THE AMPHIBIAN TREE OF LIFE

THE AMPHIBIAN TREE OF LIFE

DARREL R. FROST,1 TARAN GRANT,1,4 JULIAN FAIVOVICH,1,4

RAOUL H. BAIN,1,2 ALEXANDER HAAS,5 CELIO F.B. HADDAD,6

RAFAEL O. DE SA,7 ALAN CHANNING,8 MARK WILKINSON,9

STEPHEN C. DONNELLAN,10 CHRISTOPHER J. RAXWORTHY,1

JONATHAN A. CAMPBELL,11 BORIS L. BLOTTO,12

PAUL MOLER,13 ROBERT C. DREWES,14

RONALD A. NUSSBAUM,15 JOHN D. LYNCH,16

DAVID M. GREEN,17 AND WARD C. WHEELER3

1Division of Vertebrate Zoology (Herpetology),2Center for Biodiversity and Conservation, and3Division of Invertebrate Zoology, American Museum of Natural History(DRF: [email protected]; TG: [email protected]; JF: [email protected];

RHB: [email protected]; CJR: [email protected]; WCW: [email protected]);4Department of Ecology, Evolution, and Environmental Biology,

Columbia University, New York, NY 10027;5Biocenter Grindel and Zoological Museum Hamburg, Martin-Luther-King-Platz 3,

D-20146 Hamburg, Germany ([email protected]);6Departamento de Zoologia, Instituto de Biociencias, Universidade Estadual Paulista (UNESP),

Caixa Postal 199, 13506-900 Rio Claro, Sao Paulo, Brazil ([email protected]);7Department of Biology, University of Richmond, Richmond, VA 23173-0001 ([email protected]);

8Department of Biodiversity and Conservation Biology, University of the Western Cape,Private Bag X17, Bellville 7535, South Africa ([email protected]);

9Department of Zoology, The Natural History Museum, Cromwell Road,London SW7 5BD, UK ([email protected]);

10South Australia Museum, Evolutionary Biology Unit, North Terrace,Adelaide 5000, South Australia ([email protected]);

11Department of Biology, University of Texas at Arlington, TX 76019-0001 ([email protected]);12Division Herpetologıa, Museo Argentino de Ciencias Naturales ‘‘Bernardino Rivadavia’’,

Angel Gallardo 470, 1405 Buenos Aires, Argentina ([email protected]);13Wildlife Research Laboratory, Florida Fish and Wildlife Conservation Commission,

4005 South Main Street, Gainesville, FL 32601-9075 ([email protected]);14Department of Herpetology, California Academy of Sciences, 875 Howard Street,

San Francisco, CA 94103-3009 ([email protected]);15Museum of Zoology and Department of Ecology and Evolutionary Biology, University of Michigan,

1109 Geddes Avenue, Ann Arbor, MI 48109-1079 ([email protected]);16Instituto de Ciencias Naturales, Universidad Nacional de Colombia,

Apartado 7495, Bogota, Colombia ([email protected]);17Redpath Museum, McGill University, 859 Sherbrooke Street West,

Montreal, Quebec H3A 2K6, Canada ([email protected])

BULLETIN OF THE AMERICAN MUSEUM OF NATURAL HISTORY

CENTRAL PARK WEST AT 79TH STREET, NEW YORK, NY 10024

Number 297, 370 pp., 71 figures, 5 tables, 7 appendices

Issued March 15, 2006

Copyright q American Museum of Natural History 2006 ISSN 0003-0090

3

CONTENTS

Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11Materials and Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13

Conventions and Abbreviations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13General Analytical Approach: Theoretical Considerations . . . . . . . . . . . . . . . . . . . . . . . . . 13Taxon Sampling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14Character Sampling . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Laboratory Protocols . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Sequence Preanalysis: Heuristic Error Checking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Molecular Sequence Formatting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Analytical Strategy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

Review of Current Taxonomy, the Questions, and Taxon Sampling . . . . . . . . . . . . . . . . . . 22Comparability of Systematic Studies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22Amphibia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23Gymnophiona . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24

Rhinatrematidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25Ichthyophiidae and Uraeotyphlidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25Scolecomorphidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25Typhlonectidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25‘‘Caeciliidae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25

Caudata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26Sirenidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26Hynobiidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Cryptobranchidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Proteidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28Rhyacotritonidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Amphiumidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Plethodontidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30Salamandridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36Dicamptodontidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37Ambystomatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37

Anura . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38‘‘Primitive’’ Frogs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41

Ascaphidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41Leiopelmatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41Discoglossidae and Bombinatoridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44

‘‘Transitional’’ Frogs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 45Pipoidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46Rhinophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Pipidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 47Pelobatoidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48Pelobatidae and Scaphiopodidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49Pelodytidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49Megophryidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49

‘‘Advanced’’ Frogs—Neobatrachia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50‘‘Hyloidea’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52

Heleophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52Sooglossidae and Nasikabatrachidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53Limnodynastidae, Myobatrachidae, and Rheobatrachidae . . . . . . . . . . . . . . . . . . . . . . . 53‘‘Leptodactylidae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56‘‘Ceratophryinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57‘‘Cycloramphinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59

4 NO. 297BULLETIN AMERICAN MUSEUM OF NATURAL HISTORY

Eleutherodactylinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 60Leptodactylinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61‘‘Telmatobiinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 61‘‘Hemiphractinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62Brachycephalidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Rhinodermatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Dendrobatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 63Allophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Centrolenidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Hylidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Hylinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64Pelodryadinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Phyllomedusinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 65Bufonidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67

Ranoidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70Arthroleptidae, Astylosternidae, and Hyperoliidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72Arthroleptidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72Astylosternidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 72Hyperoliidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74Hemisotidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74Microhylidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 75Scaphiophyrninae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77Asterophryinae and Genyophryninae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77Brevicipitinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78Cophylinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 78Dyscophinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79Melanobatrachinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79Microhylinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80Phrynomerinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80‘‘Ranidae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81Ceratobatrachinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81Conrauinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83Dicroglossinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83Lankanectinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 89Micrixalinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 90Nyctibatrachinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91Petropedetinae, Phrynobatrachinae, and Pyxicephalinae . . . . . . . . . . . . . . . . . . . . . . . . 91Ptychadeninae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93‘‘Raninae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 93Ranixalinae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106Rhacophoridae and Mantellidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 106

Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 110Sequence Length Variation and Notes on Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 110Topological Results and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111Outgroup Relationships . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112Amphibia (Lissamphibia) and Batrachia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 112Gymnophiona . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113Caudata . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114

Hynobiidae and Cryptobranchidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 114Sirenidae and Proteidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116Rhyacotritonidae and Amphiumidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116Plethodontidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116Salamandridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 117

2006 5FROST ET AL.: AMPHIBIAN TREE OF LIFE

Dicamptodontidae and Ambystomatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118Anura . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118

Ascaphidae and Leiopelmatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 118Pipidae and Rhinophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119Discoglossidae and Bombinatoridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Pelobatoidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Neobatrachia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Heleophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121

Hyloidea, excluding Heleophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121Sooglossidae and Nasikabatrachidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122Myobatrachidae, Limnodynastidae, and Rheobatrachidae . . . . . . . . . . . . . . . . . . . . . . 123‘‘Leptodactylidae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123‘‘Telmatobiinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 123‘‘Hemiphractinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127Eleutherodactylinae and Brachycephalidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127‘‘Leptodactylinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 127‘‘Ceratophryinae’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128‘‘Cycloramphinae’’ and Rhinodermatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 128Centrolenidae and Allophrynidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Brachycephalidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Rhinodermatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Dendrobatidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Hylidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130Bufonidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131

Ranoidea . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131Microhylidae and Hemisotidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131Arthroleptidae, Astylosternidae, and Hyperoliidae . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134Ranidae, Mantellidae and Rhacophoridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134Mantellidae and Rhacophoridae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141

A Taxonomy of Living Amphibians . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141Taxonomic Accounts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 147

Amphibia Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 164Gymnophiona Muller, 1832 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165Rhinatrematidae Nussbaum, 1977 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 165

Stegokrotaphia Cannatella and Hillis, 1993 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166Ichthyophiidae Taylor, 1968 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 166Caeciliidae Rafinesque, 1814 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167

Batrachia Latreille, 1800 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 168Caudata Fischer von Waldheim, 1813 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169

Cryptobranchoidei Noble, 1931 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170Cryptobranchidae Fitzinger, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170Hynobiidae Cope, 1859 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170Diadectosalamandroidei new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171Hydatinosalamandroidei new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 171Perennibranchia Latreille, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172Proteidae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172Sirenidae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173Treptobranchia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 173Ambystomatidae Gray, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174Salamandridae Goldfuss, 1820 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 174Plethosalamandroidei new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175Rhyacotritonidae Tihen, 1958 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176Xenosalamandroidei new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176


Amphiumidae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 176Plethodontidae Gray, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 177

Anura Fischer von Waldheim, 1813 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 178Leiopelmatidae Mivart, 1869 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 179Lalagobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 180Xenoanura Savage, 1973 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 181Pipidae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 182Rhinophrynidae Gunther, 1859 ‘‘1858’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183Sokolanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183Costata Lataste, 1879 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184Alytidae Fitzinger, 1843 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 184Bombinatoridae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185Acosmanura Savage, 1973 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 185Anomocoela Nicholls, 1916 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186Pelodytoidea Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187Pelodytidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187Scaphiopodidae Cope, 1865 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187Pelobatoidea Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188Pelobatidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188Megophryidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 188Neobatrachia Reig, 1958 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189Heleophrynidae Noble, 1931 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190Pthanobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190Hyloides new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191Sooglossidae Noble, 1931 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191Notogaeanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 192Australobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193Batrachophrynidae Cope, 1875 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193Myobatrachoidea Schlegel, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194Limnodynastidae Lynch, 1971 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 194Myobatrachidae Schlegel, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195Nobleobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196Hemiphractidae Peters, 1862 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196Meridianura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 196Brachycephalidae Gunther, 1858 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197Cladophrynia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201Cryptobatrachidae new family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201Tinctanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201Amphignathodontidae Boulenger, 1882 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202Athesphatanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202Hylidae Rafinesque, 1815 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 202Hylinae Rafinesque, 1815 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 203Pelodryadinae Gunther, 1858 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 204Phyllomedusinae Gunther, 1858 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205Leptodactyliformes new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205Diphyabatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 205Centrolenidae Taylor, 1951 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 206Leptodactylidae Werner, 1896 (1838) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207Chthonobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208Ceratophryidae Tschudi, 1838 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208Hesticobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 209Cycloramphidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210Agastorophrynia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210Dendrobatoidea Cope, 1865 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211


Thoropidae new family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211Dendrobatidae Cope, 1865 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 211Bufonidae Gray, 1825 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 213Ranoides new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 223Allodapanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 224Microhylidae Gunther, 1858 (1843) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 224Asterophryinae Gunther, 1858 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227Cophylinae Cope, 1889 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 227Dyscophinae Boulenger, 1882 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228Gastrophryninae Fitzinger, 1843 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228Melanobatrachinae Noble, 1931 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229Microhylinae Gunther, 1858 (1843) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229Scaphiophryninae Laurent, 1946 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230Afrobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231Xenosyneunitanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231Brevicipitidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 231Hemisotidae Cope, 1867 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232Laurentobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232Hyperoliidae Laurent, 1943 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 232Arthroleptidae Mivart, 1869 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 233Natatanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 234Ptychadenidae Dubois, 1987 ‘‘1986’’ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235Victoranura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 235Ceratobatrachidae Boulenger, 1884 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 236Telmatobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 236Micrixalidae Dubois, Ohler, and Biju, 2001 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237Ametrobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237Africanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237Phrynobatrachidae Laurent, 1940 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237Pyxicephaloidea Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238Petropedetidae Noble, 1931 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 238Pyxicephalidae Bonaparte, 1850 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240Saukrobatrachia new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241Dicroglossidae Anderson, 1871 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241Dicroglossinae Anderson, 1871 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241Occidozyginae Fei, Ye, and Huang, 1991 ‘‘1990’’ . . . . . . . . . . . . . . . . . . . . . . . . . . 243Aglaioanura new taxon . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243Rhacophoroidea Hoffman, 1932 (1858) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243Mantellidae Laurent, 1946 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244Rhacophoridae Hoffman, 1932 (1858) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245Ranoidea Rafinesque, 1814 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247Nyctibatrachidae Blommers-Schlosser, 1993 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 247Ranidae Rafinesque, 1814 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 248

Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 255References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 257Appendix 1. Voucher and DNA Locus Information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292Appendix 2. Accession Numbers for Genbank Sequences Used in This Study . . . . . . . . 322Appendix 3. Base-Pair Length of 28S Fragment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 324Appendix 4. Branch Lengths, Bremer Support, and Jackknife Values by Branch . . . . . . 326Appendix 5. DNA Sequence Transformations for Selected Branches/Taxa . . . . . . . . . . . 330Appendix 6. Nomenclatural Notes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 355Appendix 7. New and Revived Combinations and Clarifications Regarding

Taxonomic Content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 359

8

ABSTRACT

The evidentiary basis of the currently accepted classification of living amphibians is dis-cussed and shown not to warrant the degree of authority conferred on it by use and tradition.A new taxonomy of living amphibians is proposed to correct the deficiencies of the old one.This new taxonomy is based on the largest phylogenetic analysis of living Amphibia so faraccomplished. We combined the comparative anatomical character evidence of Haas (2003)with DNA sequences from the mitochondrial transcription unit H1 (12S and 16S ribosomalRNA and tRNAValine genes, ø 2,400 bp of mitochondrial sequences) and the nuclear geneshistone H3, rhodopsin, tyrosinase, and seven in absentia, and the large ribosomal subunit 28S(ø 2,300 bp of nuclear sequences; ca. 1.8 million base pairs; x 5 3.7 kb/terminal). The datasetincludes 532 terminals sampled from 522 species representative of the global diversity ofamphibians as well as seven of the closest living relatives of amphibians for outgroup com-parisons.

The primary purpose of our taxon sampling strategy was to provide strong tests of themonophyly of all ‘‘family-group’’ taxa. All currently recognized nominal families and subfam-ilies were sampled, with the exception of Protohynobiinae (Hynobiidae). Many of the currentlyrecognized genera were also sampled. Although we discuss the monophyly of genera, andprovide remedies for nonmonophyly where possible, we also make recommendations for futureresearch.

A parsimony analysis was performed under Direct Optimization, which simultaneously op-timizes nucleotide homology (alignment) and tree costs, using the same set of assumptionsthroughout the analysis. Multiple search algorithms were run in the program POY over aperiod of seven months of computing time on the AMNH Parallel Computing Cluster.

Results demonstrate that the following major taxonomic groups, as currently recognized,are nonmonophyletic: Ichthyophiidae (paraphyletic with respect to Uraeotyphlidae), Caecili-idae (paraphyletic with respect to Typhlonectidae and Scolecomorphidae), Salamandroidea(paraphyletic with respect to Sirenidae), Leiopelmatanura (paraphyletic with respect to Asca-phidae), Discoglossanura (paraphyletic with respect to Bombinatoridae), Mesobatrachia (par-aphyletic with respect to Neobatrachia), Pipanura (paraphyletic with respect to Bombinatoridaeand Discoglossidae/Alytidae), Hyloidea (in the sense of containing Heleophrynidae; paraphy-letic with respect to Ranoidea), Leptodactylidae (polyphyletic, with Batrachophrynidae form-ing the sister taxon of Myobatrachidae 1 Limnodynastidae, and broadly paraphyletic withrespect to Hemiphractinae, Rhinodermatidae, Hylidae, Allophrynidae, Centrolenidae, Brachy-cephalidae, Dendrobatidae, and Bufonidae), Microhylidae (polyphyletic, with Brevicipitinaebeing the sister taxon of Hemisotidae), Microhylinae (poly/paraphyletic with respect to theremaining non-brevicipitine microhylids), Hyperoliidae (para/polyphyletic, with Leptopelinaeforming the sister taxon of Arthroleptidae 1 Astylosternidae), Astylosternidae (paraphyleticwith respect to Arthroleptinae), Ranidae (paraphyletic with respect to Rhacophoridae and Man-tellidae). In addition, many subsidiary taxa are demonstrated to be nonmonophyletic, such as(1) Eleutherodactylus with respect to Brachycephalus; (2) Rana (sensu Dubois, 1992), whichis polyphyletic, with various elements falling far from each other on the tree; and (3) Bufo,with respect to several nominal bufonid genera.

A new taxonomy of living amphibians is proposed, and the evidence for this is presentedto promote further investigation and data acquisition bearing on the evolutionary history ofamphibians. The taxonomy provided is consistent with the International Code of ZoologicalNomenclature (ICZN, 1999).

Salient features of the new taxonomy are (1) the three major groups of living amphibians,caecilians/Gymnophiona, salamanders/Caudata, and frogs/Anura, form a monophyletic group,to which we restrict the name Amphibia; (2) Gymnophiona forms the sister taxon of Batrachia(salamanders 1 frogs) and is composed of two groups, Rhinatrematidae and Stegokrotaphia;(3) Stegokrotaphia is composed of two families, Ichthyophiidae (including Uraeotyphlidae)and Caeciliidae (including Scolecomorphidae and Typhlonectidae, which are regarded as sub-families); (4) Batrachia is a highly corroborated monophyletic group, composed of two taxa,Caudata (salamanders) and Anura (frogs); (5) Caudata is composed of two taxa, Cryptobran-choidei (Cryptobranchidae and Hynobiidae) and Diadectosalamandroidei new taxon (all othersalamanders); (6) Diadectosalamandroidei is composed of two taxa, Hydatinosalamandroidei


new taxon (composed of Perennibranchia and Treptobranchia new taxon) and Plethosala-mandroidei new taxon; (7) Perennibranchia is composed of Proteidae and Sirenidae; (8) Trep-tobranchia new taxon is composed of two taxa, Ambystomatidae (including Dicamptodonti-dae) and Salamandridae; (9) Plethosalamandroidei new taxon is composed of Rhyacotritonidaeand Xenosalamandroidei new taxon; (10) Xenosalamandroidei is composed of Plethodontidaeand Amphiumidae; (11) Anura is monophyletic and composed of two clades, Leiopelmatidae(including Ascaphidae) and Lalagobatrachia new taxon (all other frogs); (12) Lalagobatrachiais composed of two clades, Xenoanura (Pipidae and Rhinophrynidae) and Sokolanura newtaxon (all other lalagobatrachians); (13) Bombinatoridae and Alytidae (former Discoglossidae)are each others’ closest relatives and in a clade called Costata, which, excluding Leiopelma-tidae and Xenoanura, forms the sister taxon of all other frogs, Acosmanura; (14) Acosmanurais composed of two clades, Anomocoela (5 Pelobatoidea of other authors) and Neobatrachia;(15) Anomocoela contains Pelobatoidea (Pelobatidae and Megophryidae) and Pelodytoidea(Pelodytidae and Scaphiopodidae), and forms the sister taxon of Neobatrachia, together form-ing Acosmanura; (16) Neobatrachia is composed of two clades, Heleophrynidae, and all otherneobatrachians, Phthanobatrachia new taxon; (17) Phthanobatrachia is composed of two majorunits, Hyloides and Ranoides; (18) Hyloides comprises Sooglossidae (including Nasikabatrach-idae) and Notogaeanura new taxon (the remaining hyloids); (19) Notogaeanura contains twotaxa, Australobatrachia new taxon and Nobleobatrachia new taxon; (20) Australobatrachia isa clade composed of Batrachophrynidae and its sister taxon, Myobatrachoidea (Myobatrach-idae and Limnodynastidae), which forms the sister taxon of all other hyloids, excluding soog-lossids; (21) Nobleobatrachia new taxon, is dominated at its base by frogs of a treefrogmorphotype, several with intercalary phalangeal cartilages—Hemiphractus (Hemiphractidae)forms the sister taxon of the remaining members of this group, here termed Meridianura newtaxon; (22) Meridianura comprises Brachycephalidae (former Eleutherodactylinae 1 Brachy-cephalus) and Cladophrynia new taxon; (23) Cladophrynia is composed of two groups, Cryp-tobatrachidae (composed of Cryptobatrachus and Stefania, previously a fragment of the poly-phyletic Hemiphractinae) and Tinctanura new taxon; (24) Tinctanura is composed of Am-phignathodontidae (Gastrotheca and Flectonotus, another fragment of the polyphyletic Hem-iphractinae) and Athesphatanura new taxon; (25) Athesphatanura is composed of Hylidae(Hylinae, Pelodryadinae, and Phyllomedusinae, and excluding former Hemiphractinae, whoseinclusion would have rendered this taxon polyphyletic) and Leptodactyliformes new taxon;(26) Leptodactyliformes is composed of Diphyabatrachia new taxon (composed of Centrolen-idae [including Allophryne] and Leptodactylidae, sensu stricto, including Leptodactylus andrelatives) and Chthonobatrachia new taxon; (27) Chthonobatrachia is composed of a refor-mulated Ceratophryidae (which excludes such genera as Odontophrynus and Proceratophrysand includes other taxa, such as Telmatobius) and Hesticobatrachia new taxon; (28) Hesti-cobatrachia is composed of a reformulated Cycloramphidae (which includes Rhinoderma) andAgastorophrynia new taxon; (29) Agastorophrynia is composed of Bufonidae (which is par-tially revised) and Dendrobatoidea (Dendrobatidae and Thoropidae); (30) Ranoides new taxonforms the sister taxon of Hyloides and is composed of two major monophyletic components,Allodapanura new taxon (microhylids, hyperoliids, and allies) and Natatanura new taxon(ranids and allies); (31) Allodapanura is composed of Microhylidae (which is partially revised)and Afrobatrachia new taxon; (32) Afrobatrachia is composed of Xenosyneunitanura newtaxon (the ‘‘strange-bedfellows’’ Brevicipitidae [formerly in Microhylidae] and Hemisotidae)and a more normal-looking group of frogs, Laurentobatrachia new taxon (Hyperoliidae andArthroleptidae, which includes Leptopelinae and former Astylosternidae); (33) Natatanura newtaxon is composed of two taxa, the African Ptychadenidae and the worldwide Victoranuranew taxon; (34) Victoranura is composed of Ceratobatrachidae and Telmatobatrachia newtaxon; (35) Telmatobatrachia is composed of Micrixalidae and a worldwide group of ranoids,Ametrobatrachia new taxon; (36) Ametrobatrachia is composed of Africanura new taxon andSaukrobatrachia new taxon; (37) Africanura is composed of two taxa: Phrynobatrachidae(Phrynobatrachus, including Dimorphognathus and Phrynodon as synonyms) and Pyxice-phaloidea; (38) Pyxicephaloidea is composed of Petropedetidae (Conraua, Indirana, Arthro-leptides, and Petropedetes), and Pyxicephalidae (including a number of African genera, e.g.Amietia [including Afrana], Arthroleptella, Pyxicephalus, Strongylopus, and Tomopterna); and(39) Saukrobatrachia new taxon is the sister taxon of Africanura and is composed of Dicro-


glossidae and Aglaioanura new taxon, which is, in turn, composed of Rhacophoroidea (Man-tellidae and Rhacophoridae) and Ranoidea (Nyctibatrachidae and Ranidae, sensu stricto).

Many generic revisions are made either to render a monophyletic taxonomy or to render ataxonomy that illuminates the problems in our understanding of phylogeny, so that future workwill be made easier. These revisions are: (1) placement of Ixalotriton and Lineatriton (Caudata:Plethodontidae: Bolitoglossinae) into the synonymy of Pseudoeurycea, to render a monophy-letic Pseudoeurycea; (2) placement of Haideotriton (Caudata: Plethodontidae: Spelerpinae)into the synonymy of Eurycea, to render a monophyletic Eurycea; (3) placement of Nesomantis(Anura: Sooglossidae) into the synonymy of Sooglossus, to assure a monophyletic Sooglossus;(4) placement of Cyclorana and Nyctimystes (Anura: Hylidae: Pelodryadinae) into Litoria, butretaining Cyclorana as a subgenus, to provide a monophyletic Litoria; (5) partition of ‘‘Lim-nodynastes’’ (Anura: Limnodynastidae) into Limnodynastes and Opisthodon to render mono-phyletic genera; (6) placement of Adenomera, Lithodytes, and Vanzolinius (Anura: Leptodac-tylidae) into Leptodactylus, to render a monophyletic Leptodactylus; (7) partition of ‘‘Eleuth-erodactylus’’ (Anura: Brachycephalidae) into Craugastor, ‘‘Eleutherodactylus’’, ‘‘Euhyas’’,‘‘Pelorius’’, and Syrrhophus to outline the taxonomic issues relevant to the paraphyly of thisnominal taxon to other nominal genera; (8) partition of ‘‘Bufo’’ (Anura: Bufonidae) into anumber of new or revived genera (i.e., Amietophrynus new genus, Anaxyrus, Chaunus, Cran-opsis, Duttaphrynus new genus, Epidalea, Ingerophrynus new genus, Nannophryne, Pelto-phryne, Phrynoidis, Poyntonophrynus new genus; Pseudepidalea new genus, Rhaebo, Rhi-nella, Vandijkophrynus new genus); (9) placement of the monotypic Spinophrynoides (Anura:Bufonidae) into the synonymy of (formerly monotypic) Altiphrynoides to make for a moreinformative taxonomy; (10) placement of the Bufo taitanus group and Stephopaedes (as asubgenus) into the synonymy of Mertensophryne (Anura: Bufonidae); (11) placement of Xe-nobatrachus (Anura: Microhylidae: Asterophryinae) into the synonymy of Xenorhina to rendera monophyletic Xenorhina; (12) transfer of a number of species from Plethodontohyla toRhombophryne (Microhylidae: Cophylinae) to render a monophyletic Plethodontohyla; (13)placement of Schoutedenella (Anura: Arthroleptidae) into the synonymy of Arthroleptis; (14)transfer of Dimorphognathus and Phrynodon (Anura: Phrynobatrachidae) into the synonymyof Phrynobatrachus to render a monophyletic Phrynobatrachus; (15) placement of Afrana intothe synonymy of Amietia (Anura: Pyxicephalidae) to render a monophyletic taxon; (16) place-ment of Chaparana and Paa into the synonymy of Nanorana (Anura: Dicroglossidae) to rendera monophyletic genus; (17) recognition as genera of Ombrana and Annandia (Anura: Dicrog-lossidae: Dicroglossinae) pending placement of them phylogenetically; (18) return of Phry-noglossus into the synonymy of Occidozyga to resolve the paraphyly of Phrynoglossus (Anura:Dicroglossidae: Occidozyginae); (19) recognition of Feihyla new genus for Philautus palpe-bralis to resolve the polyphyly of ‘‘Chirixalus’’; (20) synonymy of ‘‘Chirixalus’’ with Chi-romantis to resolve the paraphyly of ‘‘Chirixalus’’; (21) recognition of the genus Babina,composed of the former subgenera of Rana, Babina and Nidirana (Anura: Ranidae); (22)recognition of the genera Clinotarsus, Humerana, Nasirana, Pelophylax, Pterorana, Pul-chrana, and Sanguirana, formerly considered subgenera of Rana (Anura: Ranidae), with nospecial relationship to Rana (sensu stricto); (23) consideration of Glandirana (Anura: Ranidae),formerly a subgenus of Rana, as a genus, with Rugosa as a synonym; (24) recognition ofHydrophylax (Anura: Ranidae) as a genus, with Amnirana and most species of former Chal-corana included in this taxon as synonyms; (25) recognition of Hylarana (Anura: Ranidae)as a genus and its content redefined; (26) redelimitation of Huia to include as synonymsEburana and Odorrana (both former subgenera of Rana); (27) recognition of Lithobates (An-ura: Ranidae) for all species of North American ‘‘Rana’’ not placed in Rana sensu stricto(Aquarana, Pantherana, Sierrana, Trypheropsis, and Zweifelia considered synonyms of Lith-obates); (28) redelimitation of the genus Rana as monophyletic by inclusion as synonymsAmerana, Aurorana, Pseudoamolops, and Pseudorana, and exclusion of all other former sub-genera; (29) redelimitation of the genus Sylvirana (Anura: Ranidae), formerly a subgenus ofRana, with Papurana and Tylerana included as synonyms.


INTRODUCTION

Amphibians (caecilians, frogs, and sala-manders) are a conspicuous component ofthe world’s vertebrate fauna. They currentlyinclude 5948 recognized species with repre-sentatives found in virtually all terrestrial andfreshwater habitats, in all but the coldest anddriest regions or the most remote oceanic is-lands. The number of recognized species ofamphibians has grown enormously in recentyears, about a 48.2% increase since 1985(Frost, 1985, 2004, unpubl. data). Thisgrowth reflects the increasing ease of col-lecting in remote locations and a significantgrowth of active scientific communities in afew megadiverse countries. Unfortunately,the rapid increase in knowledge of amphib-ian species diversity is coincident with amassive and global decline in amphibianpopulations (Alford and Richards, 1999;Houlahan et al., 2000; Young et al., 2001;S.N. Stuart et al., 2004) due to a diversity offactors, including habitat loss and fragmen-tation (Green, 2005; Halliday, 2005) but alsopossibly due to global environmental chang-es (Donnelly and Crump, 1998; Blausteinand Kiesecker, 2002; Heyer, 2003; Licht,2003) and such proximate causes as emerg-ing infectious diseases (Collins and Storfer,2003).

Understanding of amphibian evolutionaryhistory has not kept pace with knowledge ofamphibian species diversity. For all but a fewgroups, there is only a rudimentary evolu-tionary framework upon which to cast thetheories of cause, predict which lineages aremost likely to go extinct, or even compre-hend the amount of genetic diversity beinglost (Lips et al., 2005). Indeed, it is arguablewhether our general understanding of frogphylogenetics has progressed substantiallybeyond the seminal works of the late 1960sto early 1980s (Inger, 1967; Kluge and Far-ris, 1969; J.D. Lynch, 1971, 1973; Farris etal., 1982a). The major advances in frog tax-onomy in the 1980s and 1990s were domi-nated by nomenclatural and largely litera-ture-based phenotypic sorting (e.g., Dubois,1980, 1981, 1984b; Laurent, 1986; Dubois,1987 ‘‘1986’’, 1992) that provided otherworkers with digestible ‘‘chunks’’ to discussand evaluate phylogenetically. This has be-

gun to change in the 2000s with the infusionof significant amounts of molecular evidenceinto the discussion of large-scale amphibiandiversification. But, although recent molec-ular studies have been very illuminating(e.g., Biju and Bossuyt, 2003; Darst andCannatella, 2004; Faivovich et al., 2005;Roelants and Bossuyt, 2005; San Mauro etal., 2005), so far they have not provided thegeneral roadmap for future research that alarger and more detailed study could provide.

Among the three major taxonomic com-ponents of amphibian diversity, caeciliansappear to have been the focus of the mostsignificant study of large-scale evolutionaryhistory (Gower et al., 2002; Gower and Wil-kinson, 2002; M. Wilkinson et al., 2002; M.Wilkinson et al., 2003; San Mauro et al.,2004; M.H. Wake et al., 2005), although thismay be an artifact of the relatively small sizeof the group (173 species currently recog-nized) and the few, mostly coordinated,workers. Salamanders are the best-knowngroup at the species level, but salamanderphylogenetic work has largely focused on thegeneric and infrageneric levels of investiga-tion (e.g., Zhao, 1994; Titus and Larson,1996; Highton, 1997, 1998, 1999; Garcıa-Parıs and Wake, 2000; Highton and Peabody,2000; Jockusch et al., 2001; Parra-Olea andWake, 2001; Jockusch and Wake, 2002; Par-ra-Olea et al., 2002; Steinfartz et al., 2002;Parra-Olea et al., 2004; Sites et al., 2004),although there have been several importantefforts at an overall synthesis of morpholog-ical and molecular evidence (Larson andDimmick, 1993; Larson et al., 2003; Wienset al., 2005).

Research on frog phylogenetics has alsofocused primarily on generic and infragener-ic studies (e.g., Graybeal, 1997; Cannatellaet al., 1998; Mendelson et al., 2000; Sheil etal., 2001; Channing et al., 2002a; Dawood etal., 2002; Faivovich, 2002; Glaw andVences, 2002; Pramuk, 2002; Cunninghamand Cherry, 2004; Drewes and Wilkinson,2004; B.J. Evans et al., 2004; Pauly et al.,2004; Crawford and Smith, 2005; Matsui etal., 2005), and broader discussions of frogphylogenetics have been predominantly nar-rative rather than quantitative (e.g., Canna-tella and Hillis, 1993; Ford and Cannatella,1993; Cannatella and Hillis, 2004). Illumi-


nating large-scale studies have appeared re-cently (Biju and Bossuyt, 2003; Haas, 2003;Darst and Cannatella, 2004; Roelants andBossuyt, 2005; Van der Meijden et al., 2005;Faivovich et al., 2005). Nevertheless, a studyof a broad sampling of amphibians, based ona large number of terminals, has not beenattempted to date.

A serious impediment in amphibian biol-ogy, and systematics generally, with respectto advancing historically consistent taxono-mies, is the social conservatism resulting inthe willingness of many taxonomists to em-brace, if only tacitly, paraphyletic groupings,even when the evidence exists to correctthem. The reason for this is obvious. Rec-ognizing paraphyletic groups is a way of de-scribing trees in a linear way for the purposeof telling great stories and providing favoredcharacters a starring role. Because we thinkthat storytelling reflects a very deep elementof human communication, many systema-tists, as normal storytelling humans, are un-willing to discard paraphyly. Unfortunately,the great stories of science, those popularwith the general public and some fundingagencies, almost never evidence careful anal-ysis of data and precise reasoning or lan-guage. And, for much of its history, system-atics focused on great narrative stories about‘‘adaptive radiations’’ and ‘‘primitive’’,‘‘transitional’’, and ‘‘advanced’’ groups rath-er than the details of phylogeny. These sto-ries were almost always about favored char-acters (e.g., pectoral girdle anatomy, repro-ductive modes) within a sequence of para-phyletic groupings to the detriment of a fulland detailed understanding of evolutionaryhistory.

When one deconstructs the existing tax-onomy of frogs, for example, one is struckby the number of groups delimited by verysmall suites of characters and the specialpleading for particular characters that under-lies so much of the taxonomic reasoning.Factoring in the systematic philosophy at thetime many of these groups were named, boththe origin of the problems and the illogic ofperpetuating the status quo become apparent.

Our goal in this study is to provide rem-edies for the problems noted above, by wayof performing a large phylogenetic analysisacross all living amphibians and providing a

taxonomy consistent with phylogeny thatwill serve as a general road map for furtherresearch. That such a diverse group of biol-ogists (see list of authors) would be willingto set aside their legitimate philosophical dif-ferences to produce this work demonstratesthe seriousness of the need. We hope that byproviding considerable new data and new hy-potheses of relationship that we will engen-der efforts to test our phylogenetic hypothe-ses and generate new ones. Regardless, thedays are over of construing broad conclu-sions from small analyses of small numbersof taxa using small amounts of molecular ormorphological data. We also think that thetime is past for authoritarian classifications,rich in special pleading and weak on evi-dence (e.g., Dubois, 1992; Delorme et al.,2005; Dubois, 2005). In short, we hope thatthis publication will help change the natureof the conversation among scientists regard-ing amphibian systematics, moving it awayfrom the sociologically conservative to thescientifically conservative. As noted by Can-natella and Hillis (2004: 444), the need for‘‘scaling up’’ the rate of data collection iscertainly evident (e.g., compare the eviden-tiary content of Cannatella and Hillis, 1993,with Cannatella and Hillis, 2004).

Nevertheless, even if we are successful inproviding a roadmap for future work, thiswill not assure the health of amphibian sys-tematics. Clearly, the task of understandingthe evolution and ecological, morphological,and taxonomic diversity of amphibians ismassive, yet funding remains insufficient tomaintain a healthy amphibian systematicscommmunity. Further, the institutional, inter-institutional, national and international infra-structure needed to promote the systematicsresearch program needs to be greatly en-hanced with respect to state-of-the-art collec-tion facilities, digital libraries of all relevantsystematic literature, interoperable collectiondatabases, and associated GIS and mapping-related capacity, supercomputers and the im-proved analytical software to drive them, re-motely accessible visualization instrumenta-tion and specimen images, and enhanceddata-aquisition technology, including mas-sive through-put DNA sequencing, in addi-tion to already-identified personnel, training,and financial needs related to exploring life


on this planet and maintaining large researchcollections (Q.D. Wheeler et al., 2004; Pageet al., 2005). There has been the salutary de-velopment of additional support in the train-ing of systematists (e.g., Rodman and Cody,2003) and important successes in increasingsystematics capacity in a few megadiversecountries (e.g., Brazil; see de Carvalho et al.,2005), but it is also clear that increased re-search support is needed to assure anothergeneration of evolutionary biologists capableof the detailed anatomical work to documenthow organisms have changed and diversifiedthrough time. But, especially in this time ofincreasing optimization of university hiringand retention policies on the ability of facultyto garner extramural funding, additionalfunding is needed to make sure that jobs ex-ist for the systematists that are being trained.

ABOUT THE COLLABORATION: This collabora-tion was undertaken with the knowledge thateveryone involved would have to compro-mise on deeply held convictions regardingthe nature of evidence, methods of analysis,and what constitutes a reasonable assump-tion, as well as the nature of taxonomic no-menclature. Nevertheless, all data are provid-ed either through GenBank or from http://research.amnh.org/herpetology/down-loads.html, and we expect several of thecoauthors to deal in greater detail with theproblems and taxonomic hypotheses noted inthis paper, on the basis of even greateramounts of data with various taxonomicunits within Amphibia and from their ownpoints of view. We are unanimous in thinkingthat the capacity for systematic work needsto be expanded, and given existing universityhiring and retention practices, this expansioncan only take place through enhanced fund-ing.

MATERIALS AND METHODS

CONVENTIONS AND ABBREVIATIONS

Commands used in computer programs areitalicized. Tissues are referenced in appendix1 with the permanent collection number forthe voucher specimen or, if that is unavail-able, the tissue-collection number or field-voucher number. (See appendix 1 for acro-nyms.)

GENERAL ANALYTICAL APPROACH:THEORETICAL CONSIDERATIONS

CHOICE OF PHYLOGENETIC METHOD: Allphylogenetic methods minimize the numberof character transformations required to ex-plain the observed variation. Unweighted(equally weighted) parsimony analysis min-imizes hypothesized transformations global-ly, whereas the assumptions (expressed asdifferential probabilities or costs) about theevolutionary process or perceived impor-tance of different classes of transformationsemployed in statistical (maximum-likeli-hood, Bayesian analysis) and weighted par-simony methods minimize certain classes oftransformations at the expense of others. Op-erational considerations aside (e.g., tree-space searching capabilities), disagreementsbetween the results of unweighted parsimonyanalysis and the other methods are due to theincreased patristic distance required to ac-commodate the additional assumptions. Forthis study, we chose to analyze the data un-der the minimal assumptions of unweightedparsimony. Given the size and complexity ofour dataset, an important advantage of par-simony algorithms (whether weighted or un-weighted) is that thorough analysis could beachieved in reasonable times given currentlyavailable hardware and software.

NUCLEOTIDE HOMOLOGY AND THE TREAT-MENT OF INSERTIONS/DELETIONS (INDELS): Themethod of inferring nucleotide homology(i.e., alignment) and insertions/deletions (in-dels) and the treatment of indels in evaluat-ing phylogenetic hypotheses are criticallyimportant in empirical studies. A given da-taset aligned according to different criteria orunder different indel treatments may stronglysupport contradictory solutions (e.g., W.C.Wheeler, 1995; Morrison and Ellis, 1997).Many workers infer indels as part of theirprocedure to discover nucleotide homologybut then either treat the inferred indels as nu-cleotides of unknown identity by convertinggaps into missing data or eliminate gap-con-taining column vectors altogether, becausethey are believed to be unreliable or becausethe method of phylogenetic analysis does notallow them (Swofford et al., 1996). Othersargue that indels provide evidence of phy-logeny but believe, we think incorrectly, that


sequence alignment and tree evaluation arelogically independent and must be performedseparately (e.g., Simmons and Ochoterena,2000; Simmons, 2004).

We treat indels as evidentially equivalentto any other kind of inferred transformationand as a deductively inferred component ofthe explanation of DNA sequence diversityobserved among the sampled terminals. Fur-thermore, because nucleotides lack the struc-tural and/or developmental complexity nec-essary to test their homology separately, hy-potheses of nucleotide homology can beevaluated only in reference to a topology(Grant and Kluge, 2004; see also Frost et al.,2001). In recognition of these considerations,we assessed nucleotide homology dynami-cally by optimizing observed sequences di-rectly onto competing topologies (Sankoff,1975; Sankoff et al., 1976), thereby heuris-tically evaluating competing hypotheses bysimultaneous searching of tree space. This isachieved using Direct Optimization (W.C.Wheeler, 1994, 1996, 1998, 1999; Phillips etal., 2000; W.C. Wheeler, 2000, 2001, 2002,2003a, 2003b, 2003c) as implemented in thecomputer program POY (W.C. Wheeler etal., 1996–2003).

