemotherapyresult in more easily tolerated treatment, with fewer side effects.

Endpoints of DNA damage and immune function

The micronucleus assay using acridine orange fluorescencestaining is commonly used as a genotoxic marker for chromo-somal aberrations [15]. Ionizing radiation is known to causechromosomal aberrations in the form of DNA double-strandbreaks. The evidence of these effects is the presence of micro-nuclei. A micronucleus (MN) is a fragment of chromosome oran entire chromosome that lags behind during anaphase of celldivision. After telophase, this fragment is excluded from thenucleus of daughter cells because of its lack of spindle attach-ment regions (kinetochore or centromere) and is visualized as anuclear body in the cytoplasm of the cell. Under fluorescentmicroscopy, the DNA/RNA-specific staining of this assaymakes it easy to visualize MNs within erythrocytes. Two sideeffects of chemotherapeutic treatment in humans are loss ofappetite (chemical attack on rapidly dividing intestinal epithe-lial cells) and nausea ([16]; http://www.cancer.gov/cancer-topics/eatinghints/page3). In the present study, each rodentwas weighed before and after their treatment. Changes in bodymass over the course of the 72-h treatment were recorded.

Immature red blood cells, polychromatic erythrocytes(PCEs), differ from mature reticulocytes in that they containRNA. In addition to frequencies of micronucleated PCEs, therelative PCE frequencies themselves were scored using fluo-rescent microscopy. Because stem cells in the bone marrow arethe production center for red blood cells, relative PCE frequen-cies may be used to assess bone marrow function in response totoxin exposure.

The production of white blood cells (WBCs) is associatedwith immune function, and WBCs are involved in defenseagainst infectious disease and foreign materials. Relative levelsof WBCs were noted under fluorescent microscopy and wereused to determine differences in immune cell production duringchemotherapeutic treatments of animals with different radio-active histories.

A differential whole blood count is the quantification offrequencies of the five major types of WBCs in peripheralblood. Changes in frequencies of cell types may be associatedwith specific immune responses. The second most abundantWBC, the neutrophil, is involved in inflammatory responsecommonly associated with acute stress, bacterial infection, andviral infections. Changes in the frequencies of the most commoncell type, the lymphocyte, are known to demonstrate anacquired response. Lymphocytes are classified as T, B, andnatural killer cells, each with different functions in immuneresponse. Generally, specific T cells are involved in cytokineproduction, which directs immune responses, whereas B cellsproduce antibodies associated with previously encounteredantigens, known as the acquired immune response. Monocytesare the next most prevalent and act as phagocytes in the body’ssecond line of defense against infection. Under normal con-ditions, eosinophils are rare and are increased as a result ofparasitic infection and allergic reaction. Basophils are also rareand are increased as a result of disorders such as lymphoma orleukemia. The frequencies of lymphocyte types were evaluatedin an effort to better understand the mechanisms of the observedimmune response differences between groups.

To assess relative levels of gene expression and comparedifferences in response to chemotherapeutic treatments between

animals from different radioactive histories, the expression ofspecific target genes was assessed by quantitative real timepolymerase chain reaction.

MATERIALS AND METHODS

Collections and treatment preparation

The test site, a region with low-dose radiation levels, wasPodlesnoe, Ukraine (30.097366E, 51.413673N), which is2.47 km due north of the Chernobyl Nuclear Power Plant(30.09976E, 51.38957N) and within the CEZ. The habitat isa deciduous forest (predominantly oak) in the flood plain ofthe Pripyat River, with average radiation levels measuring10.6 mGy per h. The same rodent species, A. flavicollis, wascollected from two reference sites with only background levelsof radiation (both are outside of the CEZ). Nezamozhnya(30.83923E, 51.59239N; average radiation level of 0.10 mGyper h) is a deciduous forest (oak, birch, and alder), similar toPodlesnoe, located 56.15 km northeast of reactor 4, and Nedan-chichy (30.62827E, 51.53002N; average radiation level of0.16 mGy per h) is another deciduous forest (oak, hornbeam,bird cherry), located 39.92 km northeast of reactor 4 and16.19 km southwest of Nezamozhnya. The chemical treatmentswere performed at the International Radioecology Laboratory(30.743033E, 51.526272N) in Slavutych, Ukraine. All otherlaboratory investigations were performed in Lubbock, Texas, atTexas Tech University. Animal collection, handling, husban-dry, and experimental treatments were conducted in accordancewith the approved Texas Tech University Institutional AnimalCare and Use Committee protocol 08013-05.

On collection, each animal from the Podlesnoe site wasmeasured for whole body internal counts of 137Cs and 90Srradioisotopes. Data are reported in becquerels per gram (Bq/g),or nuclear disintegrations per second per gram of tissue(Table 1).

We used a specially designed gamma- and beta- spectro-metric system installed in a mobile field laboratory housed in aconverted bus. The spectrometric system comprised a countingchamber shielded by 100- to 150-mm-thick lead walls with adrawer (internal dimensions 100� 300� 100 mm) into which acardboard box containing the animal was placed; a 60-mm-diameter, thin-film plastic scintillation beta-detector mountedvertically to the counting chamber 11 cm above the base of thedrawer into which the animals were placed; a lead (100–150-mm-thick) shielded gamma detector (Tl-activated 63 mmNaI scintillation detector) mounted horizontally to the countingchamber (the detector had an energy resolution of 50.1 keV at661 keV, and spectra were collected over 1,024 channels); anASA100 analyzer for beta spectrum processing with Betaþsoftware (Institute of Nuclear Research, Ukraine); and anInSpector multichannel analyzer with the Genie-2000gamma-analysis software (Canberra Packard). Electricity wassupplied by a portable generator through an uninterruptiblepower supply unit.

This design of the live-counting equipment allows thesimultaneous determination of 90Sr and 137Cs in an animal.The unique feature of the system is the application of a methodfor nondestructive measurement of 90Sr in thick-layer samplesin the presence of comparable activities of 137Cs [17]. Themethod is based on the use of a thin-film plastic scintillationdetector, the thickness (0.1 mm) of which allows the absorptionof 90Sr beta-electrons with an efficiency that is one or two ordersof magnitude greater than that of the gamma-quanta of137Cs (137mBa—661 keV). Specially fabricated phantoms with

Table 1. Internal 137Cs and 90Sr doses in Bq/g and percent body mass changes during chemotherapeutic or control treatments of Apodemus flavicollis from theradioactive (Podlesnoe, Ukraine) and reference (Nedanchichy and Nezamozhnya) sitesa

Locality Agent TK Cs, Bq/g Sr, Bq/g PCEs scored %Body mass change

Podlesnoe BLM 154055 15.2 1.7 4,000 �5.30%2008; n¼ 24 154056 80.7 23.5 4,000 0.80%Radioactive site 154057 31.9 16.3 4,000 12.10%

154058 8 8.8 4,000 7.20%154059 28 33.2 4,000 �4.40%154160 20 18 4,000 2.00%154161 38.5 12.3 4,000 �15.60%