Determination of nucleotide homology istreated as an optimization problem in whichthe optimal scheme of nucleotide homologiesfor a given topology is that which requiresthe fewest transformations overall—that is,that which minimizes patristic distance, thusproviding the most parsimonious explanationof the observed diversity. Determining theoptimal alignment for a given topology isNP-complete1 (Wang and Jiang, 1994). Foreven a minuscule number of sequences, thenumber of possible alignments is staggering-ly large (Slowinski, 1998), making exact so-lutions impossible for any contemporary da-taset, and heuristic algorithms are required torender this problem tractable.

Phylogenetic analysis under Direct Opti-mization, therefore, addresses two nestedNP-complete problems. POY searches si-multaneously for the optimal homology/to-

1 The notion of NP-completeness extends from formalcomplexity theory. But, we can regard NP-completeproblems as those problems for which there is no prac-tical way to determine or verify an exact solution.

pology combination, and search strategiesmust take into consideration the extent of theheuristic shortcuts applied at both levels. Thedetails of our analyses are discussed belowunder Heuristic Homology Assessment andHeuristic Tree Searching, with the generalapproach being to increase the rigor at bothlevels as the overall search progresses. In anyheuristic analysis, a balance is sought where-by the algorithmic shortcuts speed up anal-ysis enough to permit a sufficiently large anddiverse sample of trees and alignments todiscover the global optimum during final re-finement, but not so severe that the samplingis so sparse or misdirected that the globaloptimum is not within reach during final re-finement. Ideally, indicators of search ade-quacy (e.g., multiple independent minimum-length hits, stable consensus; see Goloboff,1999; Goloboff and Farris, 2001; Goloboffet al., 2003) should be employed to judge theadequacy of analysis, as is now reasonablein parsimony analysis of large prealigned da-tasets (e.g., as performed by the softwarepackage TNT; Goloboff et al., 2003). How-ever, current hardware and software limita-tions make those indicators unreachable inreasonable amounts of time for our datasetanalyzed under Direct Optimization. The ad-equacy of our analysis may only be judgedintuitively in light of the computational effortand strategic use of multiple algorithms de-signed for large datasets.

TAXON SAMPLING

The 532 terminals (reflecting 7 outgroupspecies, 522 ingroup species [with three re-dundancies]) included in our analysis aregiven in appendix 1. Because this study ispredominantly molecular, outgroup samplingwas restricted to the closest living relativesof living amphibians and did not include fos-sil taxa. These included two mammals, twoturtles, one crocodylian, one squamate, anda coelacanth as the root. Our study was notdesigned to identify the sister taxon of tet-rapods, and our use of a coelacanth insteadof a lungfish was due to expediency and nota decided preference for any particular hy-pothesis of tetrapod relationship.

The remaining 525 terminals were sam-pled from the three orders of living amphib-


ians. Our general criteria were (1) availabil-ity of tissues and/or sequences on GenBank,and (2) representation of taxonomic diversi-ty. Although taxonomic rank per se is mean-ingless, our taxon sampling was guided to alarge degree by generic diversity. Experiencesuggested that this ‘‘genus-level’’ samplingwould thoroughly sample the diversity of liv-ing amphibians. The median number of spe-cies per genus for living taxa is only three,something that we think has to do with hu-man perception of similarity and difference,not evolutionary processes. Some genera(e.g., Eleutherodactylus, ca. 605 species) areso large and/or diverse that directed subsam-pling of species groups was required to eval-uate likely paraphyly (e.g., with respect toPhrynopus).

Summarizing, our sample constitutedabout 8.8% of all species of Recent amphib-ians currently recognized, with approximate-ly the same proportion of species diversitysampled from each order. Of the ca. 467 Re-cent amphibian genera2, 326 (69.8%) are rep-resented in our sample. We targeted 17 spe-cies of caecilians, representing 16 genera ofall 6 family groups. Among salamanders wesampled 51 species from 42 genera of all 10families. The bulk of our ingroup sample fo-cused on frogs, with 437 terminals targeted.The remaining 457 terminals represent 454anuran species from ca. 269 genera and 32anuran families. A more extensive discussionof the terminals and the rationale behind theirchoice is presented under ‘‘Review of Cur-rent Taxonomy’’.

CHARACTER SAMPLING

MORPHOLOGY: The 152 transformation se-ries of morphology were incorporated di-rectly from Haas (2003). Of his original 156transformations, the gap-weighted morpho-metric transformations 12 (relative larvaldermis thickness), 83 (cornua trabeculae pro-portions), 116 (ratio of anterior ceratohyalprocesses), and 117 (relative depth of ante-

2 The estimate of the number of amphibian genera, forpurposes of these comparisons, rests on our perceptionof common usage. Because we arbitrarily treated manynominal subgenera (e.g., Clinotarsus, Hydrophylax,Lithobates) as genera, our working number of genera,for purposes of this manuscript, is considerably larger.

rior ceratohyla emargination) were excludedfrom our analysis because POY is unable toaddress noninteger transformations. We didinclude Haas’ transformation 102 (presence/absence of larval ribs) which he excludedfrom analysis because of difficulty in scoringabsences; its inclusion did not alter his finaltopology and provided us the opportunity toincorporate known occurence of larval ribsin our final hypothesis.

Of the 81 frog and 4 salamander speciesin Haas’ (2003) study, our study overlaps in41 anurans and 2 caudates. We did not com-bine into one virtual taxon morphology fromone species and DNA sequences from anoth-er, even if putatively closely related. Al-though that would have allowed us to incor-porate more (and potentially all) morpholog-ical data, and in some cases it probablywould not have affected our results detri-mentally, because of our general skepticismregarding the current understanding of am-phibian relationships we were unwilling toassume the monophyly of any group prior tothe analysis.

DNA SEQUENCES: In light of the differinglevels of diversity included in this study, wesought to sample loci of differing degrees ofvariability (i.e., rates). From the mitochon-drial genome, we targeted the mitochondrialH-strand transcription unit 1 (H1), which in-cludes the 12S ribosomal, tRNAValine, and16S ribosomal sequences, yielding approxi-mately 2,400 base pairs (bp) generated in 5–7 overlapping fragments. We also targetedthe nuclear protein coding genes histone H3(328 bp), rhodopsin (316 bp), tyrosinase (532bp), seven in absentia (397 bp), and the nu-clear 28S ribosomal gene (ca. 700 bp), givinga total of approximately 2,300 bp of nuclearDNA. Primers used in PCR amplification andcycle-sequencing reactions (and respectivecitations) are given in table 1. When possi-ble, terminals for which we were unable togenerate all fragments were augmented withsequences from GenBank (see appendices 1,2) under the assumption that the tissues wereactually conspecific. The amount of se-quence/terminal varied (fig. 1) with a rangefrom 490 bp (Limnonectes limborgi) to 4,790(Eleutherodactylus pluviacanorus), and themean being 3,554 bp (see appendix 1).


TABLE 1Primers Used for Various Loci in This Study and Their Published Sources

Gene Primer name Direction Primer sequence (59 to 39) Source

12S MVZ59MVZ5012S A-L12S F-H12S L1L13

ForwardReverseForwardReverseForwardForward

ATAGCACTGAAAAYGCTDAGATGTYTCGGTGTAAGYGARAKGCTTAAACTGGGATTAGATACCCCACTATCTTGGCTCGTAGTTCCCTGGCGAAAAGCTTCAAACTGGGATTAGATACCCCACTATTTAGAAGAGGCAAGTCGTAACATGGTA

Graybeal, 1997Graybeal, 1997Goebel et al., 1999Goebel et al., 1999Feller and Hedges, 1998Feller and Hedges, 1998

tRNAVal tRNAVal-H Reverse GGTGTAAGCGARAGGCTTTKGTTAAG Goebel et al., 1999

16S ARBRWilkinson2Titus IL2AH10

ForwardReverseReverseReverseForwardReverse

CGCCTGTTTATCAAAAACATCCGGTCTGAACTCAGATCACGTGACCTGGATTACTCCGGTCTGAGGTGGCTGCTTTTAGGCCCCAAACGAGCCTAGTGATAGCTGGTTTGATTACGCTACCTTTGCACGGT

Palumbi et al., 1991Palumbi et al., 1991J.A. Wilkinson et al., 1996Titus and Larson, 1996Hedges, 1994Hedges, 1994

Rhodopsinexon 1

Rhod1ARhod1CRhod1D

ForwardReverseReverse

ACCATGAACGGAACAGAAGGYCCCCAAGGGTAGCGAAGAARCCTTCGTAGCGGAAGAARCCTTCAAMGTA

Bossuyt and Milinkovitch, 2000Bossuyt and Milinkovitch, 2000Bossuyt and Milinkovitch, 2000

Tyrosinaseexon 1

TyrCTyrG

ForwardReverse

GGCAGAGGAWCRTGCCAAGATGTTGCTGGCRTCTCTCCARTCCCA

Bossuyt and Milinkovitch, 2000Bossuyt and Milinkovitch, 2000

Histone H3 H3FH3R

ForwardReverse

ATGGCTCGTACCAAGCAGACVGCATATCCTTRGGCATRATRGTGAC

Colgan et al., 1999Colgan et al., 1999

28S 28SV28SJJ

ForwardReverse

AAGGTAGCCAAATGCCTCATCAGTAGGGTAAAACTAACCT

Hillis and Dixon, 1991Hillis and Dixon, 1991

Seven inabsentiaa

SIA1 (T3)SIA2 (T7)

ForwardReverse

TCGAGTGCCCCGTGTGYTTYGAYTAGAAGTGGAAGCCGAAGCAGSWYTGCATCAT

Bonacum et al., 2001Bonacum et al., 2001

a Primers SIA1 and SIA2 were used with the universal T3 and T7 primers following Bonacum et al. (2001).

Fig. 1. Number of DNA base-pairs per terminal. For specific terminal data see appendix 1.


LABORATORY PROTOCOLS

Whole cellular DNA was extracted fromfrozen and ethanol-preserved tissues (liver ormuscle) using either phenol-chloroform ex-traction methods or the Qiagen DNeasy kitfollowing manufacturer’s guidelines. PCRamplification was carried out in 25 ml reac-tions using Amersham Biosciences puRe TaqReady-To-Go Beads. The standard PCR pro-gram consisted of an initial denaturing stepof 3 minutes at 948C, 35–40 cycles of 1 min-ute at 948C, 1 minute at 45–628C, and 1–1.5minutes at 728C, followed by a final exten-sion step of 6 minutes at 728C. PCR-ampli-fied products were cleaned using the AR-RAYIT kit (TeleChem International) on aBeckman Coulter Biomek 2000 robot. Cycle-sequencing using BigDye Terminators v. 3.0(Applied Biosystems) were run in 8 ml re-actions, and this was followed by isopropa-nol-ethanol precipitation and sequencing oneither an ABI 3700 or ABI 3730XL auto-mated DNA sequencer. Sequences were ed-ited in Sequencher (Gene Codes).

Given the magnitude and complexity ofthis project (over 8,500 sequences were gen-erated), the potential for errors to accumulatefrom a variety of sources (e.g., mislabeledvials, contamination, mispipetting, incorrectnaming of files) was a serious concern. Wetook several measures to avoid errors. Tis-sues, stock solutions (including DNA ex-tracts), and diluted working solutions werestored separately. Extractions were done atdifferent times in batches of no more than 30samples. Filtered tips were used to manipu-late stock DNA extracts. Multichannel pi-pettes were used whenever possible, and allPCR cleaning was done using a BeckmanCoulter Biomek 2000 robot. We extracted100 tissues twice independently and se-quenced at least one locus of each to confirmsequence identity, and we distributed multi-ple specimens of 10 species among differentbatches and generated all sequences for eachto confirm species identifications and se-quence identities and detect errors.

SEQUENCE PREANALYSIS:HEURISTIC ERROR CHECKING

Numerous steps were taken to detect er-rors in DNA sequences. As is standard prac-

tice, we generated sequences in forward andreverse directions. The ca. 2400 bp of H1were generated in 5–7 overlapping frag-ments, which allowed further sequence con-firmation. We also compared the sequencesgenerated for multiple extractions of thesame tissues, as well as multiple specimensof the same species. Using Sequencher (GeneCodes) we selected all edited sequences fora given locus and used the ‘‘assemble inter-actively’’ option to establish the threshold atwhich a given sequence would align withany other sequence, which allowed identicaland nearly identical sequences to be isolatedfor inspection. We compared questionable se-quences with those of confirmed identity andsequences in GenBank.

The sequences that passed these tests werethen aligned using ClustalX (Thompson etal., 1997). The resulting alignments andneighbor-joining trees for each partition wereexamined to detect aberrant sequences andformatting errors (e.g., reverse-comple-ments). Finally, preliminary phylogeneticanalyses were performed, and the resultingtopologies were used to identify terminalsthat required further scrutiny. Extreme vari-ance from expected position suggested thepossibility of error and caused us to performexperiments to confirm sequence identities.We clarify that no sequence was eliminatedsolely because it did not fit our prior notionsof relationships. Rather, the topologies wereused heuristically to single out terminals/se-quences for reexamination.

Once sequence identities were confirmed,sequences derived from the independentDNA extractions were merged. With a fewexceptions noted later, those from conspecificspecimens were merged into chimeras (withpolymorphisms coded as ambiguities) to re-duce the number of terminals in the analysis,but all sequences are deposited separately inGenBank (appendix 1).

MOLECULAR SEQUENCE FORMATTING

To allow integration of incomplete se-quence fragments (particularly those obtainedfrom GenBank; see Taxon Sampling Strategyand Character Sampling Strategy, above), ac-celerate cladogram diagnosis, and reducememory requirements under Iterative Pass


TABLE 2Summary of DNA Sequence Data

Sequence

Numberof

fragments

Number ofterminals forwhich a genesequence was

available

Mitochondrial ribosomalcluster

28SHistone H3RhodopsinSeven in absentia (SIA)Tyrosinase

2552243

532343378375302202

Optimization, we broke complete sequencesinto contiguous fragments. (This also im-proves the performance of POY’s implemen-tation of the parsimony ratchet; see HeuristicTree Searching, below.) We did so sparingly,however, as these breaks constrain homologyassessment by prohibiting nucleotide com-parisons across fragments, that is, it is as-sumed that no nucleotides from fragment Xare homologous with any nucleotides fromfragment Y. As the number of breaks increas-es, so too does the risk of overly constrainingthe analysis and failing to discover the glob-ally optimal solution(s).

We, therefore, inserted as few breaks aswere necessary to maximize the amount ofsequence data included, minimize the inser-tion of terminal N’s, and attain maximum-length fragments of about 500 bases (table2). Breaks were placed exclusively in highlyconserved regions (many of which corre-spond to commonly used PCR primers), asrecovery of such highly invariable regions islargely alignment-method independent andthe inserted breaks do not prevent discoveryof global optima. These highly conserved re-gions were identified via preliminaryClustalX (Thompson et al., 1997) alignmentsunder default parameters. Except for theirusefulness in placing fragments derived fromdifferent PCR primers and detecting errors(see Sequence Preanalysis, above), these pre-liminary alignments were used solely for thepurpose of identifying conserved regions;they did not otherwise inform or constrainour phylogenetic analysis. Once appropriateconserved regions were identified, fragments

were separated by inserting ampersands (&).Thus, the multiple fragments of the mtDNAcluster remain in the same file and order. Theresulting POY-formatted files can be ob-tained from http://research.amnh.org/herpe-tology/downloads.html or from the authors.

ANALYTICAL STRATEGY

We analyzed all data simultaneously usingthe program POY (W.C. Wheeler et al.,1996–2003) v. 3.0.11a (released May 20,2003) run on the AMNH Parallel ComputingCluster. We visualized results using Winclada(Nixon, 1999–2002) and performed addition-al searches of implied alignments by spawn-ing NONA (Goloboff, 1993–1999) fromWinclada (see below).

HEURISTIC HOMOLOGY ASSESSMENT: Nu-merous algorithms of varying degrees of ex-haustiveness have been proposed to optimizeunaligned data on a given topology. Oursearch strategy employed three Direct Opti-mization algorithms. In order of increasingexhaustiveness and execution time, thesewere Fixed States Optimization (W.C.Wheeler, 1999), Optimization Alignment(W.C. Wheeler, 1996), and Iterative Pass Op-timization (W.C. Wheeler, 2003a). As an in-dication of the magnitude of the problem ofanalyzing this 532-terminal dataset, execu-tion time for a single random-addition se-quence Wagner build (RAS), without swap-ping, on a 1.7 GHz Pentium 4 Dell Inspiron2650 running WindowsXP was 2.69 hoursunder Fixed States and 3.26 hours under Op-timization Alignment.

Although Fixed States Optimization wasproposed as a novel means of conceptualiz-ing DNA-sequence homology (W.C. Wheel-er, 1999), we employed it here simply as aheuristic shortcut. Because Fixed States is somuch faster than the Optimization Alignmentalgorithm, it allowed us to sample more thor-oughly the universe of trees. (The speed-upfor multiple replicates is actually much great-er than noted earlier for a random-additionsequence Wagner build, as generating the ini-tial state set is the slowest step in FixedStates analysis.) The trees obtained in FixedStates analyses were then used as startingpoints for further analysis under Optimiza-tion Alignment. The potential exists for the


globally optimal tree (or trees that wouldlead to the global optimum when swappedunder a more exhaustive optimization algo-rithm) to be rejected from the pool of can-didates under the heuristic. To minimize thisrisk, we also generated a smaller pool of can-didate trees under Optimization Alignment.The resulting 10 optimal and near-optimalcandidate trees were then submitted to finalevaluation and refinement under IterativePass optimization using iterativelowmem toreduce memory requirements. (For details ontree-searching algorithms see Heuristic TreeSearching, below.)

We did not employ exact during mostsearches, although we did use that commandin the final stages of analysis. To verifylengths reported in POY, we output the im-plied alignment (W.C. Wheeler, 2003b) andbinary version of the optimal topology inHennig86 format with phastwincladfile andopened the resulting file in Winclada (Nixon,1999–2002), following the procedure ofFrost et al. (2001). Because each topologymay imply a different optimal alignment,when multiple optimal topologies were ob-tained we examined them separately by in-putting each as a separate file using topofile.Examination of the implied alignments,whether formatted as Hennig files or as stan-dard alignments (impliedalignment), grantsanother opportunity to detect errors in for-matting or sequencing (e.g., reverse comple-ments; see Sequence Preanalysis, above).

HEURISTIC TREE SEARCHING: Efficientsearch strategies for large datasets are to acertain degree dataset-dependent (Goloboff,1999), and, as discussed above, common in-dicators of sufficiency are unrealistic givencurrent technological limitations. Therefore,rather than apply a simple, predefined searchstrategy (e.g., 100 random-addition sequenceWagner builds 1 TBR branch swapping), weemployed a variety of tree-searching algo-rithms in our analysis, spending more com-puting time on those that proved most fruit-ful. Tree fusing (Goloboff, 1999) and TBRswapping were performed at various pointsthroughout the analysis, and optimal treesfrom different searches were pooled for finaltree fusing and TBR swapping, all of whichwas refined by submitting optimal topologiesto swapping and ratcheting (see below) under

Iterative Pass Optimization (W.C. Wheeler,2003a).

See table 3 for a summary of generalsearching techniques. Initial runs used theapproxbuild heuristic to speed up building ofstarting trees, but the resulting trees requiredmuch more subsequent refinement, nullifyingthe initial speed-up. Remaining analyseswere therefore run without approxbuild. Weconducted searches without slop or check-slop, both of which increase the pool of treesexamined by swapping suboptimal treesfound during the search. Although thesesteps can be highly effective, initial trialsshowed they were too time-consuming forthe dataset (especially under Iterative Pass,where they would also be most relevant).

A variant of Goloboff’s (1999) tree drift-ing was also used to escape local optima. Al-though it is based loosely on Goloboff’s al-gorithm, the implementation in POY differssignificantly in the way it accepts candidatetrees during the search (see Goloboff, 1999,for his accept/reject calculation). In POY, theprobability of accepting a candidate tree thatis equal to or worse than the current optimum(better trees are always accepted) is given by1/(n 1 c 2 b), where c is the length of thecandidate topology, b is the length of the cur-rent optimum (best), and n is a user-specifiedfactor that decreases the probability of ac-cepting a suboptimal tree, effectively allow-ing the user to control the ease with whichthe search will drift away from the currentoptimum (we used the default of 2).

The parsimony ratchet (Nixon, 1999) wasproposed for analysis of fixed matrices. Giv-en that there are no prespecified column vec-tors to be reweighted under dynamic homol-ogy, the original approach had to be modi-fied. In the current version of POY, the ratch-et is programmed to reweight randomlyselected DNA fragments. Our data were di-vided into 41 fragments (see table 2), soratchetpercent 15 randomly reweighted 7fragments, regardless of their length or rela-tive position. In our analyses we reweighted15–35% of the fragments and appliedweights of 2–83.

As a complementary approach, we alsoperformed quick searches (few random-ad-dition sequence Wagner builds 1 SPR) underindel, transversion, and transition costs of 3:


TABLE 3Summary of Tree-Searching Methods Combined in Overall Search Strategy

See the text for more detailed explanations and references. Different runs combined multipleprocedures, and all runs included SPR and/or TBR refinement.

Searching method Description of procedure

RAS Random addition sequence Wagner builds

Constrained RAS As above, but constrained to agree with an input groupinclusion matrix derived from the consensus of topologieswithin 100–150 steps of present optimum

Subset RAS Separate analysis of subsets of 10–20 taxa; resultingarrangements used to define starting trees for further analysisof complete data set

Tree drifting Tree drifting as programmed in POY, using TBR swapping;control factor 5 2 (default)

Ratcheting (fragment) Ratcheting as programmed in POY, with 15–35% of DNAfragments selected randomly and weighted 2–8 times, saving1 minimum-length tree per replicate

Ratcheting (indel, tv, ts) Ratcheting approximated by applying relative indel-transversion-transition weights of 311, 131, and 113, savingall minimum length trees

Constrained ratcheting (fragment) As above, but beginning with the current optimum input as astarting tree and constrained to agree with an input groupinclusion matrix derived from the consensus of topologieswithin 100–150 steps of present optimum

Tree fusing Standard tree fusing followed by TBR branch swapping, withthe maximum number of fusing pairs left unconstrained

Manual rearrangement Manual movement of branches of current optimum

Ratcheting (original) of final impliedalignment

Parsimony ratchet of fixed matrix, as implemented in Winclada

1:1, 1:3:1, and 1:1:3 and included the result-ing topologies in the pool of trees submittedto tree-fusing and refinement under equalweights, following the general procedure ofd’Haese (2003). Reweighting in this methodis not done stochastically and therefore dif-fers from both Nixon’s (1999) original andPOY’s implementation of the ratchet. How-ever, because it weights sets of transforma-tions drawn from throughout the entire da-taset, it is likely to capture different patternsin the data and may be a closer approxima-tion to the original ratchet than POY’s im-plementation. Both approaches attempt to es-cape local optima.

We also performed constrained searchesby using Winclada to calculate the strict con-sensus of trees within an arbitrary number ofsteps of the present optimal, saving the to-pology as a treefile, constructing the group-

inclusion matrix (Farris, 1973) in the pro-gram Jack2Hen (W.C.Wheeler, unpublished;available at http://research.amnh.org/sci-comp/projects/poy.php), and then employingconstraint in the subsequent searches. To cal-culate the consensus we included trees within100–150 steps of the current optimum, thegoal being to collapse enough branches forswapping to be effective, but only enoughbranches to make for significant speed-ups ofRAS 1 swapping, while still allowing dis-covery of optimal arrangements within thepolytomous groups (see Goloboff, 1999:420). This is effectively a manual approxi-mation of Goloboff ’s (1999) consensus-based sectorial search procedure, the maindifference being that we collapsed branchesbased only on tree length and not relative fitdifference (Goloboff, 1999; Goloboff andFarris, 2001).


Using constraint files generated in thesame way, we also input the current optimumas a starting point for ratcheting. This strat-egy avoids spending time on RAS builds ofthe unconstrained parts of the tree (whichtend to be highly suboptimal) and seeks toescape local optima in the same way as un-constrained ratcheting, discussed earlier.However, there is a tradeoff in that the ar-rangements may be less diverse (and there-fore unable to find global optima) but arelikely to be, on average, closer to the opti-mum score than those examined throughRAS.

As a further manual approximation of sec-torial searches, we analyzed subsets of taxaseparately by defining reduced datasets withterminals files that listed only the targetedterminals. More rigorous searches (at least100 RAS 1 TBR for each of the reduceddatasets) of these reduced datasets were thenperformed, and the results were used to spec-ify starting topologies for additional search-ing of the complete dataset.

As a final attempt to discover more par-simonious solutions in POY, we also re-arranged branches of current optima manu-ally. As a general search strategy this wouldobviously be highly problematic, if for noother reason than that it would bias results.However, we performed this step primarilyto ensure that the ‘‘received wisdom’’ wasevaluated explicitly in our analysis. Our pro-cedure was to open the current optimum inWinclada, target taxa whose placement wasstrongly incongruent with current taxonomy,and move them to their expected positions(or place them in polytomies, depending onthe precision of the expectations). The re-sulting topology was saved as a treefile thatwas read into POY as a starting topology fordiagnosis and refinement (e.g., swapping,tree-fusing). In this way we were sure thatthe more heterodox aspects of our resultswere not due simply to failing to evaluate theorthodox alternatives in our searches.

We analyzed the final implied alignmentobtained in the final searches under IterativePass Optimization (i.e., the optimal solutionfound through all searching in POY) by car-rying out 10 independent ratchet runs of 200iterations each, using the default reweight-ings (Nixon, 1999). This ensured that heuris-

tic shortcuts employed in POY to speed upoptimization did not prevent discovery ofglobal optima. It also ensures that users ofother programs will be able to duplicate ourresults given our alignment.

PARALLEL COMPUTING: All POY runs wereparallelized across 95 or 64 processors of theAMNH 256-processor Pentium 4 Xeon 2.8GHz Parallel Computing Cluster. Initial anal-yses divided replicates among 5 sets of 19processors using controllers, that is, 5 repli-cates were run simultaneously, each paralle-lized across 19 processors. Although thatstrategy may lead to a more efficient parallelimplementation of POY (Janies and Wheeler,2001), a shortcoming is that catchslaveout-put, which saves all intermediate results tothe standard error file, is disabled when con-trollers is in use. Consequently, crashes (e.g.,due to HVAC failures and overheating) ormaintenance reboots result in the irrecover-able loss of days or weeks of analysis. Toavoid this problem in subsequent runs, weparallelized each replicate across all proces-sors and ran replicates serially, which al-lowed recovery from interrupted runs by in-putting the intermediate results as startingpoints.

SUPPORT MEASURES: We calculated supportusing the implied alignment of the optimalhypothesis. That is, the values reported re-flect the degree of support by the hypothe-sized transformation series and not by thedata per se. It is preferable to evaluate sup-port based on the unaligned data, as that pro-vides a more direct assessment of evidentialambiguity. (That is, it is possible for a cladeto appear strongly supported given a partic-ular alignment, but for support to dissolvewhen an alternative alignment is considered,meaning that the support by the data them-selves is ambiguous.) We based support mea-sures on the implied alignment because (1)it is much less time-consuming than supportcalculation under dynamic homology, andwe preferred to concentrate computationalresources on searches for the optimal solu-tion; and (2) these values are directly com-parable to those reported in the majority ofphylogenetic studies, which derive supportvalues from a single, fixed alignment.

To estimate Bremer values (Bremer, 1994),we output the implied alignment and optimal


trees in Hennig86 format using phastwin-cladfile, converted it to NEXUS format inWinclada, and then generated a NEXUS in-verse-constraints batch file in PRAP (K.Muller, 2004), which was analyzed inPAUP* 4.0 (Swofford, 2002). Given timeconstraints, tree searches for the Bremeranalysis were superficial, consisting of only2 RAS 1 TBR per group. Jackknife frequen-cies were calculated from 1000 replicates of1 RAS per replicate without TBR swapping;jackknife analysis was performed by spawn-ing NONA from Winclada.

REVIEW OF CURRENT TAXONOMY,THE QUESTIONS, AND TAXON

SAMPLING

In this section we review the existing tax-onomy of living amphibians and explainwhich species we sampled and what the jus-tifications were for this sampling3. We alsoexamine the evidentiary basis of the currenttaxonomy in an attempt to evaluate whichparts provide a scientific template on whichto interpret evolutionary patterns and trends,and which parts form an arbitrary and mis-leading structure that are merely anointed bytime and familiarity or, worse, by authority.The canonical issue is obviously monophyly,so the question becomes: Does our taxonomyreflect evolutionary (i.e., monophyletic)groups? And, regardless of that answer, whatis the evidentiary basis of the claims thathave been made about amphibian relation-ships? Can we sample taxa in such a way asto test those claims? In this section we have,where practical, provided specific evidencefrom the published record as it bears on thesequestions. The reader should bear in mindthat much of the current taxonomy rests onsubjective notions of overall similarity andthe relative importance of certain charactersto specific Linnaean ranks. Even whereknowledge claims derive from phylogeneticanalysis, the evidence can be highly contin-gent on a specific phylogenetic context. We

3 We do not address literature that appeared after 1August 2005 (although we do address electronicallyavailable ‘‘in-press’’ articles that had not yet appearedin hard-copy form by that date). This decision will haveexcluded some important literature, but the date is wellafter the submission date of the manuscript (29 May2005) and a practical end-point was needed.

have not attempted to provide comparablecharacters among the taxa because such a de-scription has yet to be accomplished in a de-tailed way (but see J.D. Lynch, 1973, andLaurent, 1986, for general attempts) and isoutside the scope of this study. A generalstudy would obviously change both the de-limitation of the characters and the levels ofgenerality.

COMPARABILITY OF SYSTEMATIC STUDIES

Throughout the review of current taxono-my that follows, we make only passing ref-erence to the various analytical techniquesused by various authors. There are two rea-sons for this. Not only is a deep review oftechniques of phylogenetic inference beyondthe scope of this paper, but it probably wouldbe impossible for us to put together a quorumof authors to support any view beyond thatit is monophyletic taxa that we are attempt-ing to apprehend.

Our main concerns regard the repeatabilityof systematic analyses and that readers un-derstand that many, if not most, of the anal-yses cited in this section are not rigorouslycomparable. In morphological studies it iscommon practice to report on individualtransformation series and the logic behindtreating these transformations as additive ornonadditive or whether these transformationscan be polarized individually or not. Thismakes these analyses repeatable becauseworkers can duplicate data as well as ana-lytical conditions.

DNA sequence studies, however, havetended not to provide the information nec-essary for independent workers to repeatanalyses, regardless of the accessibility of theoriginal sequence data. In most cases, au-thors align their sequences manually (whichis necessarily idiosyncratic and nonrepeata-ble, even if one uses models of secondarystructure to help). In cases where alignmentis done under algorithmic control, it is com-mon to not cite the indel, transversion, andtransition costs that went into the alignment,rendering these alignments unrepeatable.Also, many authors ‘‘correct’’ alignments byeye without explaining what this means orwhat these corrections were, further remov-ing alignment from the sphere of repeatabil-


ity. (This ‘‘correction’’ almost always meansthat the trees become longer.)

Of concern, at least for the AMNH au-thors, is that the assumptions of alignmentmay not be consistent with the assumptionsof analysis. For instance, an author may havealigned sequences using one transversion:transition cost ratio but subsequently ana-lyzed those data under an evolutionary mod-el that makes entirely different assumptionsabout these relative costs. If the alignmentmethod is not adequately specified, as iscommon in published works (e.g., Pauly etal., 2004), one is at a loss to know what com-ponent of the ultimate tree structure is due tothe assumptions of alignment or to the as-sumptions of analysis. To illuminate the un-derlying incomparability of many molecularstudies, we have provided in the relevant fig-ure legends, and where this information canbe gleaned from the publication, the align-ment costs and whether the sequence was ex-cluded for being ‘‘unalignable’’ (generallymeaning that the authors did not like thenumber of gaps required to align the se-quences), the amount of sequence and fromwhat genes, and the kind of analysis (parsi-mony, Bayesian, or maximum-likelihood),and, if some general model of nucleotideevolution was assumed, what that modelwas. Because we are alarmed by the lack ofexplicitness in the literature regarding under-lying assumptions, we urge editors to requirethat these pieces of information to be includ-ed in any works that pass over their desks.Having provided this preface to our reviewof current taxonomy as a caveat for readers,we now embark on a peregrination throughthe evidentiary basis of current amphibiantaxonomy.

AMPHIBIA

For the purposes of this paper, we are con-cerned with amphibians not as the fictional‘‘transitional’’ group from fishes to amniotes,but as the taxon enclosing the extant crownclades Gymnophiona (caecilians), Caudata(salamanders), and Anura (frogs), togetherforming Lissamphibia of Gadow (1901) andmost recent authors (e.g., Milner, 1988, 1993,1994; Ruta et al., 2003; Schoch and Milner,2004) or Amphibia in the restricted sense of

being the smallest taxon enclosing the livingcrown groups (cf. de Blainville, 1816; Gray,1825; de Queiroz and Gauthier, 1992; Can-natella and Hillis, 1993, 2004). We concurwith authors who restrict application of thename Amphibia to the living crown groups,so for this study we use the terms ‘‘Amphib-ia’’ and ‘‘Lissamphibia’’ interchangeably.

Testing lissamphibian monophyly and therelationships among the three crown groupsof amphibians was and continues to bedaunting because morphologically the groupsare mutually very divergent and temporallydistant from each other and from nonamphi-bian relatives. Furthermore, testing lissam-phibian monophyly may be outside the abil-ity of this study to address inasmuch as themajor controversy has to do with the phylo-genetic structure of various fossil groups.Most authors regard Lissamphibia as a taxonimbedded in Temnospondyli (e.g., Estes,1965; Trueb and Cloutier, 1991; Lombardand Sumida, 1992) whereas others regardfrogs to be temnospondyls and salamandersand caecilians to be lepospondyls (Carrolland Currie, 1975; Carroll et al., 1999; Car-roll, 2000a; J.S. Anderson, 2001). Laurin(1998a, 1998b, 1998c) regarded Lissamphi-bia to be completely within Lepospondyli,but more recent work (e.g., Ruta et al., 2003)returned a monophyletic Lissamphibia to thetemnospondyls. (See Lebedkina, 2004, andSchoch and Milner, 2004, for extensive re-views of the alternative views of phylogenyof modern amphibian groups.) Because noneof these paleontological studies adequatelyaddressed living diversity, we hope that fu-ture work will integrate data presented herewith fossil taxa as part of the resolution ofthe problem.

Regardless of the consideration of fossiltaxa, the choice of Recent outgroups foranalysis is clearly based on knowledge of therelationships of major tetrapod groups. Acoelacanth (Latimeria) represents a near-rel-ative of tetrapods, and among tetrapods, sev-eral amniotes (Mammalia: Didelphis and Ga-zella; Testudines: Pelomedusa and Chelydra;Diapsida: Iguana and Alligator) represent thenearest living relatives of amphibians. Al-though our choice of outgroups is made spe-cifically to root the ingroup tree, our choiceof terminals will allow weak tests of the var-


Fig. 2. Four phylogenetic hypotheses of tet-rapod relationships. A, Gauthier et al. (1988a,1988b); B, Rieppel and de Braga (1996); C, Zar-doya and Meyer (1998); D, Hedges and Poling(1999).

Fig. 3. Currently accepted view of relation-ships among caecilian families based on Nuss-baum and Wilkinson (1989), Hedges and Maxson(1993), M. Wilkinson and Nussbaum (1996),Gower et al. (2002), and M. Wilkinson et al.(2002). Quotation marks denote nonmonophyletictaxa.

ious hypotheses of amniote relationships.The alternative relationships suggested byvarious authors is large, and an extensive dis-cussion of these alternatives is outside thescope of this paper. Nevertheless, we showfour topologies in figure 2. The most populartree of amniote groups among paleontolo-gists is shown in figure 2A and reflects thepreferred topology of Gauthier et al. (1988a,1988b), although some authors suggested,also on the basis of morphological evidence,that turtles are the sister taxon of lepidosaurs,with archosaurs and mammals successivelymore distantly related (Rieppel and de Braga,1996; fig. 2B). This position, however, wasdisputed by M. Wilkinson et al. (1997). Alsorelevant to our study, some recent DNA se-quence studies have found turtles to form thesister taxon of archosaurs (Zardoya and Mey-er, 1998; Iwabe et al., 2005; fig. 2C), andothers found turtles to be the sister taxon ofarchosaurs to the exclusion of lepidosaurs,with mammals outside this group (Hedgesand Poling, 1999; Mannen and Li, 1999; fig.2D). Our data will provide a weak test ofthese alternatives.

Assuming lissamphibian monophyly, therelationships among the three major groupsof living lissamphibians remain controver-sial. On the basis of a parsimony analysis ofmorphological data, Laurin (1998a, 1998b,1998c) suggested that salamanders are para-

phyletic with respect to caecilians (althoughLaurin himself considered this conclusionimplausible). Previously published moleculardata placed salamanders as the sister taxonof either caecilians (Larson, 1991; Feller andHedges, 1998) or frogs (Iordansky, 1996;Zardoya and Meyer, 2000, 2001; San Mauroet al., 2004; Roelants and Bossuyt, 2005; SanMauro et al., 2005). The latter arrangementis most favored by morphologists (e.g., Trueband Cloutier, 1991). Additional tests usingmorphological data of the relative placementof the living lissamphibians will require eval-uation of fossils, such as Albanerpetontidae(McGowan and Evans, 1995; Milner, 2000;Gardner, 2001, 2002) and the putative Me-sozoic and Tertiary caecilians, salamanders,and frogs (Estes, 1981; Jenkins and Walsh,1993; Shubin and Jenkins, 1995; Sanchız,1998; Carroll, 2000a; Gao and Shubin, 2001,2003).

GYMNOPHIONA

Caecilians (6 families, 33 genera, 173 spe-cies) are found almost worldwide in tropicalterrestrial, semiaquatic, and aquatic habitats.A reasonably well-corroborated cladogramexists for at least the major groups of cae-cilians (Nussbaum and Wilkinson, 1989;Hedges and Maxson, 1993; M. Wilkinsonand Nussbaum, 1996, 1999; Gower et al.,2002; M. Wilkinson et al., 2002; fig. 3). Tax-on sampling has not been dense and taxo-nomic assignments are almost certain tochange with the addition of new taxa and ev-


idence. Nevertheless, it appears that mostcaecilian taxa are monophyletic, with the ex-ception of ‘‘Ichthyophiidae’’ with respect toUraeotyphlidae (Gower et al., 2002) and‘‘Caeciliidae’’, which includes most of thediversity (93 species; 54% of all caecilians)and which is paraphyletic with respect to Ty-phlonectidae (M.H. Wake, 1977; M. Wilkin-son, 1991) and possibly with respect to Sco-lecomorphidae (M.H. Wake, 1993; M. Wil-kinson et al., 2003).

The following taxa were sampled:RHINATREMATIDAE (2 GENERA, 9 SPECIES): A

South American group, Rhinatrematidae ishypothesized to be the sister taxon of re-maining caecilians and is clearly composedof the most generally plesiomorphic livingcaecilians (Nussbaum, 1977, 1979; Duellmanand Trueb, 1986; San Mauro et al., 2004).They retain a tail (a plesiomorphy) but sharethe putatively derived characters of highnumbers of secondary annuli, having an osbasale, and lacking the fourth ceratobranchi-al. We sampled one species each of the twonominal genera (Rhinatrema bivittatum andEpicrionops sp.) to optimize characters forthe family appropriately and to test themonophyly of this group.

ICHTHYOPHIIDAE (2 GENERA, 39 SPECIES)AND URAEOTYPHLIDAE (1 GENUS, 5 SPECIES):Tropical Asian Ichthyophiidae was hypothe-sized to form the sister taxon of Uraeotyph-lidae (M. Wilkinson and Nussbaum, 1996;San Mauro et al., 2004), or to include Uraeo-typhlidae (cf. Gower et al., 2002), or, cur-rently less corroborated, to be the sister taxonof Uraeotyphlidae plus stegokrotaphic cae-cilians (i.e., ‘‘Caeciliidae’’ 1 Scolecomor-phidae 1 Typhlonectidae; Nussbaum, 1979;Duellman and Trueb, 1986). The morpholog-ical diagnosis of Ichthyophiidae is contingenton whether Uraeotyphlus is within or outsideof Ichthyophiidae, but the presence of an-gulate annuli anteriorly in ichthyophiids re-mains an apomorphy among these phyloge-netic hypotheses. We have sampled onestriped Ichthyophis (Ichthyophis sp.) that isnot suspected to be close to Uraeotyphlusand one unstriped Ichthyophis (I. cf. penin-sularis), which we suspect (M. Wilkinsonand D.J. Gower, unpubl. data) to be phylo-genetically close to Uraeotyphlus. Monophy-ly of the endemic and monotypic Indian

group Uraeotyphlidae is supported by themorphological character of the tentacle beingpositioned below the naris. Our sole sampleof this taxon is Uraeotyphlus narayani.