Average %BMCb �0.40%VBL 154060 78.7 13.5 4,000 �3.90%

154061 258.9 65.4 4,000 �0.60%154062 158.8 47.7 4,000 0.00%154063 28.3 41.9 4,000 �11.70%154064 80.5 15.9 4,000 �17.10%154162 27.5 12 4,000 �10.90%154163 99.7 34.5 4,000 �12.00%

Average %BMC �8.00%LPS 154065 9.3 32.2 4,000 �12.70%

154066 53.8 13 4,000 �13.30%154067 106.7 20.3 4,000 6.80%154068 9.8 9.3 4,000 �7.70%154069 61.9 8.1 4,000 �1.90%

Average %BMC �5.70%SAL 154070 34.2 6.9 4,000 �6.10%

154071 51.4 17.4 4,000 1.50%154072 74.7 13.8 4,000 1.80%154073 44.3 16.3 4,000 �1.00%154159 90.9 30.5 4,000 14.40%

Average %BMC 2.10%Nadanchichy and Nezamozhnya BLM 154035 Background Background 4,000 �8.40%2008; n¼ 23 154036 Background Background 4,000 �7.30%

154037 Background Background 4,000 �14.00%Reference sites 154038 Background Background 4,000 �8.00%

154039 Background Background 4,000 �10.40%Average %BMC �9.60%

VBL 154040 Background Background 4,000 �6.70%154041 Background Background 4,000 �18.40%154042 Background Background 4,000 �6.30%154043 Background Background 4,000 �7.00%154044 Background Background 4,000 �21.10%154165 Background Background 4,000 �8.90%154166 Background Background 4,000 �13.50%154167 Background Background 4,000 �9.80%

Average %BMC �11.50%LPS 154045 Background Background 4,000 �7.70%

154046 Background Background 4,000 �11.30%154047 Background Background 4,000 �11.00%154048 Background Background 4,000 �5.20%154049 Background Background 4,000 �4.70%

Average %BMC �8.00%SAL 154050 Background Background 4,000 7.80%

154051 Background Background 4,000 �3.80%154052 Background Background 4,000 �11.00%154053 Background Background 4,000 �6.00%154054 Background Background 4,000 10.50%

Average %BMC �0.50%

a TK¼Specimen voucher number for Museum at Texas Tech University; PCE¼ Polychromatic erythrocytes; Bq/g¼Becquerel/gram; BLM¼Bleomycin;VBL¼Vinblastine; LPS¼Lipopolysaccharide; SAL¼Saline.

b BMC¼ body mass change.

642 Environ. Toxicol. Chem. 30, 2011 E.K. Howell et al.

known contents of 137Cs and 90Srþ 90Y were used to calibratethe system. The phantoms were made from 0.1-mm-thick poly-ethylene and had an oval profile. Six sizes of phantoms wereused, with masses ranging from 6 to 20 g and dimensions(height, width, and length) ranging from 10, 18, and 45 mm,to 15, 29, and 61 mm, respectively. The phantoms were filledwith a granular (0.5–1.0 mm) standard source with a density of1 g/cm3 (OISN-3; Applied Ecology Laboratory of Environ-mental Safety Centre, Odessa, Ukraine) and activity concen-trations of approximately 110 kBq/kg (February 2007) for both90Sr and 137Cs. After background subtraction, spectra obtained

for the calibration phantoms were described by cubic splines,which were subsequently used to describe sample spectra.

Before live-counting, the mice were placed into a specialdisposable cardboard container (50� 35� 100 mm) with anupper wall constructed from polyethylene (<0.1-mm-thickmembrane). Small holes were made in the upper corners ofthe containers to provide ventilation during counting. Thisprocedure is minimally invasive, and the mice do not sufferduring the measurement period.

The counting duration varied from 180 to 1,200 seconds,depending on the radioactivity of the animals being analyzed.

Tolerance to chemotherapy after low-dose radiation exposure Environ. Toxicol. Chem. 30, 2011 643

The spectrometer’s beta and gamma backgrounds varied from0.7 to 0.9 counts per second and 0.3 to 0.6 counts per second,respectively. The range in minimum detectable activity was 15to 238 Bq 137Cs and 15 to 105 Bq 90Sr per animal, depending onexternal radiation conditions (determined by where the mobilelaboratory was operating), the radionuclide content of theanimal, and counting duration. The error on the radionuclidecontent estimation did not exceed 20 to 30%. The 20 g phantomwas analyzed daily to check detector efficiency. Assays ofrodents, small birds, and amphibians have previously indicatedthat the data for 137Cs and 90Sr obtained using this method donot deviate significantly (<20%) from results obtained usingmore conventional spectrometric and radiochemical methods[17].

All mice were housed at the International RadioecologyLaboratory in individual wire-top standard Nalgene animalcages for a 7-d acclimation period before chemotherapeutictreatment. Each animal was provided ad libitum water, grains,and vegetables native to the region for the duration of the study.

Chemical treatments

Mice from each site (radioactive and reference) were eval-uated based on their response to one of two clinically usedchemotherapeutic drugs or an agent commonly used to test forimmune response. The BALB/c strain of Mus musculus wasused as a positive control for the effects resulting from theadministration of the chemical agents. This group was not usedto test a comparative response to the native Chernobyl rodentunder study.

Bleomycin sulfate (BLM) is a glycopeptide produced byStreptomyces verticillus and is used to treat Hodgkin’s lym-phoma, testicular carcinoma, and squamous cell carcinomas.The mechanism of action is DNA cleavage involving super-oxide and free-radical formation after metal ion chelation([18];http://www.cancer.gov/cancertopics/druginfo/bleomycin).Because BLM is a radio-mimetic, which causes DNA double-strand breaks much like ionizing radiation, it was used in thecurrent study as a chemical analog to the effects of high doses ofradiation exposure.

Vinblastine sulfate (VBL) is used to treat Hodgkin’s lym-phoma, lung cancer, breast cancer, and testicular cancer. Vin-blastine binds tubulin, inhibiting the formation of microtubules.Because microtubule assembly is necessary for spindle forma-tion, cells are unable to undergo cell division [19]. Vinblastinewas used in the present study to investigate how low-doseionizing radiation affects cell cycle progression.

Lipopolysaccharide (LPS) is a structural component of theouter membrane of gram-negative bacteria [20]. This drug is anendotoxin and is used in cancer patients to elicit an immuneresponse and activate specific transcription factors [21]. Lip-opolysaccharide was used in the current study to investigate theimmune response of organisms with and without a history oflow-dose radiation exposure.

The treatment regimen for the current study was modeledafter the Collaborative Study Group for the Micronucleus Test[22]. Each animal received maximum tolerable doses of one offour different treatment chemicals: BLM, VBL, LPS, or thevehicle alone, normal saline (SAL). The SAL group not onlyserved as a negative control for the current study, but elucidatedany basal differences between the populations. Selection ofanimals for specific treatment groups was random and eachgroup was age, sex, and weight matched. To compare radiationhistory with the respective responses to the different chemo-therapeutic agents, equal numbers of experimental animals

were tested from different collection localities for each chemo-therapeutic agent. Each individual received a total of threeintraperitoneal injections of their respective chemical agentover 72 h. Intraperitoneal injections were chosen to ensureadministration of target dose with minimal stress to the testanimals. Each set of three injections was administered atmaximum tolerable dose, 0.5 maximum tolerable dose, and0.25 maximum tolerable dose, respectively at 24-h increments.Administered doses for the chemical agents are as follows:BLM (8.3 mg/kg) [23], VBL (5.0 mg/kg) [24], LPS (0.5 mg/kg)[25], and an equivalent volume of normal saline. Peripheralblood smears were prepared at four different time points (0 h,24 h, 48 h, and 72 h) for each individual. Sampling at 24 hincrements after each injection ensures that subsequentresponses are measured before cell recycling. These samplingincrements also allow characterization of immune responseover time and to different levels of chemical exposures [22].Blood smears were stored at 48C until their return to Texas TechUniversity, after which they were stored at �208C.

After the 72-h treatment regimen, in accordance with theapproved Texas Tech University Animal Care and Use Com-mittee (Texas Tech University IACUC) protocol (#08013-05),each animal was euthanized by CO2 asphyxiation. After eutha-nization, 0.5 ml blood was stored in 1 ml phosphate-bufferedsaline, and the following tissues were fixed in lysis buffer: liver,kidney, spleen, lung, heart, bone, brain, gonads, and muscle.

Assays

The acridine orange micronucleus assay was used for thedetection of genotoxic effects [15]. Before staining, the bloodsmear slides were coded by a third party to ensure blind scoring.Slides were placed on a slide warmer at 658C for 10 min andthen transferred to absolute methanol for 10 min for fixation.The slides were then stained for 2 min in a 2:40 ml mixture of0.1% acridine orange:Sorenson’s buffer. Four 10-min washes ofSorenson’s buffer were used to destain the slides, and MNs weremanually scored under fluorescent microscopy. One thousandPCEs were scored per slide (4,000 per individual), providingsufficient power for statistical analyses [22]. MicronucleatedPCEs were scored exclusively because of their recent produc-tion, revealing damage induced by the experimental treatmentalone.

Additional responses were evaluated by noting frequenciesof PCEs, total WBCs, body mass changes, and differentialWBC counts. Concerning the differential WBC counts, bloodsmears were stained in Wright’s stain (a mixture of methyleneblue and acidic eosin) and scored manually under bright fieldmicroscopy. White blood cells were scored (100 per slide) todetermine the relative frequencies of the different cell types.

Gene expression

The RNA was extracted from liver tissue stored in RNAlaterusing Qiagen’s RNeasy Mini-Kit. The RNA extracts weretreated with RQ1 RNase-Free DNase from Promega and thennormalized to a concentration of 100 ng/ml. The Bio-Rad iScriptcDNA Synthesis Kit and reverse transcriptase polymerase chainreaction were used to synthesize complementary DNA from theRNA extracts. The complementary DNA was labeled using theBio-Rad iTaq SYBR Green Supermix with ROX Kit and run onan Applied Biosystems 7500 quantitative polymerase chainreaction system. The reactions were performed in triplicatewith the internal normalizer genes (Gapdh and Ubc) [26]. Toconfirm that Mus musculus primers could efficiently amplify thesame genes in A. flavicollis, the polymerase chain reaction

644 Environ. Toxicol. Chem. 30, 2011 E.K. Howell et al.

products were sequenced and verified using the nucleotide basiclocal alignment search tool. The target genes for the presentstudy were chosen based on their roles in oxidative stressmetabolism, apoptosis, and cytokine production pathways(Table 2).

Statistical analysis

The Student’s t test was employed to compare meansbetween and among treatment groups and collection localitiesfor DNA damage, PCE frequencies, WBC levels, differentialcounts, and body mass change data. Differences between groupswere considered statistically significant when p< 0.05. Geneexpression data were analyzed using the DDCt model with atwofold change threshold identifying significant differentialgene expression [27].

RESULTS

DNA damage

After a blind manual scoring of 1,000 PCEs per slide (4,000per individual), MN frequencies were determined. In micereceiving injections of LPS and SAL, MN frequencies werenot consistently different between collecting localities. How-ever, in rodents receiving either BLM or VBL injections, thosecollected from the radioactive locality had significantlydecreased MN frequencies relative to those from the referencesite. Specifically, in mice receiving BLM, a significant decreasein MN frequencies was observed at 48 h (reference site¼ 21.0/1,000, radioactive site¼ 9.2/1,000, p< 0.05) and a notable butnonsignificant decrease at 72 h (reference site¼ 17.0/1,000,radioactive site¼ 9.6/1,000, p< 0.1) after the initial injection(Fig. 1A). In contrast, under VBL treatment, significantdecreases in MN frequencies were seen at the 24-h time point(reference site¼ 24.0/1,000, radioactive site 12.0/1,000,p< 0.05) as well as nonsignificant decreases at the 48-h (refer-ence site¼ 30.4/1,000, radioactive site¼ 20.3/1,000) and 72-h(reference site¼ 35.8/1,000, radioactive site¼ 19.0/1,000) time

Table 2. The target genes investigated via qRT-PCR (involved in reactive oxygendescription (name), annotation (abbreviation), PCR produc

Gene Name Abb

Mus musculus superoxide dismutase 1 Sod

Mus musculus superoxide dismutase 2 Sod

Mus musculus transformation related protein 53 Trp

Mus musculus mitogen-activated protein kinase 8 Map

Mus musculus glutathione peroxidase 1 Gpx

Mus musculus aconitase 1 Aco

Mus musculus catalase Cat

Mus musculus glutathione S-transferase pi 1 Gst

Mus musculus tumor necrosis factor alpha TNF

Mus musculus interferon regulatory factor 1 IRF

Mus musculus ubiquitin C (normalizer) Ubc

Mus musculus glyceraldehyde-3-phosphate dehydrogenase (normalizer) Gap

a All primers constructed using PrimerQuest with sequences from GenBank.

points (Fig. 1B). These data demonstrate a significantly lowerincidence of DNA double-strand breaks in rodents collectedfrom the radioactive site when compared with the same speciescollected from the uncontaminated site after receiving chemo-therapeutic treatment.

Body mass change

When treated with BLM, A. flavicollis from the referencesite lost significantly more body mass over the course ofthe treatment than the same species from the radioactive site(reference site¼ � 9.6%, radioactive site¼ � 0.4%, p< 0.05).The VBL (reference site¼ � 11.5%, radioactive site¼� 8.0%), LPS (reference site¼ � 8.0%, radioactive site¼� 5.7%), and SAL (reference site¼ � 0.5%, radioactivesite¼þ2.1%) treatments showed the same trend, althoughnot significant (Table 1). Because all of the tested animalswere fed ad libitum, any significant differences in body masschange was attributed to decreases in appetite.