SCOLECOMORPHIDAE (2 GENERA, 6 SPECIES):The East African Scolecomorphidae wassuggested to form the sister taxon of ‘‘Cae-ciliidae’’ 1 Typhlonectidae (Nussbaum,1979), but because this suggestion was basedon one of the early phylogenetic studies ofcaecilians, the sampling over which this gen-eralization was made was small. Subsequentstudies from mtDNA (M. Wilkinson et al.,2003) and morphology (M.H. Wake, 1993;M. Wilkinson, 1997) suggested that Scole-comorphidae, like Typhlonectidae, is imbed-ded within ‘‘Caeciliidae’’. The monophyly ofScolecomorphidae is well-corroborated bymorphology (Nussbaum, 1979; M. Wilkin-son, 1997). Nevertheless, we sampled mem-bers of each of the two nominal genera (Cro-taphatrema tchabalmbaboensis and Scole-comorphus vittatus), both as a test of scole-comorphid monophyly and to help optimizemolecular characters for the family to the ap-propriate branch4.

TYPHLONECTIDAE (5 GENERA, 14 SPECIES):The South American Typhlonectidae is amorphologically well-corroborated taxon ofsecondarily aquatic caecilians (M.H. Wake,1977; Nussbaum, 1979; M. Wilkinson,1991), clearly derived out of ‘‘Caeciliidae’’.Although there are several nominal genera oftyphlonectids, because of the highly apo-morphic nature and highly corroboratedmonophyly of the taxon we sampled only Ty-phlonectes natans.

‘‘CAECILIIDAE’’ (21 GENERA, 100 SPECIES):

4 A minor but controversial issue is exposed hereamong the coauthors. Throughout the text, ‘‘phyloge-netic tree’’ and ‘‘cladogram’’ are used interchangeably,although there is good reason to consider the latter to bethe operational basis of the former (Platnick, 1977). Arelated issue is that we prefer the nomenclature of trans-formation series containing characters (e.g., Wiley,1981; Grant and Kluge, 2004), rather than the more op-erational terminology of characters containing characterstates. Character transformations happen through timealong lineages (i.e., along branches in the tree, therbyrendering the notion of branch length). We use the term‘‘branch’’ rather than the more operational ‘‘node’’ (aterm from computer science, not biology). In otherwords, we attempt to use evolutionary terms rather thanthe operational equivalents that have enjoyed consider-able usage. Frost bears responsibility for this decision.


This nominal taxon can be diagnosed only inthe sense of being coextensive with the‘‘higher’’ caecilians (Stegokrotaphia of Can-natella and Hillis, 1993) in lacking a tail,having a stegokrotaphic skull, and not beingeither a scolecomorphid or typhlonectid. Wechose taxa from within the pantropical ‘‘Cae-ciliidae’’ that on the basis of previously pub-lished results (M.H. Wake, 1993; M. Wilkin-son et al., 2003) we predicted would illumi-nate the paraphyly of ‘‘Caeciliidae’’ with re-spect to the presumptively derivative groupsTyphlonectidae and Scolecomorphidae. Wesampled: Boulengerula uluguruensis (Afri-ca), Caecilia tentaculata (South America),Dermophis oaxacae (Mexico), Gegeneophisramaswanii (India), Geotrypetes seraphini(Africa), Herpele squalostoma (Africa), Hy-pogeophis rostratus (Seychelles), Schisto-metopum gregorii (Africa), and Siphonopshardyi (South America).

CAUDATA

Salamanders (10 families, 62 genera, 548species) are largely Holarctic and Neotropi-cal and are the best known amphibian group,even though their phylogeny is notoriouslyproblematic because of the confounding ef-fects of paedomorphy on interpreting theirmorphology by (Larson et al., 2003; Wienset al., 2005). Apparently independent pae-domorphic lineages include Cryptobranchi-dae, Proteidae, and Sirenidae, as well as var-ious lineages within Ambystomatidae andSalamandridae. Larson et al. (2003) providedan extensive discussion of salamander sys-tematics, offering detailed discussion of theexisting issues, although much of the sup-porting evidence was not disclosed. Until re-cently, Larson and Dimmick (1993) providedthe received wisdom on salamander relation-ships based on a combined analysis of mor-phology (29 transformation series) and mol-ecules (177 informative sites from rRNA se-quences; fig. 4). The branch associated withinternal fertilization in their tree (all sala-manders excluding Sirenidae, Cryptobran-chidae, and Hynobiidae) is corroborated pri-marily by a number of morphological char-acters that are functionally related to the se-cretion of a spermatophore (Sever, 1990;Sever et al., 1990; Sever, 1991a, 1991b,1992, 1994).

Gao and Shubin (2001) provided a parsi-mony analysis of DNA sequences and mor-phology (including relevant fossils) suggest-ing that Sirenidae is not the sister taxon ofthe remaining salamander families, but thesister taxon of Proteidae (fig. 5). Otherwise,their results were largely congruent withthose of Larson and Dimmick (1993). Theexemplars used for their family-group treewere not provided nor were the distributionof morphological characters sufficiently de-tailed to allow us to include their data. Fur-ther, Larson et al. (2003), on the basis of mo-lecular data alone (the data themselves notpresented or adequately described beyondnoting that they are from nuclear rRNA andmtDNA sequences), suggested the treeshown in figure 6. Larson et al. (2003) alsonoted that phylogenetic analysis of mostmorphological characters, other than thoseassociated with spermatophore production,do not support the monophyly of their Sal-amandroidea (sensu Duellman and Trueb,1986; all salamander families other than Sir-enidae, Hynobiidae, and Cryptobranchidae).Although we address salamander phylogenythrough the application of a large amount ofmolecular data, we did not address the mor-phological data set presented by Larson andDimmick (1993) and Gao and Shubin (2001,2003) because of the lack of correspondencebetween our exemplars and theirs and be-cause this would have required reconciliationof these data with the frog morphology datawe did include, an undertaking that is outsidethe scope of this study.

Most recently, Wiens et al. (2005) provid-ed an analysis that included additional char-acters of morphology and the addition of datafrom RAG-1 DNA sequences (fig. 7). Theseauthors presented results from different ana-lytical approaches (e.g., maximum-likeli-hood, Bayesian, parsimony). We illustrateonly the parsimony analysis of morphology1 molecules, which most closely approxi-mates our own assumption set. A paper bySan Mauro et al. (2005) provided substan-tially similar results using the RAG-1 genealso used by Wiens et al. (2005).

SIRENIDAE (2 GENERA, 4 SPECIES): Sirenidaeis a North American, pervasively paedomor-phic taxon, whose members are obligatelyaquatic and possess large external gills and


Fig. 4. Relationships of salamanders suggested by Larson and Dimmick (1993). Families are notedon right. Typhlonectes and Xenopus were employed as outgroups. Consensus of 40 equally-parsimonioustrees (length 5 460, ci 5 0.59). Data are 32 morphological and 177 molecular (nu rDNA) charactertransformations (from Larson, 1991). The method of DNA alignment was not specified. Gaps wereexcluded as evidence.

lack pelvic girdles and hind limbs as well aseyelids. Only two genera (Siren and Pseu-dobranchus) are recognized. Sirenidae hasbeen considered the sister taxon of the re-maining salamanders by most authors be-cause of its lack of internal fertilization (thisis assumed on the basis of its lacking sper-matophore-producing glands and not on anyobservation regarding its reproductive be-havior) and its primitive jaw closure mech-anism (Larson and Dimmick, 1993). Other

morphological similarities (such as externalgills and reduced maxillae) shared with otherobligate paedomorphs have been more-or-less universally considered by authors to beconvergent. Nevertheless, Gao and Shubin(2001), on the basis of an analysis of livingand fossil taxa, concluded that sirenids arethe sister taxon of proteids (fig. 5). Wiens etal. (2005) suggested, on the basis of a par-simony analysis of DNA sequences and mor-phology, that sirenids are the sister taxon of


Fig. 5. Tree of salamander families from Gaoand Shubin (2001; fossil terminals pruned) basedon a parsimony analysis of nu rRNA sequencedata from Larson and Dimmick (1993) and 60morphological transformation series (length 5402; ci 5 0.549; ri 5 0.537). The sequence align-ment method was not disclosed. Indels (i.e., gaps)were treated as evidence.

Fig. 6. Relationships of salamander familiessuggested by Larson et al. (2003) on the basis ofundisclosed nu rRNA and mtDNA sequence data.

all other salamanders (fig. 7), although theirBayesian analysis placed Sirenidae as the sis-ter taxon of Salamandroidea, with Crypto-branchoidea outside the inclusive group. Weselected representatives of each nominal ge-nus: Siren lacertina, S. intermedia, and Pseu-dobranchus striatus.

HYNOBIIDAE (7 GENERA, 46 SPECIES): TheAsian Hynobiidae and Asian and NorthAmerican Cryptobranchidae are usually con-sidered each others’ closest relatives becausethey share the putatively plesiomorphic con-dition of external fertilization and have them. pubotibialis and m. puboischiotibialisfused to each other (Noble, 1931; Larson etal., 2003; Wiens et al., 2005). Hynobiidshave aquatic larvae and transformed adults,and they retain angular bones in the lowerjaw (presumed plesiomorphies). Morpholog-ical evidence in support of monophyly of thisgroup are septomaxilla absent (also absent inplethodontids and ambystomatids), first hy-pobranchial and first ceratobranchial fused(also in Amphiuma), second ceratobranchialin two elements, and palatal dentition re-placed from the posterior of the vomer (alsoin ambystomatids; Larson and Dimmick,1993). Our selection of hynobiid taxa wasrestricted to Ranodon sibiricus and Batra-chuperus pinchoni. Larson et al. (2003) sug-gested that Onychodactylus, especially, andseveral genera that we could not obtain (e.g.,

Hynobius), are not bounded phylogeneticallyby these taxa, so our analysis will not pro-vide a rigorous test of hynobiid monophyly.

CRYPTOBRANCHIDAE (2 GENERA, 3 SPECIES):Cryptobranchids are a Holarctic group rep-resented by only three species in two genera,Cryptobranchus (eastern North America) andAndrias (eastern temperate Asia). We includ-ed all three species, Cryptobranchus allegan-iensis, Andrias davidianus, and A. japonicus,to test the monophyly of Andrias and opti-mize ‘‘family’’ evidence to the appropriatebranch. The monophyly of Cryptobranchidaeis not seriously in doubt as these giant, ob-ligately paedomorphic salamanders are high-ly apomorphic in many ways, such as inlacking gills or functional lungs, and insteadrespiring across the extensive skin surface.Like Hynobiidae and Sirenidae (presum-ably), cryptobranchids lack internal fertiliza-tion.

PROTEIDAE (2 GENERA, 6 SPECIES): Protei-dae is another obligate paedomorphic per-ennibranch clade considered to be monophy-letic because of its loss of the maxillae (alsovery reduced in sirenids, apparently indepen-dently) and the basilaris complex of inner ear(also lost in sirenids, plethodontids, andsome salamandrids), and because it has othercharacters associated with paedomorphy,such as lacking a m. rectus abdominis (No-ble, 1931). Unlike sirenids, cryptobranchids,


Fig. 7. Relationships of salamanders suggested by Wiens et al. (2005). Families are noted on right.Results reflect a parsimony analysis of 326 character transformations of morphology (221 parsimony-informative), and DNA sequences from nu rRNA (212 bp from Larson, 1991; 147 parsimony-infor-mative) and RAG-1 (1,530 bp; 624 parsimony-informative). Sequence alignment was made using Se-quencher (Gene Codes Corp.). Morphological characters identified as paedomorphic were treated asunknown for adult morphology and in some cases hypothetical terminals were related-species chimaerasof composite molecular and morphological data. Molecular transformations were weighted equally inanalysis. Inferred insertion-deletion events were coded as binary characters separate from the nucleotidesequence characters and indel-required gaps within sequences were coded as missing. The tree wasrooted on Gymnophiona 1 Anura.


and hynobiids, but like other salamanderfamilies, proteids employ internal fertiliza-tion through use of a spermatophore (Noble,1931). In our analysis, we included two spe-cies of Necturus (of North America), N. cf.beyeri and N. maculosus, but were unsuc-cessful in amplifying DNA of the only othergenus, Proteus (which is found only in thewestern Balkans). Nevertheless, Trontelj andGoricki (2003) did study Proteus and pro-vided molecular evidence consistent with themonophyly of Proteidae, and Wiens et al.(2005), also reporting on both Necturus andProteus, subsequently provided strong evi-dence in favor of its monophyly.

RHYACOTRITONIDAE (1 GENUS, 4 SPECIES):Western North American Rhyacotriton wasoriginally placed in its own subfamily withinAmbystomatidae (Tihen, 1958) but wasshown to be distantly related to ambysto-matines by Edwards (1976), Sever (1992),and Larson and Dimmick (1993), who con-sidered it to be a family distinct from Am-bystomatidae. Wiens et al. (2005) consid-ered, on the basis of their parsimony analy-sis, that Rhyacotritonidae is the sister taxonof Amphiumidae 1 Plethodontidae. Goodand Wake (1992) provided the most recentrevision. Rhyacotritonidae retains a reducedypsiloid cartilage and has at least one apo-morphy associated with the glandular struc-ture of the cloaca (Sever, 1992). Inasmuch asthe four species are seemingly very closelyrelated and morphologically very similar, wesampled only Rhyacotriton cascadae, al-though this leaves the taxon’s monophyly un-tested.

AMPHIUMIDAE (1 GENUS, 3 SPECIES): Theamphiumas of eastern North America havereduced limbs and are obligate aquatic pae-domorphs. They have internal fertilizationand a suite of morphological features that areassociated with spermatophore formation andinternal fertilization. Some authors have as-sociated Amphiumidae with Plethodontidae(sharing fused maxillae and reproductive be-havior patterns; e.g., Salthe, 1967; Larsonand Dimmick, 1993) and recent molecularstudies place them here as well (Wiens et al.,2005). The three species are very similar andshare many apomorphies, so we restrictedour sampling to Amphiuma tridactylum.

PLETHODONTIDAE (4 SUBFAMILIES, 27 GEN-

ERA, 374 SPECIES): Plethodontidae includesthe large majority of salamander species,with most being in North America, CentralAmerica, and South America, with Speleo-mantes found in Mediterranean Europe andKarsenia found in the Korean Peninsula(Min et al., 2005). The monophyly of thegroup is not seriously questioned, as itsmembers share a number of morphologicalsynapomorphies such as nasolabial groovesin transformed adults and the absence oflungs (found in other groups as well; Larsonand Dimmick, 1993). Starting in 2004, andwhile this project was in progress, under-standing of the evolution of Plethodontidaemoved into a dynamic state of flux with thepublication of a series of important studiesaddressing substantial amounts of DNA se-quence data and morphology (Chippindale etal., 2004; Mueller et al., 2004; Macey, 2005;Wiens et al., 2005). Before 2004, plethodon-tid phylogeny appeared to be reasonably wellunderstood (D.B. Wake, 1966; D.B. Wakeand Lynch, 1976; J.F. Lynch and Wake,1978; D.B. Wake et al., 1978; Maxson et al.,1979; Larson et al., 1981; Maxson and Wake,1981; Hanken and Wake, 1982; J.F. Lynch etal., 1983; D.B. Wake and Elias, 1983; Lom-bard and Wake, 1986; D.B. Wake, 1993;Jackman et al., 1997; Garcıa-Parıs and Wake,2000; Parra-Olea et al., 2004) with the groupputatively composed of two monophyleticsubfamilies (fig. 8), Desmognathinae andPlethodontinae, although the morphologicalevidence for any suprageneric group otherthan Desmognathinae and Bolitoglossini (atribe in Plethodontinae as then defined) wasequivocal.

Desmognathines (2 genera, 20 species;Desmognathus 1 Phaeognathus) as tradi-tionally understood share nine morphologicalcharacters suggested to be synapomorphies(Schwenk and Wake, 1993; Larson et al.,2003), although at least some of them maybe manifestations of a single transformationhaving to do with the unique method of jawclosure: (1) heavily ossified and strongly ar-ticulated skull and mandible; (2) dorsoven-trally flattened, wedge-like head; (3) modi-fied anterior trunk vertebrae; (4) enlargeddorsal spinal muscles; (5) hindlimbs largerthan forelimbs; (6) stalked occipital con-dyles; (7) enlarged quadratopectoralis mus-


Fig. 8. Composite tree of hypothesized relationships among Plethodontidae as inferred from 1966–2004 literature; subfamilies and tribes noted on the right (D.B. Wake, 1966; D.B. Wake and Lynch,1976; J.F. Lynch and Wake, 1978; D.B. Wake et al., 1978; Maxson et al., 1979; Larson et al., 1981;Maxson and Wake, 1981; Hanken and Wake, 1982; J.F. Lynch et al., 1983; D.B. Wake and Elias, 1983;Lombard and Wake, 1986; D.B. Wake, 1993; Jackman et al., 1997; Garcıa-Parıs and Wake, 2000; andParra-Olea et al., 2004). Quotation marks denote nonmonophyletic taxa.

cles; (8) modified atlas; and (9) presence ofatlantomandibular ligaments. Most specieshave a biphasic life history, but at least somespecies have either nonfeedling larvae or di-rect development (Tilley and Bernardo,1993). Plethodontinae in the pre-2004 sense(fig. 8) did not have strong morphologicalevidence in support of its monophyly, al-though Lombard and Wake (1986) suggestedthat possessing three embryonic or larvalepibranchials is synapomorphic. Within

Plethodontinae were included three nominaltribes: Hemidactyliini, Plethodontini, andBolitoglossini.

Hemidactyliini (5 genera, 33 species) wasthe only putative plethodontine group withfree-living larvae and transformation intoadults (although this is shared with most des-mognathines). Lombard and Wake (1986)suggested that Hemidactylium is the sistertaxon of Stereochilus 1 (Eurycea, Gyrino-philus, and Pseudotriton) but provided only


a single morphological character (parietalwith a distinct ventrolateral shelf) in supportof the monophyly of this group.

Plethodontini (3 genera, 62 species), astraditionally understood, was a heteroge-neous assemblage composed of Plethodon,Aneides, and the more distant Ensatina (1nominal species, but likely containing manyspecies under any meaningful definition ofthat term; see Highton, 1998). Lombard andWake (1986) suggested two morphologicalcharacters in support of the monophyly ofthis group (radii expanded and fused to bas-ibranchial, and presence of a posterior max-illary facial lobe).

As traditionally viewed (before 2004),Bolitoglossini (15 genera, 222 species) rep-resented a highly-speciose group in the NewWorld tropics and west-coastal North Amer-ica, with isolated representation in Mediter-ranean Europe. The group was characterizedby having a projectile tongue, although thisalso appears in other plethodontids.

Lombard and Wake (1986) proposed a(nonparsimonious) scenario in which theysuggested 10 synapomorphies of Bolitoglos-sini, all associated with the structure andfunction of the tongue. They regarded the su-pergenus Hydromantes (Hydromantes 1Speleomantes) to be the sister taxon of thesupergenus Bolitoglossa 1 supergenus Ba-trachoseps (containing solely Batrachoseps)based on two synapomorphies. Elias andWake (1983) discussed phylogeny withinBolitoglossini and suggested the topologyHydromantes [including Speleomantes] 1(Batrachoseps (Nyctanolis 1 other bolito-glossine genera)). Synapomorphies given byElias and Wake (1983) for Bolitoglossini are(1) urohyal lost; (2) radii fused to the basi-branchial; (3) long epibranchials relative tothe ceratobranchials; (4) second ceratobran-chial modified for force transmission; (5)presence of a cylindrical muscle complexaround the tongue; (6) juvenile otic capsuleconfiguration. The synapomophry for Batra-choseps 1 Nyctanolis 1 other bolitoglossinegenera was reduction in number of caudos-acral vertebrae to two. For the supergenusBolitoglossa (Nyctanolis 1 other genera ofbolitoglossines, excluding Batrachoseps andsupergenus Hydromantes), they suggestedthat having the tail base with complex of

breakage specializations was synapomorphicand for the supergenus Bolitoglossa exclud-ing Nyctanolis they suggested that fusedmaxillae was a synapomorphy.

As noted above, in 2004–2005 three stud-ies appeared that transformed our under-standing of plethodontid relationships(Mueller et al., 2004; Chippindale et al.,2004; Macey, 2005). Although there arethree relevant analyses, there are only twodata sets. Mueller et al. (2004; fig. 9) pre-sented a Bayesian analysis of completemtDNA genomes; this data set was reana-lyzed by parsimony and extensively dis-cussed by Macey (2005; fig. 10). Anotherdata set and analysis of combined morphol-ogy and DNA sequence evidence was pro-vided by Chippindale et al. (2004; fig. 11).

All three studies suggested strongly notonly that Plethodontinae (as traditionally un-derstood) is paraphyletic with respect to Des-mognathinae, but that the traditional view ofplethodontid relationships was largely mis-taken, presumably due in part to the specialpleading for particular characters that under-pinned the older system of subfamilies andtribes. Mueller et al. (2004) found that allthree of the traditionally recognized pletho-dontine tribes, Bolitoglossini, Hemidactyli-ini, and Plethodontini, are polyphyletic.Chippindale et al. (2004) found Hemidacty-liini and Plethodontini to be polyphyletic,with Bolitoglossini insufficiently sampled totest its monophyly rigorously. Macey (2005;fig. 10) also rejected the monophyly of Bol-itoglossini and Hemidactyliini, in his reanal-ysis of the data of Mueller et al. (2004).Mueller et al. (2004; fig. 9) placed Hemidac-tylium as the sister taxon of Batrachoseps (abolitoglossine) and the remaining hemidac-tyliines as the sister of a group of bolito-glossines (excluding Hydromantes and Spe-leomantes). Chippindale et al. (2004; fig. 11)considered Hemidactylium to be the sistertaxon of all other bolitoglossines and hemi-dactyliines, and the remaining hemidactyli-ines to form the sister taxon of Hemidacty-lium 1 bolitoglossines (Hydromantes andSpeleomantes not analyzed).

Chippindale et al (2004; fig. 11) provideda new taxonomy, recognizing a newly for-mulated Plethodontinae (including Pletho-dontini and Desmognathinae of the older tax-


Fig. 9. Tree of Plethodontidae by Mueller et al. (2004), with the traditional taxonomic assignments(Desmognathinae 1 tribes of Plethodontinae; Wake, 1966) placed on the right, with taxonomic fragmentsnumbered for clarity. The generic taxonomy was updated to reflect name changes of former Salamandraluschani to Lyciasalamandera (Veith and Steinfartz, 2004) and Hydromantes italicus to Speleomantes.The results reflect a Bayesian analysis of entire mt DNA genomes (number of informative sites notstated, but analyzed fragments totalled 14,040 bp), with control region and ambiguously alignable regionexcluded. Sequences were aligned with default costs of GCG v. 10.3 (Accelrys, San Diego; cost of 8for gap creation and extension cost of 2) and subsequently adjusted manually. It was not stated whethergaps were treated as evidence or as missing data.

onomy). The sister taxon of Plethodontinaewas not named in their taxonomy, the com-ponent parts being named Hemidactyliinae(for Hemidactylium alone), Spelerpinae (forthe remainder of the old Hemidactyliini), andBolitoglossinae (identical in content to theold Bolitoglossini, these authors not havingstudied Hydromantes sensu lato). Mueller etal. (2004), followed by Macey (2005),showed that Hydromantes (in the sense ofincluding Speleomantes) is not imbedded inBolitoglossini, as previously supposed, but isimbedded in Plethodontinae. Macey (2005)arrived at the same taxonomy as Chippindaleet al. (2004), although Macey (2005) placed

Hemidactylium (Hemidactyliinae) as the sis-ter taxon of the remaining plethodontids.

Clearly, the analyses of mtDNA-sequencedata by Mueller et al. (2004) and Macey(2005) and of nuDNA, mtDNA, and mor-phology by Chippindale et al. (2004) 5 are

5 The Bayesian analysis of plethodontid relationshipspresented by Min et al. (2005) was based on a subset ofthe data provided by Chippindale et al. (2004) andWiens et al. (2005), with the addition of sequences ofKarsenia koreana and Hydromantes brunus. Becausethat analysis rests on a smaller amount of data than theearlier studies and was performed solely to place thenewly-discovered Karsenia (as the sister taxon of Anei-des 1 desmognathines), we restrict our comments aboutthis paper to the placement of Karsenia.


Fig. 10. Parsimony tree of Plethodontidae by Macey (2005), a reanalysis of entire mt DNA genomesequence data provided by Mueller et al. (2004). On right are the traditional taxonomy and Macey’srevised subfamilial taxonomy, which is substantially identical to that suggested by Chippindale et al.(2004; fig. 11). The generic taxonomy is updated to reflect name changes of former Salamandra luschani(Veith and Steinfartz, 2004) and Hydromantes italicus.

strongly discordant with previous (and morelimited) morphological and molecular re-sults. Because of the timing of the appear-ance of these papers, our selection of taxawas chosen to address the older, more tradi-tional view but may provide a weak test ofthe new view of plethodontid phylogeny andtaxonomy.

We included in our analysis Hemidacty-lium scutatum (Hemidactyliinae) as well asthe more ‘‘typical’’ hemidactyliines (Speler-

pinae of Chippindale et al., 2004, and Macey,2005): Eurycea wilderae and Gyrinophilusporphyriticus.

Of the new Plethodontinae (composed offormer Desmognathinae, Plethodontini, andsupergenus Hydromantes of Bolitoglossini)we sampled broadly. We included one spe-cies of western Plethodon, P. dunni, and onespecies of eastern Plethodon, P. jordani. Wealso included Aneides hardii and Ensatinaeschscholtzii. Mueller et al. (2004), based on


Fig. 11. Tree of Plethodontidae suggested by Chippindale et al. (2004) based on parsimony analysisof 104 transformation series of morphology and 1,493 informative sites of nu DNA (RAG-1) and mtDNA (cytochrome c and ND4a). On the right (left to right) are the old taxonomy of plethodontids andthe taxonomy recommended by Chippindale et al. (2004). Sequences were aligned manually with onlysingle-codon indels; gaps were considered missing data in the analysis.

analysis of mtDNA, rejected the monophylyof Plethodontini, placing Ensatina as the sis-ter taxon of desmognathines. (In a parsimonyanalysis of the same data, Macey, 2005,placed Ensatina as the sister taxon of Hydro-mantes.) The monophyly of Plethodon, inparticular, is controversial, with some authors(e.g., Larson et al., 1981; Mahoney, 2001)finding the western species to be closer toAneides to the exclusion of eastern species,and others (e.g., Chippindale et al., 2004;Mueller et al., 2004; Macey, 2005) finding

Plethodon and Aneides to be rather distantlyrelated. We bracketed the diversity (Titus andLarson, 1996) of desmognathines (the pre-2004 Desmognathinae) by sampling Phaeog-nathus hubrichti, Desmognathus quadrama-culatus, and D. wrighti. Of the supergenusHydromantes, formerly in Bolitoglossini, wesampled Hydromantes platycephalus andSpeleomantes italicus.

Of Bolitoglossinae we sampled 11 of the14 nominal genera: supergenus Batrachoseps(B. attenuatus and B. wrightorum), and su-


Fig. 12. Salamandrid relationships suggested by Titus and Larson (1995) based on a parsimonyanalysis of 44 morphological character transformations and 431 informative sites of ca. 1.8 kb of the12S and 16S mt rRNA and tRNAVal fragments of mtDNA. Sequence alignment was done using MALIGN(W.C. Wheeler and Gladstein, 1992) with equal weighting of transversions and transitions and a gappenalty cost of 6. Sequence data and morphology in parsimony analysis had equal costs and gaps weretreated as evidence. The tree was rooted on Eurycea 1 Phaeognathus; tree length 5 2,081. Genericnames are updated to reflect the naming of Lyciasalamandra (Veith and Steinfartz, 2004) and thepartition of Triturus into Mesotriton, Lissotriton (not studied by Titus and Larson, 1995), and Triturus(Garcıa-Parıs et al., 2004b).

pergenus Bolitoglossa (Bolitoglossa rufes-cens, Cryptotriton alvarezdeltoroi, Dendrotri-ton rabbi, Ixalotriton niger, Lineatriton lineo-lus, Nototriton abscondens, Oedipina unifor-mis, Parvimolge townsendi, Pseudoeuryceaconanti, and Thorius sp.).

SALAMANDRIDAE (18 GENERA, 73 SPECIES):Salamandridae is found more-or-lessthroughout the Holarctic, with the bulk of itsphylogenetic and species diversity in tem-perate Eurasia. Salamandrids are character-ized by strongly keratinized skin in adults(except for the strongly aquatic Pachytriton),

in addition to two cranial characters (pres-ence of a frontosquamosal arch and fusion ofthe premaxillaries [reversed in Pleurodeles 1Tylototriton, and Chioglossa]).

Titus and Larson (1995) provided a phy-logenetic tree on the basis of a study of mtrRNA and morphology data (fig. 12). Scholz(1995; fig. 13) obtained similar results on thebasis of morphology and courtship behavior.Zacj and Arntzen (1999) also reported onphylogenetics of Triturus, showing (as didTitus and Larson, 1995) that it is composedof two groups: (1) Triturus vulgaris 1 Tri-


Fig. 13. Consensus of salamandrid relation-ships suggested by Scholz (1995) based on a par-simony analysis of 27 character transformationsof morphology and behavior. Triturus in Scholz’ssense included what is now Lissotriton, Mesotri-ton, and Triturus (Garcıa-Parıs et al., 2004b).

turus marmoratus species groups; (2) andTriturus cristatus group, but not addressingits polyphyly. Steinfartz et al. (2002) report-ed on salamandrid phylogeny and substanti-ated the polyphyly of Triturus and of Mer-tensiella. Subsequently (and appearing afterthis analysis was completed), Garcıa-Parıs etal. (2004b) partitioned the polyphyletic ‘‘Tri-turus’’ into three genera (Triturus, Lissotri-ton, and Mesotriton), based on the sugges-tions that (1) Triturus, sensu stricto (Trituruscristatus 1 T. marmoratus species groups) ismost closely related to Euproctus; (2) Me-sotriton (Triturus alpestris) is the sister taxonof a group composed of Cynops, Parame-sotriton, and Pachytriton); and (3) Lissotri-ton (Triturus vulgaris species group) is ofuncertain relationship to the other compo-nents, but does not form a monophyleticgroup with either Mesotriton or Triturus.Garcıa-Parıs et al. (2004a: 602) also sug-gested that ongoing molecular work (evi-dence undisclosed), will show Euproctus tobe paraphyletic and that Triturus vittatus willnot be included within Triturus, the oldestavailable name for this taxon being Omma-totriton Gray, 1850.

We could not address these final issues,these appearing well after the manuscript was

written, but we chose taxa that should allowthe basic structure of salamandrid phylogenyto be elucidated. To bracket this suggestedtopology with appropriate taxonomic sam-ples we chose Euproctus asper, Neurerguscrocatus, Notophthalmus viridescens, Pach-ytriton brevipes, Paramesotriton sp., Pleu-rodeles waltl, Salamandra salamandra, Tar-icha sp., Triturus cristatus, and Tylototritonshanjing.

DICAMPTODONTIDAE (1 GENUS, 4 SPECIES):The North American Dicamptodon is relatedto Ambystomatidae (Larson and Dimmick,1993; fig. 4) and, like them, some popula-tions are neotenic (Nussbaum, 1976). Likeother salamandroid salamanders they haveinternal fertilization and a suite of morpho-logical features associated with forming andcollecting spermatophores. Dicamptodon dif-fers from Ambystomatidae in glandular fea-tures of the cloaca and in attaining a largesize, but is considered by most workers asthe sister taxon of Ambystomatidae (e.g.,Larson et al., 2003—fig. 6; Wiens et al.,2005—fig. 7). We sampled both Dicampto-don aterrimus and D. tenebrosus.

AMBYSTOMATIDAE (1 GENUS, 31 SPECIES):North American Ambystomatidae is a mor-phologically compact family having internalfertilization via a spermatophore and thesuite of morphological characters that sup-port this attribute. Some populations exhibitneotenic aquatic adults.

The last summary of phylogeny within thegroup based on explicit evidence was pre-sented by Shaffer et al. (1991; see also Lar-son et al., 2003), who provided a cladogrambased on 32 morphological transformationseries and 26 allozymic transformation se-ries. The basal dichotomy in this tree is be-tween Ambystoma gracile 1 A. maculatum1 A. talpoideum on one hand, and all otherspecies of Ambystoma, on the other. We wereunable to obtain any of these three species,but we did sample Ambystoma cingulatum,A. mexicanum and A. tigrinum. Ambystomamexicanum and A. tigrinum are very closelyrelated, and A. cingulatum is distantly relatedto them. This is a weaker test of monophylythan we would have liked because it does notinclude A. gracile, A. maculatum, or A. tal-poideum. Further, Larson et al. (2003) sug-gested that, in addition to A. gracile, A. ma-


culatum, and A. talpoideum, A. jeffersonian-um, A. laterale, A. macrodactylum, and A.opacum were likely to be outside of the taxabracketed by our species, although the evi-dence for this was not presented.

ANURA

Frogs (32 families, ca. 372 genera, 5227species) constitute the vast majority (88%) ofliving species of amphibians and the bulk oftheir genetic, physiological, ecological, andmorphological diversity. Despite numerousstudies that point towards its deficiencies(e.g. Kluge and Farris, 1969; Lynch, 1973;Sokol, 1975, 1977; Duellman and Trueb,1986; Ruvinsky and Maxson, 1996; Maglia,1998; Emerson et al., 2000; Maglia et al.,2001; Scheltinga et al., 2002; Haas, 2003;Roelants and Bossuyt, 2005; San Mauro etal., 2005; Van der Meijden et al., 2005), thecurrent classification continues in many of itsparts to reflect sociological conservatism andthe traditional preoccupation with groupingsby subjective impressions of overall similar-ity; special pleading for characters consid-ered to be of transcendent importance; andnotions of ‘‘primitive’’, ‘‘transitional’’, and‘‘advanced’’ groups instead of evolutionarypropinquity. Understanding of frog relation-ships remains largely a tapestry of conflictingopinion, isolated lines of evidence, unsub-stantiated assertion, and unresolved paraphy-ly and polyphyly. Indeed, the current taxon-omy of frogs is based on a relatively smallsampling of species and in many cases theputative morphological characteristics of ma-jor clades within Anura are overly-general-ized, overly-interpreted, and reified throughgenerations of literature reviews (e.g., Fordand Cannatella, 1993), of which this reviewis presumably guilty as well. This generallack of detailed understanding of anuran re-lationships has been exacerbated by the ex-plosive discovery of new species in the past20 years.

Currently, the most widely cited review offrog phylogeny is Ford and Cannatella(1993; fig. 14), which provided a narrativediscussion of the evidence for a novel viewof frog phylogeny without providing all ofthe underlying data from which this discus-sion was largely derived. The result was that

the extent of character conflict within theirdata set was never adequately exposed. Morerecently, Haas (2003; fig. 15) provided a dis-cussion of frog evolution, based primarily onnew larval characters. Haas did, however, ex-clude several of the adult characters includedby Ford and Cannatella (1993) as insuffi-ciently characterized or assayed. More re-cently, important discussions of phylogenyhave been made in the context of DNA se-quence studies (Roelants and Bossuyt,2005—fig. 16; San Mauro et al., 2005—fig.17) that will be cited throughout our review.

The monophyly of frogs (Anura) relativeto other living amphibians has not been gen-erally questioned6 (although the universalityof this taxon with respect to some fossil an-tecedent taxa has (e.g., Griffiths, 1963; Ro-cek, 1989, 1990), and the number of mor-phological characters corroborating thismonophyly is large—e.g., (1) reduction ofvertebrae to 9 or fewer; (2) atlas with a singlecentrum; (3) hindlimbs significantly longerthan forelimbs, including elongation of anklebones; (4) fusions of radius and ulna and tib-ia and fibula; (5) fusion of caudal vertebralsegments into a urostyle; (6) fusion of hyob-ranchial elements into a hyoid plate; (7) pres-ence of keratinous jaw sheaths and kerato-donts on larval mouthparts; (8) a single me-dian spiracle in the larva, a characteristic ofthe Type III tadpole (consideration of this asa synapomorphy being highly contingent onthe preferred overall cladogram); (9) skinwith large subcutaneous lymph spaces; and(10) two m. protractor lentis attached to lens,based on very narrow taxon sampling (Saint-Aubain, 1981; Ford and Cannatella, 1993).

Haas (2003) suggested (fig. 15) an addi-tional 20 synapomorphies from larval mor-phology: (1) paired venae caudalis lateralisshort; (2) operculum fused to abdominalwall; (3) m. geniohyoideus origin from cer-atobranchials I–II; (4) m. interhyoideus pos-terior absent; (5) larval jaw depressors orig-inate from palatoquadrate; (6) ramus maxil-laris (cranial nerve V2) medial to the m. le-

6 Rocek and Vesely (1989) suggested a diphyletic or-igin of Anura based on a hypothesized nonhomologybetween the rostral plate of pipoid larvae and the cornuatrabeculae of other anuran larvae. The developmentalhomology of these structures was later established (Ols-son and Hanken, 1996; de Sa and Swart, 1999).


Fig. 14. Narrative tree of relevant anuran taxa by Ford and Cannatella (1993). A branch subtendingHylidae 1 Pseudidae in the original figure is collapsed per errata distributed with reprint. An asteriskwas used by these authors to denote a metataxon, and quotation marks to denote nonmonophyly.

vator manidbulae longus; (7) ramusmandibularis (cranial nerve V3) anterior (dor-sal) to the m. levator mandibulae longus; (8)ramus mandibularis (cranial nerve V3) ante-rior (dorsal) to the externus group; (9) car-tilago labialis superior (suprarostral cartilage)present; (10) two perilymphatic foramina;(11) hypobrachial skeletal parts as planum

hypobranchiale; (12) processus urobranchial-is short, not reaching beyond the hypobran-chial plates; (13) commisura proximalis Ipresent; (14) commisura proximalis II pre-sent; (15) commisura proximalis III present;(16) ceratohyal with diarthrotic articulationpresent, medial part broad; (17) cleft betweenhyal arch and branchial arch I closed; (18)



←

Fig. 15. Anuran relationships suggested by Haas (2003). Consensus of 144 equally parsimonioustrees discovered by parsimony analysis of 151 character-transformation series (excluding his morpho-metric characters 12, 83, 116, and 117, as well as 102) of larval and adult morphology and reproductivemode (ci 5 0.31; ri 0.77). Taxonomy is updated to reflect subsequent publications.

ligamentum cornuquadratum present; (19)ventral valvular velum present; (20) branchi-al food traps present. Haas also suggestedthat the following were synapomorphies notmentioned as such by Ford and Cannatella(1993): (1) amplexus inguinal; (2) verticalpupil shape; (3) clavicle overlapping scapulaanteriorly; and (4) cricoid cartilage as aclosed ring.

‘‘PRIMITIVE’’ FROGS

We first address the groups that are some-times referred to collectively as Archaeoba-trachia (Duellman, 1975) and traditionallyare considered ‘‘primitive’’, even though thecomponent taxa have their own apomorphiesand the preponderance of evidence suggestsstrongly that they do not form a monophy-letic group (Roelants and Bossuyt, 2005; SanMauro et al., 2005).

ASCAPHIDAE (1 GENUS, 2 SPECIES): Ford andCannatella (1993) considered North Ameri-can Ascaphus (Ascaphidae) to be the sistertaxon of all other frogs (fig. 14), although onthe basis of allozyme study by Green et al.(1989) and, more recently, Roelants et al.(2005; fig. 16) and San Mauro et al. (2005;fig. 17), on the basis of evidence from DNAsequences, suggested that Ascaphidae 1Leiopelmatidae forms a monophyletic group.Baez and Basso (1996) presented a phylo-genetic analysis designed to explore the re-lationships of the fossil anurans Vieraellaand Notobatrachus with the extant taxa As-caphus, Leiopelma, Bombina, Alytes, andDiscoglossus. Despite their restricted taxonsampling, their results also support themonophyly of Ascaphus 1 Leiopelma, al-though the authors considered their evidenceweak for reasons of difficulty in evaluatingcharacters.

Green and Cannatella (1993) did not finda monophyletic Ascaphus 1 Leiopelma. As-caphus and Leiopelma share the presence ofa m. caudalipuboischiotibialis and nine pre-

sacral vertebrae (Ford and Cannatella, 1993),both considered plesiomorphic within Anu-ra7. Ascaphus has an intromittant organ (apo-morphic) in males and a highly modified tor-rent-dwelling tadpole. The vertebrae are am-phicoelous and ectochordal (Nicholls, 1916;Laurent, 1986), presumably plesiomorphic atthis level of generality. Our sampled speciesfor this taxon is Ascaphus truei, one of thetwo closely-related species.

LEIOPELMATIDAE (1 GENUS, 4 SPECIES): Iso-lated in New Zealand, Leiopelmatidae, likeAscaphidae, is a generally very plesiomorph-ic group of frogs. Nevertheless, it possessesapomorphies, such as ventral inscription ribs,found nowhere else among frogs (Noble,1931; Laurent, 1986; Ford and Cannatella,1993). Unlike Ascaphus, Leiopelma does nothave feeding larvae (Archey, 1922; Altig andMcDiarmid, 1999; Bell and Wassersug,2003). As in Ascaphidae, the vertebrae areamphicoelous and ectochordal with a persis-tent notochord (Noble, 1924; Ritland, 1955)and both vocal sacs and vocalization are ab-sent (Noble and Putnam, 1931).

Ford and Cannatella (1993) suggested thatLeiopelmatidae is the nearest relative of allother frogs (excluding Ascaphidae) and listedfive synapomorphies in support of thisgrouping (their Leiopelmatanura): (1) elon-gate arms on the sternum; (2) loss of the as-cending process of the palatoquadrate; (3)sphenethmoid ossifying in the anterior posi-tion; (4) exit of the root of the facial nervefrom the braincase through the facial fora-men, anterior to the auditory capsule, ratherthan via the anterior acoustic foramen intothe auditory capsule; (5) palatoquadrate ar-

7 Ritland (1955) suggested the possibility that the m.caudalipuboischiotibialis is not homologous with thetail-wagging muscles of salamanders but instead, an ac-cessory coccygeal head of the m. semimembranosus. Inthat case, the character would be judged to be a syna-pomorphy of Ascaphus 1 Leiopelma, rather than a sym-plesiomorphy shared by those taxa.


Fig. 16. Tree of amphibians provided by Roelants and Bossuyt (2005). This tree reflects a maximum-likelihood analysis of 3,963 aligned positions (2,022 variable and 1,788 parsimony-informative) of threeprotein-coding nuDNA genes (ca. 555 bp of RAG-1, ca. 675 bp of CXCR-4, ca. 1280 bp of NCX-1)and ca. 1940 bp of the mitochondrial genome (part of 16S and tRNAMet, and all of tRNALeu, tRNAIle,ND-1, and tRNAGln). Alignment was done initially using ClustalX (Thompson et al., 1997; presumablyapplying default cost functions) followed by a probabilistic method implemented in the programProAlign (Loytynoja and Milinkovitch, 2003) and, in the case of 16S and tRNA seqments, subsequentlymodified manually, guided by models of secondary structure for Xenopus. Gaps were treated as missingdata and ambiguously aligned sequences were excluded. The model of evolution assumed was GTR 1G 1 I.


Fig. 17. Tree of amphibians provided by San Mauro et al. (2005). This tree reflects a maximum-likelihood analysis of 1,368 bp of the nuclear protein-coding gene RAG-1, assuming the GTR 1 G 1I substitution model (as suggested by ModelTest v. 3.6; Posada and Crandall, 1998). Sequence alignmentwas made manually with only one gap excluded from analysis.

ticulates with the braincase via a pseudobasalprocess rather than a basal process.

Characters 4 (facial nerve exit) and 5 (pal-atoquadrate articulation) are polarized with

respect to salamanders; the other three char-acters were likely polarized on the assump-tion that Ascaphus is plesiomorphic and thesister taxon of remaining frogs, thereby pre-


supposing the results, although this was notstated. With respect to character 1 (the tri-radiate sternum), the parsimony cost of thistransformation on the overall tree is identicalif Ascaphidae and Leiopelmatidae are sistertaxa and Bombinatoridae and Discoglossidaeare sister taxa. The remaining characters, 2and 3, were not discussed with respect to out-groups or reversals in the remainder of Fordand Cannatella’s tree, implying that they areunreversed and unique.

With Ascaphus, Leiopelma shares the apo-morphy of columella not present (N.G. Ste-phenson, 1951). Haas (2003) did not includeLeiopelma in his analysis of exotrophic lar-val morphology because of their endotrophy.We included in our analysis Leiopelma ar-cheyi and L. hochstetteri, which bracket thephylogenetic diversity of Leiopelmatidae(E.M. Stephenson et al., 1974), although it isnot sufficient to test hypotheses of the evo-lution of direct development (exoviviparityin this case; Thibaudeau and Altig, 1999)within Leiopelma.

DISCOGLOSSIDAE8 (2 GENERA, 12 SPECIES)AND BOMBINATORIDAE (2 GENERA, 10 SPECIES):Ford and Cannatella (1993; fig. 14) suggest-ed that Bombina 1 Barbourula forms the sis-ter taxon of all other frogs, exclusive of Leio-pelmatidae and Ascaphidae, although recentmolecular evidence (Roelants and Bossuyt,2005; fig. 16) placed Bombinatoridae andDiscoglossidae in the familiar position of sis-ter taxa.

Ford and Cannatella’s (1993) arrangement(fig. 14; i.e., paraphyly of Bombinatoridae 1Discoglossidae) required a partition of thetraditionally recognized Discoglossidae (sen-su lato) to place Bombina and Barbourula intheir own family, Bombinatoridae. In theirsystem, Bombinatoridae 1 its sister taxon(all frogs excluding Leiopelmatidae and As-caphidae) was named Bombianura. Bombi-anura is corroborated by four synapomor-phies: (1) fusion of the halves of the sphe-nethmoid; (2) reduction to eight presacralvertebrae; (3) loss of the m. epipubicus (re-gained in Xenopus); and (4) loss of the m.

8 Sanchız (1998) and Dubois (2005) noted that thename with priority for this taxon is Alytidae. However,to reflect the relevant literature we retain the name Dis-coglossidae in this section.

caudalipuboischiotibialis. In addition,Abourachid and Green (1999) noted that al-though Leiopelma and Ascaphus do hop,they swim with alternating sweeps of thehind legs (the presumably plesiomorphiccondition), unlike those in Bombianura,which swim with coordinated thrusts of thehind limbs, a likely synapomorphy.

Bombinatoridae was considered (Ford andCannatella, 1993) to have as synapomorphies(1) expanded flange of the quadratojugal, and(2) presence of endochondral ossifications inthe hyoid plate (both unreversed). We sam-pled four species of Bombina: B. bombina,B. microdeladigitora, B. orientalis, and B.variegata. The genus may be monophyletic,but no rigorous phylogenetic study has beenperformed so far, and paraphyly of Bombinawith respect to Barbourula remains an openquestion. We could not obtain tissues of Bar-bourula so its phylogenetic position will re-main questionable. Bombina has aquaticfeeding tadpoles, but larvae of Barbourulaare unknown and are suspected to be endo-trophic (Altig and McDiarmid, 1999). Dis-coglossidae (sensu stricto) also has free-liv-ing aquatic tadpoles (Boulenger, 1892‘‘1891’’; Altig and McDiarmid, 1999).

Ford and Cannatella (1993; fig. 14) alsoposited a taxon, Discoglossanura, composedof Discoglossidae (sensu stricto) and the re-maining frogs (exclusive of Ascaphidae,Leiopelmatidae, and Bombinatoridae) whichthey suggested to be monophyletic on the ba-sis of two synapomorphies: (1) bicondylarsacrococcygeal articulation; and (2) epister-num present. Monophyly of Discoglossidae(sensu stricto) was supported by their pos-session of (1) V-shaped parahyoid bones(also in Pelodytes) and (2) a narrow epipubiccartilage plate.

Haas (2003; fig. 15) presented a cladogramthat is both deeply at variance with the re-lationships suggested by Ford and Cannatella(1993) and, at least with respect to this partof their cladogram, consistent with the mo-lecular evidence presented by Roelants andBossuyt (2005; fig. 16). Haas (2003) pre-sented six morphological synapomorphies ofDiscoglossidae 1 Bombinatoridae (as Dis-coglossidae, sensu lato) and rejected Discog-lossidae (sensu Ford and Cannatella) as par-aphyletic, placing Alytes as the sister taxon


of the remaining members of Discoglossidae1 Bombinatoridae. Synapomorphies ofHaas’ Discoglossidae are: (1) origin of m.intermandibularis restricted to the medialface of the cartilago meckelii; (2) larval m.levator mandibulae externus present as twobundles (profundus and superficialis); (3)posterior processes of pars alaris double; (4)cartilaginous roofing of the cavum craniipresent only as taenia traversalis; (5) verte-bral centra formation epichordal; and (6) pro-cessus urobranchialis absent. Synapomor-phies suggested by Haas (2003; fig. 15) forDiscoglossidae, excluding Alytes are (1) epi-dermal melanocytes forming an orthogonalpattern; (2) advertisement call inspiratory;and (3) pupil an inverted drop-shape (trian-gular). Of Discoglossidae (sensu stricto), wesampled one species of Alytes (A. obstetri-cans) and two species of Discoglossus (D.galganoi and D. pictus). Discoglossidae andBombinatoridae show opisthocoelous andepichordal vertebrae according to Mookerjee(1931), Griffiths (1963), and Haas (2003).Kluge and Farris (1969: 23) suggested thatvertebral development in Discoglossus pictusis perichordal, although Haas (2003) reportedit as epichordal.

Roelants and Bossuyt (2005; fig. 16) and,with denser taxon sampling, San Mauro etal. (2005; fig. 17) provided substantialamounts of DNA evidence suggestingstrongly that Bombinatoridae 1 Discoglos-sidae forms a monophyletic group, therebyrejecting Discoglossanura, Leiopelmatanura,and Bombianura of Ford and Cannatella(1993).

‘‘TRANSITIONAL’’ FROGS

The following few groups traditionallyhave been considered ‘‘transitional’’ from theprimitive to advanced frogs, even though onecomponent taxon in particular, Pipidae, ishighly apomorphic in several ways. Themonophyly of this collection of families wassupported by some authors (e.g., Ford andCannatella, 1993; Garcıa-Parıs et al., 2003),but recent morphological (e.g., Haas, 2003;Pugener et al., 2003) and DNA sequence ev-idence (Roelants and Bossuyt, 2005; SanMauro et al., 2005) does not support itsmonophyly.

Ford and Cannatella (1993; fig. 14) sug-gested this group, Mesobatrachia, to bemonophyletic and composed of Pipoidea(Pipidae 1 Rhinophrynidae) and Pelobato-idea (Pelobatidae [including Scaphiopodidae]1 Megophryidae 1 Pelodytidae). They pro-vided four synapomorphies for their Meso-batrachia: (1) closure of the frontoparietalfontanelle by juxtaposition of the frontopa-rietal bones (not in Pelodytes or Spea); (2)partial closure of the hyoglossal sinus by theceratohyals; (3) absence of the taenia tectimedialis; and (4) absence of the taenia tectitransversum.

Pugener et al. (2003) rejected Mesobatra-chia and suggested three synapomorphies fora clade composed of all frogs excluding pi-poids. (This statement is based on Pugeneret al.’s, 2003, figure 12; they provided nocomprehensive list of synapomorphies.)

Haas (2003; fig. 15), in contrast, suggesteda number of characters that placed Pipoideaas the sister taxon of all frogs except Asca-phidae (although he did not study Leiopel-ma). This is consistent with the molecularstudies of San Mauro et al. (2005; fig. 17).Haas’ characters also placed Pelobatoidea (asrepresented by his exemplars) as a paraphy-letic series of Spea, (Pelodytes, Heleophry-ne), and Pelobates 1 Megophrys 1 Lepto-brachium, ‘‘between’’ Discoglossidae (sensulato) and Limnodynastes on a pectinate tree.This is inconsistent with the results of Roe-lants and Bossuyt (2005). Larval characterssuggested by Haas (2003) to support thegroup of all frogs exclusive of Ascaphidaeand Pipoidea are (1) m. mandibulolabialispresent; (2) upper jaw cartilages powered byjaw muscles; (3) larval m. levator mandibu-lae externus main portion inserts in upperjaw cartilages; (4) insertion of the larval m.levator mandibulae internus in relation to jawarticulation lateral; (5) m. levator mandibulaelongus superficialis and profundus in twobundles; (6) processus anterolateralis of cris-ta parotica present; (7) processus muscularispresent; (8) distal end of cartilago meckeliwith stout dorsal and ventral processes form-ing a shallow articular fossa; and (9) liga-mentum mandibulosuprarostrale present.

Garcıa-Parıs et al. (2004b; fig. 18) pre-sented mtDNA sequence evidence for themonophyly of Mesobatrachia although their


Fig. 18. Tree of Pelobatoidea and outgroups of Garcıa-Parıs et al. (2003) based on 1,000 bp of twomitochondrial genes: cytochrome c and 16S rRNA. The sequences were aligned using Clustal X (Thomp-son et al., 1997) using default costs then manually modified based on published secondary-structuremodels of the 16S gene. Gaps were treated as missing data and data were analyzed under the assumptionof the GTR 1 G substitution model, as suggested by ModelTest 3.06 (Posada and Crandall, 1998). Thetree was rooted on Ascaphus montanus 1 A. truei. Quotation marks denote nonmonophyly.

outgroup sampling (which was limited to As-caphus truei, A. montanus, Discoglossus gal-ganoi, and Rana iberica) provided only aminimal test of this proposition. Even morerecently, on the basis of more DNA sequenceevidence and better sampling, Roelants andBossuyt (2005; fig. 16) and San Mauro et al.(2005; fig. 17) found ‘‘Mesobatrachia’’ tohave its elements in a paraphyletic serieswith respect to Neobatrachia. Roelants andBossuyt (2005) found (Ascaphidae 1 Leio-pelmatidae) 1 (Discoglossoidea 1 (Pipoidea1 (Pelobatoidea 1 Neobatrachia))) and SanMauro et al. (2005) found Ascaphidae 1Leiopelmatidae as the sister taxon of Pipo-idea 1 (Discoglossoidea 1 (Pelobatidae 1Neobatrachia)). In other words, their substan-tial difference is in Discoglossoidea (5 Bom-binatoridae 1 Discoglossidae) and Pipoidea

changing places, with San Mauro et al.’s(2005) placement of Pipoidea agreeing withthat of Haas (2003).

PIPOIDEA: Pipoidea (Pipidae 1 Rhino-phrynidae) is clearly well corroborated asmonophyletic but not clearly resolved withrespect to its rather dense fossil record. Fordand Cannatella (1993; fig. 14) considered Pi-poidea to be supported by five morphologicalsynapomorphies: (1) lack of mentomeckelianbones; (2) absence of lateral alae of the par-asphenoid; (3) fusion of the frontoparietalsinto an azygous element; (4) greatly enlargedotic capsule; and (5) tadpole with paired spi-racles and lacking keratinized jaw sheathsand keratodonts (Type I tadpole). Haas(2003) added a substantial number of larvalcharacters: (1) eye position lateral; (2) oper-cular canal and spiracles paired; (3) insertion


of m. levator arcuum branchialium reachingmedially and extending on proximal parts ofceratobranchial IV; (4) m. constrictor bran-chialis I absent; (5) m. levator mandibulaeinternus shifted anteriorly; (6) m. levatormandibulae longus originates exclusivelyfrom arcus subocularis; (7) posterolateralprojections of the crista parotica with expan-sive flat chondrifications; (8) arcus subocu-laris with a distinct processus lateralis pos-terior projecting laterally from the posteriorpalatoquadrate; (9) articulation of cartilagolabialis superior with cornu trabeculae fusedinto rostral plate; and (10) forelimb eruptsout of limb pouch, outside of peribranchialspace. In addition, recent DNA sequencedata (Roelants and Bossuyt, 2005; fig. 16)strongly support a monophyletic group ofRhinophrynidae 1 Pipidae.

RHINOPHRYNIDAE (1 GENUS, 1 SPECIES):Tropical North American and Central Amer-ican Rhinophrynus dorsalis is a burrowingfrog with a number of apomorphies with re-spect to its nearest living relative, Pipidae:(1) division of the distal condyle of the femurinto lateral and medial condyles; (2) modi-fication of the prehallux and distal phalanxof the first digit into a spade for digging; (3)tibiale and fibulare short and stocky, withdistal ends fused; and (4) an elongate atlantalneural arch. In addition to the previous char-acters provided by Ford and Cannatella(1993; fig. 14), Haas (2003; fig. 15) provided(1) larval m. geniohyoideus absent; (2) larvalm. levator mandibulae externus present intwo bundles (profundus and superficialis);(3) ramus mandibularis (cranial nerve V3)posterior (ventral) to m. levator mandibulaeexternus group; (4) endolymphatic spacesextend into more than half of the vertebralcanal (presacral vertebrae 4 or beyond); (5)branchial food traps divided crescentrically;(6) cricoid ring with dorsal gap; and (7) uro-branchial process very long. Available DNAsequence data (e.g., Roelants and Bossuyt,2005) also suggest strongly that Rhinophry-nus is the sister taxon of Pipidae. We sam-pled the single species in this taxon, Rhino-phrynus dorsalis. Baez and Trueb (1997) not-ed that Rhinophrynus also has amphicoelousectochordal vertebrae, as in Ascaphidae andLeiopelmatidae, which may be a synapomor-

phy of Rhinophrynidae at this level of gen-erality.

PIPIDAE (5 GENERA, 30 SPECIES): SouthAmerican and African Pipidae is a highlyapomorphic group of bizarre, highly aquaticspecies. Ford and Cannatella (1993) provided11 characters in support of its monophyly:(1) lack of a quadratojugal; (2) presence ofan epipubic cartilage; (3) unpaired epipubicmuscle; (4) free ribs in larvae; (5) fused ar-ticulation between the coccyx and the sa-crum; (6) short, stocky scapula; (7) elongateseptomaxillary bones; (8) ossified pubis; (9)a single median palatal opening of the eus-tachian tube; (10) lateral line organs in theadults; and (11) loss of tongue. Baez andTrueb (1997) added to this list (fossil taxapruned by us for purposes of this discussion):(1) the possession of an optic foramen witha complete bony margin formed by the sphe-nethmoid; (2) anterior ramus of the pterygoidarises near the anteromedial corner of theotic capsule; (3) parasphenoid fused at leastpartially with the overlying braincase; (4) vo-mer without an anterior process if the boneis present; (5) mandible bears a broad-based,bladelike coronoid process along its postero-medial margin; (6) sternal end of the cora-coid not widely expanded; (7) anterior ramusof pterygoid dorsal with respect to the max-illa; and (8) premaxillary alary processes ex-panded dorsolaterally. Haas (2003) provided11 additional larval characters: (1) origin ofthe m. subarcualis rectus II–IV placed far lat-erally; (2) anterior insertion of m. subarcualisrectus II–IV on ceratohyal III; (3) commis-surae craniobranchiales present; (4) arcus su-bocularis round in cross section; (5) one peri-lymphatic foramen; (6) vertebral centra for-mation epichordal; (7) processus urobran-chialis absent; and (8) ventral valvular velumabsent, as well as these additional charactersof the adult: (9) advertisement call withoutairflow; (10) pupil shape round; and (11)pectoral girdle pseudofirmisternal.

On the basis of morphology, Cannatellaand Trueb (1988; fig. 19A) considered thegeneric relationships to be Xenopus 1 (Sil-urana 1 ((Hymenochirus 1 Pseudhymeno-chirus) 1 Pipa)). Subsequently, de Sa andHillis (1990; fig. 19B), on the basis of a com-bined analysis of morphology and mtDNA,proposed the arrangement Hymenochirus


Fig. 19. Trees of intergeneric relationshipswithin Pipidae: A, Analysis of Cannatella andTrueb (1988) based on 94 character transforma-tions of morphology and 7 ingroup taxa (4 speciesof Pipa collapsed and Pseudhymenochirus consid-ered a synonym of Hymenochirus in our figure forclarity of discussion). Monophyly of Pipidae wasassumed as well as the sister-taxon relationship ofRhinophrynidae, with pelobatoids accepted as thesecond taxonomic outgroup (no tree statistics pro-vided). B, Analysis of de Sa and Hillis (1990)based on 1.486kb of sequence from nuclear 18Sand 28S rDNA and the morphological data fromCannatella and Trueb (1988). Sequences werealigned manually and analyzed under equallyweighted parsimony; gaps were not treated as ev-idence. The tree was rooted on Spea (tree lengthcounting only informative characters 5 81, ci 50.74). C, Parsimony tree of Baez and Pugener(2003) based on 49 characters of adult morphol-ogy, outgroups and fossils pruned for graphic pur-poses (the effect of this pruning on the number ofcharacters being relevant is not known). The treewas rooted on Rhinophrynus, Discoglossus, andAscaphus. (The length of original tree 5 93, ci 50.677.) D, Relevant section of tree from Roelantsand Bossuyt (2005). See figure 16 for informationon alignment and analysis.

(Xenopus 1 Silurana), and this was furthercorroborated by Baez and Trueb (1997) andBaez and Pugener (2003; who found [Hy-menochirus 1 Pipa] 1 [Xenopus 1 Silur-ana]; fig. 19C), and suggested the followingsynapomorphies for Dactylethrinae (Xenopus1 Silurana; fossil taxa pruned for this dis-cussion): (1) scapula extremely reduced; (2)margins of olfactory foramina cartilaginous;(3) articular surfaces of the vertebral pre- and

postzygopophyses bear sulci and ridges, withthe prezygopophyses covering the lateralmargin of the postzygopophysis; and (4) an-terior process of the pterygoid laminae. Theyalso suggested the following synapomorphiesfor Pipinae (Pipa 1 Hymenochirus) (fossiltaxa pruned for purposes of this discussion):(1) wedge-shaped skull; (2) vertebrae withparasagittal spinous processes; (3) anteriorposition of the posterior margin of the par-asphenoid; (4) possession of short coracoidsbroadly expanded at their sternal ends. In ad-dition, they noted other characters of moreambiguous placement that optimize on thisstem in this topology. Recent DNA sequencedata (Roelants and Bossuyt, 2005; figs. 16,19D), however, suggest a topology of Pipa1 (Hymenochirus 1 (Xenopus 1 Silurana)).

We sampled three species of Dactylethri-nae (Africa): Silurana tropicalis, Xenopuslaevis, and X. gilli. From Pipinae (SouthAmerica and Africa) we sampled Hymeno-chirus boettgeri, Pipa pipa, and P. carvalhoi.According to the cladogram provided byTrueb and Cannatella (1986), inclusion of ei-ther Pipa parva or P. myersi would havebracketed the phylogenetic diversity of Pipasomewhat better, although our sampling wasadequate to test pipine (weakly), dactyleth-rine, and pipid monophyly, and the place-ment of Pipidae among other frogs.

PELOBATOIDEA: Pelobatoidea (Megophryi-dae, Pelobatidae, Pelodytidae, and Scaphio-podidae) has also been the source of consid-erable controversy. Haas (2003; fig. 15) didnot recover the group as monophyletic (seethe earlier discussion under Mesobatrachia),although Ford and Cannatella (1993) sug-gested that synapomorphies include the pres-ence of a palatine process of the maxilla andossification of the sternum into a bony style.Gao and Wang (2001) found Pelobatoidea tobe more closely related to Discoglossidae onthe basis of a limited analysis of fossil taxa.But, Garcıa-Parıs et al. (2003; fig. 18) sug-gested that Pelobatoidea is the sister taxon ofPipoidea on the basis of a maximum-likeli-hood analysis of mtDNA evidence, althoughtheir outgroup structure was insufficient toprovide a strong test of this proposition.(This position was effectively rejected by re-cent molecular evidence [Roelants and Bos-


suyt, 2005; San Mauro et al., 2005; figs. 16,17].)

Maglia (1998) also provided an analysis ofPelobatoidea, but because she constrainedthe monophyly of this group we are not surehow to interpret the distribution of her mor-phological evidence. Pugener et al. (2003)provided a cladogram based on morphologyin which Pelobatoidea was recovered asmonophyletic (and imbedded within Neoba-trachia), but the underlying data were notprovided. Roelants and Bossuyt (2005; fig.16) suggested on the basis of DNA evidencethat Pelobatoidea is the sister taxon of Neo-batrachia, a result that is consistent with theolder view of Savage (1973; cf. Noble,1931). Dubois (2005) most recently treatedall pelobatoids as a single family composedof four subfamilies, but this was merely achange in Linnaean rank without a concom-itant change in understanding phylogenetichistory.

PELOBATIDAE (1 GENUS, 4 SPECIES) AND

SCAPHIOPODIDAE (2 GENERA, 7 SPECIES): Fordand Cannatella (1993; fig. 14) diagnosed Pe-lobatidae (including Scaphiopodidae in theirsense) on the basis of (1) fusion of the jointbetween the sacrum and urostyle; (2) exos-tosed frontoparietals; and (3) presence of ametatarsal spade supported by a well-ossifiedprehallux. As noted earlier, Haas (2003; fig.15) did not recover Pelobatidae (sensu lato)as monophyletic, instead placing Spea phy-logenetically far from Pelobatidae, more dis-tant than Heleophryne. More recently,Garcıa-Parıs et al. (2003; fig. 18) providedmolecular data suggesting that Pelobatidaeand Scaphiopodidae are not each other’sclosest relatives. These results were aug-mented by the DNA sequence studies ofRoelants and Bossuyt (2005) and San Mauroet al. (2005), both of which supported Sca-phiopodidae as the sister taxon of Pelodyti-dae 1 (Pelobatidae 1 Megophryidae) (figs.16, 17). All species have typical exotrophicaquatic larvae (Altig and McDiarmid, 1999).We sampled Spea hammondii, Scaphiopuscouchii, and S. holbrooki from Scaphiopod-idae, and Pelobates fuscus and P. cultripesfrom Pelobatidae.

PELODYTIDAE (1 GENUS, 3 SPECIES): Fordand Cannatella (1993; fig. 14) diagnosed Pe-lodytidae as having a fused astragalus and

calcaneum (also found in some Centroleni-dae; Sanchız and de la Riva, 1993) andplaced them in their Pelobatoidea as didGarcıa-Parıs et al. (2003; fig. 18). Haas(2003), however, recovered Pelodytes in apolytomy with Heleophryne, Neobatrachiaand Megophrys 1 Pelobates 1 Leptobrach-ium. We sampled Pelodytes punctatus as ourexemplar of Pelodytidae. Larvae in pelody-tids are also typical free-living exotrophs(Altig and McDiarmid, 1999).

MEGOPHRYIDAE (11 GENERA, 129 SPECIES):Ford and Cannatella (1993; fig. 14) diag-nosed Megophryidae as having (1) a com-plete or nearly complete absence of cerato-hyals in adults; (2) intervertebral cartilageswith an ossified center; and (3) paddle-shaped tongue. Haas (2003; fig. 15) recov-ered a group consisting of the megophryids(Leptobrachium and Megophrys being hisexemplars) and Pelobates but did not resolvethe megophryids sensu stricto. Evidence forthis megophryid 1 Pelobates clade is: (1)distal anterior labial ridge and keratodont-bearing row very short and median; (2) venacaudalis dorsalis present; (3) anterior inser-tion of the m. subarcualis rectus II–IV onceratobranchial III; (4) m. mandibulolabialissuperior present; (5) adrostral cartilage verylarge and elongate; and (6) cricoid ring witha dorsal gap.

Dubois (1980) and Dubois and Ohler(1998) suggested that megophryids form twosubfamilies based on whether the larvae havefunnel-shaped oral discs (Megophryinae), anapomorphy, or nonmodified oral discs (Lep-tobrachiinae), a plesiomorphy. Megophryi-nae includes Atympanophrys, Brachytarso-phrys, Megophrys, Ophryophryne, and Xen-ophrys. Their Leptobrachiinae includes Lep-tobrachella, Leptolalax, Leptobrachium,Oreolalax, Scutiger, and Vibrissaphora. De-lorme and Dubois (2001) presented a con-sensus tree (fig. 20) based on 54 transfor-mation series of morphology (not includingVibrissaphora). This tree suggests that Me-gophryinae (Megophrys montana being theirexemplar) is deeply imbedded within a par-aphyletic Leptobrachiinae (the remainingmegophryid exemplars being of this nominalsubfamily); that Scutiger is composed of aparaphyletic subgenus Scutiger and a mono-phyletic subgenus Aelurophryne), and that


Fig. 20. Consensus of 12 equally parsimonious trees of selected members of Megophryidae ofDelorme and Dubois (2001), rooted on Scaphiopus and Pelodytes. Underlying data were 54 transfor-mation of morphology, rooted on Pelodytes and Scaphiopus (ci 5 0.581; ri 5 0.713). Although the treeand a list of the underlying character transformation were provided, no association was made betweenthe character transformations and taxa or particular branches on the tree, rendering the analysis practi-cally unrepeatable. Nominal subfamilies are noted on the right.

Oreolalax is composed of a paraphyletic sub-genus Oreolalax and a monotypic subgenusAelurolalax.

Within megophryines, Xie and Wang(2000) noted conflict between isozyme andkaryological data regarding the monophylyof Brachytarsophrys, and also noted thatAtympanophrys is only dubiously diagnos-able from Megophrys or Xenophrys. Theyalso suggested that Xenophrys may not bediagnosable from Megophrys.

Lathrop (1997) suggested that, amongnominal leptobrachiines, Leptolalax has noidentified apomorphies. Xie and Wang(2000) noted that Oreolalax is diagnosablefrom Scutiger on the basis of unique maxil-lary teeth and that Vibrissaphora has apo-morphies (e.g., keratinized spines along thelips of adults), although the effect of recog-nizing Oreolalax and Vibrissaphora on themonophyly of Scutiger has not been evalu-ated. Similarly, the monophyly of Lepto-brachium is undocumented.

The species sampled for DNA sequences

were Brachytarsophrys feae, Leptobrachiumchapaense, L. hasselti, Leptolalax bourreti,Megophrys nasuta, Ophryophryne hansi, O.microstoma, Xenophrys major (formerly X.lateralis). We were unable to obtain samplesof Atympanophrys, Leptobrachella, Oreola-lax, Scutiger, and Vibrissaphora, so, al-though we are confident that our samplingwill allow phylogenetic generalizations to bemade regarding the family, most of the prob-lems within the group (e.g., the questionablemonophyly of Leptobrachium, Leptolalax,Megophrys, Scutiger, and Xenophrys) willremain unanswered.

‘‘ADVANCED’’ FROGS—NEOBATRACHIA

Neobatrachia9 includes about 96% of ex-tant frogs and is a poorly understood arrayof apparently likely paraphyletic groups withapomorphic satellites. So, at this juncture inour discussion the quantity of evidence sug-

9 There is controversy regarding the appropriate nameof this taxon. It is addressed in appendix 6.


Fig. 21. Bayesian tree of anuran exemplars of Biju and Bossuyt (2003), with particular reference toNeobatrachia. Underlying data are two mtDNA fragments, covering part of 12S rRNA, complete t-RNAVal, and part of 16S rRNA. In addition, one fragment of the nuclear genome: exon 1 of rhodopsin,single exon of RAG-1, and exon 2 of CXCR-4, for a total of 2,325 bp of sequence. Alignment wasmade using Clustal X (Thompson et al., 1997), alignment costs not disclosed, with ambiguous sectionsexcluded and gaps excluded as evidence. Model of nucleotide substitution assumed for analysis wasGTR 1 G1 I.

gested by authors to support major groups,and the quality of published taxonomic rea-soning drops significantly to the realm ofgrouping by overall similarity and specialpleading for particularly favored characters.Like the larger-scale Archeobatrachia (prim-itive frogs), Mesobatrachia (transitionalfrogs), and Neobatrachia (advanced frogs) of

prephylogenetic systematics, Neobatrachiaalso has within it its own nominally ‘‘prim-itive’’ groups aggregated on plesiomorphy(e.g., Leptodactylidae), as well as its ownnominally ‘‘transitional’’ and ‘‘advanced’’groups (e.g., Ranidae and Rhacophoridae,Arthroleptidae and Hyperoliidae). Further,the unwillingness of the systematics com-


munity to change taxonomies in the face ofevidence is best illustrated here. For exam-ple, Brachycephalidae was shown to be im-bedded within the leptodactylid taxonEleutherodactylinae, but the synonymy wasnot made by Darst and Canntella (2004), andLeptopelinae was shown to be more closelyrelated to Astylosternidae than to hyperoliinehyperoliids by Vences et al. (2003c), but wasretained by those authors in an explicitly par-aphyletic Hyperoliidae.

Ford and Cannatella (1993; fig. 14) sug-gested five characters in support of themonophyly of Neobatrachia: (1) (neo)palatinebone present; (2) fusion of the third distalcarpal to other carpals; (3) complete separa-tion of the m. sartorius from the m. semiten-dinosus; (4) presence of an accessory headof the m. adductor longus; and (5) absenceof the parahyoid bone. In addition, Haas(2003; fig. 15) presented the following larvalcharacters (but see Heleophrynidae): (1) up-per lip papillation with broad diastema; (2)cartilage of the cavum cranii forms tectumparietale; (3) secretory ridges present; and(4) pupil horizontally elliptical. The charac-ter of central importance historically to therecognition of this taxon is the (neo)palatinebone, a character not without its own contro-versy.

‘‘HYLOIDEA’’: The worldwide Hyloidea,for which no morphological synapomorphyhas been suggested, was long aggregated onthe basis of its being ‘‘primitive’’ with re-spect to the ‘‘more advanced’’ Ranoidea, al-though molecular evidence under certain an-alytical methods and assumptions supportsits monophyly (Ruvinsky and Maxson, 1996;Feller and Hedges, 1998). Hyloidea is de-fined by the plesiomorphic (at least withinNeobatrachia) possession of arciferal pecto-ral girdles (coracoids not fused) and simpleprocoelous vertebrae, although descriptionsof both characters have been highly reifiedthrough repetition and idealization. More re-cently, Biju and Bossuyt (2001: fig. 21) sug-gested on the basis of a DNA sequence anal-ysis that Hyloidea, as traditionally viewed, isparaphyletic with respect to Ranoidea, butwithin ‘‘Hyloidea’’ is a monophyletic grouplargely coextensive with ‘‘Hyloidea’’, but ex-cluding Heleophrynidae, Limnodynastidae,Myobatrachidae, Nasikabatrachidae, Soog-

lossidae, and, presumably Rheobatrachidaeas well. Darst and Cannatella (2004; fig. 22)redelimited Hyloidea as the descendants ofthe most recent common ancestor of Eleuth-erodactylini, Bufonidae, Centrolenidae, Hy-linae, Phyllomedusinae, Pelodryadinae, andCeratophryinae, thereby excluding Heleo-phrynidae, Limnodynastidae, Myobatrachi-dae, Rheobatrachidae, and Sooglossidae (andby implication, presumably Nasikabatrachi-dae) from Hyloidea10. For this discussion, weretain the older, more familiar definition ofHyloidea as all neobatrachians excluding theranoids.

HELEOPHRYNIDAE (1 GENUS, 6 SPECIES):South African Heleophryne was consideredby Ford and Cannatella (1993; fig. 14) to bea member of Neobatrachia and Hyloidea.The synapomorphy of Heleophrynidae sug-gested by these authors includes only ab-sence of keratinous jaw sheaths in exotrophicfree-living larvae. Haas (2003; fig. 15), incontrast, placed Heleophrynidae outsideNeobatrachia in a pectinate relationshipamong ‘‘pelobatoids’’ or as the sister taxon

10 Because Darst and Cannatella (2004) used Limno-dynastes and Heleophryne as outgroups to root the re-mainder of the tree, it was not possible for them to haveobtained a tree in which traditional Hyloidea is mono-phyletic so their statement (p. 46) that ‘‘the placementof some basal neobatrachian clades (Heleophrynidae,Myobatrachidae, and Sooglossidae) remains uncertain’’is actually an assumption of their phylogenetic analysis.Uncited by Darst and Cannatella (2004), Biju and Bos-suyt (2003) differentiated between ‘‘Hyloidea’’ sensulato (the traditional view of Hyloidea) and Hyloidea sen-su stricto, which they considered to be monophyletic andwhich, like the concept of Darst and Cannatella (2004),excluded Myobatrachidae, Limnodynastidae, Heleo-phrynidae, Sooglossidae, and Nasikabatrachidae. Anoth-er issue is that Ford and Cannatella (1993) and Canna-tella and Hillis (2004) defined the name Hylidae to applycladographically to the hypothetical ancestor of Hemi-phractinae, Hylinae, Pseudinae (now part of Hylinae),and Pelodryadinae, and all of its descendants. However,Darst and Cannatella (2004) implied that their Hylidaewas redefined to exclude Hemiphractinae. This redefi-nition would be necessary to keep content and diagnosisas stable as possible with respect to the traditional useof the term ‘‘Hylidae’’, because without this kind of re-definition in a system that aspires to precision, the pre-tense of precision is lost. For example, the cladographicdefinition of Hylidae by Ford and Cannatella (1993) andCannatella and Hillis (2004) applied to the cladogramof Darst and Cannatella (2004) would require that thefollowing be included within Hylidae: Brachycephali-dae, Leptodactylidae, Bufonidae, Centrolenidae, Den-drobatidae, and, likely, Rhinodermatidae.


of Pelobates, Leptobrachium, and Mego-phrys. Heleophryne is included at this levelin Haas’ analysis by having (1) m. tympan-opharyngeus present; (2) m. interhyoideusposterior present; (3) m. diaphragmatoprae-cordialis present; (4) m. constrictor bran-chialis I present; and (5) interbranchial sep-tum IV musculature with the lateral fibers ofthe m. subarcualis rectus II–IV invading theseptum, and lacking the characters listed byHaas for Neobatrachia. In addition, the ver-tical pupil and ectochordal vertebrae tie he-leophrynids to myobatrachines, and non-neo-batrachians. Recent DNA sequence evidence(San Mauro et al., 2005; fig. 17) stronglysupports Heleophrynidae as the sister taxonof all other neobatrachians (although Bijuand Bossuyt, 2003, also on the basis of mo-lecular evidence as well had suggested thatHeleophrynidae is the sister taxon of Lim-nodynastidae 1 Myobatrachidae).

We sampled Heleophryne purcelli and H.regis. These species are likely close relatives(Boycott, 1982) so broader sampling (to haveincluded H. rosei, whose isolation on TableMountain near Cape Town suggests a likelydistant relationship to the other species)would have been preferable.

SOOGLOSSIDAE (2 GENERA, 4 SPECIES) AND

NASIKABATRACHIDAE (1 GENUS, 2 SPECIES):Sooglossidae is a putative Gondwanan relict(Savage, 1973) on the Seychelles, possiblyrelated to myobatrachids as evidenced bysharing with that taxon the plesiomorphy ofectochordal vertebrae (J.D. Lynch, 1973), al-though Bogart and Tandy (1981) suggested arelationship with the arthroleptines (a ranoidgroup). In fact, the group is plesiomorphic inmany characters, being arciferal (althoughhaving a bony sternum; see Kaplan, 2004,for discussion of the various meanings of‘‘arcifery’’) and all statements as to its rela-tionships, based on morphology, have beenhighly conjectural. Biju and Bossuyt (2003;fig. 21) suggested on the basis of DNA se-quence evidence that Sooglossidae is the sis-ter taxon of the recently discovered Nasika-batrachus, found in the Western Ghats ofSouth India. Nasikabatrachus has so far hadlittle of its morphology documented. Theyalso found Sooglossidae 1 Nasikabatrachi-dae to form the sister taxon of all other neo-batrachians.

We sampled one species each of the nom-inal sooglossid genera (Nesomantis thomas-seti and Sooglossus sechellensis). Of Nasi-kabatrachidae we sampled Nasikabatrachussahyadrensis as well as sequences attributedby Dutta et al. (2004) only to an unnamedspecies of Nasikabatachidae, also from theWestern Ghats. Although Dutta et al. did notname their species as new, they explicitlytreated it as distinct from N. sahyadrensis(Dutta et al., 2004: 214), and we thereforefollow their usage. (Our statement that Na-sikabatrachidae contains two species rests onthis assertion, although any clear diagnosisof the second has yet to be cogently provid-ed.) All species of Sooglossidae that areknown are endotrophic according to Thibau-deau and Altig (1999). Sooglossus sechellen-sis has free tadpoles that are carried on theback of the mother. The tadpoles are likelyendotrophic, but this is not definitely known(R.A. Nussbaum, personal obs.). Dutta et al.(2004) reported exotrophic tadpoles occur-ring in fast-flowing streams for their un-named species of Nasikabatrachidae.

LIMNODYNASTIDAE (8 GENERA, 50 SPECIES),MYOBATRACHIDAE (11 GENERA, 71 SPECIES),AND RHEOBATRACHIDAE (1 GENUS, 2 SPECIES):Different authors consider this taxonomiccluster to be one family (Myobatrachidae,sensu lato) with two or three subfamilies(Heyer and Liem, 1976); to be two families,Limnodynastidae and Myobatrachidae (Zuget al., 2001; Davies, 2003a, 2003b); or to bethree families, Limnodynastidae, Myoba-trachidae, and Rheobatrachidae (Laurent,1986). Because Rheobatrachidae (Rheoba-trachus; Laurent, 1986) was only tentativelyassociated with Myobatrachidae by Ford andCannatella (1993), we retain its familial sta-tus for clarity of discussion.