Polychromatic erythrocytes

In the animals from the reference site, a sharp decrease(�58.9%) occurred in PCE frequency 24 h after the first injec-tion of BLM, with recovery to basal levels by 72 h. In theanimals from the radioactive site under the same treatment, thatsharp decrease was absent ( p< 0.05), instead showing a gradualincrease (þ18.3%) and stabilization in PCE frequency over thecourse of the treatment. These data suggest that if PCE pro-duction is an accurate indication of bone marrow function, theanimals from the radioactive site were more resistant to the bonemarrow toxicity of BLM treatment.

White blood cells

After BLM treatment, notable increases were found in WBClevels (at 48 and 72 h) in the animals collected from the radio-active site relative to the animals collected from the referencesite (reference site¼ 1.0, radioactive site¼ 1.7, p< 0.1; refer-ence site¼ 1.0, radioactive site¼ 2.3, p< 0.05, respectively).

species (ROS) metabolism, apoptosis, and immune function) including genet size, and primer sequences used for amplificationa

rev. Product size Primer sequence

1 185 For: GGTGTGGCCAATGTGTCCATTGAARev: TACTGCGCAATCCCAATCACTCCA

2 131 For: TTAAGGAGAAGCTGACAGCCGTGTRev: TGTTGTTCCTTGCAATGGGTCCTG

53 103 For: AAAGGATGCCCATGCTACAGAGGARev: GCAGTTTGGGCTTTCCTCCTTGAT

k8 144 For: AGCTCGGAACACCTTGTCCTGAATRev: TGTTATGCTCTGAGTCAGCTGGGA

1 125 For: CGCAACGACATTGCCTGGAACTTTRev: TGGGACAGCAGGGTTTCTATGTCA

1 98 For: TCCATTGCTGACCGAGCTACGATTRev: AGCAGGTACGCGATGCTAACTTCA

102 For: AGAGGAAACGCCTGTGTGAGAACARev: AGTCAGGGTGGACGTCAGTGAAAT

p1 200 For: AAGCTTTCATCGTGGGTGACCAGARev: ATTGCCATTGATGGGACGGTTCAC

-a 340 For: GCGACGTGGAACTGGCAGAAGRev: TCCATGCCGTTGGCCAGGAGG

1 500 For: AGGGCTTAGGAGGCAGAGTCRev: AAAGGCCTAGACTGGGGAGA

179 For: AAAGATCCAGGACAAGGAGGGCATRev: TCTTGCCTGTCAGGGTCTTCACAA

dh 115 For: TCAACAGCAACTCCCACTCTTCCARev: ACCCTGTTGCTGTAGCCGTATTCA

Fig. 1. Frequencies of micronuclei (MN) in animals collected from theradioactive and reference sites under (A) Bleomycin (BLM) and (B)Vinblastine (VBL) treatments. Micronucleus frequencies are shown per1,000 polychromatic erythrocytes (PCE). White bars represent animals fromthe reference site, and black bars represent animals from the radioactive site.The x axis represents time after initial injection; the y axis represents numberof MN per 1,000 PCEs. �denotes significance.

Fig. 2. (A) Lymphocyte and (B) neutrophil frequencies between individualsfrom different collection sites (radioactive and reference) after bleomycin(BLM) treatment. Values shown are frequencies per 100 cells. White barsrepresent animals from the reference site, and black bars represent animalsfrom the radioactive site. The x axis represents time after initial injection; they axis represents number of cells per 100 WBCs. �denotes significance.

Tolerance to chemotherapy after low-dose radiation exposure Environ. Toxicol. Chem. 30, 2011 645

The results were similar for VBL treatment, with significantincreases in WBC production in the animals from the radio-active site at the 48 h (reference site¼ 1.0, radioactivesite¼ 2.6, p< 0.05) and 72 h (reference site¼ 1.0, radioactivesite¼ 3.1, p< 0.05) time points. These data suggest that WBCproduction (thus, general immune response) is more pro-nounced in animals with a history of radiation exposure afterreceiving a chemotherapeutic challenge. Interestingly, theimmune cell induction was not evident until the 48-h timepoint, suggesting that the response may be not an immediateinflammatory induction (commonly observed less than 24 hafter a stress) but potentially an adaptive response mediatedby a previous stress (low-dose radiation).

Differential counts

Each chemotherapeutic agent induced a change in bothlymphocyte and neutrophil frequencies. Under saline treatment,basal frequencies of both lymphocytes (�70%) and neutrophils(�23%) remained constant over the course of the treatment.However, under each chemotherapeutic treatment, all mice(regardless of collection locality) had decreased lymphocyteand increased neutrophil frequencies at the 24-h time point, withrecovery to basal levels after 72 h, indicating the response wasto the chemotherapeutic agents. When the animals from differ-ent localities were compared under BLM treatment, those fromthe reference site had significantly lower frequencies of lym-phocytes and significantly higher frequencies of neutrophilsthan those from the radioactive site ( p< 0.01 at 48 and 72 h;Fig. 2). The same trends were seen in the LPS treatment group,although they were not significant. These data suggest that BLMand LPS induce a different type of immune response than either

VBL or SAL. No significant changes were seen in monocyte,basophil, or eosinophil frequencies.

Gene expression

Under BLM treatment, the animals collected from the radio-active site showed significant down-regulation in eight of 10target genes (Aco1, Cat, Gpx-1, Gstp1, Sod1, Sod2, TNF-a,Trp53), whereas 0 of 10 were significantly up-regulated(Fig. 3). Under VBL treatment, the animals from the radioactivesite showed significant down-regulation in five of 10 targetgenes (Gpx-1, Sod1, Sod2, TNF-a, Trp53), whereas one of10 were significantly up-regulated (Gstp1). Under LPS treat-ment, the animals from the radioactive site showed significantdown-regulation in four of 10 target genes (Gpx-1, IRF-1,Sod2, TNF-a), whereas two of 10 were significantly up-regu-lated (Cat and Trp53). The animals from the radioactive sitetreated with SAL showed significant down-regulation in twoof 10 target genes (Gpx-1 and Sod2), and one of 10 weresignificantly up-regulated (Sod1). Collectively, 19 down-regu-lation events and four up-regulation events occurred in animalsfrom the radioactive site (low-dose radiation contamination)relative to those from the reference site (background levelsof radiation). Of the treatment agents, BLM showed thiseffect most consistently. This is potentially caused by thesimilarity of BLM and ionizing radiation in vivo. Bleomycinis considered a radio-mimetic and induces DNA damage byusing metal ions that react with oxygen to form hydroxide-freeradicals and superoxide that cleave DNA. The target genesGpx-1 and Sod2 were unique in that these genes were down-regulated under each treatment, including the saline controltreatment (Fig. 4).