Limnodynastidae, Myobatrachidae, andRheobatrachidae are primarily united on thebasis of their geographic propinquity on Aus-tralia and New Guinea (Tyler, 1979; Fordand Cannatella, 1993). And, only one line ofevidence, that of spermatozoal morphology,has ever suggested that these taxa taken to-gether are monophyletic (Kwon and Lee,1995). Heyer and Liem (1976) provided acharacter analysis that assumed familial andgeneric monophyly, but this was criticizedmethodologically (Farris et al., 1982a).



←

Fig. 22. Parsimony tree of Darst and Cannatella (2004) of hyloid frogs and outgroups based onanalysis of 12S and 16S fragments of mitochondrial rRNA gene sequences. Sequence alignment wasperformed using Clustal X (Thompson et al., 1997) under a number of different cost regimes (notdisclosed) and then compared with secondary structures and manually manipulated to minimize thenumber of informative sites under a parsimony criterion. Unalignable regions were excluded and gapswere treated as missing. The number of informative sites was not stated. The tree was rooted onLimnodynastes 1 Heleophryne. We updated the taxonomy of the terminals and higher taxonomy tocorrespond with changes made after the paper was published. Use of Euhyas (instead of Eleutherodac-tylus) is our modification to illuminate discussion.

Rheobatrachinae (Rheobatrachus) is of un-certain position, although Farris et al.(1982a) in their reanalysis of Heyer andLiem’s (1976) data, considered it to be partof Limnodynastinae. Ford and Cannatella(1993) subsequently argued that Rheobatra-chinae is more closely related to Myoba-trachidae than to Limnodynastidae, althoughthis suggestion, like the first, rests on highlycontingent phylogenetic evidence. Moreover,Myobatrachidae may be related to Sooglos-sidae (J.D. Lynch, 1973) and Limnodynasti-nae to Heleophrynidae (J.D. Lynch, 1973;Ruvinsky and Maxson, 1996), although theseviews are largely conjectural inasmuch as thecharacter evidence of J.D. Lynch (1973) waspresented in scenario form.

Ford and Cannatella (1993) suggested, onthe basis of discussion of characters present-ed by Heyer and Liem (1976), that Myoba-trachidae (Myobatrachinae in their sense andpresumably including Rheobatrachus) hasfour morphological synapomorphies: (1)presence of notochordal (ectochordal) verte-brae with intervertebral discs; (2) m. petro-hyoideus anterior inserting on the ventralface of the hyoid; and, possibly, (3) reductionof the vomers and concomitant reduction ofvomerine teeth (J.D. Lynch, 1971).

Ford and Cannatella (1993) suggested sev-eral synapomorphies of Myobatrachidae andSooglossidae to the exclusion of Limnodyn-astidae: (1) incomplete cricoid cartilage ring;(2) semitendinosus tendon inserting dorsal tothe m. gracilis (in myobatrachines excludingTaudactylus and Rheobatrachus, which havea ventral trajectory of the tendon; (3) hori-zontal pupil (except in Uperoleia; (also ver-tical in Rheobatrachus; limnodynastinesprimitively have a vertical pupil according toHeyer and Liem, 1976, although several have

horizontal ones); (4) broad alary process(Griffiths, 1959a), which they found inMyobatrachidae and Rheobatrachus (as wellas in Adenomera, Physalaemus [in the senseof including Engystomops and Eupemphix],and Pseudopaludicola); and (5) dividedsphenethmoid.

Ford and Cannatella (1993) reported atleast one synapomorphy for Limnodynasti-dae: a connection between the m. interman-dibularis and m. submentalis (also found inLeptodactylinae and Eleutherodactylinae ac-cording to Burton, 1998b). Rheobatrachuswas diagnosed by having gastric brooding oflarvae—an unusual reproductive mode, tosay the least. It is tragic that the two speciesare likely now extinct (Couper, 1992).

Read et al. (2001) provided a phylogeneticstudy of myobatrachine frogs (fig. 23) basedon mtDNA sequence data that assumedmonophyly of the group and used only Lim-nodynastes to root the myobatrachine tree.The evolutionary propinquity of Limnodyn-astes (Limnodynastidae) and Myobatrachus(Myobatrachidae) was supported on the basisof DNA sequence evidence by Biju and Bos-suyt (2003).

We were able to sample at least one spe-cies for most of the genera of the three nom-inal families. For Limnodynastidae we sam-pled at least one species for all nominal gen-era: Adelotus brevis, Heleioporus australia-cus, Lechriodus fletcheri, Limnodynastesdepressus, L. dumerilii, L. lignarius, L. or-natus, L. peronii, L. salmini, Mixophyes car-binensis, Neobatrachus sudelli, N. pictus,Notaden melanoscaphus, Philoria sphagni-cola. Recent authors (e.g., Cogger et al.,1983) have considered Kyarranus to be asynonym of Philoria, and we follow this.J.D. Lynch (1971) provided morphological


Fig. 23. Parsimony tree of Crinia, Geocrinia,and allied myobatrachids, of Read et al. (2001).Data were of mtDNA: approximately 621 bp (266variable) from the 12S rRNA region and 677 bp(383 variable) of ND2. Sequence alignment of12S and ND2 were done under ClustalX (Thomp-son et al., 1997) with gap opening and extensioncosts set at 50, and transversion: transition costratio set at 2. Ambiguously alignable regions wereexcluded. In analysis, transversion:transition costswere set at 2. It was not stated whether gaps weretreated as evidence but we infer that gaps weretreated as missing data. Branches marked with anasterisk were collapsed in the original publicationbecause of low bootstrap support.

characters that are evidence of monophyly ofKyarranus 1 Philoria (e.g., presence of stub-by fingers and concealed tympana as well asdirect development—Littlejohn, 1963; DeBavay, 1993; Thibaudeau and Altig, 1999).

For Rheobatrachidae, we obtained Rheo-batrachus silus. And, for Myobatrachidae,we obtained at least single representatives ofall nominal genera: Arenophryne rotunda,Assa darlingtoni, Crinia nimbus, C. signi-fera, Geocrinia victoriana, Metacrinia ni-chollsi, Myobatrachus gouldii, Paracriniahaswelli, Pseudophryne bibroni, P. coriacea,Spicospina flammocaerulea, Taudactylusacutirostris, and Uperoleia laevigata. Withexceptions, this taxon selection will not al-low us to comment on generic monophyly,but it will identify major monophyleticgroups and questions that will guide futureresearch. All rheobatrachids and most myob-atrachids have endotrophic larvae and vari-ous degrees of direct development (Thibau-deau and Altig, 1999).

‘‘LEPTODACTYLIDAE’’ (57 GENERA, 1243SPECIES): ‘‘Leptodactylidae’’ holds the sameposition in the Americas as Myobatrachidae(sensu lato, as containing Limnodynastidaeand Rheobatrachidae) does in Australia—alikely nonmonophyletic hodgepodge ‘‘prim-itive’’ holochordal or rarely stegochordal, ar-ciferal, and procoelous neobatrachian groupunited by geography and not synapomorphy.‘‘Leptodactylidae’’ is currently divided intofive subfamilies, some of which are notclearly monophyletic (or consistently diag-nosable) and some of which may be poly-phyletic (Ruvinsky and Maxson, 1996; Haas,2003; Darst and Cannatella, 2004; Faivovichet al., 2005; San Mauro et al., 2005; figs. 17,22, 24).

J.D. Lynch (1971, 1973) considered lep-todactylids to be divided into four subfami-lies, on the basis of both synapomorphy andsymplesiomorphy: (1) Ceratophryinae (forCeratophrys and Lepidobatrachus); (2) Elo-siinae (5 Hylodinae of other authors; forCrossodactylus, Hylodes, and Megaelosia);(3) Leptodactylinae (for Barycholos, Edalor-hina, Hydrolaetare, Leptodactylus [includingAdenomera], Limnomedusa, Lithodytes, Par-atelmatobius, Physalaemus [including En-gystomops and Eupemphix], Pleurodema,and Pseudopaludicola); and (4) Telmatobi-


inae, aggregated on the basis of plesiomor-phy. Within his Telmatobiinae Lynch definedfive tribes, each aggregated on a variable ba-sis of synapomorphy and symplesiomorphy:Telmatobiini (Batrachophrynus, Caudiver-bera, Telmatobius, and Telmatobufo); Also-dini (Batrachyla, Eupsophus [including Al-sodes], Hylorina, and Thoropa); Odonto-phrynini (Macrogenioglottus, Odontophry-nus, and Proceratophrys); Grypiscini(Crossodactylodes, Cycloramphus, and Za-chaenus); and Eleutherodactylini (Eleuther-odactylus, Euparkerella, Holoaden, and Is-chnocnema, as well as several other generasubsequently placed in the synonymy ofEleutherodactylus), with Scythrophrys beingleft incertae sedis. Subsequently, Heyer(1975) provided a preliminary clustering(based on the nonphylogenetic monotheticsubset method of Sharrock and Felsenstein,1975) of the nominal genera within the fam-ily that assumed monophyly of both the fam-ily and the constituent genera (see Farris etal., 1982a, for criticism of the approach) inwhich Heyer identified, but did not recognizeformally, five units that were recognized sub-sequently (Laurent, 1986) as Ceratophryinae,Eleutherodactylinae, Cycloramphinae, Lep-todactylinae, and Telmatobiinae. J.D. Lynch(1978b) revised the genera of Telmatobiinae,where he recognized three tribes: Telmato-biini (Alsodes, Atelognathus, Batrachophry-nus, Eupsophus, Hylorina, Insuetophrynus,Limnomedusa, Somuncuria, and Telmato-bius), Calyptocephalellini (Caudiverbera andTelmatobufo), and Batrachylini (Batrachylaand Thoropa). The justification for this ar-rangement was partially based on characterargumentation, although plausibility of re-sults was based on subjective notions ofoverall similarity and relative character im-portance. A cursory glance at figure 24 (Fai-vovich et al., 2005) shows that several ofthese groups are nonmonophyletic.

Burton (1998a) suggested on the basis ofhand muscles (although his character polaritywas not well supported) that the leptodactyl-id tribe Calyptocephalellini is more closelyrelated to the South African Heleophrynidaethan to other South American leptodactylids.San Mauro et al. (2005; fig. 17) suggested onthe basis of DNA sequence data that Cau-diverbera (Calyptocephalellini) is more

closely related to at least some component ofLimnodynastidae (Lechriodus) than to otherSouth American ‘‘leptodactylids’’. Anotherleptodactylid satellite is Brachycephalidae, asmall monophyletic taxon, likely the sistertaxon of Euparkerella (Leptodactylidae:Eleutherodactylinae) based on digit reduction(Izecksohn, 1988; Giaretta and Sawaya,1998). Similarly, Rhinodermatidae (Rhinod-erma) is a small group that is likely also atelmatobiine leptodactylid (Barrio and Rin-aldi de Chieri, 1971; Lavilla and Cei, 2001),differing from them in having partial or com-plete larval development within the male vo-cal sac and, except for Eupsophus, in havingendotrophic larvae (Formas et al., 1975; Al-tig and McDiarmid, 1999).

Laurent (1986) provided the subfamilialtaxonomy we employ for discussion (his ar-rangement being the formalization of thegroupings tentatively recommended by Hey-er, 1975). He recognized Ceratophryinae (inthe larger sense of including J.D. Lynch’sOdontophrynini, transferred from Telmato-biinae), Telmatobiinae (including calyptoce-phallelines and excluding J.D. Lynch’sEleutherodactylini), Cycloramphinae (asGrypiscinae, including Grypscini and Elosi-inae of J.D. Lynch), Eleutherodactylinae, andLeptodactylinae.

‘‘CERATOPHRYINAE’’ (6 GENERA, 41 SPE-CIES): Reig (1972) and Estes and Reig (1973)suggested that the leptodactylid subfamilyCeratophryinae was ‘‘ancestral’’, in somesense, to Bufonidae, although others rejectedthis (e.g., J.D. Lynch, 1971, 1973). Laurent(1986), following Heyer (1975), transferredMacrogenioglottus, Odontophrynus, andProceratophrys (J.D. Lynch’s tribe Odonto-phrynini) into this nominal subfamily, withCeratophrys, Chacophrys, and Lepidobatra-chus being placed in Ceratophryini. Haas(2003; fig. 15) presented morphological evi-dence that Ceratophryini and Odontophry-nini are not each other’s closest relatives (fol-lowing J.D. Lynch, 1971), with Odontophry-nus most closely related to Leptodactylus,and the clade Ceratophryini (Lepidobatra-chus 1 Ceratophrys) most closely related tohylids, exluding hemiphractines. Duellman(2003) treated the two groups as subfamilies,Odontophryninae and Ceratophryinae, pre-sumably following the results of Haas



←

Fig. 24. Tree of Hylidae and outgroups from Faivovich et al. (2005), based on 5.5kb sequence fromfour mitochondrial genes (12S, 16S, tRNAVal, cytochrome c) and five nuclear genes (rhodopsin, tyrosi-nase, RAG-1, seven in absentia, 28S) and analyzed by Direct Optimization in POY under equal costfunctions. Gaps were treated as evidence.

(2003), and this was followed by Dubois(2005). Faivovich et al. (2005; fig. 24) alsofound Ceratophryinae to be polyphyletic. Wesampled exemplars from all nominal cerato-phryid genera except Macrogenioglottus,which is similar to Odontophrynus (J.D.Lynch, 1971) and karyologically similar toProceratophrys (Silva et al., 2003; Odonto-phrynus not examined in that study) that wedoubt that this will be an important problem.Ceratophryini does have synapomorphies,for example: (1) transverse processes of an-terior presacral vertebrae widely expanded;(2) cranial bones dermosed; and (3) teethfanglike, nonpedicellate (J.D. Lynch, 1971,1982b), although nominal Odontophryninidoes not have unambiguously synapomor-phies, and the group is united on overall sim-ilarity. All ceratophryids have free-living ex-otrophic larvae (Altig and McDiarmid,1999). We sampled three species of Cerato-phryini (Ceratophrys cranwelli, Chacophryspierotti, and Lepidobatrachus laevis) andthree species of Odontophrynini (Odonto-phrynus achalensis, O. americanus, and Pro-ceratophrys avelinoi). Our sampling of Pro-ceratophrys should have been denser, but thisproved a practical impossibility.

‘‘CYCLORAMPHINAE’’ (10 GENERA, 79 SPE-CIES): Haas (2003) suggested that this groupmay be closely related to Dendrobatidae, inpart supporting the earlier position of Noble(1926) and J.D. Lynch (1973) that the hylo-dine part of this nominal subfamily (Cros-sodactylus, Hylodes, and Megaelosia) is par-aphyletic with respect to Dendrobatidae. Fai-vovich et al. (2005; fig. 24) recovered Cros-sodactylus (their exemplar of this group) asthe sister taxon of Dendrobatidae. Laurent(1986) recognized this subfamily, thus uni-fying J.D. Lynch’s (1971, 1973) Grypisciniand Elosiinae (5 Hylodinae), although theevidentiary basis for uniting these was basedon Heyer’s (1975) results based on monoth-etic subsets, not parsimony. (Note that J.D.Lynch, 1971, had considered his Grypiscini

to be close to Eleutherodactylini on the basisof overall similarity.) Grypiscines and hylo-dines differ in (1) the shape of the transverseprocesses of the posterior presacral vertebrae,being short in hylodines and not short in gry-piscines; (2) the shape of the facial lobe ofthe maxillae (deep in grypiscines, shallow inhylodines); (3) the shape of the nasals (largeand in median contact in grypiscines, smalland widely separated in hylodines); and (4)whether the nasal contacts the frontoparietal(contact in grypiscines, no contact in hylo-dines). We were unable to obtain samples ofCrossodactylodes, Rupirana, or Zachaenus,but we did obtain at least one species of ev-ery other nominal genus in the group: Cros-sodactylus schmidti, Cycloramphus bora-ceiensis, Hylodes phyllodes, Megaelosiagoeldii, Paratelmatobius sp., Scythrophryssawayae, and Thoropa miliaris. Denser sam-pling of this particular taxon would havebeen preferable, but what we obtained willtest cycloramphine monophyly and its puta-tive relationship to Dendrobatidae and willprovide an explicit hypothesis of its internalphylogenetic structure as the basis of futurestudies.

Duellman (2003) did not accept Laurent’s(1986) unification of J.D. Lynch’s Hylodinaeand Grypiscini and recognized Hylodinae(Crossodactylus, Hylodes, and Megaelosia)as a different subfamily from Cycloramphi-nae. Duellman distinguished Hylodinae andCycloramphinae by T-shaped terminal pha-langes in Hylodinae and knoblike terminalphalanges in Cycloramphinae; and glandularpads on the dorsal surface of the digits, ab-sent in Hylodinae and present in Cycloram-phinae. However, neither the particulars ofdistribution of these characters in the taxanor the levels of universality of their appli-cation as evidence was discussed. Duellman(2003) also suggested that Hylodinae andCycloramphinae differ in chromosome num-bers, with 13 pairs in Cycloramphinae and 3pairs in Hylodinae. However, Kuramoto


(1990) noted that hylodines in Duellman’ssense have 11–13 pairs of chromosomes, andcycloramphines in Duellman’s sense alsohave 11–13 pairs, so Duellman’s statement istaken to be an error.

ELEUTHERODACTYLINAE (13 GENERA, 782SPECIES): The only suggested synapomorphyof this taxon is direct terrestrial developmentof large eggs deposited in small clutches(J.D. Lynch, 1971). The universality of directdevelopment in this group is based on ex-trapolation from the few species for whichdirect development has been observed; theoccurrence of large, unpigmented eggs, andbecause free-living larvae are unknown (seecautionary remarks in Thibaudeau and Altig,1999). Inasmuch as this taxon contains thelargest vertebrate genus, Eleutherodactylus(ca. 600 species) of which the vast majorityare not represented by genetic samples, thistaxon will remain inadequately sampled forsome time. There has never been any com-prehensive phylogenetic study of the rela-tionships within the group and the likelihoodof many (or even most) of the non-Eleuth-erodactylus genera being components ofEleutherodactylus is high. Indeed, Ardila-Robayo (1979) suggested strongly that forthe taxon currently referred to as Eleuthero-dactylus (sensu lato) to be rendered mono-phyletic it would need to include Barycholos,Geobatrachus, Ischnocnema, and Phrynopus(and likely Adelophryne, Phyllonastes, Phy-zelaphryne, Holoaden and Euparkerella, andBrachycephalidae [Izecksohn, 1971; Giarettaand Sawaya, 1998; Darst and Cannatella,2004; Faivovich et al., 2005]11). Regardless,many of the nominal eleutherodactyline gen-era represent rare and extremely difficult an-imals to obtain (e.g., Atopophrynus, Dischi-dodactylus), so our sampling of this partic-ular taxon is clearly inadequate to addressmost systematic problems. We could not ob-tain samples of Adelophryne, Atopophrynus,Dischidodactylus, Euparkerella (even thoughit was suggested to be closely related to Bra-chycephalidae), Geobatrachus, Holoaden,Phyllonastes, or Phyzelaphryne. We hope

11 Dubois (2005) noted that if Brachycephalidae is asynonym of Eleutherodactylinae, as suggested by the re-sults of Darst and Cannatella (2004), the appropriatename for this taxon, within Leptodactylidae, would beBrachycephalinae.

that work in the near future can rectify thiswith the recognition of major monophyleticgroups from within Eleutherodactylus. Whatwe could sample of the non-Eleutherodac-tylus eleutherodactyline taxa were Barycho-los ternetzi, Ischnocnema quixensis, and twospecies of Phrynopus. Of Eleutherodactylus(sensu lato) we sampled two species of theNorth American subgenus Syrrhophus(Eleutherodactylus marnocki of the E. mar-nocki group of J.D. Lynch and Duellman,1997, and E. nitidus of the E. nitidus groupof J.D. Lynch and Duellman, 1997); one spe-cies of the Antillean subgenus Euhyas(Eleutherodactylus planirostris of the E. ri-cordii group of J.D. Lynch and Duellman,1997); two species of the South Americansubgenus Eleutherodactylus (E. binotatusand E. juipoca, both of the E. binotatusgroup of J.D. Lynch, 1978a; see also J.D.Lynch and Duellman, 1997); and six speciesof the Middle American subgenus Craugas-tor12 (E. bufoniformis of the E. bufoniformisgroup of J.D. Lynch, 2000, E. alfredi of theE. alfredi group of J.D. Lynch, 2000, E. au-gusti of the E. augusti group of J.D. Lynch,2000, E. pluvicanorus of the E. fraudatorgroup of Kohler, 2000, E. punctariolus andE. cf. ranoides13 of the E. rugulosus groupof J.D. Lynch, 2000) and E. rhodopis of theE. rhodopis group of J.D. Lynch, 2000). (Forexpediency, all of these are noted in ‘‘Re-sults’’ in combination with their subgenericnames; e.g., Eleutherodactylus (Syrrhophus)marnockii is treated as Syrrhophus marnock-ii.) As noted earlier, we expect that Eleuth-erodactylus will be found to be paraphyleticwith respect to a number of other eleuther-odactyline taxa (e.g., Barycholos, Phrynopus,and Ischnocnema) and hope that this selec-tion will allow some illumination of this.

12 Craugastor was recently considered to be a genusby Crawford and Smith (2005) and we follow that ar-rangement, although we refer to Craugastor in this sec-tion and elsewhere as part of Eleutherodactylus (sensulato) for consistency with the immediately relevant lit-erature.

13 We report this species as Craugastor cf. ranoides,because we discovered late in this project that the vouch-er specimen was lost. However, the identification in theassociated field notes was ‘‘Eleutherodactylus rugulo-sus’’ and the only member of the rugulosus group (andof Craugastor) otherwise in that collection and from thatregion is Craugastor ranoides.


Nevertheless, we are aware that this tinyfraction of the species diversity of Eleuth-erodactylus is insufficient to fully resolve thephylogeny of this massive taxon and that thevalue of the results will be in highlightingoutstanding problems and providing a basisfor future, more densely sampled studies.

LEPTODACTYLINAE (12 GENERA, 159 SPE-CIES): Monophyly of this group is supportedby the possession of foam nests (except inLimnomedusa [Langone, 1994] and Pseudo-paludicola [Barrio, 1954], and in some spe-cies of Pleurodema [Duellman and VelosoM., 1977]) and the presence of a bony ster-num (rather than the cartilaginous sternum ofother leptodactylids; J.D. Lynch, 1971).However, Haas (2003; fig. 15) sampled threespecies of Leptodactylinae (Physalaemus bi-ligonigerus, Leptodactylus latinasus, andPleurodema kriegi) for mostly larval mor-phology and found the group to be para- orpolyphyletic with respect to Odontophrynus,and with Physalaemus14 and Pleurodemaforming, respectively, more exclusive out-groups of Haas’ hylodines and dendrobatids.In Darst and Cannnatella’s (2004) phyloge-netic analysis of mtDNA (fig. 22), their lep-todactyline exemplars are monophyletic inthe maximum-likelihood analysis of mtDNA,but polyphyletic in the parsimony analysis.In Faivovich et al.’s (2005; fig. 24) parsi-mony analysis of multiple mtDNA andnuDNA loci, exemplars of most genera ofLeptodactylinae obtained as monophyletic,with the exception of Limnomedusa. There-fore, the monophyly of Leptodactylinae is anopen question. We could not obtain samplesof Hydrolaetare (or the recently resurrectedEupemphix and Engystomops), but we sam-pled at least one species of each of the othernominal leptodactyline genera: Adenomerahylaedactyla, Edalorhina perezi, Leptodac-tylus fuscus, L. ocellatus, Limnomedusa ma-croglossa, Lithodytes lineatus, Physalaemusgracilis, Pleurodema brachyops, Pseudopa-ludicola falcipes, and Vanzolinius discodac-tylus). Our sampling of Leptodactylus is not

14 Nascimento et al. (2005) recently partitioned Phys-alaemus into Physalaemus, Eupemphix, and Engysto-mops on the basis of phenetic comparisons. Unfortu-nately, the historical reality of these taxa will remainarguable until a phylogenetic analysis is performed onthis group.

dense enough to evaluate well the likely par-aphyly of this taxon with respect to others,such as Adenomera (Heyer, 1998), being re-stricted to only two of the five nominal spe-cies groups. Leptodactylines vary from hav-ing endotrophic larvae, facultatively endotro-phic larvae (Adenomera) to having exotroph-ic, free-living larvae (Edalorhina,Engystomops, Eupemphix, Leptodactylus,Lithodytes, Physalaemus, Pleurodema, Pseu-dopaludicola, Vanzolinius; Altig and Mc-Diarmid, 1999).

‘‘TELMATOBIINAE’’ (11 GENERA, 98 SPE-CIES): Telmatobiinae is a similarity groupingof mostly austral South American frogs. Ascurrently employed, contents of this subfam-ily stem from Laurent’s (1986) formalizationof Heyer’s (1975) informal grouping. Tel-matobiines are currently arranged in threetribes (J.D. Lynch, 1971, 1978b; Burton,1998a): Telmatobiini (Alsodes, Atelognathus,Eupsophus, Hylorina, Insuetophrynus, So-muncuria, and Telmatobius); Batrachylini(Batrachyla and Thoropa); and Calyptoce-phalellini (Batrachophrynus, Caudiverbera,and Telmatobufo). All telmatobiines haveaquatic, exotrophic larvae except Eupsophus,which has endotrophic larvae (Altig andMcDiarmid, 1999), and Thoropa, which issemiterrestrial (Bokermann, 1965; Wassersugand Heyer, 1983; Haddad and Prado, 2005).

Batrachylini (in J.D. Lynch’s sense of in-cluding Thoropa) is diagnosed by having ter-restrial eggs and aquatic to semiterrestriallarvae and T-shaped terminal phalanges.Laurent (1986) did not (apparently) acceptJ.D. Lynch’s (1978b) transferral of Thoropainto Batrachylini, and retained Thoropa inCycloramphinae following Heyer (1975).

Calyptocephalellini was most recently dis-cussed and diagnosed by Burton (1998a) onthe basis of hand musculature, but the char-acter argumentation was essentially that ofoverall similarity, not synapomorphy. For-mas and Espinoza (1975) provided karyolog-ical evidence for the monophyly of Calyp-tocephallelini (although they did not addressBatrachophrynus). Cei (1970) suggested onthe basis of immunology that Calyptoce-phalellini is phylogenetically distant fromleptodactylids, being closer to Heleophryni-dae than to any South American leptodactyl-id group. J.D. Lynch (1978b) suggested the


following to be synapomorphies of Calyp-tocephalellini (composed of solely Caudiv-erbera and Telmatobufo): (1) occipital arteryenclosed in a bony canal; and (2) very broadpterygoid process of the premaxilla. In ad-dition, (1) a very long cultriform process ofthe parasphenoid; and (2) presence of a me-dial process on the pars palatina of the pre-maxilla are osteological characters suggestedby J.D. Lynch possibly to unite Batracho-phrynus with Caudiverbera and Telmatobu-fo.

We sampled representatives of two of thegenera of Calyptocephallelini (Caudiverberacaudiverbera and Telmatobufo venustus). Wecould not sample Batrachophrynus, whichwas considered a calyptocephalelline byBurton (1998a), and in some of the clado-grams presented by J.D. Lynch (1978b) Ba-trachyophrynus was considered to form thesister taxon of his Calyptocephalellini, so itsabsence from our analysis is unfortunate.

‘‘Telmatobiini’’ of J.D. Lynch (1978b) isexplicitly paraphyletic with respect to Batra-chylini and as such has no diagnosis otherthan that of the inclusive clade ‘‘Telmatobi-ini’’ 1 Batrachylini: (1) presence of an outermetatarsal tubercle (dubiously synapomorph-ic), and (2) reduction of imbrication on theneural arches of the vertebrae. Among spe-cies of ‘‘Telmatobiini’’ we sampled Alsodesgargola, Atelognathus patagonicus, Eupso-phus calcaratus, Hylorina sylvatica, Telma-tobius jahuira, T. cf. simonsi, and T. sp. OfBatrachylini, we sampled Batrachyla lepto-pus. On this basis we provide a weak test oftelmatobiine relationships with regard to Ba-trachylini. We were unable to sample anymember of Insuetophrynus or Somuncuria.

‘‘HEMIPHRACTINAE’’ (5 GENERA, 84 SPE-CIES): Mendelson et al. (2000) provided acladogram of Hemiphractinae but assumedits monophyly and its hylid affinities, as hadall authors since Duellman and Gray (1983)and Duellman and Hoogmoed (1984). Haas(2003) suggested (fig. 15), on the basis ofmorphological data, that his examplar ofHemiphractinae, Gastrotheca, was far fromother hylids and imbedded within a heter-eogeneous group of leptodactylids and ran-oids. Darst and Cannatella (2004), who ex-amined one exemplar species each of Gas-trotheca and Cryptobatrachus, suggested on

the basis of mtDNA evidence that Hemi-phractinae is polyphyletic, with Cryptobatra-chus closest to direct-developing eleuthero-dactylines, and Gastrotheca imbedded in an-other group of leptodactylids. Similarly, inthe analysis by Faivovich et al. (2005; fig.24) of multiple mtDNA and nuDNA loci,hemiphractines do not appear as monophy-letic. They recovered one clade composed ofGastrotheca and Flectonotus, one clade com-posed of Stefania and Cryptobatrachus, andthey found Hemiphractus to form a cladewith the few included exemplars of Eleuth-erodactylinae and Brachycephalidae. Further,inasmuch as the sole noncontingent synapo-morphy of nominal Hemiphractinae, bell-shaped larval gills, has not been surveyedwidely in direct-developing leptodactylids,we consider the morphological evidence forthe monophyly of the hemiphractines to bequestionable.

Faivovich et al. (2005; fig. 24) transferred‘‘Hemiphractinae’’ out of a reformulated Hy-lidae and into ‘‘Leptodactylidae’’ on the ba-ses that continued inclusion in Hylidaewould render Hylidae polyphyletic; its nom-inal inclusion in ‘‘Leptodactylidae’’ did noviolence to a taxon already united solely byplesiomorphy and geography; and placing itincertae sedis within Hyloidea was to suggestits possible placement outside of the ‘‘lep-todactylid’’ region of the overall tree, whichit is not. ‘‘Hemiphractinae’’ is a grouping ofSouth American frogs united by (1) broodingof eggs on the female’s back, generally with-in a dorsal depression or well-developedpouch; (2) possession in the developing lar-vae of bell-shaped gills (Noble, 1927); and(3) presence of a broad m. abductor brevisplantae hallucis (Burton, 2004). Larvae maybe exotrophic and endotrophic among spe-cies of Gastrotheca and Flectonotus, and en-dotrophic alone in Cryptobatrachus, Hemi-phractus, and Stefania. Based on Faivovichet al.’s (2005) topology (fig. 24), claw-shaped terminal phalanges and presence ofintercalary cartilages between the ultimateand penultimate phalanges must be consid-ered either convergent with those found inHylidae or plesiomorphically retained in hy-lids (and lost in intervening lineages), whilethe proximal head of metacarpal II not be-tween prepollex and distal prepollex, and the


larval spiracle sinistral and ventrolateral(Duellman, 2001) are convergent with thosein the Phyllomedusinae. Our sampling ofGastrotheca is not dense enough to allow forthe detection of the paraphyly suggested byMendelson et al. (2000). Our sampling pre-cludes evaluation of paraphyly of any of thenominal genera. Nevertheless, we did sampleat least one species per genus, which allowsus to test the monophyly of the hemiphrac-tines based on more extensive outgroup sam-pling. Our sampled taxa are Cryptobatrachussp., Flectonotus sp., Gastrotheca fissipes, G.cf. marsupiata, Hemiphractus helioi, andStefania evansi.

BRACHYCEPHALIDAE (1 GENUS, 8 SPECIES):This tiny group of diminutive south- tosoutheastern Brazilian species are united by(1) the absence through fusion of a distin-guishable sternum; (2) digital reduction (pos-sibly homologous with that in Euparkerellaand Phyllonastes in Eleutherodactylinae);and (3) complete ossification of the epicor-acoid cartilages with coracoids and clavicles(Ford and Cannatella, 1993; Kaplan, 2002).Brachycephalidae was suggested to be im-bedded within Eleutherodacylinae (Izeck-sohn, 1971; Giaretta and Sawaya, 1998),which also shows direct development. Fur-ther, Darst and Cannatella (2004; fig. 22)provided molecular data to link this taxon toEleutherodactylinae, but continued its rec-ognition despite the demonstrable paraphylythat its recognition requires. Although thereare several named and unnamed species inthe genus, the monophyly of the group is notin question (Kaplan, 2002), and we sampledthe type species, Brachycephalus ephippium,for this study.

RHINODERMATIDAE (1 GENUS, 2 SPECIES): Asnoted earlier, the Chilean Rhinodermatidae isa likely satellite of a paraphyletic ‘‘Lepto-dactylidae’’; it is like them in having pro-coelous and holochordal vertebrae. J.D.Lynch (1973) conjectured that Rhinoderma-tidae is the sister taxon of Bufonidae, where-as Lavilla and Cei (2001) suggested that Rhi-noderma is within the poorly-defined ‘‘Tel-matobiinae’’ (‘‘Leptodactylidae’’). The onlynotable synapomorphy of Rhinodermatidaeis the rearing of tadpoles within the vocalsacs of the male, although Manzano and Lav-illa (1995) also discussed myological char-

acters that are possible synapomorphies. Twospecies are currently recognized, Rhinoder-ma darwinii and R. rufum. We sampled R.darwinii.

DENDROBATIDAE (CA. 11 GENERA, 241 SPE-CIES): The monophyly of Dendrobatidae hasbeen upheld consistently (e.g., Myers andFord, 1986; Ford, 1993; Haas, 1995; Cloughand Summers, 2000; Vences et al., 2000b),but different datasets place Dendrobatidae atvarious extremes within the neobatrachianclade. It is either nested deeply within hy-loids and arguably related to cycloramphineleptodactylids (Noble, 1926, 1931; J.D.Lynch, 1971, 1973; Burton, 1998a; Haas,2003; Faivovich et al., 2005); the sister groupof Telmatobius (Vences et al., 2003b); orclosely related to Hylinae (Darst and Can-natella, 2004). Alternatively, they have beensuggested to be deeply imbedded within ran-oids, usually considered close to arthrolep-tids or petropedetids (Griffiths, 1959b, 1963;Duellman and Trueb, 1986; Ford, 1993; Fordand Cannatella, 1993; Grant et al., 1997).Rigorous evaluation of the support for thesecontradictory hypotheses is required.

Ford and Cannatella (1993; fig. 14) pro-vided the following as synapomorphies ofDendrobatidae: (1) retroarticular process pre-sent on the mandible; (2) conformation of thesuperficial slip of the m. depressor mandib-ulae; and (3) cephalic amplexus. They men-tioned other features suggested by other au-thors but that were suspect for one reason oranother. Haas (2003; fig. 15) considered thefollowing to be synapomorphies that nestDendrobatidae within hylodine leptodactyl-ids: (1) guiding behavior observed duringcourtship; and (2) T- or Y-shaped terminalphalanges. Like most other frogs, most den-drobatids have aquatic free-living tadpoles(with some endotrophy in Colostethus), al-though the parental-care behavior of carryingtadpoles to water on the back of one of theparents appears to be synapomorphic (Altigand McDiarmid, 1999), although amongNew World anurans it also occurs in Cyclor-amphus stejnegeri (Heyer and Crombie,1979).

Taxon sampling was designed to providethe maximal ‘‘spread’’ of phylogenetic vari-ation with a minimum number of species: Al-lobates femoralis, Ameerega boulengeri, Co-


lostethus undulatus, Dendrobates auratus,Mannophryne trinitatis, Minyobates clau-diae, Phobobates silverstonei, and Phyllo-bates lugubris. We did not sample any rep-resentative of Aromobates, Cryptophylloba-tes, Nephelobates, nor did we sample eitherof two generally-not-recognized genera Oop-haga or Ranitomeya. On the basis of ongo-ing work by T. Grant, we think that all ofthese are imbedded within our sampled gen-era and their absence does not hamper ourability to test dendrobatid monophyly andplace the family in the larger phylogeneticscheme.

ALLOPHRYNIDAE (1 GENUS, 1 SPECIES):South American Allophryne has been (1)very provisionally associated with Hylidae(J.D. Lynch and Freeman, 1966); (2) assertedto be in Bufonidae on the basis of morphol-ogy (Laurent, 1980 ‘‘1979’’; Dubois, 1983;Laurent, 1986), the evidence for this latterposition not actually presented until muchlater by Fabrezi and Langone (2000); (3) im-bedded within Centrolenidae, on the basis ofmorphology (Noble, 1931); or (4) placed asthe sister taxon of Centrolenidae on the basisof mtDNA sequence studies (Austin et al.,2002; Faivovich et al., 2005). Cognoscenti offrogs will marvel at the vastness separatingthese various hypotheses. Ford and Canna-tella (1993) noted that Allophryne lacks theinteracalary cartilages of hylids and centro-lenids and suggested that placement in anytaxon other than Neobatrachia is misleading.Haas (2003; fig. 15) did not examine Allo-phryne. We sampled the single species, Al-lophryne ruthveni. Larvae are unknown (Al-tig and McDiarmid, 1999).

CENTROLENIDAE (3 GENERA, 139 SPECIES):Centrolenidae has long been thought to beclose to, or the sister taxon of, Hylidae (J.D.Lynch, 1973; Ford and Cannatella, 1993;Duellman, 2001) because of the occurrenceof interacalary cartilages between the ulti-mate and penultimate phalanges. On the ba-sis of mostly-larval morphology, Haas(2003) recovered (weakly) Centrolenidae asthe sister taxon of all Neobatrachia except forLimnodynastes (Limnodynastidae), becauseit lacked all characters that Haas’ analysissuggested were synapomorphies of Neoba-trachia. The analysis of Faivovich et al.(2005; fig. 24) of multiple mtDNA and

nuDNA loci recovered an Allophryne 1 Cen-trolenidae clade nested within a grade of‘‘Leptodactylidae’’. Clearly, the diversity ofopinions on the placement of Centrolenidaeis great. For our analysis we selected speciesof the three nominal genera: Centrolene gec-koideum, C. prosoblepon, Cochranella be-jaranoi, and Hyalinobatrachium fleischman-ni. Larvae of centrolenids are aquatic or bur-rowing exotrophs (Altig and McDiarmid,1999).

HYLIDAE (48 GENERA, 806 SPECIES): Hyli-dae, as traditionally recognized, was recentlyshown to be polyphyletic (Ruvinsky andMaxson, 1996; Haas, 2003; Darst and Can-natella, 2004; Faivovich et al., 2005). As aninterim measure to resolve this problem Fai-vovich et al. (2005) transferred ‘‘Hemiphrac-tinae’’ into ‘‘Leptodactylidae’’, therebyrestricting Hylidae to the Holarctic and Neo-tropical Hylinae, tropical American Phyllo-medusinae, and Australo-Papuan Pelodrya-dinae (and thereby formalizing the implica-tion of Darst and Cannatella, 2004).

Our notions of hylid relationships extendfrom the recent revision by Faivovich et al.(2005; fig. 24), who provided a phylogeneticanalysis of multiple mtDNA and nuDNAloci. Their study addressed 220 hylid exem-plar terminals as well as 48 outgroup taxa.For our study, we considered including allterminals from the Faivovich et al. (2005)study, which would have allowed a more rig-orous test, but the increased computationalburden was judged too great for the expectedpayoff of increased precision within Hylinae.Our sampling strategy aimed to be sufficient-ly dense to test the position of hylids amongother frogs and the monophyly of the majorclades without unduly exacerbating compu-tational problems.

HYLINAE (38 GENERA, 586 SPECIES): Oursampling structure of Hylinae was guided bythe results of Faivovich et al. (2005). Beyondtheir genetic evidence, monophyly of thissubfamily is corrobated by at least one mor-phological synapomorphy: tendo superfici-alis digiti V (manus) with an additional ten-don that arises ventrally from the m. palmarislongus (Da Silva In Duellman, 2001). All hy-lines for which it is known have free-livingexotrophic larvae (Altig and McDiarmid,1999). Faivovich et al. (2005) recognized


four monophyletic tribes within Hylinae: Co-phomantini (Aplastodiscus, Bokermannohy-la, Hyloscirtus, Hypsiboas, and Myersiohy-la); Hylini (Acris, Anotheca, Bromeliohyla,Charadrahyla, Duellmanohyla, Ecnomiohy-la, Exerodonta, Hyla, Isthmohyla, Megasto-matohyla, Pseudacris, Plectrohyla, Ptychoh-yla, Smilisca [including former Pternohyla],Tlalocohyla, and Triprion); Dendropsophini(Dendropsophus, Lysapsus, Pseudis, Scar-thyla, Scinax, Sphaenorhynchus, and Xeno-hyla); and Lophiohylini (Aparasphenodon,Argenteohyla, Corythomantis, Itapotihyla,Nyctimantis, Osteocephalus, Osteopilus,Phyllodytes, Tepuihyla, and Trachycephal-us).

In this study we included representativesof these four tribes: Cophomantini (Aplas-todiscus perviridis, Hyloscirtus armatus, H.palmeri, Hypsiboas albomarginatus, H.boans, H. cinerascens (formerly Hypsiboasgranosus; see Barrio-Amoros, 2004: 13), H.multifasciatus); Dendropsophini (Dendrop-sophus marmoratus, D. minutus, D. nanus,D. parviceps, Lysapsus laevis, Pseudis par-adoxa, Scarthyla goinorum, Scinax garbei, S.ruber, Sphaenorhynchus lacteus); Hylini(Acris crepitans, Anotheca spinosa, Char-adrahyla nephila, Duellmanohyla rufioculis,Ecnomiohyla miliaria, Exerodonta chimala-pa, Hyla arbrorea, H. cinerea, Isthmohyla ri-vularis, Pseudacris crucifer, P. ocularis, Pty-chohyla leonhardschultzei, Smilisca phaeota,Tlalocohyla picta, and Triprion petasatus);and Lophiohylini (Argenteohyla siemersi,Osteocephalus taurinus, Osteopilus septen-trionalis, Phyllodytes luteolus, Trachyce-phalus jordani, and T. venulosus).

PELODRYADINAE (3 GENERA, 168 SPECIES):Knowledge of phylogenetic relationshipsamong Australo-Papuan hylids is poorly un-derstood, beyond the pervasive paraphyly ofnominal ‘‘Litoria’’ with respect to the othertwo genera, Nyctimystes and Cyclorana (Ty-ler and Davies, 1978; King et al., 1979; Ty-ler, 1979; Maxson et al., 1985; Hutchinsonand Maxson, 1987; Haas and Richards, 1998;Haas, 2003; Faivovich et al., 2005). Faivov-ich (2005) noted one morphological syna-pomorphy of Phyllomedusinae 1 Pelodry-adinae, the presence of a tendon of the m.flexor ossis metatarsi II arising only fromdistal tarsi 2–3. Evidence for the monophyly

of Pelodryadinae remains unsettled. Haas(2003), on the basis of six exemplars, recov-ered the subfamily as paraphyletic with re-spect to hylines and phyllomedusines. Tyler(1971c) noted the presence of supplementaryelements of the m. intermandibularis in bothPelodryadinae (apical) and Phyllomedusinae(posterolateral). These characters were inter-preted by Duellman (2001) as nonhomolo-gous and therefore independent apomorphiesof their respective groups. If these conditionsare homologues as suggested by Faivovich etal. (2005) on the basis of their preferred clad-ogram, the polarity between the two charac-ters is ambiguous because either the pelod-ryadine or the phyllomedusinae conditionmight be ancestral for Phyllomedusinae 1Pelodryadinae. Because our study aims toprovide a general phylogenetic structure foramphibians, not to resolve all systematicproblems, and in light of ongoing researchby S. Donnellan, we have not sampled ‘‘Li-toria’’ densely enough to provide a detailedresolution of relationships within Pelodry-adinae. Nevertheless, we sampled denselyenough to provide additional evidence re-garding the paraphyly of ‘‘Litoria’’ with re-spect to Cyclorana or Nyctimystes. Speciessampled in this group are Cyclorana aus-tralis, ‘‘Litoria’’ aurea, ‘‘L.’’ freycineti, ‘‘L.’’genimaculata, ‘‘L.’’ inermis, ‘‘L.’’ lesueurii,‘‘L.’’ meiriana, ‘‘L.’’ nannotis, Nyctimystesdayi, and N. pulcher. All pelodryadines ap-pear to have free-living exotrophic larvae(Tyler, 1985; Altig and McDiarmid, 1999).

PHYLLOMEDUSINAE (7 GENERA, 52 SPECIES):There is abundant morphological and molec-ular evidence for the monophyly and phylo-genetic structure of this subfamily of bizarrefrogs. Synapomorphies of the group include:(1) vertical pupil; (2) ventrolateral positionof the spiracle; (3) arcus subocularis of larvalchondrocranium with distinct lateral process-es; (4) ultralow suspensorium; (5) secondaryfenestrae parietales; and (6) absence of a pas-sage between the ceratohyal and the cerato-branchial I (Haas, 2003). Faivovich et al.(2005) discussed several other characterslikely to be synapomorphies of Phyllome-dusinae. Faivovich et al. (2005) demonstrat-ed on the basis of molecular data that Cru-ziohyla is the sister taxon of the remaininggenera, which are further divided in two



←

Fig. 25. A, Consensus tree of Bufonidae from Graybeal (1997). The tree reflects a parsimony anal-ysis of DNA sequence data. Sequences used were primarily of mtDNA gene regions 12S and 16S (totalof 1672 bp, aligned, for 50 species), with the addition of the protein coding mtDNA gene cytochromeb (390 bp for 19 species) and the nuDNA protein-coding gene c-mos (280 bp for 7 species). The protein-coding genes were aligned manually according to the amino-acid sequence, while the rDNA sequenceswere performed manually with reference to assumed secondary structure, with gaps excluded as evi-dence. Length of the component trees is 3,862 steps, ci 5 0.305, ri 5 0.392. Cunningham and Cherry(2004: 681) noted that her 16S DNA sequences of Bufo garmani (U52746) are Bufo gutturalis; her Bufovertebralis (U52730) sequences are of B. maculatus, and her B. maculatus sequences are likely not ofB. maculatus, but of another species, unidentified by them. B, Consensus tree of Bufonidae from Gray-beal (1997) based on DNA sequence data (from A) and morphological data (undisclosed).

clades, one containing Phasmahyla and Phyl-lomedusa, and the other containing the re-maining genera (Agalychnis, Hylomantis,Pachymedusa, and Phrynomedusa). Our tax-on sampling reflects this understanding: Aga-lychnis callidryas, Cruziohyla calcarifer,Phasmahyla guttata, and Phyllomedusa vail-lanti.

BUFONIDAE (35 GENERA, 485 SPECIES): Bu-fonidae is a worldwide hyloid clade of non-controversial monophyly, although the 35genera for the most part are weakly diag-nosed (e.g., Andinophryne, Bufo, Crepido-phryne, Pelophryne, and Rhamphophryne).Ford and Canntella (1993) suggested the fol-lowing synapomorphies for Bufonidae: (1)presence of a Bidder’s organ (although ab-sent in Melanophryniscus [Echeverria, 1998]and Truebella [Graybeal and Cannatella,1995]); (2) unique pattern of insertion of them. hyoglossus; (3) absence of the m. con-strictor posterior (Trewevas, 1933); (4) teethabsent (also in some basal telmatobiines, Al-lophryne, some dendrobatids, and some rha-cophorids); (5) origin of the m. depressormandibulae solely from the squamosal andassociated angle or orientation of the squa-mosal (Griffiths, 1954; also in several otheranurans—see Manzano et al., 2003); (6)presence of an ‘‘otic element’’, an indepen-dent ossification in the temporal region thatfuses to the otic ramus of the squamosal(Griffiths, 1954; also known in two generaof Ceratophryini, Ceratophrys and Chaco-phrys, but unknown in Lepidobatrachus—Wild, 1997, 1999). Ford and Cannatella(1993) considered characters 2–6 to be in-sufficiently surveyed but likely synapo-morphic. Da Silva and Mendelson (1999)

also noted the possibility that the possessionof inguinal fat bodies and having a xiphi-sternum free from the underlying m. rectusabdominis are synapomorphies of Bufonidae,or some subtaxon of that group.

Dubois (1983, 1987 ‘‘1985’’) recognizedfive nominal subfamilies, not predicated onany phylogenetic hypothesis or, seemingly,any concern for monophyly (Graybeal andCannatella, 1995; Graybeal, 1997).

Graybeal and Cannatella (1995) provideda discussion of the monophyly of most of thegenera within Bufonidae that is extremelyuseful. They noted that many bufonid generaare monotypic and therefore not eligible fortests of monophyly: Altiphrynoides Dubois,1987 ‘‘1986’’; Atelophryniscus McCranie,Wilson, and Williams, 1989; Bufoides Pillaiand Yazdani, 1973; Crepidophryne Cope,1889; Didynamipus Andersson, 1903, Fros-tius Cannatella, 1986; Laurentophryne Tih-en, 1960; Mertensophryne Tihen, 1960; Me-taphryniscus Senaris, Ayarzaguena, and Gor-zula, 1994; Pseudobufo Tschudi, 1838;Schismaderma Smith, 1849; and Spinophry-noides Dubois, 1987 ‘‘1986’’.

Graybeal and Cannatella (1995) noted thatmany genera lack evidence of monophyly:Adenomus Cope, 1861 ‘‘1860’’; Andinophry-ne Hoogmoed, 1985; Bufo Laurenti, 1768;Nectophrynoides Noble, 1926; PedostibesGunther, 1876 ‘‘1875’’; Pelophryne Barbour,1938; Peltophryne Fitzinger, 1843; Rham-phophryne Trueb, 1971; Stephopaedes Chan-ning, 1979 ‘‘1978’’; and WolterstorffinaMertens, 1939. Graybeal and Cannatella(1995) noted the following genera to showevidence of monophyly: Ansonia Stoliczka,1870; Atelopus Dumeril and Bibron, 1841;


Capensibufo Grandison, 1980; Dendrophryn-iscus Jimenez de la Espada, 1871 ‘‘1870’’;Leptophryne Fitzinger, 1843; Melanophryn-iscus Gallardo, 1961; Nectophryne Buchholzand Peters, 1875; Nimbaphrynoides Dubois,1987 ‘‘1986’’; Oreophrynella Boulenger,1895; Osornophryne Ruiz-Carranza and Her-nandez-Camacho, 1976; Truebella Graybealand Cannatella, 1995; and Werneria Poche,1903.

Graybeal (1997) provided the latest esti-mate of phylogeny within the entire Bufon-idae. Unfortunately, although the morpholog-ical results were presented, the morphologi-cal data matrix and morphological transfor-mation series were not, though theypresumably are available in her unpublisheddissertation (Graybeal, 1995). Her DNA se-quence data and analytical methods are avail-able, however. There have been serious res-ervations published about the quality ofGraybeal’s 16S sequence data (Harris, 2001;Cunningham and Cherry, 2004)15 and the pa-per was largely a narrative largely focusedon comparing parsimony, maximum-likeli-hood, and neighbor-joining techniques. Forour discussion we present two of her treesthat rest on analytical assumptions similar toour own: (1) a strict consensus of 82 equallyparsimonious trees based on the unweightedmolecular data alone (fig. 25A); and (2) hercombined morphology 1 molecular tree (fig.25B). Her molecular results suggest that, ofthe exemplars treated in that particular tree(fig. 25A), Melanophryniscus is the sistertaxon of all other bufonids, and Atelopus 1Osornophryne form the sister taxon of theremaining bufonids, excluding Melanophryn-iscus. (This would suggest that presence of aBidder’s organ is not a synapomorphy of Bu-fonidae, but of a smaller component of that

15 Harris (2001) was unable to duplicate Graybeal’s16S sequences of Bufo melanostictus and B. calamita,although her sequences still are most similar to otherGenBank sequences of these species. Cunningham andCherry (2004) were unable to duplicate most of her 16Ssequences for the taxa that Cunningham and Cherry(2004) studied; they suggested widespread sequencingerrors in Graybeal’s study. Whether the inclusion of bet-ter-quality sequences would change her results is un-known. Nevertheless, the problems with the DNA se-quences and the nondisclosure of the morphological ev-idence require that her results not be accepted at facevalue.

taxon.) She also suggested that Peltophryne(the Bufo peltocephalus group) is far fromother New World bufonids, that Bufo gar-garizans is far from her other exemplar ofthe B. bufo group (B. bufo), and that the twomembers of the B. viridis group (sensu Inger,1973), B. calamita and B. viridis, are isolatedphylogenetically from each other. Neverthe-less, resolution was not strongly corroborat-ed. The combined morphology 1 molecularanalysis provides less resolution at the baseof the tree and placed Bufo viridis and B.calamita far apart, but it did resolve the Bufobufo group as monophyletic (B. bufo and B.gargarizans being her exemplars). Beyondthat, her results do not offer a great deal ofresolution. Although Graybeal (1997; fig. 25)and, more recently Pauly et al. (2004; see‘‘Taxonomy of Living Amphibians’’) provid-ed estimates of bufonid phylogeny and start-ed to delineate the paraphyly of ‘‘Bufo’’within Bufonidae, taxonomy within ‘‘Bufo’’remains largely parsed among similarity-based species groups (Blair, 1972b; Cei,1972; Inger, 1972; R.F. Martin, 1972). Thesespecies groups have enjoyed considerablepopularity and longevity of use, but, with ex-ceptions, it is not clear whether their recog-nition continues to be helpful in promotingscientific progress, inasmuch as no attemptso far has been made to formulate thesegroups in phylogenetic terms.

Grandison (1981) provided a phylogeneticdata set for African bufonids that she as-sumed were closely related to Didynamipus.Her data were reanalyzed and her tree wascorrected by Graybeal and Cannatella(1995), and this tree is presented herein (fig.26). On the basis of Grandison’s (1981) ev-idence, Dubois (1987 ‘‘1985’’) partitionedformer Nectophrynoides into four nominalgenera: Spinophrynoides (with aquatic lar-vae), Altiphrynoides (with terrestrial larvae),Nectophrynoides (ovoviviparous), and Nim-baphrynoides (viviparous). Graybeal andCannatella’s (1995; fig. 26) reanalysis sug-gests, at least on the basis of Grandison’s(1981) evidence, that ‘‘Nectophrynoides’’(sensu stricto) remains paraphyletic. Necto-phryne and Wolterstorffina also appear par-aphyletic in this tree, although Graybeal andCannatella (1995) suggested additional char-acters in support of the monophyly of Nec-


Fig. 26. Tree from Graybeal and Cannatella’s(1995) parsimony reanalysis of Grandison’s(1981) 24 transformation series of morphology forAfrican bufonids suggested by Grandison (1981)to be related to Didynamipus (length 5 79, ci 50.45, ri 5 0.68), rooted on a hypothetical ancestor.The taxonomy is updated to include genericchanges made by Dubois (1987 ‘‘1985’’) subse-quent to Grandison’s study.

tophryne. This topology may be deeplyflawed, however, because Graybeal’s (1997)tree of morphology and molecules (fig. 25)show that among the exemplars shared withthe study of Grandison (1981), Altiphryno-ides, Didynamipus, Nectophrynoides, andWerneria are not necessarily particularlyclosely related. Didynamipus, in particular, ismore closely related to Asian Pelophryneand South American Oreophrynella than tothe others in the group addressed by Gran-dison (1981).

Cunningham and Cherry (2004) provideda DNA sequence study of putatively mono-phyletic African 20-chromosome Bufo (fig.27). They suggested that the 20-chromosometoads form a monophyletic group with a re-versal to 22-chromosomes in the Bufo par-dalis group (their exemplars being B. par-dalis and B. pantherinus). They also sug-gested that Stephopaedes and Bufo lindneri(a member of the B. taitanus group, long as-sociated with Mertensophryne and Stepho-

paedes) form a monophyletic group, that onthe basis of larval morphology also includesMertensophryne. The sister taxon of thisMertensophryne group they suggested is theBufo angusticeps group, with more distantrelatives being the Bufo vertebralis groupand Capensibufo.

Because of this lack of a corroboratedglobal phylogeny of Bufonidae16, we at-tempted to sample as widely as possible. Thenominal bufonid taxa we, unfortunately,were unable to sample are Adenomus, Alti-phrynoides, Andinophryne, Atelophryniscus,several of the species groups of nominalBufo, Bufoides, Churamiti, Crepidophryne,Frostius, Laurentophryne, Leptophryne,Mertensophryne, Metaphryniscus, Nimba-phrynoides, Oreophrynella, Parapelophryne,Pseudobufo, and Truebella. Several of these(e.g., Andinophryne, Bufoides, and Pseudob-ufo) are likely imbedded within sampled gen-era.

At least some of the bufonids are descrip-tively firmisternal, such as Atelopus, Dendro-phryniscus, Melanophryniscus, Oreophrynel-la, and Osornophryne. Others (Leptophryne)approach this condition (Laurent, 1986; butsee Kaplan, 2004, for discussion of the var-ious meanings of ‘‘firmisterny’’). Some bu-fonids exhibit various kinds of endotrophy:Altiphrynoides (nidicolous; M.H. Wake,1980), Didynamipus (direct development;Grandison, 1981), Laurentophryne (directdevelopment; Grandison, 1981), Nectophry-ne (nidicolous; Scheel, 1970), Nectophryno-ides (oviductal-ovoviviparous; Orton, 1949),Nimbaphrynoides (viviparous; Lamotte andXavier, 1972), Oreophrynella (direct devel-opment; McDiarmid and Gorzula, 1989), andPelophryne (nidicolous; Alcala and Brown,1982). Others are also suspected to have en-dotrophic larvae or direct development: Cre-pidophryne, Dendrophryniscus, Frostius,Metaphryniscus, Osornophryne, Rhampho-phryne, Truebella, and Wolterstorffina (Peix-oto, 1995; Thibaudeau and Altig, 1999). Un-fortunately, our inability to sample any ofthese taxa other than Didynamipus, Necto-

16 The study by Pauly et al. (2004) appeared duringthe writing phase of this study and therefore did notinfluence our taxon sampling. We comment on that pa-per in the Taxonomy section.


phryne, Nectophrynoides, Osornophryne, Pe-lophryne, Rhamphophryne, and Wolterstorf-fina prevents us from elucidating the detailsof the evolution of life history in this groupor the considerable morphological variationin bufonid larvae, including such things asfleshy accessory respiratory structures on thehead (e.g., on Stephopaedes, Mertensophry-ne, Bufo taitanus) and flaps on the head(Schismaderma).

Regardless of the taxa we could not in-clude, we were able to sample a worldwideselection of 62 bufonid species: Ansonia lon-gidigitata, A. muelleri, Atelopus flavescens,A. spumarius, A. zeteki, Bufo alvarius, B. am-boroensis, B. andrewsi, B. angusticeps, B.arenarum, B. cf. arunco, B. asper, Bufo as-pinia, B. biporcatus, B. boreas, B. brauni, B.bufo, B. camerunensis, B. celebensis, B. cog-natus, B. coniferus, B. divergens, B. galeatus,B. granulosus, B. guttatus, B. gutturalis, B.haematiticus, B. latifrons, B. lemur, B. ma-culatus, B. margaritifer, B. marinus, B. ma-zatlanensis, B. melanostictus, B. nebulifer, B.punctatus, B. quercicus, B. regularis, B.schneideri, B. spinulosus, B. terrestris, B.tuberosus, B. viridis, B. woodhousii, Capen-sibufo rosei, C. tradouwi, Dendrophryniscusminutus, Didynamipus sjostedti, Melano-phryniscus klappenbachi, Nectophryne afra,N. batesi, Nectophrynoides tornieri, Osor-nophryne guacamayo, Pedostibes hosei, Pe-lophryne brevipes, Rhamphophryne festae,Schismaderma carens, Stephopaedes anotis,Werneria mertensi, and Wolterstorffina par-vipalmata. This sampling, while not denseoverall given the size of Bufonidae, allows arigorous test of the monophyly and place-ment of Bufonidae among anurans, as wellas a minimal test of the monophyly and re-lationships of many groups. Most important,the results, together with the obvious defi-ciencies in taxon sampling, will provide anexplicit reference point for future, more thor-ough studies of the internal phylogeneticstructure of Bufonidae.

RANOIDEA: Ranoidea is an enormous groupof frogs, arguably monophyletic, groupedlargely on the basis of one complex morpho-logical character of the pectoral girdle (i.e.,firmisterny, the fusion of the epicoracoid car-tilages), except where considered to be non-homologous (possibly Dendrobatidae, some

bufonids and pipids; see Kaplan, 1994, 1995,2000, 2001, 2004, for discussion). In addi-tion, most ranoids are reported as diplasio-coelous, although the definitions of amphi-coely, anomocoely, procoely, diplasiocoely,as well as ectochordy (5 perichordy), epi-chordy, holochordy, and stegochordy (5 ep-ichordy) in frogs remains controversial17.Ranoidea contains noncontroversially Ar-throleptidae, Astylosternidae, Hemisotidae,Hyperoliidae, Mantellidae, Microhylidae, Pe-tropedetidae, Ranidae, and Rhacophoridae.More controversially included (see above) isDendrobatidae, which is placed by variousauthors within Hyloidea. Haas (2003; fig. 15)did not recover Ranoidea as monophyletic inhis analysis of larval characteristics, insteadfinding major ranoid groups (e.g., ranids,rhacophorids, hemisotids 1 hyperoliids 1microhylids) interspersed among various hy-loid groups (e.g., Physalaemus, Pleurodema,Odontophrynus 1 Leptodactylus, and bufon-ids). Discussing the evidence that supportsthe monophyly of the various ranoid groupsis extremely difficult, partly because of thehighly contingent nature of the evidence and,more commonly because historically thegroups were assembled on the basis of over-all similarity or special pleading for specificcharacteristics.

As understood by most workers, the ques-tions regarding Ranoidea fall into two cate-gories: (1) What are the phylogenetic rela-tionships within Microhylidae?; and (2)What are the phylogenetic relationships with-in ‘‘Ranidae’’ (sensu lato as including allother ranoid subfamilial and familial taxa).The possibility of paraphyly of ‘‘Ranidae’’(sensu lato) with respect to Microhylidaedoes not seem to have been considered se-riously. We know of no definitive evidencethat would reject this hypothesis, althoughmicrohylids predominantly have broadly di-lated sacral diapophyses, a presumed ple-

17 Several authors (Griffiths, 1959b, 1963; Tihen,1965; Kluge and Farris, 1969) considered the amphicoe-lous-anomocoelous-procoelous-diplasiocoelous condi-tions delimited by Nicholls (1916) to have been over-simplified and over-generalized. See Kluge and Farris(1969) for discussion, but also see comments by J.D.Lynch (1973: 140) and Haas (2003: 74), who disagreedwith various statements by Kluge and Farris, includingtheir assertion regarding the continuum of variation be-tween epichordy and perichordy.


Fig. 27. Implied consensus of two most parsimonious trees of African toads studied by Cunninghamand Cherry (2004), showing 22N → 20N transition point and reversal to 22N in the Bufo pardalis group,and alternative placements of Bufo maculatus. The underlying data are sequences from mtDNA (12S,16S, ND2, and the tRNA genes flanking ND2) and nuDNA (ACTC and rhodopsin). Alignment of 12Sand 16S were made initially with ClustalX (Thompson et al., 1997), costs not disclosed, and adjustedmanually, guided by models of secondary structure. Alignment of coding, tRNA and intron sequencesinvolved so few length variables that these were done manually. Gaps and missing data were treated asunknowns. Outgroups not show in tree: Dendropsophus labialis (Hylidae); Euhyas cuneata (Leptodac-tylidae: Eleutherodactylinae), Limnodynastes dorsalis (Limnodynastidae); Heleophryne natalensis (12Sonly; Heleophrynidae); H. purcelli (16S only; Heleophrynidae); Nesomantis thomasetti (Sooglossidae);Rana temporaria (Ranidae).

siomorphy, and ranoids predominantly haveround sacral diapophyses (Noble, 1931; J.D.Lynch, 1973), although in the absence of anexplicit cladogram the optimization of thistransformation and the number of conver-gences is questionable. Nevertheless, we willrestrict our comments to the ranoids, exclud-

ing microhylids, while noting that any studyof ranoid phylogenetics must address the po-sition of microhylids within the ranoidframework.

Within the nonmicrohylid ranoid group,modern progress in our understanding mustbe dated from the publication of Dubois


(1981), in which he presented a discussion ofranoid nomenclature with reference to the at-tendant published morphological diversity ofRanidae as then understood. Although non-phylogenetic in outlook, subsequent papersby Dubois (1983, 1984b, 1987 ‘‘1985’’,1992) provided workers with phenotypicgroupings and a working taxonomy that inearlier manifestations, at least, were useful asrough approximations of phylogeneticgroups. This approach was criticized for itslack of a phylogenetic rationale and overgen-eralization of characters (Inger, 1996). Butbecause there was little else with which towork, the taxonomies of Dubois have beeninfluential. The most substantive differencesbetween Dubois’ classifications (e.g., Du-bois, 1992, 2005) and those of other authors(e.g., Vences and Glaw, 2001) revolvearound category-rank differences, particular-ly with respect to the rank and content ofRhacophoridae (variably including Mantelli-dae as a subfamily, or as Rhacophorinaeplaced as a subfamily within Ranidae or withMantellidae and Rhacophoridae as distinctfamilies), with the status of the various com-ponents of ‘‘Ranidae’’ left as an open ques-tion. With the exception of the recent papersby Marmayou et al. (2000) and Roelants etal. (2004), which dealt only with Asian taxa,and Van der Meijden et al. (2005), which fo-cused on an African clade, no comprehensiveattempt has been made to address the phy-logenetics of the entire Ranoidea.

ARTHROLEPTIDAE, ASTYLOSTERNIDAE, AND

HYPEROLIIDAE: Arthroleptidae, Astylosterni-dae, and Hyperoliidae are poorly understoodAfrican families that have been joined andseparated by various authors (Dubois, 1981;Laurent, 1984b; Dubois, 1987 ‘‘1985’’,1992) and even suggested to be related to atleast two microhylid subgroups, Scaphio-phryninae (Laurent, 1951) and Brevicipitinae(Van der Meijden et al., 2004). Ford andCannatella (1993) regarded Arthroleptidae(sensu Dubois, 1981; including Astyloster-nidae) as a metataxon (Donoghue, 1985; Es-tes et al., 1988; Archibald, 1994), eventhough no evidence was suggested to supportthe monophyly of a group composed of Ar-throleptidae and Astylosternidae and as orig-inally proposed was considered to be para-phyletic (Laurent, 1951) with respect to Hy-

peroliidae (Hyperoliinae in Laurent’s usage).Laurent (1986) suggested that the groupcomposed of Arthroleptidae, Astylosternidae,and Hyperoliidae is distinguished from Ran-idae (sensu lato) by having: (1) a cartilagi-nous metasternum without a bony style (pre-sumably plesiomorphic at this level of gen-erality); (2) second carpal free; (3) third dis-tal tarsal free; (4) terminal phalangesgenerally hooked; (5) pupil usually vertical(usually horizontal in Hyperoliinae, althoughvertical in some—e.g., Afrixalus, Heterixal-us, Kassina, Phlyctimantis; vertical in Lep-topelinae); and (7) metatarsal tubercle absentor poorly developed. None of these charac-ters is demonstrably synapomorphic.

ARTHROLEPTIDAE (SENSU DUBOIS, 1992; 3GENERA, 49 SPECIES): Laurent and Fabrezi(1986 ‘‘1985’’) provided a discussion of thephylogeny of genera within this African tax-on and suggested a relationship of (Arthro-leptis 1 Coracodichus) 1 (Cardioglossa 1Schoutedenella), although the evidence forthis scenario is unclear. Like astylosterninesand hyperoliids, arthroleptids possess a car-tilaginous sternum, a vertical pupil (horizon-tal in most hyperoliines), and a free seconddistal carpal, all of which are questionable asto level of universality and polarity. Themonophyly of this taxon has never been rig-orously tested by phylogenetic analysis with-in a well-sampled larger group although Bijuand Bossuyt (2003; fig. 21), on the basis ofa relatively small sampling of frogs foundHyperoliidae to be polyphyletic, and Venceset al.’s (2003c; figs. 28, 29) analysis ofmtDNA suggested that Arthroleptis, Schou-tedenella, and Cardioglossa form a clade, ei-ther as the sister taxon of Astylosternidae 1Leptopelinae, or as the sister taxon of Hy-peroliinae. We sampled: Arthroleptis tanneri,A. variabilis, Cardioglossa gratiosa, C. leu-comystax, Schoutedenella schubotzi, S. syl-vatica, S. taeniata, and S. xenodactyloides.We were unable to sample a member of Cor-acodichus (if recognized as distinct from Ar-throleptis). Within Arthroleptidae, Arthrolep-tis, Schoutedenella, and Coracodichus havedirect development (Laurent, 1973), but Car-dioglossa have free-living, feeding larva (La-motte, 1961; Amiet, 1989; Altig and Mc-Diarmid, 1999; Thibaudeau and Altig, 1999).

ASTYLOSTERNIDAE (5 GENERA, 29 SPECIES):


Fig. 28. Maximum-likelihood tree of hyperoliid, arthroleptid, and astylosternid frogs provided byVences et al. (2003c). A, Maximum-likelihood analysis of 12S rRNA molecule (187 informative sites)analyzed under a GTR substitution model (cost functions reported) suggested by Modeltest (Posada andCrandall, 1998). Initial alignments under Clustal software, costs not disclosed, and subsequently adjustedmanually. Highly variable regions and gaps were excluded as evidence. B, Maximum-likelihood treesbased on 138 informative sites of 16S rRNA molecule under a GTR substitution model (cost functionsreported) for hyperoliids, arthroleptids, and astylosternids. Initial alignments were made under Clustal,costs not disclosed, and subsequently adjusted manually. Highly variable regions and gaps sites wereexcluded as evidence.

The African Astylosternidae traditionally hasbeen allied with Arthroleptidae and Hyper-oliidae (see above), although the evidentiaryjustification for this appears to be overallsimilarity rather than synapomorphy. Like ar-

throleptines and hyperoliids, astylosternidshave a cartilaginous sternum, a vertical pupil(except in Leptodactylodon), and a free sec-ond distal carpal, all of which are question-able as to level of universality. For our anal-


Fig. 29. Maximum-likelihood tree of Venceset al. (2003c), based on 566 informative sites ofcombined fragments of mitochondrial 16S, 12SrRNA, and cytochome b, analyzed under the as-sumptions of the Tamura-Nei substitution model(cost functions provided). Gaps were not treatedas evidence.

ysis we sampled one species of each nominalgenus: Astylosternus schioetzi, the presum-ably closely related Trichobatrachus robus-tus, and Leptodactylodon bicolor, Nyctibatescorrugatus, and Scotobleps gabonicus.Vences et al. (2003c; figs. 28, 29) suggestedon the basis of mtDNA evidence that Lep-topelinae (Hyperoliidae) is either imbeddedwithin a paraphyletic Astylosternidae or aparaphyletic Arthroleptidae, but they did notexpress this in the taxonomy. Astylosternusand Trichobatrachus have exotrophic aquaticlarvae; in Scotobleps, the larva is unknown;and in Leptodactylodon the exotrophic aquat-ic larva has an upturned mouth presumablyto feed on the surface film (Amiet, 1970).

HYPEROLIIDAE (18 GENERA, 2 SUBFAMILIES,250 SPECIES): The African treefrogs of thefamily Hyperoliidae are currently dividedinto two subfamilies: Hyperoliinae, which isunited by the presence of a gular gland(Drewes, 1984), and Leptopelinae, whichwas found by Vences et al. (2003c18; figs. 28,

18 The various maximum-likelihood trees produced bythis study (Vences et al., 2003c) were not shown. Theauthors provided trees of (1) 471 bp of the 16S rRNA;(2) combined analysis of 415 bp of the cytochrome bgene as well as 409 bp of the 12S and 997 bp of the16S rRNA; and (3) 321 bp of the 12S rRNA gene. Taxonsampling among the three analyses was quite differentand beyond the general conclusion that Hyperoliidae ispolyphyletic, this sampling provided low resolution ofintergeneric relationships.

29) to be more closely related to Astyloster-nidae than to Hyperoliinae. Vences et al.(2003c) further discussed some of the char-acters that Drewes (1984) used in his anal-ysis of the family. Like Hyperoliinae, Lep-topelinae lacks fusion of the second tarsal el-ement and fusion of the second distal carpal(Drewes, 1984; fig. 30). Channing (1989) re-analyzed the morphological data provided byDrewes (1970; fig. 30) and provided differ-ent cladistic interpretations of these data; thisreanalysis and the underlying characters werediscussed in detail by J.A. Wilkinson andDrewes (2000). All hyperoliids for which itis known have free-living exotrophic larvae(Altig and McDiarmid, 1999). With the ex-ception of a partial revision of Hyperolius(Wieczorek et al., 1998; Wieczorek et al.,2000, 2001), only the intergeneric relation-ships within Hyperoliidae have been ad-dressed phylogenetically (Drewes, 1984;Channing, 1989; Richards and Moore, 1998)and paraphyly of Hyperolius and Kassina re-main strong possibilities. Our genetic sam-pling included four species of the sole genusin Leptopelinae (Leptopelis argenteus, L. bo-cagei, L. sp., and L. vermiculatus). Of Hy-peroliinae we were less complete, as we werenot able to sample any member of Callixalus,Chlorolius, Chrysobatrachus, Kassinula,Phlyctimantis, or Semnodactylus. Neverthe-less, we were able to obtain genetic samplesof all remaining genera: Acanthixalus spi-nosus, Afrixalus fornasinii, A. pygmaeus, Al-exteroon obstetricans, Heterixalus sp., H. tri-color, Hyperolius alticola, H. puncticulatus,H. tuberilinguis, Kassina senegalensis, Ne-sionixalus thomensis (transferred back intoHyperolius during the course of this study byDrewes and Wilkinson, 2004), Opisthothylaximmaculatus, Phlyctimantis leonardi, andTachycnemis seychellensis.

HEMISOTIDAE (1 GENUS, 9 SPECIES): Rela-tionships of the African taxon Hemisotidaeare also unclear (Channing, 1995). LikeRhinophrynus and Brachycephalus, Hemisuslacks a distinguishable sternum. Haas’ (2003;fig. 15) study of larval morphology found itto be the sister taxon of Hyperoliidae amonghis exemplars. Blommers-Schlosser (1993)suggested on the basis of one morphologicalsynapomorphy (median thyroid gland) thathemisotines should be united with brevicip-


Fig. 30. Hyperoliid relationships suggested byA, Liem (1970) based on 36 dendritic to linearcharacter transformations of morphology and as-suming monophyly of a group composed of hy-peroliids, mantellids, and rhacophorids, the treerooted on a hypothetical ranid; B, Drewes’ (1984)parsimony analysis of 27 morphological charactertransformations, rooted on a hypothetical ancestorconstructed by comparison of a large number ofranids, astylosternids, and arthroleptids (Semno-dactylus was treated as Kassina weali in this pub-lication.); C, Channing’s (1989) parsimony re-analysis (with minor modifications) of the mor-phological data of Drewes (1984).

itine microhylids. That hemisotines and brev-icipitines are quite dissimilar cannot be dis-puted (Channing, 1995; Van Dijk, 2001), andthe putative phylogenetic relationship be-tween the two taxa was corroborated via mo-lecular data only recently (Van der Meijdenet al., 2004; fig. 31), although Loader et al.(2004) could not place with confidence Hem-isus with brevicipitines on the basis ofmtDNA sequence evidence. Emerson et al.(2000b) on the basis of mtDNA and a smallamount of morphology also allied hemisotidswith microhylids, although hemisotids retaina Type IV tadpole unlike the Type II tadpolesof microhylids (or direct development as inbrevicipitines). We sampled only Hemisusmarmoratus, one species of the single genus,of this morphologically compact taxon.

On the basis of the tree of Van der Me-ijden et al. (2004), Dubois (2005) recognizedan enlarged family, Brevicipitidae, composedof six subfamilies: Astylosterninae, Arthro-leptinae, Brevicipitinae, Hemisotinae, Hyper-oliinae, and Leptopelinae. For our discussionwe maintain the older, more familiar taxon-omy.

MICROHYLIDAE (69 GENERA, 432 SPECIES):Microhylidae is a worldwide, arguably well-corroborated taxon (J.D. Lynch, 1973; Star-rett, 1973; Blommers-Schlosser, 1975; Sokol,1975, 1977; Wassersug, 1984; Haas, 2003;but see Van der Meijden et al., 2004 (fig. 31),who suggested that the taxon is paraphyleticwith respect to the hemisotines), although theinternal relationships of Microhylidae arecertainly problematic (Burton, 1986; Zwei-fel, 1986, 2000). The subfamilial taxonomyor taxonomic differentia have not changedmaterially since the revision by Parker(1934), with the exception of the treatmentof Phrynomeridae as a subfamily of Micro-hylidae by J.D. Lynch (1973), the inclusionof the Scaphiophryninae by Blommers-Schlosser (1975), and the demonstration ofthe evolutionary propinquity of Hemisotidaeand Brevicipitinae by Van der Meijden et al.(2004; fig. 31). Beyond the isolation of brev-icipitines from other microhylids, the allo-zyme data of Sumida et al. (2000a) suggestthat the subfamilial definitions and genericassignments within nominal Genyophryninaeand Asterophryninae may require change. In-deed, Savage (1973) had synonymized the


Fig. 31. Maximum-likelihood tree of various ranoids constructed by Van der Meijden et al. (2004)on the basis of 1,566 bp of the nuclear gene RAG-1. Sequence alignment was not reported. Costfunctions of analysis were not provided nor which model of nucleotide evolution (as suggested byModelTest; Posada and Crandall, 1998) was employed in the analysis. The tree was rooted on Xenopuslaevis. We inserted the higher taxonomy on the right to allow easier comparison to other studies dis-cussed in this section.

two subfamilies on the basis of their geo-graphical and morphological similarity.

Savage (1973) suggested that Dyscophinaeis polyphyletic, with the Asian Calluellamore closely related to asterophryines thanto the Madagascan Dyscophus. Blommers-Schlosser (1976) reviewed the controversyand retained Dyscophus and Calluella inDyscophinae. Our taxon sampling allows usto test whether Dyscophinae is monophyleticor diphyletic.

Ford and Cannatella (1993) identified fivelarval synapomorphies for Microhylidae (al-though these cannot be documented in line-ages with direct development such as inbrevicipitines, asterophryines, and geny-ophrynines, so the level of universality of

these characters is questionable): (1) absenceof keratodonts in tadpoles; (2) ventral velumdivided medially; (3) glottis fully exposed onbuccal floor; (4) nares not perforate; and (5)secretory ridges of branchial food traps withonly a single row of secretory cell apices. Inaddition, adults are characterized as having2–3 palatal folds (palatal folds also beingfound in Hemisus). Van de Meijden et al.(2004) suggested on the basis of molecularevidence that Hemisotidae 1 Brevicipitinaeis more closely related to Hyperoliidae, Ar-throleptidae, and Astylosternidae than to anotherwise monophyletic group of microhy-lids (fig. 31). Therefore, the only articulatedquestions so far regarding the monophyly ofMicrohylidae are whether Hemisotidae is im-


Fig. 32. Trees of Asterophryinae suggested byA, Zweifel (1972), based on 9 morphologicaltransformation series and showing alternative po-sitions of Barygeny (tree rooted on a generalizedprimitive hypothetical ancestor); and B, Burton(1986), based on a subjective evaluation of 54transformation series of morphology. This tree re-lects our understanding of Burton’s narrative sum-mary of asterophryine relationships, with the no-menclature updated (Callulops replacing Phryno-mantis). Quotation marks denote nonmonophyly.

bedded within it (see above) or, with Brevi-cipitinae, more closely related to non-micro-hylid groups, although the definition, histor-ical reality, and content of the various sub-families are controversial.

SCAPHIOPHRYNINAE (2 GENERA, 11 SPECIES):The Madagascan microhylid subfamily Sca-phiophryninae has no demonstrable synapo-morphies in support of its monophyly, but ifits monophyly is assumed it is widely con-sidered to be the sister taxon of the remain-ing Microhylidae. At least some authors(e.g., Dubois, 1992) regard it as a distinctfamily. Ford and Cannatella (1993) suggest-ed that larval synapomorphies that place it inassociation with the remaining Microhylidae(at least for those that have larvae) are (1)the possession of a median spiracle in thelarvae; (2) gill filaments poorly developed orabsent; (3) modifications of buccal pumpingmechanisms (short lever arm on ceratohyal,small buccal floor area); (4) absence of m.suspensoriohyoideus; and (5) lack of sepa-ration of the mm. quadrato-, hyo-, and sus-pensorioangularis. Parker (1934) reported thetaxon as diplasiocoelus like most other ran-oids, although he noted Hoplophryninae(Parhoplophryne 1 Hoplophryne), Astero-phryinae, and some members of his Micro-hylinae (e.g., Melanobatrachus, Metaphry-nella, Myersiella, Phrynella) as procoelous.Parker (1934) noted that Scaphiophryne re-tains a complete sphenethmoid, thereby ex-cluding it from Microhylidae, which, as heapplied the name, included only those taxawhere the sphenethmoid is either in twoparts, or, more rarely, not ossified at all. Haas(2003) suggested on the basis of larval mor-phology that Scaphiophryninae is polyphy-letic, with Scaphiophryne forming the sistertaxon of the remaining microhylids, and Par-adoxophyla more closely related to Phry-nomerinae. Clearly the monophyly of thistaxon is controversial, but we, unfortunately,were unable to sample Paradoxophyla and socould not test the monophyly of Scaphio-phryninae. We were able to obtain only arepresentative of the other genus, Scaphio-phryne marmorata. Our results regarding theScaphiophryninae will therefore remain in-complete.