Fig. 3. Relative gene expression across all target genes between individualsfrom the different collection sites after bleomycin (BLM) treatment. Valuesshown are DDCt values. White bars represent animals from the reference site,and black bars represent animals from the radioactive site. The x axisrepresents the genes investigated; the y axis represents fold differences ingene expression. Glutathione peroxidase 1 (Gpx-1) values are offset into adifferent graph with a different scale. �denotes significance. Referencesite¼Nedanchichy. Radioactive site¼Podlesnoe (Ukraine). See Table 2 forkey to gene abbreviations.

646 Environ. Toxicol. Chem. 30, 2011 E.K. Howell et al.

DISCUSSION

The purpose of the present study was to determine whether ahistory of low-dose ionizing radiation exposure affects the wayorganisms respond to subsequent stressors, including chemo-therapeutic agents. Our results suggest that low-dose radiationexposure before chemotherapeutic treatment reduced the sideeffects of treatment when compared with the same species froma noncontaminated region.

Rodents collected from the radioactive locality had signifi-cantly decreased MN frequencies relative to the reference siteafter both the BLM and VBL treatments. These results suggest asignificantly decreased incidence of DNA double-strand breaks

Fig. 4. Relative gene expression for (A) Glutathione peroxidase 1 (Gpx-1)and (B) Superoxide dismutase 2 (Sod2) between individuals from thedifferent collection sites under bleomycin (BLM), vinblastine (VBL),lipopolysaccharide (LPS), and saline (SAL) treatments. Values shown areDDCt values. White bars represent animals from the reference site, and blackbars represent animals from the radioactive site. The x axis representstreatments administered; the y axis represents fold differences in geneexpression. �denotes significance.

after chemotherapeutic treatment in rodents with a history ofchronic radiation exposure when compared with the samespecies collected from a reference site. Despite the observationof this radio-adaptive effect, the mechanism behind this reduc-tion in DNA damage is not completely understood. Oneexplanation for this phenomenon may be that, because ofprevious exposure to stressful environments, these animalspossess a more efficient mechanism of DNA double-strandbreak repair [28]. Another study suggests that genetic selectionmay occur at critical loci for resistance against polluted environ-ments, which may be extended to radiation exposures in theCEZ [29]. Although the mechanism is unclear, the data supporta radio-adaptive response demonstrated by a reduction of DNAdouble-strand breaks after chemotherapeutic stress (measuredin MN) in rodents collected from the radioactive site relative tothe reference site.

Under the same treatment regimens, Apodemus flavicollisfrom the reference site lost a higher percentage of body massover the course of the study than the same species from theradioactive site. Although qualitative and subjective, weobserved that rodents from the radioactive site were noticeablyless lethargic than rodents from the reference site, whichappeared to be extremely ill while receiving chemotherapeutics.The appetites of the rodents from the radioactive site appearedto be unaffected, whereas the rodents from the reference site atenoticeably less. These results suggest that, under the sametreatment, rodents from the radioactive site tolerated one ofthe side effects of chemotherapy (appetite/weight loss) betterthan those from the reference site.

In the animals from the reference site, a significant decreaseoccurred in PCE frequency at the 24-h time point, with recoveryto basal levels by 72 h. In the animals from the radioactive site,that decrease was absent, instead showing a gradual increaseand stabilization in PCE frequency over the course of thetreatment. If PCE production is an accurate indication of bonemarrow function, then the animals from the radioactive sitewere more resistant to the initial bone marrow toxicity of BLM.The two primary radionuclides found in the CEZ today(137Cs and 90Sr) have been shown to act as elemental analogs(K and Ca, respectively) and accumulate in specific tissues(muscle and bone, respectively) [8]. Because 90Sr accumulatesin bone, the stem cells in the bone marrow of animals from theradioactive site would receive higher doses of 90Sr. Therefore,the bone marrow cells in animals from the radioactive site arechronically exposed to 90Sr, which may result in enhancedtolerance to an agent with a similar mechanism of action(BLM). Rodents not previously been exposed to 90Sr throughchronic low-dose irradiation (such as those from the referencesite) may not develop the same resistance and thus show bonemarrow function inhibition under BLM treatment as reportedherein.

After both BLM and VBL treatments, notable increases inWBC levels occurred in the animals from the radioactive siterelative to the animals from the reference site (at the 48-h and72-h time points). These data suggest a more pronouncedimmune response at 48 and 72 h after the first injection ofthe chemotherapeutic. The same phenomenon has been noted insurvivors of the atomic bombs at Hiroshima and Nagasaki;results indicate that background leukocyte counts are signifi-cantly higher in survivors and correlate to radiation dosereceived [30]. This is similar to our SAL treatment results,in which basal WBC levels were greater in mice with a historyof ionizing radiation exposure. Our tests indicate a protectiveeffect of previous exposures to low-dose ionizing radiation

Tolerance to chemotherapy after low-dose radiation exposure Environ. Toxicol. Chem. 30, 2011 647

through increased production of immune cells during chemo-therapeutic treatment.

Each chemotherapeutic agent induced a change in bothlymphocyte and neutrophil frequencies. As expected, basalfrequencies of both lymphocytes (�70%) and neutrophils(�23%) were constant over the course of the treatment inthe SAL controls. However, under each chemotherapeutictreatment, animals from both collecting localities had decreasedlymphocyte and increased neutrophil frequencies at the 24-htime point, with recovery to basal levels after 72 h. This effect isexpected because a chemotherapeutic agent, given at this dose,should elicit an inflammatory immune response, shown byincreases in neutrophil frequencies.

High neutrophil frequencies indicate an innate inflammatoryresponse, whereas high lymphocyte frequencies suggest a dif-ferent mechanism of response. In comparisons of groups receiv-ing the BLM treatment, the animals from the reference site hadsignificantly lower frequencies of lymphocytes and signifi-cantly higher frequencies of neutrophils than those from theradioactive site. Although less clear, the same trends wereobserved in the LPS treatment group. These results suggestthat the biological stress induced by ionizing radiation exposureis mechanistically similar to that of BLM and LPS, and the mostefficient defense against these agents is a more specific acquiredimmune response, as opposed to the general inflammatoryresponse. Similarly, lymphocyte frequencies in atomic bombsurvivors were increased whereas neutrophil frequencies wereunchanged [30]. One explanation for the relative increase inlymphocyte frequencies in animals with a history of radioactiveexposures is an acquired response, involving the increase inproduction of memory T cells. Although the present study didnot investigate actual memory T-cell levels, the delayedresponse in total WBC levels clearly demonstrated absenceof an immediate inflammatory neutrophil response to the che-motherapeutic agents. In addition, another study stated that,because of the radiation received by atomic bomb victims, anexpansion may have occurred of the memory T-cell populationspresent shortly after the bombing [31]. This increase in memoryT cells may have been an acquired immune response used toenhance resistance to subsequent genotoxic stresses. However,until specific T-cell frequencies and cytokine production pro-files are characterized, we cannot conclude that this differentialimmune response is memory mediated.