ASTEROPHRYINAE (8 GENERA, 64 SPECIES)AND GENYOPHRYNINAE (11 GENERA, 142 SPE-

CIES): Zweifel (1972) and Burton (1986) lastreported on phylogenetics of the Australo-Papuan Asterophryinae (fig. 32). Geny-ophryninae is also Australo-Papuan but ex-tends into the Philippines and Lesser Sundas.No major revision or broad-scale phyloge-netic study has appeared since Parker (1934),although Burton (1986) did suggest evidencethat it is paraphyletic with respect to Aster-ophryinae. Sumida et al. (2000a) noted thatsome allozyme evidence suggested that As-terophryinae is imbedded within a paraphy-letic Genyophryninae. Savage (1973) consid-ered Genyophryninae to be part of Astero-phryinae based on the dubious nature of theprocoely–diplasiocoely distinction; that theyshare direct-development; and, in part, that


they are both biogeographically centered inNew Guinea.

Zweifel (1971) summarized the distinctionbetween the subfamilies as (1) maxillae oftenoverlapping the premaxillae and usually incontact anteriorly (Asterophryinae; this pre-sumably is apomorphic), maxillae not over-lapping the premaxillae (Genyophryninae);(2) vertebral column diplasiocoelous (rarelyprocoelous; Asterophryinae), procoelous(Genyophryninae); and 3) tongue subcircu-lar, entirely adherent, often with a medianfurrow and posterior pouch (Asterophryi-nae), tongue oval, half-free behind, no traceof a median furrow or pouch (Genyophry-ninae; shared with Cophylinae). Genyophry-ninae and Asterophryinae share direct devel-opment (Zweifel, 1972; Thibaudeau and Al-tig, 1999). Our sampling will allow us to testthe hypotheses of relationship so far pub-lished and elucidate the possible paraphylyof Genyophryninae. Unfortunately, we couldsample only one species of Asterophryinae,Callulops slateri, which will not allow us totest its monophyly. The effect of excludingrepresentatives of Asterophrys, Barygenys,Hylophorbus, Mantophryne, Pherohapsis,Xenobatrachus, and Xenorhina is unknown.

Of Genyophryninae, we were able to sam-ple Aphantophryne pansa, Choerophryne sp.,Cophixalus sphagnicola, Copiula sp., Geny-ophryne thomsomi, Liophryne rhododactyla,Oreophryne brachypus, and Sphenophrynesp. We were unable to sample Albericus,Austrochaperina, Oreophryne, or Oxydacty-la.

BREVICIPITINAE (5 GENERA, 22 SPECIES):Like the Australo-Papuan Asterophryninaeand Genyophryninae, the African Brevicipi-tinae has direct development (Parker, 1934;Thibaudeau and Altig, 1999). Parker (1934)considered the subfamily to be distantly re-lated to all other microhylid taxa and char-acterized by the retention of a medially ex-panded vomer. Parker (1934) reported thetaxon as diplasiocoelus like most other ran-oids. The species within the subfamily areclosely similar and unlike all other micro-hylids in general habitus, although the mono-phyly of the group has never been tested rig-orously.

Blommers-Schlosser (1993) suggested (thepresence of a median thyroid gland being the

sole synapomorphy) that brevicipitinesshould be united with hemisotids (but seeChanning, 1995, who considered this changepremature at the time because of the other-wise trenchant differences between them).Van der Meijden et al. (2004; fig. 31) andLoader et al. (2004) provided molecular datain support of a hemisotid–brevicipitine rela-tionship. Of the nominal genera we were un-able to sample the monotypic Balebrevicepsand Spelaeophryne. The effect of excludingthese taxa is unknown, although Loader etal. (2004) recovered Spelaeophryne in aclade with Probreviceps and Callulina, to theexclusion of Breviceps. We were able to sam-ple at least one species of the remainingnominal genera: Breviceps mossambicus,Callulina kisiwamitsu, C. kreffti, and Pro-breviceps macrodactylus. Because there are13 species of Breviceps and 3 species of Pro-breviceps, we were unable to test rigorouslythe monophyly of these taxa.

COPHYLINAE (7 GENERA, 41 SPECIES): TheMadagascan Cophylinae is similar to Dys-cophinae and Genyophryninae in retainingmaxillary and vomerine teeth (except inStumpffia) but differs from Dyscophinae inhaving procoelous vertebrae and from Dys-cophinae and Genyophryninae in having adivided vomer (Parker, 1934); none of thecharacters is demonstrably synapomorphic.Blommers-Schlosser and Blanc (1993) pro-vided a cladogram (fig. 33A) of the generabased on nine morphological characters, inwhich they suggested that Plethodontohylawas paraphyletic and that Platypelis did nothave apomorphies to assure its monophyly.Andreone et al. (2004 ‘‘2005’’) recently pro-vided a maximum likelihood analysis of1173 bp of mtDNA (fig. 33B), in which hedocumented Plethodontohyla paraphyly. Be-cause these sequences became available afterour analyses were completed, we did notsample Cophyla, Madecassophryne, orRhombophryne. The effect of this on theplacement of the subfamily will remain un-known, although we did sample four speciesof the four remaining genera: Anodonthylamontana, Platypelis grandis, Plethodonto-hyla sp., and Stumpffia psologlossa. Unfor-tunately, because of our limited sampling wewill not be able to test rigorously the resultsof either Blommers-Schlosser and Blanc


Fig. 33. Trees of Cophylinae suggested by A,Blommers-Schlosser and Blanc (1993), on the ba-sis of nine morphological transformation series,rooted (by implication) on Dyscophinae and Sca-phiophryninae. The figure is redrawn with branch-es collapsed that were unsupported by evidencein the original; B, Andreone et al. (2004 ‘‘2005’’),based on 1,173 bp of 12S and 16S rRNA mtDNA.This tree is redrawn to note only monophyleticgenus-group taxa. Alignment was made using theClustal option in Sequence Navigator (AppliedBiosystems), with cost functions for alignment notprovided. All sections that could not be aligned,including those with three of more gaps in one ormore taxa, were excluded from analysis. Whethergaps were treated as unknown or evidence wasnot stated. The Tamura-Nei substitution modelwas selected for maximum-likelihood analysis ofaligned data. The tree was rooted on Scaphio-phryne (not shown). Quotation marks aroundnames denotes nonmonophyly.

(1993) or Andreone et al. (2004 ‘‘2005’’).Species of Cophylinae have nidicolous lar-vae (Blommers-Schlosser and Blanc, 1991;Glaw and Vences, 1994).

DYSCOPHINAE (2 GENERA, 10 SPECIES): TheMadagascan Dyscophinae is distinguishedfrom most other microhylid subfamilies byretaining maxillary and vomerine teeth, oth-erwise known only in Cophylinae and Gen-yophryninae, both of which are procoelousrather than diplasiocoelous (Parker, 1934) asin Dyscophinae. Savage (1973) had regarded

Calluella as associated with the direct-devel-oping Asterophryinae and any similaritieswith Dyscophus as reflecting plesiomorphy.We sampled one species each of the twonominal genera: Calluella guttulata and Dys-cophus guineti.

MELANOBATRACHINAE (3 GENERA, 4 SPE-CIES): On the basis of geography alone (EastAfrica [2 genera] and southern India [1 ge-nus]), one would suspect that this is not amonophyletic taxon. Nevertheless, the threegenera share an incomplete auditory appa-ratus (convergent in Balebreviceps [Brevi-cipitinae]; Largen and Drewes, 1989) and fu-sion of the sphenethmoid with the paras-phenoid (Parker, 1934). Savage (1973), fol-lowed by Laurent (1986) and Dubois (2005),placed Melanobatrachus in Microhylinaeand retained Hoplobatrachus and Parhoplo-phryne in Hoplophryninae, but did so onlyby discarding absence of the auditory appa-ratus and fusion of the sphenethmoid to theparasphenoid, as convergences, without of-fering specific characters that conflicted withthese as synapomorphies. Although we aresuspicious of the monophyly of this taxon,we stick with the most parsimonious hypoth-esis (monophyly of Melanobatrachinae, sen-su lato) until alternative evidence emerges.

Apparently based on information providedfor Hoplophryne by Barbour and Loveridge(1928) and Noble (1929), Parker (1934) gen-eralized that all members of his Melanoba-trachinae lack a free-swimming tadpole, thelarvae with ‘‘metamorphosis taking place onland, but not in an egg’’. No reproductive ordevelopmental data on Parahoplophryne orMelanobatrachus have been published (Dal-try and Martin, 1997). Thibaudeau and Altig(1999) listed Melanobatrachus and Parho-plophryne as having endotrophic larvae, pre-sumably because of the earlier statement byParker (1934). McDiarmid and Altig (1999:13), however, listed Hoplophryne as exo-trophic, because Barbour and Loveridge(1928: 256) reported vegetable matter in theguts of larvae and because R. Altig examinedAMNH larvae of Hoplophryne and inferredthat they could feed (R.W. McDiarmid, per-sonal commun.). Laurent (1986) reported thetaxon (Parhoplophryne and Hoplophryne inhis Hoplophrynnae; Melanobatrachus in hisMicrohylinae) as procoelous, unlike most


Fig. 34. Tree of New World microhylids byWild (1995) based on a parsimony analysis of 14morphological transformations series, outgroupsand evidence for ingroup monophyly not speci-fied.

other ranoids so this may also be synapo-morphic. Unfortunately, we were able tosample only Hoplophryne rogersi and so willnot be able to comment on the monophylyof Melanobatrachinae.

MICROHYLINAE (30 GENERA, 133 SPECIES):The American and tropical Asian Microhy-linae have free-swimming tadpoles (exceptfor a few species, such as Myersiella mi-crops, that have direct development; Izeck-sohn et al., 1971). Although microhylinescan be morphologically characterized, theyhave no known synapomorphies, and theirmonophyly is deeply suspect. According toParker (1934), maxillary and vomerine teethare absent (as in several other extra-Mada-gascar subfamilies); the vomer is much re-duced and usually divided; the sphenethmoidis divided or absent; and the vertebrae arediplasiocoelous (or rarely procoelous). Wild(1995) provided a cladogram of New Worldgenera (fig. 34), but this assumed that theNew World group is monophyletic and wasunclear about the outgroup(s) used to polar-ize the transformations. Laurent (1986) treat-

ed the Old World and New World compo-nents separately, implying some kind of tax-onomic division. This was followed, withoutdiscussion, by Dubois (2005), who recog-nized Gastrophryninae for the New Worldcomponent and Microhylinae for the OldWorld component. We are not aware of anyevidence in support of this arrangement sowe retain the old taxonomy. Of the 30 nom-inal genera we were able to sample represen-tatives of 14: Chaperina fusca, Ctenophrynegeayei, Dasypops schirchi, Dermatonotusmuelleri, Elachistocleis ovalis, Gastrophryneelegans, G. olivacea, Hamptophryne bolivi-ana, Kalophrynus pleurostigma, Kaloulapulchra, Microhyla heymonsi, Microhyla sp.,Micryletta inornata, Nelsonophryne aequa-torialis, Ramanella obscura, and Synaptur-anus mirandaribeiroi). We were not able tosample Adelastes, Altigius, Arcovomer,Chiasmocleis, Gastrophrynoides, Glyphog-lossus, Hyophryne, Hypopachus, Metaphry-nella, Myersiella, Otophryne, Phrynella, Re-lictovomer, Stereocyclops, Syncope, andUperodon. Most of these appear to be clus-tered with sampled taxa. The exclusion ofOtophryne and Uperodon, however, is partic-ularly regrettable. Our sampling will not al-low detailed elucidation of the evolution oflife-history strategies. Adelastes, Altigius,Gastrophrynoides, Hyophryne, Kalophrynus(nidicolous), Myersiella (direct develop-ment), Phrynella, Synapturanus (nidicolous),and Syncope (nidicolous) have endotrophiclarvae that exhibit (or are suspected to ex-hibit) various degrees of truncation of larvaldevelopment (Thibaudeau and Altig, 1999).That we lack representatives of about half ofthese is lamentable, but our results will pro-vide an explicit starting point for future,more detailed studies. The remaining generahave exotrophic larvae of typical microhylidmorphology (Altig and McDiarmid, 1999).

PHRYNOMERINAE (1 GENUS, 5 SPECIES): TheAfrican Phrynomerinae is diagnosable fromMicrohylinae solely by possessing intercala-ry cartilages between the ultimate and pen-ultimate phalanges (Parker, 1934). Like mostother ranoids it is diplasiocoelous. Of thissmall taxon we sampled Phrynomantis bifas-ciatus. Phrynomantis typically has aquatic,exotrophic microhylid larvae (Altig andMcDiarmid, 1999).


‘‘RANIDAE’’ (CA. 54 GENERA, 772 SPECIES):Ranidae is a large ranoid taxon, that is likelyparaphyletic with respect to Mantellidae andRhacophoridae—at least on the basis of mo-lecular evidence (Vences and Glaw, 2001;Roelants et al., 2004; Van der Meijden et al.,2005). Ford and Cannatella (1993; fig. 14)suggested that the group is paraphyletic, or,at least, that it does not have recognized syn-apomorphies. Nevertheless, Haas (2003; fig.15) suggested the following to be synapo-morphies for Ranidae, excluding other ran-oids: (1) cartilaginous roofing of the cavumcranii present as taenia transversalis and me-dialis; (2) free basihyal present; and (3) fir-misterny (convergent elsewhere in Haas’tree).

Laurent (1986) included the mantellinesand rhacophorids in his Ranidae, a contentthat allows at least two other characters (dis-tinctly notched tongue and bony sternalstyle) to be considered as possible synapo-morphies (Ford and Cannatella, 1993).(These are, however, incongruent with char-acters suggested by Haas, 2003).

Dubois and coauthors (Dubois, 1992; Du-bois and Ohler, 2001; Dubois et al., 2001;Dubois, 2005) suggested a taxonomy of 11–14 subfamilies of uncertain monophyly or re-lationship with respect to each other. For dis-cussion, we recognize Dubois’ subfamilies,except as noted. As discussed by Inger(1996), the diagnostic features supportingDubois’ (1992) classification at the time ofthat writing frequently reflected overgener-alized and postfacto approximations for clus-ters that were aggregated with overall simi-larity, not synapomorphy, as the organizingprinciple. The relationships suggested by thistaxonomy (and Dubois, 2005, as well) canbe at variance with evidence of monophyly,notably evidence from DNA sequences (Em-erson and Berrigan, 1993; Bossuyt and Mil-inkovitch, 2000; Emerson et al., 2000b; Mar-mayou et al., 2000; Biju and Bossuyt, 2003;Roelants et al., 2004), so this taxonomy re-quires careful evaluation.

CERATOBATRACHINAE (6 GENERA, 81 SPE-CIES): Ceratobatrachinae is composed of di-rect-developing species found from westernChina (i.e., Ingerana) to the Indo-Australianarchipelago (Batrachylodes, Discodeles, Pal-matorappia, Platymantis, and the monotypic

Ceratobatrachus). Ceratobatrachinae repre-sents the direct-developing part of Cornufer-inae sensu Noble (1931) and Platymantinaeof later authors (e.g., Savage, 1973; Laurent,1986). Those taxa formerly included inCornuferinae or Platymantinae that exhibitunforked omosterna and/or free-living tad-poles (what are now Amolops, Huia, Mer-istogenys, Staurois, Hylarana [sensu lato],and Micrixalus) are now placed in Raninaeor Micrixalinae. Batrachylodes is inferred tohave direct development (Noble, 1931;Brown, 1952; Duellman and Trueb, 1986;Thibaudeau and Altig, 1999), but unlike oth-er members of Ceratobatrachinae, Batrachy-lodes has an entire omosternum (rather thanbeing forked). Noble (1931) regarded Batra-chylodes as derived from his Cornufer (5Platymantis) and, by inference, exhibiting di-rect development. Because of the characterconflict of omosternum shape and life-his-tory, Brown (1952) regarded Batrachylodesas related either to ‘‘Hylarana’’ (exotrophic,entire omosternum) or to the Ceratobatra-chus group (direct-developing, forked omos-ternum). Laurent (1986) treated Batrachylo-des as a member of Raninae, although Bou-lenger (1920) had noted the intraspecificplasticity of omosternum shape, the only ev-idence supporting placement of Batrachylo-des in Raninae. This arrangement was ac-cepted by Dubois (1987 ‘‘1985’’), althoughsubsequently, Dubois (2005) transferred Ba-trachylodes out of Raninae and into Cerato-batrachinae, presumably on the basis of thedirect development. Our analysis should pro-vide more evidence on the placement of thistaxon.

Dubois (1992) recognized Ceratobatrachi-ni within his Dicroglossinae, but later (Du-bois et al., 2001) considered it to be a sub-family, of unclear relationship to Dicroglos-sinae. Even later, Dubois (2003) stated, onthe basis of unpublished molecular data, thatCeratobatrachini is a tribe within Dicroglos-sinae. Van der Meijden et al. (2005) present-ed DNA sequence evidence that Ceratoba-trachus is outside of Dicroglossinae, and onthat basis (Dubois, 2005) once again em-braced the subfamilial rank Ceratobatrachi-nae. Roelants et al. (2004; fig. 35), in a studyof predominantly Indian taxa, provided mo-lecular evidence that suggest that Ingerana is



←

Fig. 35. One of 24 most parsimonious trees of ranoids of Roelants et al. (2004) that corresponds,except for branches marked with an asterisk (*), to their maximum-likelihood tree, based on 698 infor-mative sites out of 1,895 bp of: (1) 750 bp covering part of 12S rRNA gene, complete tRNAVal gene,and part of the 16S rRNA gene; (2) 550 bp of the 16S rRNA gene; (3) ca. 530 bp of exon 1 of thenuclear tyronsinase gene; (4) ca. 315 bp of exon 1 of the rhodopsin gene; (5) ca. 175 bp of exon 4 ofthe nuclear rhodopsin gene. Alignment was made using the programs SOAP v. 1.0 (Loytynoja andMilinkovitch, 2000) and ClustalX (Thompson et al., 1997). Cost functions were not specified, andalignment was subsequently adjusted manually. Sequence segments considered to be ambiguouslyaligned were excluded from analysis (508 bp). Substitution model assumed for analysis was GTR 1G1 I. It was not stated whether gaps were treated as missing data or as evidence.

in Occidozyginae, rather than in Ceratobatra-chinae, although Dubois (2005), without dis-cussion, did not accept this.

Of this group we sampled Batrachylodesvertebralis, Discodeles guppyi, Ceratobata-chus guentheri, Platymantis pelewensis, P.weberi, and Ingerana baluensis. Thus, weonly lack Palmatorappia from this group19.Although we obviously cannot test themonophyly of these individual genera (ex-cept Platymantis), our taxon sampling is ad-equate to test the monophyly of the inclusivegroup.

CONRAUINAE (1 GENUS, 6 SPECIES): Untilthe recent publication by Dubois (2005), thisgenus (Conraua) had been placed on the ba-sis of overall similarity in a monotypic tribe,Conrauini, in Dicroglossinae (Dubois, 1992).Conrauini was proposed (Dubois, 1992) forthe West African genus Conraua, the diag-nostic characters being the retention of afree-living tadpole stage (plesiomorphic),with a larval keratodont formula of 7–8/6–11 (see Dubois, 1995, for the definition ofkeratodont formula) and lateral line not re-tained into adulthood (plesiomorphic). Vander Meijden et al. (2005; fig. 36), on the ba-sis of DNA sequence data, showed that Con-raua is not close to Dicroglossinae but thesister taxon to a taxonomically heteroge-

19 The status of Liurana Dubois, 1987, is unclear. Du-bois (1987 ‘‘1985’’) named Liurana as a subgenus ofIngerana (Ceratobatrachinae) but, without discussingevidence, Dubois (2005: 4) subsequently consideredLiurana to be a synonym of Taylorana (5 Limnonectes,Dicroglossinae). Similarly, Dubois (2005), with minimaldiscussion, placed Annandia Dubois, 1992, in his tribeLimnonectini, although he had named this taxon as asubgenus of Paa, in his Paini. Because these statementsare not associated with evidence, they do not merit fur-ther discussion.

neous group of southern African ranoids, in-cluding Afrana, Cacosternum, Natalobatra-chus, Petropedetes, Pyxicephalus, Strongy-lopus, and Tomopterna. Kosuch et al. (2001;figs. 38, 39), on a relatively small amount ofevidence, had previously placed Conraua al-ternatively as either the sister taxon of Lim-nonectes (based on 16S alone) or as the sistertaxon of Tomopterna 1 Cacosternum (basedon combined 12S and 16S). The latter resultwas suggestive of the more complete resultsof Van der Meijden et al. (2005). Althoughcharacters have not been suggested that areclearly synapomorphic, the group is morpho-logically compact and monophyly is likely.Of the six species we sampled two: Conrauarobusta and C. goliath.

DICROGLOSSINAE (12 GENERA, 152 SPECIES):Recounting the taxonomic history of Dicrog-lossinae is difficult inasmuch as it was orig-inally formed on the basis of overall similar-ity, and the content has varied widely, evenby the same authors. Only recently has itsconcept begun to be massaged by phyloge-netic evidence. Dubois (1987 ‘‘1985’’, 1992)diagnosed Dicroglossinae (in the sense of in-cluding Conrauinae and excluding Paini) ashaving the omosternum moderately orstrongly bifurcate at the base and the nasalsusually large and in contact with each otherand with the frontoparietal, although none ofthese characters is demonstrably synapo-morphic. The most recent taxonomy of Di-croglossinae (Dubois, 2005) recognized fourtribes: Dicroglossini (for Euphlyctis, Fejer-varya, Hoplobatrachus, Minervarya, Nan-nophrys, and Sphaerotheca), Limnonectini(for Limnonectes, as well as some taxa con-sidered by most authors to be synonyms ofLimnonectes), Occidozygini (for Occidozyga


Fig. 36. Maximum likelihood tree of exemplars of Ranoidea, with a focus on African taxa, by Vander Meijden et al. (2005), based on mt DNA (12S and 16S rRNA) and nu DNA (RAG-1, RAG-2,rhodopsin), for 2,995 bp of sequence. Alignment was made using ClustalW (Thompson et al., 1994),with costs not disclosed and gaps and highly variable sites excluded from analysis. The model assumedfor maximum-likelihood analysis was TrN 1 I 1 G. The tree was rooted on an hierarchical outgroups(not shown in original) composed of Latimeria, Homo, Gallus, Lyciasalamandra, Alytes (2 spp.), Aga-lychnis, and Litoria. The ‘‘southern African clade’’ represents Pyxicephalinae as subsequently redelim-ited by Dubois (2005).


and Phrynoglossus), and Paini (for Chapar-ana, Nanorana, and Quasipaa).

Dicroglossini was diagnosed by Dubois(1992; in the sense of including Occidozy-ginae) as retaining a free-living tadpole (ple-siomorphic) and having a lateral line systemthat usually is retained into adulthood (pre-sumably apomorphic, but not present in Oc-cidozyga, sensu stricto). As conceived byDubois (1992), the taxon contained Euphlyc-tis, Occidozyga, and Phrynoglossus. Fei et al.(1991 ‘‘1990’’) and, subsequently, Dubois etal. (2001) on the basis of published and un-published molecular evidence (Marmayou etal., 2000—fig. 37; Kosuch et al., 2001—figs.38; Delorme et al., 2004—fig. 40) placed Oc-cidozyga and Phrynoglossus in the subfamilyOccidozyginae, and transferred without dis-cussion into Dicroglossini Fejervarya andHoplobatrachus (from Limnonectini) andSphaerotheca (from Tomopterninae), andNannophrys (from Ranixalinae).

Grosjean et al. (2004), building on the ear-lier work of Kosuch et al. (2001) suggestedon the basis of several mtDNA and nuDNAloci that Euphlyctis is the sister taxon of Ho-plobatrachus with Fejervarya, Sphaerothe-ca, Nannophrys, and Limnonectes formingmore distant relations, a result that is consis-tent with the tree of Roelants et al. (2004;fig. 35).

Dubois (1992) also recognized a tribeLimnonectini diagnosed nearly identicallywith Conrauini (Conrauinae of this review),differing only in the larval keratodont for-mula of 1–5/2–5, which is arguably plesiom-orphic. Nominal genera contained in thisgroup occur from tropical Africa to tropicalAsia with most taxonomic diversity being inAsia: Hoplobatrachus, Limnonectes, and Fe-jervarya (which was considered a subgenusof Limnonectes at the time). In addition Mar-mayou et al. (2000; fig. 37) and Delorme etal. (2004; fig. 40) suggested on the basis ofmtDNA evidence that Sphaerotheca (former-ly in Tomopterninae; Dubois, 1987 ‘‘1985’’)and Taylorana (now a synonym of Limno-nectes; originally considered to be a memberof Limnonectini [Dubois, 1987 ‘‘1985’’] butsubsequently transferred to Ceratobatrachi-nae by Dubois, 1992) are in Limnonectini.

Sphaerotheca, therefore, is likely not to beclosely related to Tomopterna, as one would

have expected given that the species ofSphaerotheca were long placed in Tomopter-na (Pyxicephalinae). Roelants et al. (2004;fig. 35) also placed Nannophrys in Dicrog-lossinae (by implication) on the basis ofmtDNA and nuDNA evidence, substantiatingthe earlier assessment by Kosuch et al.(2001; figs. 38) which was made on less ev-idence. It was previously assigned to Ranix-alini by Dubois (1987 ‘‘1985’’) and to Di-croglossini by Dubois et al. (2001). Duboiset al. (2001: 55) implied on the basis of var-ious published and unpublished mtDNA datathat Euphlyctis (formerly in his Dicroglossi-ni), Fejervarya, Hoplobatrachus, Minervar-ya, Nannophrys, and Sphaerotheca (formerlyin his Limnonectini) should be included in areconstituted Dicroglossini.

Delorme et al. (2004; fig. 40) demonstrat-ed—as had Roelants et al. (2004; fig. 35)—that Lankanectes is phylogenetically distantfrom Limnonectes.

Of these taxa we sampled rather broadly:Euphlyctis cyanophlyctis; Fejervarya cancri-vorus, F. kirtisinghei, F. limnocharis, and F.syhadrensis; Hoplobatrachus occipitalis andH. rugulosus; Limnonectes acanthi, L. grun-niens, L. heinrichi, L. kuhlii, L. limborgi (for-merly Taylorana limborgi), L. poilani, and L.visayanus; Nannophrys ceylonensis; Sphaer-otheca breviceps and S. pluvialis. On the ba-sis of this sampling we should be able toevaluate the reality of this taxon and, at leastto some degree, the monophyly of the con-tained genera.

Occidozygini is a tropical Asian group ofarguable position. Marmayou et al. (2000;fig. 40) presented mtDNA evidence that Oc-cidozyga and Phrynoglossus are not withinDicroglossinae but are outside of a cladecomposed of Rhacophoridae and other mem-bers of a paraphyletic Ranidae. Fei et al.(1991 ‘‘1990’’) had already transferred Oc-cidozyga (sensu lato) out of Dicroglossinaeand into its own subfamily on the basis oflarval characters and this evidence supportedthe view that Dicroglossinae, as previouslyconceived, is polyphyletic. Roelants et al.’s(2004) greater sampling of Asian ranoidssuggested that Ingerana (nominally in Cer-atobatrachinae) is in this clade and togetherform the sister taxon of a reformulated Di-croglossinae (fig. 35), which together are the


Fig. 37. Consensus of two equally parsimonious trees from Marmayou et al. (2000) of exemplarsof Ranidae and Rhacophoridae (Ranidae: Rhacophorinae in their usage) based on 305 bp (151 infor-mative sites) of 12S mtDNA, aligned using the program MUST (Philippe, 1993) and subsequentlymanually modified with reference to secondary structure models. Cost functions for alignment were notstated, nor whether gaps were treated as missing data or as evidence (ci 5 0.382, ri 5 0.429). Treerooted on Eleutherodactylus cuneatus (5 Euhyas cuneata).

sister taxon of a clade composed of Mantel-lidae, Rhacophoridae, and Raninae. No Af-rican taxa were examined by Marmayou etal. (2000; fig. 37), Roelants et al. (2004; fig.35), or Delorme et al. (2004; fig. 40), so therelative position and monophyly of Occidoz-yginae and Dicroglossinae needed to be fur-ther elucidated. This issue was addressed byVan der Meijden et al. (2005; fig. 36), whodid analyze Asian and African taxa simulta-neously and found Occidozygya lima to sitwithin their Dicroglossinae. Dubois (2005),on the strength of the evidence produced byVan der Meijden et al. (2005), returned Oc-cidozyginae to Dicroglossinae as a tribe. We

sampled Phrynoglossus baluensis, P. boreal-is, P. martensii, and Occidozyga lima.

Paini is a montane Asian tribe diagnosedamong ranids by having an unforked omos-ternum (and was therefore formerly includedin Raninae by Dubois, 1987 ‘‘1985’’, 1992)and males having black, keratinous ventralspines (presumably a synapomorphy withNanorana; Jiang et al., 2005: 357). Paini ac-cording to Dubois (1992) was composed oftwo genera, each with four subgenera: genusChaparana with subgenera Annandia, Cha-parana, Feirana, and Ombrana; genus Paawith subgenera Eripaa, Gynandropaa, Paa,and Quasipaa. Dubois et al. (2001), citing


Fig. 38. Neighbor-joining tree of ranoid exemplars of Kosuch et al. (2001), which ‘‘agreed well’’with the consensus of four equally parsimonious trees (ci 5 0.51). Underlying data were 572 bp ofaligned 16S mtDNA sequences of which 221 are parsimony-informative. Alignment was done manuallyusing Sequencher (Applied Biosystems). Indels were treated as missing data. Taxon assignments on theright reflect the taxonomy as it existed at the time.


Fig. 39. Neighbor-joining tree of ranoid ex-emplars of Kosuch et al. (2001). Underlying datawere 16S data (see figure 38) and 12S mtDNA(331 bp). Alignment was done manually using Se-quencher (Applied Biosystems). Gaps treated asmissing data.

unpublished DNA sequence, suggested thatPaini be transferred from Raninae to Dicog-lossinae. Jiang and Zhou (2001, 2005; fig.41), Jiang et al. (2005; fig. 42), Roelants etal. (2004; fig. 35), and Van der Meijden(2005; fig. 36) on the basis of publishedDNA sequence evidence, suggested that Di-croglossinae, with a forked omosternum, isparaphyletic with respect to Paini, with anunforked omosternum. For this reason Roe-lants et al. (2004) and Jiang et al. (2005)transferred Paini out of Raninae and into Di-croglossinae. Larvae in the group are exo-trophic and aquatic (Altig and McDiarmid,1999).

Jiang et al. (2005) recently provided a phy-logenetic study (fig. 42) of Paini on the basisof 12S and 16S rRNA fragments. Unfortu-nately, that study appeared too late to guideour choice of terminals, but their results areimportant in helping us interpret our own re-sults. They found Paa to be paraphyletic withrespect to Chaparana and Nanorana; Cha-parana to be polyphyletic with the parts im-bedded within ‘‘Paa’’; and Nanorana to bedeeply imbedded within ‘‘Paa’’. Within Painithey recognized two groups: (1) Group 1,

composed of ‘‘Chaparana’’, several speciesof ‘‘Paa’’, and Nanorana, characterized byspines forming two patches on the chest (saveC. quadranus, the type of subgenus Feirana,which does not have spines on the chest); and(2) Group 2, composed of ‘‘Paa’’ species as-sociated previously with the subgenera Quas-ipaa Dubois, 1992 (P. robertingeri), and onespecies nominal of the genus Chaparana, sub-genus Feirana Dubois, 1992 (Paa yei). Thesecond group is characterized by havingspines as a single group, more or less over theentire venter, but this characteristic is suffi-ciently variable among subgroups as not to bediagnostic practically except in the not-Na-norana group sense. These authors recom-mended that the generic name Quasipaa beapplied to Group 2, but for unstated reasonshesitated to resolve taxonomically the non-monophyly of Chaparana and Paa in theirGroup 1. Nanorana Gunther, 1896, is the old-est available name for their first group.

Three nominal genera are definitely in-cluded in Paini: ‘‘Chaparana’’ (polyphyletic;see above); Nanorana; and ‘‘Paa’’ (paraphy-letic with respect to ‘‘Chaparana’’ and Nan-orana20). We sampled Nanorana pleskei,Quasipaa exilispinosa and Q. verrucospino-sa but did not sample ‘‘Chaparana’’ or‘‘Paa’’ (sensu stricto).

Jiang et al. (2005) did not mention or ad-dress three supraspecific taxa usually asso-ciated with Paini. The first is Eripaa Dubois,1992, whose type and only species is Ranafasciculispina Inger, 1970. Eripaa Dubois,1992, was named and is currently treated asa subgenus of Paa. Although Eripaa exhibitsspines on the entire chest and throat, such asin group 2 of Jiang et al. (2005), they areuniquely distinct from all other ‘‘Paa’’,‘‘Chaparana’’, and Nanorana species in thatthese spines are clustered in groups of 5–10on circular whitish tubercles. We cannot haz-ard a guess as to how Eripaa is related tothe rest of Paini. The second is Annandia

20 Without mentioning content, Dubois (2005) recog-nized three genera: Chaparana, Nanorana, and Quasi-paa. In light of the phylogenetic study by Jiang et al.(2005), it is not clear how Chaparana and Nanoranawere intended to be delimited or what the content ofthese taxa would be. We presume that Dubois’ (2005)intention was to recognize a paraphyletic Chaparanawithin which a monophyletic Nanorana is imbedded.


Fig. 40. Maximum-likelihood tree of ranoids of Delorme et al. (2004), based on sequences from12S and 16S rRNA for a total of 1198 bp. Alignment was made using the program Se-Al (Rambaut,1995; cost functions not provided) and by comparison with models of secondary structure. Gaps weretreated as missing data. The maximum-likelihood nucleotide substitution model accepted was TrN 1 I1 G.

Dubois, 1992, whose type and only speciesis Rana delacouri Angel, 1928. Annandiawas originally named as a subgenus of Cha-parana Bourret, 1939, but recently, Dubois(2005), without discussion of evidence, treat-ed Annandia as a genus in Limnonectini.Perhaps this was done because this speciesbears a smooth venter, with spinules onlyclustering around the anus (Dubois, 1987‘‘1986’’). Regardless, this is a large taxo-nomic change (from Paini to Limnonectini)and because no evidence was produced ordiscussed to justify this change, we mustconsider the status of this taxon questionable.The third is Ombrana Dubois, 1992, whosetype and only species is Rana sikimensis Jer-don, 1870). Ombrana Dubois, 1992, was

originally proposed as a subgenus of Cha-parana. This species also posseses spinulesonly around the anus, prompting Dubois(1987, ‘‘1986’’) to consider it evidence of aunique reproductive mode, and thus a closerelative of Annandia delacouri. Unfortunate-ly, we did not sample any of these three taxa,so their status will remain questionable.

LANKANECTINAE (1 GENUS, 1 SPECIES): Thissubfamily was named for Lankanectes cor-rugatus of Sri Lanka by Dubois and Ohler(2001). Its distinguishing features are (1)forked omosternum (plesiomorphy); (2) vo-merine teeth present (presumed plesiomor-phy); (3) median lingual process absent (like-ly plesiomorphy); (4) femoral glands absent(likely plesiomorphy); (5) toe tips not en-


Fig. 41. Consensus of two parsimony trees of Chinese ranids from Jiang and Zhou (2005). Datawere 1,005 bp of the mtDNA sequences of the 12S and 16S rRNA gene fragments (tree length 5 1485,ci 5 0.449). Sequences were aligned using ClustalX (Thompson et al., 1997), with manual modificationsmade subsequently. Gaps and ambiguously aligned sequences excluded from analysis. Generic namesin parentheses reflect alternative usages. Generic taxonomy is updated to recognize Quasipaa (Jiang etal., 2005).

larged (arguable polarity); (6) tarsal fold pre-sent (likely plesiomorphy at this level); and(7) lateral line system present in adults (alsoin Phrynoglossus and Euphlyctis, but pre-sumably apomorphic). Roelants et al. (2004;fig. 35) and Delorme et al. (2004; fig. 40)subsequently suggested on the basis ofmtDNA and nuDNA evidence that Lanka-

nectes is far from Limnonectes, where it hadbeen placed by Dubois (1992). Roelants etal. (2004) placed it as the sister taxon ofNyctibatrachinae, and Delorme et al. (2004)placed it as the sister taxon of Nyctibatra-chinae 1 Raninae. We sampled the sole spe-cies, Lankanectes corrugatus.

MICRIXALINAE (1 GENUS, 11 SPECIES): Trop-


Fig. 42. Consensus of four parsimony trees ofPaini by Jiang et al. (2005), based on 796 bp (ofwhich 174 were parsimony informative) of the12S and 16S rRNA framents of mtDNA. Se-quences were aligned using ClustalW (Thompsonet al., 1994), cost functions not disclosed, withsubsequent manual modifications. Gaps and am-biguously aligned sequences were excluded fromanalysis (ci 5 0.584, ri 5 0.571). The trees wererooted on Hoplobatrachus chinensis and Fejer-varya fujianensis. A conclusion of Jiang et al.(2005) is that their Group 2 was recognized asQuasipaa.

ical Asian Micrixalus (11 species) is the solemember of this taxon, diagnosed by Dubois(2001) as differing from Dicroglossinae inlacking a forked omosternum (possibly apo-morphic), lacking vomerine teeth, havingdigital discs (present in some limnonectinesand otherwise widespread in Ranoidea) andhaving a larval keratodont formula in itsaquatic tadpoles of 1/0 (likely apomorphic)(Dubois et al., 2001). On the basis of mtDNAand nuDNA evidence, Roelants et al. (2004;fig. 35) considered Micrixalinae to be the sis-ter taxon of Ranixalinae. We were able tosample Micrixalus fuscus and M. kottigehar-ensis. Although this provides only a minimaltest of the monophyly of Micrixalus, it al-lows us to place the taxon phylogenetically.

NYCTIBATRACHINAE (1 GENUS, 12 SPECIES):Nyctibatrachinae contains the Indian taxonNyctibatrachus and is characterized by hav-ing a forked omosternum (likely plesiom-orphic), vomerine teeth present, digital discspresent, femoral glands present (shared withRanixalinae and some Dicroglossinae) andan aquatic tadpole with a keratodont formulaof 0/0 (likely apomorphic; Dubois et al.,2001). Of this taxon we sampled Nyctibatra-chus cf. aliciae and N. major.

PETROPEDETINAE (2 GENERA, 10 SPECIES);PHRYNOBATRACHINAE (4 GENERA, 72 SPECIES)AND PYXICEPHALINAE (13 GENERA, 57 SPE-CIES): Until recently, members of Petrope-detinae and Phrynobatrachinae, as well asseveral genera now assigned to Pyxicephali-nae (e.g., Anhydrophryne, Arthroleptella,Cacosternum, Microbatrachella, Nataloba-trachus, Nothophryne, and Poyntonia) wereconsidered members of ‘‘Petropedetidae’’(sensu lato), aggregated on the basis of over-all similarity, with no evidence for its mono-phyly ever suggested. Noble (1931) recog-nized his Petropedetinae (Arthroleptides andPetropedetes), as united by the possession ofdermal scutes on the upper surface of eachdigit and otherwise corresponding osteolog-ically and morphologically with Raninae.Noble (1931) also recognized Cacosterninaefor Cacosternum and Anhydrophryne, unitedby lacking a clavicle and having palatal ridg-es. He related the cacosternines to brevicip-itines, and the remainder of the genera thennamed he allocated to Raninae.

Laurent (1941 ‘‘1940’’) addressed the con-fusion between Arthroleptis and Phrynoba-trachus and transferred Petropedetes, Anhy-drophryne, Phrynobatrachus (including Na-talobatrachus), Dimorphognathus, and Ar-throleptella into his Phrynobatrachinae.Laurent (1941) subsequently provided an an-atomical characterization of the group.

Laurent (1951) transferred Cacosterninaeinto Ranidae and moved Microbatrachellainto Cacosterninae. Poynton (1964a) sug-gested that Phrynobatrachus is deeply para-phyletic with respect to Cacosterninae andtherefore considered Laurent’s Phrynobatra-chinae (5 Petropedetinae) and Cacosterninaeto be synonyms. Subsequent authors (e.g.,Dubois, 1981; Frost, 1985) uncritically fol-lowed this unsupported suggestion, although


there have been significant instances ofworkers continuing to recognize Cacosterni-nae and Petropedetinae as distinct (e.g.,Liem, 1970; J.D. Lynch, 1973).

Another morphologically compact Africangroup was Pyxicephalinae (Dubois, 1992),composed of Pyxicephalus (2 species) andAubria (2 species). The taxon was diagnosedby at least four synapomorphies (Clarke,1981): (1) cranial exostosis; (2) occipital ca-nal present in the frontoparietal; (3) zygo-matic ramus being much shorter than otic ra-mus; and (4) sternal style a long bony ele-ment tapering markedly from anterior to pos-terior. Dubois’ (1992) reasoning forexcluding this taxon from Dicroglossinae isnot clear, but presumably had to do with thedistinctive appearances of Pyxicephalus andAubria.