We chose to investigate the modulation of genes that are wellcharacterized with regard to functions in oxidative stress metab-olism, apoptosis, and cytokine production pathways. Combin-ing all four treatment regimens, 19 significant down-regulationevents and only four significantly up-regulated events occurredin rodents from the radioactive site. These results suggestdifferential gene expression based on radiation exposure his-tory.

Expression of glutathione peroxidase 1 (Gpx-1) aids in thesynthesis of proteins involved in metabolizing and detoxifyinghydrogen peroxide (H2O2 to ROH) and is largely considered toplay a role in antioxidant activity. This gene is up-regulated inresponse to oxidative stress (a result of ionizing radiationexposure) and has been shown to protect against the harmfuleffects of reactive oxygen species (ROS) [32]. A down-regu-lation of this gene has been shown to induce apoptosis inspecific cell types [33]. Under all four treatments, Gpx-1 wasdown-regulated in the rodents from the radioactive site. Thecurrent study did not investigate apoptosis or oxidative stresslevels, so we cannot comment on the downstream effects of thisgene. However, data from the current study suggest that the

individuals from the radioactive site had increased resistance tothe effects of ROS production resulting from treatments.

Expression of superoxide dismutase 2 (Sod2) leads to theconversion of superoxide radicals (ROS) to hydrogen peroxide(O�2 to H2O2), an important step in the sequence of ROSmetabolism and detoxification of oxidative stressors. Down-regulation of Sod2 has been shown to cause increases in ROSand thus oxidative stress [34]. Under all four treatments, Sod2was down-regulated in the rodents from the radioactive site.Although we cannot comment on the actual ROS concentrationsin vivo, we noted no compromising effect of the down-regu-lation of this gene (such as increased DNA damage throughoxidative stress) in response to chemotherapeutic treatment.

Superoxide dismutase 1 (Sod1) functions in a similar mannerto Sod2; the primary difference is that Sod1 binds Zn or Curather than Mn. Dysregulation or mutation of Sod1 can lead tosensitivity of mitochondria to ROS [35]. Under BLM and VBLtreatment, Sod1 expression was down-regulated in animals witha history of radiation exposure. Under SAL treatment, theexpression was up-regulated in the same group of rodents.Again, how ROS concentrations affect the expression of thisgene is unclear, a history of low-dose radiation exposureappears to result in down-regulation of Sod1.

The function of aconitase 1 (Aco1) is to regulate cellular ironmetabolism. It also has been shown to protect mitochondrialDNA from increases in point mutations and single-strand DNAbreaks [36]. When Aco1 is down-regulated in yeast, the integ-rity of mitochondrial DNA is compromised by an increase inpoint mutations and single-strand DNA breaks [36]. We foundthat Aco1 expression was only altered under BLM treatment,where it was significantly down-regulated in animals from theradioactive site. The Cytb mitochondrial gene sequence showedno significant differences between rodents from the differentcollecting localities (data not shown). We conclude that in ouranimals, although down-regulation of Aco1 occurred, the integ-rity of mitochondrial DNA was not compromised.

Catalase (Cat) plays a key role in metabolizing hydrogenperoxide (H2O2 to H2O); thus, this gene product plays asignificant role in resistance to oxidative stress. However, anincrease in ROS concentration leads to a down-regulation in Catexpression [37]. Alternatively, up-regulation of Cat expressionincreases protection against ROS. In our study, Cat expressionwas down-regulated under BLM treatment, and up-regulatedunder LPS treatment in rodents from the radioactive site.Because BLM is a radiomimetic, the increase in ROS concen-trations attributable to BLM treatment may have initiated thedecrease in Cat expression. However, LPS is also known toincrease levels of ROS [38], and instead of the expected down-regulation of Cat, we observed a significant up-regulation of thegene in the presence of LPS. Interestingly, within the group ofrodents collected from the radioactive site, treatment withdifferent chemotherapeutics led to dissimilar Cat modulation,suggesting that the chemicals induce different types of stress.

The function of glutathione S-transferase p (Gstp1) is to aidin detoxification by the conjugation of glutathione to hydro-phobic and electrophilic compounds. Glutathione is known toinfluence protein synthesis, DNA synthesis, amino acid trans-port, activation of enzyme activities, and protection from ROS[39]. Glutathione S-transferase p 1 has been shown to act as atumor suppressor, in which inactivation of the gene leads toaggressive tumor behavior [40]. Our results show that in theindividuals from the radioactive site, Gstp1 was down-regulatedunder BLM treatment and up-regulated under VBL treatment.Glutathione concentrations, ROS concentrations, and Gstp1

648 Environ. Toxicol. Chem. 30, 2011 E.K. Howell et al.

associated protein levels might help to determine the mecha-nism of these differences in expression. Mechanistic investi-gations should be employed to determine the differences inexpression patterns of this gene between treatments.

Tumor necrosis factor-alpha (TNF-a) leads to the produc-tion of specific cytokines that play a significant role in inflam-matory mediation and apoptosis, including autoimmunediseases and transplantation [41]. Tumor necrosis factor-alphalevels can be regulated at the transcriptional, posttranscrip-tional, and translational levels. If TNF-a expression is notcontrolled, lethal shock to treated cells results [42]. Weobserved a down-regulation of TNF-a during BLM, VBL,and LPS treatments in the animals from the radioactive siteas opposed to those from an uncontaminated region. Although asevere inflammatory response would be expected after admin-istration of these treatments, the down-regulation of this gene inanimals from the radioactive site may have reduced the severityof the inflammatory response, minimizing the probability oflethal shock. This conclusion is further supported by WBCdifferential counts as evidence of a limited inflammatoryresponse after chemotherapeutic treatment in animals with ahistory of radiation exposure as opposed to those with noexposure history.

The mitogen-activated protein kinase 8 (Mapk8) gene playsa role in T cell proliferation, differentiation, and transcriptionregulation. It is also activated by TNF-a to induce apoptosis[43]. Because we observed an overall down-regulation of TNF-a, a change in expression of Mapk8 was expected. However, nosignificant differences were seen in expression of Mapk8between the rodents collected from either site under any ofthe treatments.

Transformation related protein 53 (Trp53) affects the pro-duction of proteins that respond to cellular stresses, resulting incell cycle arrest, DNA repair, apoptosis, and metabolism.Cellular stress usually leads to increased transcription of theTrp53 genes, thereby reducing cellular proliferation and pro-moting apoptosis [44]. Therefore, under the cellular stress ofchemotherapeutic treatments, Trp53 up-regulation would be theexpected result. In animals from the radioactive site that weretreated with BLM and VBL, this was not the case. Trans-formation-related protein 53 was, however, up-regulated in theanimals from the radioactive site after LPS treatment. Althoughthe responses to BLM and VBL do not correspond to mecha-nistically expected expression trends, we cannot comment onapoptosis levels or response protein production following thesetreatments. We can, however, report that the animals from theradioactive site, regardless of Trp53 expression, exhibit anincreased tolerance to these chemotherapeutic agents asopposed to their noncontaminated equivalents.

Interferon regulatory factor 1 (IRF-1) is key in apoptosispathways and tumor suppression. This transcriptional regulatoractivates specific interferons required for RNA induction aswell as transcriptional activation. Interferon regulatory factor 1is known to regulate internal levels of interferon-g and,when up-regulated, correlates with a positive prognosis incancer patients [45]. Interferon regulatory factor 1 wasdown-regulated in the animals from the radioactive sitereceiving LPS. Although the rodents from the radioactive siteappeared to tolerate the chemotherapeutic treatments betterthan the reference group, transcriptional levels of IRF-1 weresignificantly lower.

Interestingly, our results show that the rodents inhabiting asite with low levels of radiation had generally lower levels oftranscription (expression) than the same species from the

reference site. Studies have reported similar results in humans,concluding that gene expression is largely down-regulated inindividuals occupationally exposed to low-dose radiation (21up-regulated, 57 down-regulated genes) [46]. Although theexpression differences reported in our study may be counter-intuitive with the mechanistic pathways associated with thesegenes, the general transcriptional down-regulation effect is notunexpected. Additionally, the expression patterns observedherein did not correspond to a negative effect in the animals;instead they can be linked to our other endpoints demonstratinga radio-adaptive response. Analysis of data from the endpointsemployed (MN frequencies, PCE frequencies, WBC levels,neutrophil and lymphocyte frequencies, body mass change,and gene expression) support the conclusion that animals witha history of radiation exposure experience fewer adverse effectsfrom chemotherapeutic treatment. Research investigating therole of ROS concentrations, apoptosis rates, and methylationpatterns are currently being performed to help elucidate themechanisms responsible for our observations.

Acknowledgement—Special thanks to Llewellyn Densmore, RonaldKendall, Valentyn Martynenko, Julia Makluk, Sergei Makluk, HeatherMeeks, Mikhail Bondarkov, Ronald Chesser, Carleton Phillips, MhairiSutherland, Mohammed Fokar, Eric Chambers, John Hanson, RobertBradley, Peter Larsen, Kendra Phelps, Faisal Ali Anwarali Kahn, and RobertBaker. Thanks are also offered for the use of the research facilities at theInternational Radioecology Laboratory in Slavutych, Ukraine and theDepartment of Biological Sciences at Texas Tech University in Lubbock,Texas. Partial funding for this research was received from Sigma Xi Grants-in-Aid of Research, the United States Department of Energy (DE-FG02-02ER63439), and the Association of Biologists at Texas Tech University.

REFERENCES

1. Webb GM, Anderson RW, Gaffney MJS. 2006. Classification of eventswith an off-site radiological impact at the Sellafield site between 1950and 2000, using the International Nuclear Event Scale. J Radiol Prot26:33.

2. Decort M, Dubois G, Fridman ShD, Germenchuk MG, Izrael YuA,Janssens A, Jones AR, Kelly GN, Kvasnikova EV, Matveenko II,Nazarov IM, Pokumeiko YuM, Sitak VA, Stukin ED, Tabachny IYa,Tsaturov YuS, Avdyushin SI. 1998. Atlas of caesium deposition onEurope after the Chernobyl accident. EU publication EUR 16733.European Union, Brussels, Belgium.

3. Borovoy AA, Gagarinskiy AYu. 2001. Release of radionuclides from thedestroyed block of Chernobyl NPP. At Energ 90:137–145 (In Russianwith English abstract).

4. Gustafsson M. ed., 1996. One decade after Chernobyl: Influence onenvironment and further perspectives. IAEA/J1-CN-63. InternationalAtomic Energy Agency, Vienna, Austria.

5. Abagian AA. 1986. Information about the accident at Chernobyl NPPand its consequences, prepared for IAEA. At Energ 61:301–320 (InRussian with English abstract).

6. Izrael YuA. ed., 1990. Chernobyl: Radioactive Contamination ofNatural Environment. Hydrometeoizat, Leningrad, Russia. (In Russian).

7. Medvedev ZA. 1994. Chernobyl: Eight years after. Trends Ecol Evol9:369–371.

8. Chesser RK, Sugg DW, Lomakin MD, Van Den Bussche RA, DeWoodyJA, Jagoe CH, Dallas CE, Whicker FW, Smith MH, Gaschak SP,Chizhevsky IV, Lyabik VV, Buntova EG, Holloman K, Baker RJ. 2000.Concentrations and dose rate estimates of 134,137Cesium and 90Strontiumin small mammals at Chornobyl, Ukraine. Environ Toxicol Chem 19:305–312.

9. Wickliffe JK, Bickham AM, Rodgers BE, Chesser RK, Phillips CJ,Gaschak SP, Goryanaya JA, Chizhevsky I, Baker RJ. 2003. Exposure tochronic, low-dose rate gamma-radiation at Chornobyl does not inducepoint mutations in Big Blue mice. Environ Mol Mutagen 42:11–18.

10. Rodgers BE, Wickliffe JK, Phillips CJ, Chesser RK, Baker RJ. 2001.Experimental exposure of naı̈ve bank voles (Clethrionomys glareolus) tothe Chornobyl, Ukraine, environment: A test of radioresistance. EnvironToxicol Chem 20:1936–1941.

11. Chesser RK, Rodgers BE, Wickliffe JK, Gaschak SP, ChizhevskyI, Phillips CJ, Baker RJ. 2001. Accumulation of 137Cesium and

Tolerance to chemotherapy after low-dose radiation exposure Environ. Toxicol. Chem. 30, 2011 649

90Strontium from abiotic and biotic sources in rodents at Chornobyl,Ukraine. Environ Toxicol Chem 20:1927–1935.

12. U.S. Department of Energy. 2009. Low Dose Radiation. Office ofBiological and Environmental Research, Washington, DC.

13. Rodgers BE, Holmes KM. 2008. Radio-adaptive response to environ-mental exposures at Chernobyl. Dose-Response 6:209–221.

14. Tapio S, Jacob V. 2007. Radioadaptive response revisited. RadiatEnviron Bioph 46:1–12.

15. Hayashi M, Sofuni T, Ishidate M Jr. 1983. An application of acridineorange fluorescent staining to the micronucleus test. Mutat Res 120:241–247.

16. National Cancer Institute. 2003. Managing Eating Problems duringTreatment. U.S. National Institutesof Health, Bethesda,Maryland,USA.

17. Bondarkov MD, Zheltonozhsky VA, Maksimenko AM, Sadovnikov LV,Strilchuk NV. 2002. Non-radiochemical technique for 90Sr measurementin biological objects and samples of soil. Collection of scientific articlesof the Nuclear Research Institute, National Academy of Sciences ofUkraine 2:162–167.

18. National Cancer Institute. 2009. Bleomycin sulfate. U.S. NationalInstitutes of Health, Bethesda, MD, USA.

19. Jagetia GC, Jacob PS. 1992. Vinblastine treatment induces dosedependent increases in the frequency of micronuclei in mouse bonemarrow. Mutat Res 280:87–92.

20. Pecaut MJ, Dutta-Roy R, Miller GM, Gridley DS. 2007. Radiation-induced modifications in primary immune response to lipopolysacchar-ide: Lymphocyte distribution and function. In Vivo 21:463–470.

21. Sassi N, Paul C, Martin A, Bettaieb A, Jeannin JF. 2010. Lipid a-inducedresponses in vivo. Adv Exp Med Biol 667:69–80.

22. Collaborative Study Group for the Micronucleus Test (CSGMT). 1995.Guidelines for Testing of Chemicals: Protocol recommended by theCSGMT/JEMS.MMS for the short-term mouse peripheral bloodmicronucleus test. Mutagenesis 10:153–159.

23. Teva Parenteral Medicines. 2005. Bleomycin sulfate for injection, USP.Material Safety Data Sheet. Irvine, CA, USA.

24. Van Belle S, Fortan L, De Smet M, De Neve W, Van der Elst J, Storme G.1994. Interaction between Vinblastine and ionizing radiation in themouse MO4 fibrosarcoma in vivo. Anticancer Res 14:1043–1048.

25. Calbiochem. 1999. Lipopolysaccharide E. coli J5. Material Safety DataSheet. La Jolla, CA, USA.

26. Pfaffl MW, Horgan GW, Dempfle L. 2002. Relative expression softwaretool (REST) for group-wise comparison and statistical analysis ofrelative expression results in real-time PCR. Nucleic Acids Res 30:e36.

27. Wu Y, Zuo J, Ji G, Saiyin H, Liu X, Yin F, Cao N, Wen Y, Li JJ, Yu L.2009. Proapoptotic function of integrin beta3 in human hepatocellularcarcinoma cells. Clin Cancer Res 15:60–69.

28. Ikushima T, Aritomi H, Morisita J. 1996. Radioadaptive response:Efficient repair of radiation-induced DNA damage in adapted cells.Mutat Res 358:193–198.

29. Bickham JW, Smolen MJ. 1994. Somatic and heritable effects ofenvironmental genotoxins and the emergence of evolutionary toxicol-ogy. Environ Health Persp 102:25–28.

30. Neriishi K, Nakashima E, Delongchamp RR. 2001. Persistent subclinicalinflammation among A-bomb survivors. Int J Radiat Biol 77:475–482.

31. Kusunoki Y, Hayashi T, Morishita Y, Yamaoka M, Maki M, Bean MA,Kyoizumi S, Hakoda M, Kodama K. 2001. T-cell responses to mitogensin atomic bomb survivors: A decreased capacity to produce interleukin 2characterizes the T cells of heavily irradiated individuals. Radiat Res155:81–88.

32. De Haan JB, Bladier C, Griffiths P, Kelner M, O’Shea RD, Cheung NS,Bronson RT, Silvestro MJ, Wild S, Zheng SS, Beart PM, Hertzog PJ,Kola I. 1998. Mice with a homozygous null mutation for the mostabundant glutathione peroxidase, Gpx1, show increased susceptibility tothe oxidative stress-inducing agents paraquat and hydrogen peroxide.J Biol Chem 273:22528–22536.

33. Nakamura T, Ishigami T, Makino N, Sakamoto K. 2001. The down-regulation of glutathione peroxidase causes bovine luteal cell apoptosisduring structural luteolysis. J Biochem 129:937–942.

34. Nanduri J, Wang N, Yuan G, Khan SA, Souvannakitti D, Peng YJ, KumarGK, Garcia JA, Prabhakar NR. 2009. Intermittent hypoxia degrades HIF-2alpha via calpains resulting in oxidative stress: Implications forrecurrent apnea-induced morbidities. P Natl Acad Sci 106:1199–1204.

35. Mattiazzi M, D’Aurelio M, Gajewski CD, Martushova K, Kiaei M, BealMF, Manfredi G. 2002. Mutated human Sod1 causes dysfunction ofoxidative phosphorylation in mitochondria of transgenic mice. J BiolChem 277:29626–29633.

36. Chen XJ, Wang X, Butow RA. 2007. Yeast aconitase binds and providesmetabolicallycoupled protection to mitochondrial DNA. P Natl Acad Sci104:13738–13743.

37. Venkatesan B, Mahimainathan L, Das F, Ghosh-Choudhury N, Ghosh-Choudhry G. 2007. Downregulation of catalase by reactive oxygenspecies via PI 3 kinase/akt signaling in mesangial cells. J Cell Physiol211:457–467.

38. Yamada H, Arai T, Endo N, Yamashita K, Fukuda K, Sasada M,Uchiyama T. 2006. LPS-induced ROS generation and changes inglutathione level and their relation to the maturationof humanmonocyte-derived dendritic cells. Life Sci 78:926–933.

39. Meister A, Anderson ME. 1983. Glutathione. Annu Rev Biochem 52:711–760.

40. Yuan Y, Qian ZR, Sano T, Asa SL, Yamada S, Kagawa N, Kudo E. 2008.Reduction of GSTP1 expression by DNA methylation correlates withclinicopathological features in pituitary adenomas. Modern Pathol 21:856–865.

41. Hajeer AH, Hutchinson IV. 2000. TNF-alpha gene polymorphism:Clinical and biological implications. Microscop Res Techniq 50:216–228.

42. Dofferhoff AS, Vellenga E, Limburg PC, Van Zanten A, Mulder PO,Weits J. 1991. Tumour necrosis factor (cachectin) and other cytokines inseptic shock: A review of the literature. Neth J Med 39:45–62.

43. Show MD, Hill CM, Anway MD, Wright WW, Zirkin BR. 2008.Phosphorylation of mitogen-activated protein kinase 8 (Mapk8) isassociated with germ cell apoptosis and redistribution of the Bcl2-modifying factor (BMF). J Androl 29:338–344.

44. Jin XL, Chandrakanthan V, Morgan HD, O’Neill C. 2009. Preimplan-tation embryo development in the mouse requires the latency of Trp53expression, which is induced by a ligand-activated PI3 kinase/AKT/MDM2-mediated signaling pathway. Biol Reprod 81:233–242.

45. Zeimet AG, Reimer D, Wolf D, Fiegl H, Concin N, Wiedemair A, WolfAM, Rumpold H, Muller-Holzner E, Marth C. 2009. Intratumoralinterferon regulatory factor (IRF)-1 but not IRF-2 is of relevance inpredicting patient outcome in ovarian cancer. Int J Cancer 124:2353–2360.

46. Fachin AL, Mello SS, Sandrin-Garcia P, Junta CM, Ghilardi-Netto T,Donadi EA, Passos GA, Sakamoto-Hojo ET. 2009. Gene expressionprofiles in radiation workers occupationally exposed to ionizingradiation. Radiat Res 50:61–71.