Dubois (1992) also recognized a subfam-ily Tomopterninae, for Tomopterna (sensulato, at the time including Sphaerotheca, nowin Dicroglossinae, Limnonectini). The diag-nosis provided by Clarke (1981) presumablyapplies inasmuch as he examined only Afri-can species (Tomopterna, sensu stricto), eventhough the optimization of these characterson his cladogram may well be contingent onbeing compared only with other African ra-nids: (1) zygomatic ramus much shorter thanotic ramus; (2) outline of anterior end of cul-triform process pointed, with lateral borderstapering to a point; (3) distal end of the an-terior pterygoid ramus overlapping the dorsalsurface of the posterior lateral border of thepalatine; (4) no overlap of the anterior borderof the parasphenoid ala by the medial ramusof the pterygoid in the anterior–posteriorplane; (5) sternal style short, tapering poste-riorly; (6) dorsal protuberance of the iliumnot or only slightly differentiated from thespikelike dorsal prominence; and (7) terminalphalanges of the fingers and toes reduced,almost conelike.

In 2003 this untidy, but familiar arrange-ment began to unravel. Dubois (2003), re-moved Cacosterninae from ‘‘Petropedetidae’’without discussion, apparently anticipatingevidence to be published elsewhere, althoughKosuch et al. (2001; fig. 38) had suggestedearlier that Cacosternum was more closelyrelated to Tomopterna and Strongylopus thanit was to Petropedetes. The content of this

taxon was stated to be Anhydrophryne, Ar-throleptella, Cacosternum, Microbatrachel-la, Nothophryne, Poyntonia (from Petrope-detidae), and, possibly Strongylopus and To-mopterna (from Ranidae).

Van der Meijden et al. (2005; fig. 36) sug-gested Phrynobatrachus to be the sister tax-on of Ptychadena. On this basis Dubois(2005) recognized a ranid subfamily Phry-nobatrachinae, containing Phrynobatrachus,but also allocated to this subfamily, withoutdiscussion, Dimorphognathus, Ericabatra-chus, and Phrynodon. Petropedetes and Con-raua formed successively more distant out-groups of the southern African clade of Vander Meijden et al. (2005), so Dubois (2005)removed Conrauini (Conraua) from Dicog-lossinae and placed it in its own subfamily,Conrauinae, and recognized Petropedetinaefor Petropedetes, as well as the presumablyclosely allied Arthroleptides. The southernAfrican clade of Van der Meijden et al.(2005; fig. 36) was composed of Cacoster-num (formerly of Petropedetidae), Afranaand Strongylopus (formerly of Raninae), Na-talobatrachus (formerly of Petropedetidae),Tomopterna (Tomopterninae), and Pyxice-phalus (Pyxicephalinae), a group that Dubois(2005) allocated to an enlarged Pyxicephal-inae. Aubria was asserted by Dubois (2005)to be in this group because it was groupedby morphological evidence with Pyxicephal-us. Amietia he transferred into the groupwithout discussion, but presumably becausethey appeared to him to be related to Stron-gylopus and Afrana. He transferred Arthro-leptella, Microbatrachella, Nothophryne, andPoyntonia into Pyxicephalinae, presumablybecause he thought that they were more like-ly to be here than close to either Petropede-tinae or Phrynobatrachinae.

Of Dubois’ (2005) Petropedetinae (whichpresumably is diagnosed as by Noble, 1931)we were able to sample both genera: Arthro-leptides sp. and Petropedetes cameronensis,P. newtoni, P. palmipes, and P. parkeri.

Of the newly constituted Phrynobatrachi-nae, we were also able to sample speciesfrom three of four genera: Dimorphognathusafricanus, Phrynobatrachus auritus, P. cal-caratus, P. dendrobates, P. dispar, P. ma-babiensis, P. natalensis, and Phrynodon san-dersoni. We did not sample Ericabatrachus,


an unfortunate omission, inasmuch as we areunaware of the evidence for Dubois’ (2005)association of Ericabatrachus with Phryno-batrachinae, other than the statement that itis ‘‘Phrynobatrachus-like’’ (Largen, 1991).Phrynobatrachus, at least for the specieswhich it is known, have exotrophic larvae.Larvae are unknown in Dimorphognathusand Ericabatrachus, and Phrynodon is en-dotrophic (Amiet, 1981; Altig and Mc-Diarmid, 1999).

Of the reformulated Pyxicephalinae wewere able to sample Aubria (Aubria subsi-gillata [2 samples21]) and Pyxicephalus (Py-xicephalus edulis) as well as several of thetaxa recently transferred into this taxon in-cluding Anhydrophryne rattrayi, Arthrolep-tella bicolor, Cacosternum platys, and Na-talobatrachus bonebergi. We also sampledmembers of Afrana (A. angolensis and A.fuscigula), Tomopterna (T. delalandii),Strongylopus (S. grayii), and Amietia (A. ver-tebralis), but for reasons having to do withthe evidentiary basis and history of taxono-my in Raninae, considerable discussion ofthese genera is presented there. We did notsample Microbatrachella, Nothophryne, orPoyntonia. Pyxicephalines have exotrophiclarvae, with the exception of Anhydrophryneand Arthroleptella, which are endotrophic;unknown in Nothophryne (Hewitt, 1919;Procter, 1925; DeVilliers, 1929; Altig andMcDiarmid, 1999). This selection should al-low us to test the phylogenetic results of Vander Meijden et al. (2005).

PTYCHADENINAE (3 GENERA, 51 SPECIES):Ptychadeninae is a morphologically compactgroup of sub-Saharan ranids diagnosed(Clarke, 1981; Dubois, 1987 ‘‘1985’’, 1992)by having: (1) an otic plate of the squamosalcovering the crista parotica in dorsal viewand extending mesially to overlap the otoc-cipital; (2) palatines absent; (3) clavicles re-duced; (4) sternal style a short compact ele-ment tapering anteriorly to posteriorly; (5)eighth presacral vertebra fused with sacralvertebra; and (6) the dorsal protuberance ofilium smooth-surfaced and not prominent.

21 We included two specimens of Aubria subsigillataas separate terminals in the analysis because the identityof one of the specimens was not determined conclusive-ly until after the analyses were complete.

The three nominal genera in the taxon arePtychadena (47 species), Hildebrandtia (3species), and Lanzarana (1 species) of whichwe sampled only Ptychadena anchietae, P.cooperi, and P. mascareniensis. Because wedid not sample Hildebrandtia and Lanzar-ana, we did not adequately test the mono-phyly of this group. Nevertheless, assumingthe group to be monophyletic, our three spe-cies of Ptychadena allow us to test the place-ment of Ptychadeninae within Ranoidea. Forhis analysis Clarke (1981) assumed that Pty-chadeninae is imbedded within other Africanranids, although a lack of comparison withAsian members of the group makes this as-sumption questionable. Van der Meijden etal. (2005; fig. 36) suggested that Ptychadenais the sister taxon of Phrynobatrachus amonghis exemplars, thereby implying that Pty-chadeninae is the sister taxon of Phrynoba-trachinae.

‘‘RANINAE’’ (CA. 8 GENERA, 309 SPECIES):‘‘Raninae’’ is a catch-all largely Holarcticand tropical Asian taxon united because themembers do not fit into the remaining sub-families and have unforked omosterna. Untilrecently, ‘‘Raninae’’ included two tribes: Pai-ni and Ranini (Dubois, 1992). However, Pai-ni and Nanorana of Ranini were transferredto Dicroglossinae on the basis of mtDNA andnuDNA evidence (Roelants et al., 2004—fig.35; Jiang et al., 2005—fig. 42), so Raninae,as we use it, is coextensive with Ranini ofDubois (1992), itself dubiously monophylet-ic22.

‘‘Raninae’’ is distributed on the planet co-extensively with the family and is united bythe lack of putative apomorphies, either inthe adult or in the larvae. There does notappear to be any reason to suggest that thisnominal taxon is monophyletic.

The starting point of any discussion ofRanini must be Dubois (1992), who providedan extensive, and controversial, taxonomy.Because the distinction between ranks (sec-

22 Van der Meijden et al. (2005; fig. 36), provided ev-idence from DNA sequences that suggests strongly that‘‘Raninae’’ is polyphyletic, with at least Afrana andStrongylopus in a southern African clade (along withPyxicephalus, Tomopterna, Natalobatrachus, and Ca-costernum), far from other ranines, and in Pyxicephali-nae of Dubois (2005). We therefore treat ‘‘Raninae’’ inthe following discussion as dubiously monophyletic.


tion, subsection, genus, and subgenus) in Du-bois’ system appears to rest primarily on sub-jective perceptions of similarity and differ-ence, the evidentiary basis of this taxonomyis unclear, even though we accepted his sys-tem as a set of bold phylogenetic hypotheses.Nevertheless, most of these taxa are imper-fectly or incompletely diagnosed and to laythe foundation for our results and concomi-tant taxonomic remedies, we discuss this tax-onomy in greater depth than we do most ofthe remainder of current amphibian taxono-my. Suffice it to say that we think that wesampled ‘‘Rana’’ diversity sufficiently toprovide at least a rudimentary phylogeneticunderstanding of the taxon as a starting pointfor future, more densely sampled studies.

Within his Ranini, Dubois (1992) recog-nized six genera: Amolops, Batrachylodes,Nanorana, Micrixalus, Rana, and Staurois(table 4). Of these, two continue to be placedin this taxon (Amolops and Rana [sensulato]) (Dubois, 2005). Staurois, Nanoranaand Micrixalus have subsequently beentransferred out of Ranini, Staurois to a newtribe, Stauroini (Dubois, 2005), Nanorana toDicroglossidae (Roelants et al., 2004; fig.35), and Micrixalus to a distant Micrixalinae(Dubois et al., 2001). Batrachylodes was pro-visionally transferred, without substantialdiscussion, by Dubois (2005) to Ceratobatra-chinae.

Within both Amolops and Rana, Duboisrecognized several subgenera, that other au-thors (e.g., Yang, 1991b) considered to begenera, as we do, although we arrange thediscussions by Dubois’ genera and subgen-era. Dubois (2003) arranged Raninae intotwo tribes (Amolopini for the taxa with cas-cade-adapted tadpoles, i.e., Amo, Amolops,Huia, Meristogenys, Chalcorana, Eburana,Odorrana) and Ranini (for everything else).This system represents typical nonevolution-ary A and not-A groupings, although Amo-lopini in this form is testable. Dubois (2005)subsequently did not embrace Amolopini,because it was too poorly understood, but hedid erect Stauroini for Staurois, because Roe-lants et al. (2004) placed Staurois as the pu-tative sister taxon of other ranines.

Amolops, Amo, Huia, and Meristogenys:Amolops has been recognized in some formsince Inger (1966) noted the distinctive tad-

pole morphology (presence of a raised,sharply defined abdominal sucker). Like oth-er cascade-dwelling taxa, larvae of Amolops(sensu lato) all share high numbers of kera-todont rows. Subsequently, Yang (1991b)recognized two other genera from withinAmolops: Meristogenys and Huia. Amolops(sensu stricto) has one possible synapomor-phy (short first metacarpal, also found inHuia), and three synapomorphies joiningHuia and Meristogenys to the exclusion ofAmolops (lateral glands present in larvae;four or more uninterrupted lower labial ker-atodont rows; and longer legs).

Subsequently, Dubois (1992) treated Mer-istogenys and Huia as subgenera of Amolops,and added a fourth subgenus, Amo (includingonly Amolops larutensis). Amo was diag-nosed (Boulenger, 1918) as having a digitaldisc structure similar to species of Staurois(i.e., having a transverse groove or ridge onthe posteroventral side of the disc continuouswith a circummarginal groove to define ahemisphere; Boulenger, 1918) and as havingaxillary glands (after Yang, 1991b) that areotherwise unknown in Amolops.

Although Dubois (1992) considered Amo-lops (sensu stricto), Amo, Huia, and Meris-togenys to be subgeneric parts of a mono-phyletic genus Amolops, other authors (e.g.,Yang, 1991b) considered at least Amolops,Huia, and Meristogenys as genera. For con-sistency we treat as genera Amo, Amolops,Huia, and Meristogenys. Our samples wereAmolops (A. chapaensis, A. hongkongensis),Huia (H. nasica), and Meristogenys (M. or-phocnemis). We were unable to sample Amolarutensis.

Staurois: The definition of Staurois (digi-tal discs broader than long; T-shaped termi-nal phalanges in which the horizontal part ofthe T is longer than the longitudinal part;outer metatarsals separated to base but joinedby webbing; small nasals separated fromeach other and frontoparietal; omosternalstyle not forked [Boulenger, 1918]) has alsobeen used to define Hylarana (Boulenger,1920; see below). Although some larvalcharacters are shared among species of Stau-rois (deep, cup-like oral disc in the tadpole,no glands or abdominal disc in tadpole; In-ger, 1966), the diagnostic value of these char-acters is unknown due to the large number


of ranid species whose adults are morpho-logically similar to those of Staurois, butwhose larvae remain undescribed. Our singleexemplar of Staurois, S. tuberilinguis, is notsufficient to test the monophyly of the genus.Although no one has suggested that Stauroisis polyphyletic, or that it is paraphyletic withrespect to any other group, both of these re-main untested possibilities. Roelants et al.(2004; fig. 35) provided evidence that Stau-rois is the sister taxon of remaining ranines.

Rana (sensu Dubois, 1992)23: Rana of Du-bois (1992) is diagnostically coextensivewith his Ranini (our ‘‘Raninae’’), and no fea-tures provided in his paper exclude ‘‘Rana’’from being paraphyletic with respect to Stau-rois, Amolops (sensu Dubois, 1992), or Ba-trachylodes. So, as we discuss the internaltaxonomy of ‘‘Rana’’ as provided by Dubois,readers should bear in mind that Amolops(sensu lato), Batrachylodes, and Staurois, asdiscussed by Dubois (1992), must be regard-ed as potential members of all infragenerictaxa that do not have characters that specif-ically exclude them. (And, at least with re-spect to Dubois’, 1992, Rana subgenera,Strongylopus and Afrana, DNA sequencedata have been published that suggest thatthey have little relationship with other rani-nes [Van der Meijden et al., 2005; fig. 36].)With respect to ‘‘Rana’’ specifically, Dubois(1992) provided a system of sections, sub-sections, and subgenera that has posed seri-ous challenges for us: Rather than a syna-pomorphy scheme, or even a system of care-fully-evaluated characteristics, the varioustaxa appear to represent postfacto characterjustifications of decidedly nonphylogeneticand subjectively arrived-at groups. We foundDubois’ (1987 ‘‘1985’’, 1992) arrangementto be inconsistent with the preponderance ofevidence in certain instances (see the discus-sion of inclusion of Aquarana in his sectionPelophylax, below) and the underlying di-agnostic basis of the system to contain over-ly-generalized statements from the literature

23 Although Afrana, Amietia, and Strongylopus (nowin Pyxicephalinae), Batrachylodes (now in Ceratoba-trachidae), Micrixalus (now in Micrixalinae), and Na-norana (now in Dicroglossinae) have been transferredout of Raninae, we address them as part of the generaldiscussion of ranine systematics prior to 2004. (See table4)

(Inger, 1996) that are not based on any com-prehensive comparative study of either inter-nal or external morphology. For instance, lar-vae may have dorsal dermal glands, lateraldermal glands, or ventral dermal glands invarious combinations (e.g., Yang, 1991b).These characters have become larval dermalglands present or absent in Dubois’ (1992)diagnoses, thereby conflating the positionalhomology of these features. Although we ad-dress deficiencies here and in the Taxonomysection, for other critiques see Emerson andBerrigan (1993), Matsui (1994), Matsui et al.(1995), Inger (1996), Bain et al. (2003), andMatsui et al. (2005).

As noted earlier, several, if not most taxarecognized by Dubois within his ‘‘Rana’’ areeffectively undiagnosed in a utilitarian sense(i.e., they are diagnosed sufficiently only tomake the names available under the Inter-national Code; ICZN, 1999). In addition,several are demonstrably nonmonophyletic(Matsui, 1994; Matsui et al., 1995; Inger,1996; Tanaka-Ueno et al., 1998a; Emerson etal., 2000a; Marmayou et al., 2000; Vences etal., 2000a; B.J. Evans et al., 2003; Roelantset al., 2004; Jiang and Zhou, 2005). Unlikethe superficially similar situation in Eleuth-erodatylus (sensu lato) where it is straight-forward to get specific information on indi-vidual species and where the nominal sub-genera and most related genera, even if theydo not rise to the level of synapomorphyschemes, have been diagnosed largely com-paratively, the subgeneric (and generic, inpart) diagnoses of ranids are not comparable,and the purported differentiating charactersfrequently do not bear up to specimen ex-amination (e.g., Tschudi, 1838; Boulenger,1920; Yang, 1991b; Fei et al., 1991 ‘‘1990’’;Dubois, 1992).

Historically, taxonomists approachedRana (sensu lato) as being composed of twovery poorly defined similarity groupings: (1)those that have expanded toe tips (likely ple-siomorphic) that at one time or another havebeen covered by the name Hylarana; and (2)those that lack expanded toe tips, and thathave more-or-less always been associatedwith the generic name Rana. Most authorssince Boulenger (1920) recognized the lackof definitive ‘‘breaks’’ between the twogroups, and Dubois was the first to attempt


TABLE 4Generic and Subgeneric Taxonomy of Dubois’ (1992) Ranini

Nanorana transferred to Paiini by Roelants et al. (2004); Batrachylodes transferred to Ceratobatrachinae,without discussion of evidence by Dubois (2005); Micrixalus transferred to a new subfamily,Micrixalinae, by Dubois (2001); Afrana and Strongylopus transferred to Pyxicephalinae by Dubois(2005), based on evidence presented by Van der Meijden et al. (2005); and Staurois transferred to anew tribe, Stauroini, by Dubois (2005).

Genus Section Subsection SubgenusNumber of

speciesSpecies sampled (reflecting

nomenclature used in this work)

Amolops Amolops 22 Amolops chapaensis, A.hongkongensis

Amolops Amo 1 Not sampledAmolops Huia 4 Huia nasicaAmolops Meristogenys 8 Meristogenys orphnocnemis

Batrachylodes 8 Batrachylodes vertebralis

Micixalus 6 Micrixalus fuscus, M. kottigeharensis

Nanorana Altirana 1 Not sampledNanorana Nanorana 2 Nanorana pleskei

Rana Amerana Amerana 2 Amerana muscosaRana Amerana Aurorana 4 Aurorana auroraRana Amietia Amietia 2 Amietia vertebralisRana Babina Babina 2 Not sampledRana Babina Nidirana 6 Nidirana adenopleura, N. chapaensisRana Hylarana Hydrophylax Amnirana 9 Amnirana albilabrisRana Hylarana Hydrophylax Humerana 3 Not sampledRana Hylarana Hydrophylax Hydrophylax 2 Hydrophylax galamensisRana Hylarana Hydrophylax Papurana 11 Papurana daemeliRana Hylarana Hydrophylax Pulchrana 10 Not sampledRana Hylarana Hydrophylax Sylvirana 21 Sylvirana guentheri, S. maosonensis,

S. nigrovittata,S. temporalis

Rana Hylarana Hylarana Chalcorana 9 Chalcorana chalconataRana Hylarana Hylarana Clinotarsus 1 Clinotarsus curtipesRana Hylarana Hylarana Eburana 5 Eburana chloronotaRana Hylarana Hylarana Glandirana 1 Glandirana minimaRana Hylarana Hylarana Hylarana 3 Hylarana erythraea, H. taipehensisRana Hylarana Hylarana Nasirana 1 Not sampledRana Hylarana Hylarana Odorrana 10 Odorrana grahamiRana Hylarana Hylarana Pterorana 1 Not sampledRana Hylarana Hylarana Sanguirana 2 Not sampledRana Hylarana Hylarana Tylerana 2 Tylerana arfakiRana Lithobates Lithobates 3 Lithobates palmipesRana Lithobates Sierrana 3 Sierrana maculataRana Lithobates Trypheropsis 2 Trypheropsis warszewitschiiRana Lithobates Zweifelia 5 Not sampledRana Pelophylax Aquarana 7 Aquarana catesbeiana, A. clamitans,

A. grylio,A. heckscheri

Rana Pelophylax Pantherana 22 Pantherana berlandieri, P. capito, P.chiricahuensis, P. forreri, P.pipiens, P. yavapaiensis

Rana Pelophylax Pelophylax 17 Pelophylax nigromaculata, P.ridibunda

Rana Pelophylax Rugosa 3 Not sampledRana Pseudorana Pseudorana 3 Pseudorana johnsiRana Rana Rana 27 Rana japonica, R. sylvatica, R.

temporariaRana Strongylopus Afrana 8 Afrana angolensis, Afrana fuscigulaRana Strongylopus Strongylopus 6 Strongylopus grayii

Staurois 4 Staurois tuberlinguis


Fig. 43. Restriction-site tree of exemplars ofHolarctic Rana of Hillis and Davis (1986). Un-derlying data were restriction sites of the nuclearrDNA gene; presence was considered to be evi-dence of relationship, absence was not. The treewas rooted on Pyxicephalus and Pelophylax (asRana ridibunda). The original figure treated allspecies, save Pyxicephalus, as members of Rana.We have noted on the right the nominal subgeneraof Dubois (1992; which we have treated as gen-era), to clarify discussion.

to summarize the relevant taxonomic litera-ture and to divide Rana (sensu lato) intoenough groups to allow some illumination ofthe problem. Our issue with his system is thatit is impossible to tell from the relevant pub-lication (Dubois, 1992) which species haveactually been evaluated for characters andwhich have merely been aggregated on thebasis of overall similarity or erected on thebasis of specially-favored characters.

Dubois’ primary division of Rana was intoeight sections of arguable phylogenetic pro-pinquity to each other or to other ranine gen-era (see table 4). We discuss these with ref-erence to his diagnoses and other literaturerelevant to their recognition:

(1) Section Amerana. Dubois (1992) erect-ed his subgenera Amerana and Aurorana forparts of the Rana boylii group of Zweifel(1955), which he placed in their own section,Amerana. Most previous work (e.g., Case,1978; Farris et al., 1979; Post and Uzzell,1981; Farris et al., 1982b; Uzzell and Post,1986) had placed these frogs from westernNorth American close to, or within, the Eur-asian Rana temporaria group. Nevertheless,section Amerana was recognized by Dubois(1992) on the basis of a combination of char-acters, none unique but corresponding to theRana boylii group identified by ribosomaldata by Hillis and Davis (1986; fig. 43). Thisgroup had been suggested by Hillis and Da-vis (1986) to be in a polytomy with whatDubois regarded as his section Rana (R. tem-poraria and R. sylvatica were the exemplarspecies in their analysis), a group composedof a part of Dubois’ section Pelophyax(Aquarana), and his sections Lithobates andPantherana. Moreover, Hillis and Davis’(1986; fig. 43) results suggested that neitherof the groups subsequently identified by Du-bois (1992) as the subgenera Aurorana andAmerana are monophyletic. Subsequentwork (Hillis and Wilcox, 2005; fig. 44) hasprovided substantial amounts of evidence insupport of the nominal subgenus Auroranabeing polyphyletic, and the subgenus Amer-ana being paraphyletic. Hillis and Wilcox(2005) used the section Amerana 1 Ranatemporaria to root the remainder of theirtree, so their overall tree cannot be taken asadditional evidence of evolutionary propin-quity of the section Amerana being in a

monophyletic group with Rana temporaria,to the exclusion of all other North AmericanRana, inasmuch as this was an assumption oftheir analysis, based on earlier work (e.g.,Case, 1978).

Dubois (1992) provided no unique mor-phological features to diagnose sectionAmerana, and because of his use of present-or-absent as a characteristic, the charactersprovided in his table 1 fail to rigorously dis-tinguish section Amerana from sections Hy-larana, Lithobates, Pelophylax, Rana, orStrongylopus (now in Pyxicephalinae on thebasis of DNA sequence evidence—Dubois,2005; Van der Meijden et al., 2005). Within


Fig. 44. Maximum-likelihood tree of Holarctic Rana of Hillis and Wilcox (2005). The underlyingdata are ca. 2kb of mtDNA of the 12S–16S region (spanning the tRNAVal gene). Sequence alignmentwas done initially using Clustal W (Thompson et al., 1994), costs not disclosed, and manually adjusted,guided by assumed secondary structure, ambiguously aligned sequences discarded. It was not statedwhether gaps were treated as data, but we presume not. Substitution model GTR 1 G1 PINVAR wasassumed for the maximum-likelihood analysis. On the basis of previous research, the root was assumedto be between the Rana temporaria 1 Rana boylii group and the remainder of New World Rana.


Amerana, Dubois recognized two subgenera,Amerana and Aurorana, differing in the ex-pansion of toe tips (mildly expanded inAmerana; not expanded in Aurorana), rowsof larval keratodonts (4–7/4–6 in Amerana;2–3/3–4 in Aurorana) karyotype (derived inAmerana; primitive in Aurorana). This sub-generic distinction is not phylogeneticallyconsistent with the results of Hillis and Davis(1986; fig. 43), who presented evidence sug-gesting that Dubois’ Aurorana is paraphylet-ic with respect to his Amerana (making onewonder what the purpose was in naming twosubgenera). Macey et al. (2001) subsequentlyprovided additional molecular evidence forparaphyly of Aurorana with respect to Amer-ana. Examples of this section in our analysisare Amerana muscosa and Aurorana aurora(see table 4).

(2) Section Amietia (including a singlesubgenus, Amietia, for two species in the Le-sotho Highlands of southern Africa). Thesole synapomorphy of Amietia is the umbra-culum over the eye in the larva. The diag-nosis of section Amietia is otherwise phylo-genetically indistinguishable on the basis ofthe table of characters provided by Dubois(1992), from Amerana, Hylarana, Lithoba-tes, Rana, or Strongylopus. We sampledAmietia vertebralis. Amietia was transferredinto Pyxicephalinae by Dubois (2005) on theapparent but undiscussed assumption that itis closely related to Strongylopus, which wasplaced by Van der Meijden et al. (2005) inthat group on the basis of DNA sequence ev-idence.

(3) Section Babina (for the Rana holstiand Rana adenopleura groups). The uniquesynapomorphy for this group is a large ‘‘su-prabrachial’’ gland (sensu Dubois, 1992) onthe sides of reproductive males (which canbe difficult to assess in nonreproductive an-imals). The diagnosis of section Babina doesnot otherwise allow it to be practically sep-arated from the sections Amerana, Hylarana,Lithobates, Pelophylax, Rana, or Strongylo-pus. Within section Babina, Dubois recog-nized two subgenera, Babina (with a largefingerlike prepollical spine, an apomorphy)and Nidirana (members of the Babina sec-tion lacking the apomorphy of the subgenusBabina). Fei et al. (2005) considered Nidi-rana to be a subgenus of their Hylarana, but

their taxonomy was presented for only theChinese fauna, so the wider implication ofthis action is not known. Of this section wesampled no member of the subgenus Babina,although we did sample Nidirana adenopleu-ra and N. chapaensis. Babina and Nidiranahave also been associated with ‘‘Hylarana’’(see below), so Dubois’ (1992) reason forrecognizing this as a section distinct fromsection Hylarana is unclear.

(4) Section Lithobates. This section is notrigorously diagnosable by the features pre-sented by Dubois’ (1992: his table 1) fromsections Amerana, Hylarana, Rana, or Stron-gylopus. However, Lithobates is consistentwith the phylogenetic tree of American Ranaprovided by Hillis and Davis (1986; fig. 43),presumably the source of the concept of thissection. Hillis and Davis placed this taxon,on the basis of DNA substitutions, as the sis-ter taxon of part of Dubois’ section Pelophy-lax, the subgenus Pantherana. Within sectionLithobates, Dubois recognized four subgen-era: Lithobates (Rana palmipes group), Sier-rana (Rana maculata group), Trypheropsis(Rana warszewitschii group), and Zweifelia(Rana tarahumarae group). All of them areconsistent with the tree provided by Hillisand Davis (1986). Dubois (1992) offered thefollowing morphological characters whichmay be synapomorphies: Lithobates differsfrom other members of the section by havingtympanum diameter larger or equal to the di-ameter of the eye; Sierrana without diagnos-tic characters that differentiate it from thesection diagnosis; Trypheropsis by having anouter metatarsal tubercle (unusual in Ameri-can ranids); and Zweifelia with sacrum notfused with presacral vertebrae. Hillis andWilcox (2005; fig. 44) presented evidencethat suggests that section Lithobates of Du-bois (1992) is paraphyletic, with part of Du-bois’ subgenera Sierrana (R. maculata), andall of his subgenera Trypheropsis, and Lith-obates falling within one monophyleticgroup, but Zweifelia (the Rana tarahumaraegroup) and another part of Sierrana (R. sier-ramadrensis) forming the sister taxon of Du-bois’ subgenus Pantherana, the Rana pipiensgroup of Hillis and Wilcox (2001).

Our exemplars of this section are Lithob-ates palmipes, Sierrana maculata, and Try-


pheropsis warszewitschii. We did not sampleZweifelia.

(5) Section Pelophylax. The charactersprovided by Dubois for his section Pelophy-lax will not rigorously diagnose it fromAmerana, Hylarana, Rana, or Strongylopus.Further, the association of his subgeneraAquarana (former Rana catesbeiana group),Pantherana (former Rana pipiens group),Pelophylax (former Rana ‘‘esculenta’’group), and Rugosa (Rana rugosa group) iscurious inasmuch as we are unaware thatanyone had previously suggested such a re-lationship. All published evidence that wasavailable to Dubois at the time of his writing(e.g., Case, 1978; Post and Uzzell, 1981; Hil-lis and Davis, 1986; Pytel, 1986; Uzzell andPost, 1986) suggested that this section ispolyphyletic, with Dubois’ subgenus Panth-erana (of his section Pelophylax) moreclosely related to his section Lithobates, thanto any other member of section Pelophylax.Indeed, the subgenera Aquarana and Panth-erana of Pelophylax are both more closelyrelated to both the sections Lithobates, Rana,and Amerana, than they are to the Old Worldmembers of section Pelophylax according tothe evidentiary literature (i.e, Case, 1978;Post and Uzzell, 1981; Hillis and Davis,1986; Pytel, 1986; Uzzell and Post, 1986).There never was any evidence for the mono-phyly of section Pelophylax sensu Dubois,while there was considerable evidenceagainst it. Recently, Hillis and Wilcox (2005;fig. 44) have provided molecular evidencethat Aquarana (their Rana catesbeianagroup) is the sister taxon of Rana sylvatica,and together the sister taxon of all otherAmerican Rana, with the exception of thesection Amerana (their Rana boylii group).

The subgenera recognized by Duboiswithin section Pelophylax have more justifi-cation for their monophyly. Aquarana is dis-tinct on the basis of its large snout–ventlength and its tympanum diameter, which isgreater than eye diameter in males. Rugosais separated by its ‘‘small’’ adult snout–ventlength. Pantherana and Pelophylax are sep-arated from Aquarana and Rugosa by their‘‘medium’’ size and spots on the dorsum, butare otherwise undiagnosable from each otherby features presented by Dubois (1992). Feiet al. (1991 ‘‘1990’’, 2005) consistently con-

sidered Pelophylax and Rugosa to be a dis-tinct genera, but these authors generalizedsolely over the Chinese fauna rather than at-tempting to draw global distinctions. FromAquarana (Rana catesbeiana group) wesampled Aquarana catesbeiana, A. clami-tans, A. grylio, and A. heckscheri. Of Panth-erana (Rana pipiens group) we sampledPantherana berlandieri, P. capito, P. chiri-cahuensis, P. forreri, P. pipiens, and P. ya-vapaiensis. Of Pelophylax we sampled R. ni-gromaculata and P. ridibunda. We did notsample Rugosa.

(6) Section Pseudorana. This section can-not be rigorously diagnosed on the basis ofinformation given by Dubois (1992) fromsection Hylarana. Pseudorana was named byFei et al. 1991 ‘‘1990’’) as a distinct genusfor Rana sauteri, R. sangzhiensis, and R.weiningensis. Subsequently, Fei et al. (2000)coined Pseudoamolops for Rana sauteri,suggesting, on the basis of its having a largeventral sucker on the tadpole, that it is moreclosely related to Amolops (sensu lato) thanto Pseudorana. Although the ventral suckerfound in Pseudoamolops is associated withthe oral disc of the tadpole, in Amolops theventral sucker sits posterior to the oral disc.Fei et al. (2000) suggested that Pseudoamo-lops is the sister taxon of the remainder oftheir Amolopinae (Amo, Amolops, Huia, andMeristogenys) and derived with respect to aparaphyletic Hylarana, although Tanaka-Ueno et al. (1998a) had previous suggestedon the basis of DNA sequence analysis thatPseudorana sauteri is imbedded within thebrown frog clade (Rana temporaria group),although that analysis had addressed nomember of nominal Amolopinae. We wereable to sample Pseudoamolops sauteri andPseudorana johnsi to test the placement ofthese species.

(7) Section Rana. This section cannot bediagnosed rigorously from sections Amer-ana, Hylarana, Lithobates, Pelophylax, orStrongylopus on the basis of characters pre-sented by Dubois (1992). The association ofRana sylvatica with the Rana temporariagroup has been controversial, with Hillis andDavis (1986) providing weak evidence for itsplacement with Rana temporaria, and Case(1978) suggesting that Rana sylvatica is phy-logenetically within other North American


Rana (sensu lato). Hillis and Wilcox (2005;fig. 44) recently provided molecular evidencein support of Rana sylvatica being the sistertaxon of the Rana catesbeiana group (Aquar-ana of Dubois, 1992). In addition to noncon-troversial members of the Rana temporariagroup (Rana japonica and R. temporaria) wesampled Rana sylvatica to test whether it wasa member of the Rana temporaria group or,as suggested previously, imbedded within aNorth American clade.

(8) Section Strongylopus. This section alsois not phylogenetically diagnosable on thebasis of Dubois’ (1992) suggested evidencefrom sections Amerana, Hylarana, Lithoba-tes, Pelophylax, or Rana. If the autapomor-phies of Babina and Amietia are not consid-ered, there also is nothing in the diagnosis ofsection Strongylopus that would prevent itfrom being paraphyletic with respect to Ba-bina or Amietia. Nevertheless, DNA se-quence evidence of Van der Meijden et al.(2005; fig. 36) places Strongylopus in Pyxi-cephalinae, and Dubois (2005) presumed thatAfrana and Amietia also should be so allo-cated. Section Strongylopus is seemingly ageographically determined unit, not a phy-logenetically determined one. Within sectionStrongylopus, Dubois recognized two sub-genera that differ in size and color of larvae(long and dorsally black in Afrana; modestlength and entirely black in Strongylopus),foot length (short in Afrana; long in Stron-gylopus), and webbing (less webbing in Af-rana than in Strongylopus).

Van der Meijden (2005; fig. 36) provideda phylogenetic tree, based on mtDNA andnuDNA sequence data, that placed Strongy-lopus and Afrana in a heterogeneous clade(which they termed the ‘‘southern African ra-nid clade’’, and which Dubois, 2005, consid-ered as an expanded Pyxicephalinae), alongwith Tomopterna (Tomopterninae), Cacos-ternum and Natalobatrachus (‘‘Petropedeti-dae’’), and Pyxicephalus (Pyxicephalinae).Because the evidence of Van der Meijden etal. (2005; fig. 36) is the first phylogeneticevidence that bears on this issue, we followthat taxonomy, but note that nothing in mor-phology so far supports this arrangement.

We sampled Afrana angolensis, A. fusci-gula, and Strongylopus grayii.

(9) Section Hylarana. We have left section

Hylarana to the end of this discussion be-cause it represents the heart of the problemof ‘‘Rana’’ systematics. The name Hylaranahas had an historically unstable application,alternatively being considered synonymouswith Rana, or treated as a distinct subgenusor genus with an ill-defined content, and di-agnosed in several different, even contradic-tory ways (e.g., Tschudi, 1838; Gunther,1859 ‘‘1858’’; Boulenger, 1882, 1920; Perret,1977; Poynton and Broadley, 1985; Laurent,1986; Fei et al., 1991 ‘‘1990’’; Dubois,1992), although it is almost always associ-ated with frogs that exhibit expanded toetips. The original diagnostic character of thegenus Hylarana Tschudi, 1838 (type species:Rana erythraea Schlegel, 1827) is the pres-ence of a dilated disc on the tips of the toes(a character that can now be seen to encom-pass many of the species of Ranidae and itsimmediate outgroups). Gunther (1859‘‘1858’’) revised the diagnosis to include‘‘males with an internal subgular vocal sac’’(i.e., lacking gular pouches) as a character,and increased the composition to five Asianand African species (including Hylarana al-bolabris and H. chalconota).

Because of the ambiguity of the diagnosticcharacter of dilated toe disc, Boulenger(1882, 1920) believed Hylarana to be a‘‘group of polyphyletic origin’’, but suggest-ed that it was a subgenus of Rana, removingvocal sac condition as a diagnostic characterand expanding its definition: dilated digitaldiscs with circummarginal grooves, T-shapedterminal phalanges, and an unforked omos-ternal style (Boulenger, 1920: 123; as Hylor-ana). All of his putatively diagnostic char-acters have greater levels of generality than‘‘Hylarana’’. He listed 62 species from Aus-tralasia, including Rana curtipes, R. guenth-eri, and R. taipehensis (the latter implicit, ashe synonomized it with R. erythraea; Bou-lenger, 1920: 152–155).

Perret (1977: 842) listed ten African spe-cies of the genus Hylarana (including H. gal-amensis), revising the diagnosis as follows:precoracoids ossified, transverse, approach-ing each other medially; metasternum ossi-fied, elongated; males with or without gularpouches; males with brachial (humeral)glands. Poynton and Broadley (1985: 139)revised the diagnosis in their account of Af-


Fig. 45. Tree of Chinese species of Odorranaof Ye and Fei (2001), based on 29 character trans-formations of morphology (ci 5 0.507). Tree root-ed on Rana japonica and Rana omeimontis. Thesubgenera Odorrana and Eburana of Fei et al.(2005) are noted on the right and the terminalsnoted with an asterisk (*) are members of Dubois’(1992) subgenus Eburana.

rican Hylarana: only some species with ex-panded digital discs; broad brown to goldenband from head to urostyle; upper lip white;males with single or paired baggy gularpouches. Laurent (1986: 761) further revisedthe diagnosis of Hylarana: without trans-verse grooves on finger discs.

Fei et al. (1991 ‘‘1990’’) moved some spe-cies from Hylarana into a new genus Odor-rana. They diagnosed their new genus Odor-rana by having: omosternum extremelysmall, colorless spines present on chest ofmale in breeding condition. Despite the ety-mology of the generic name, Fei et al. (1991‘‘1990’’), did not include odoriferous secre-tions as one of the characters uniting the ge-nus. In addition, they included six species(O. anlungensis, O. kwangwuensis, O. swin-hoana, O. tiannanensis, O. versabilis, and O.wuchuanensis) known not to have colorlessspinules on the chest of the male. Subse-quently, Ye and Fei (2001; fig. 45), on thebasis of a phylogenetic study of ChineseOdorrana (including Eburana in their sense),suggested that only the Odorrana andersoni

group (O. andersoni, O. grahami, O. haina-nensis, and O. margaretae) have large chestspines, with small spines otherwise only inO. schmackeri. Chest spines were reported asabsent in all other species of Odorrana thatthey studied: O. anlungensis, O. exiliversa-bilis, O. hejiangensis, O. kuangwuensis, O.livida, O. lungshengensis, O. nasuta, O.swinhoana, O. tiannanensis, O. versabilis,and O. wuchuanensis.

Fei et al. (1991 ‘‘1990’’: 138–139) furtherdivided Hylarana into two subgenera, Hylar-ana and Tenuirana based on the followingcharacters (Tenuirana in parentheses): ante-rior process of hyoid long, curved outwards(long, straight); tips of digits with or withouta horizontal groove (always present on toes);feet almost fully webbed (half webbed);body not long or slender (long, slender);snout blunt and rounded (long, pointed);limbs moderate (long, slender); dorsolateralfolds distinct to extremely broad (narrow);humeral gland or shoulder gland present inmales (absent); gular pouches present inmale (absent); and tadpole vent tube dextral(medial). As part of the Chinese fauna, theyincluded R. nigrovittata and R. guentheri(under the subgenus Hylarana) and R. tai-pehensis (the type species of the subgenusTenuirana) in Hylarana. Although they didnot discuss R. erythraea (the type species ofHylarana), its inclusion in the subgenus Hy-larana was implied.

As noted earlier, Dubois (1992) partitionedspecies formerly associated with one or moreof the historical manifestations of Hylaranainto several sections, subsections, and sub-genera (see table 4) of which the sectionsBabina (subgenera Babina and Nidirana)and Hylarana (subsections Hydrophylax andHylarana) are particularly relevant to thisdiscussion of ‘‘Hylarana’’-like frogs (al-though the section Hylarana, in Dubois’ sys-tem was not precluded by any evidence frombeing paraphyletic to any or all of the othersections defined by him). Sections Babinaand Hylarana are distinguishable in Dubois’system solely by the possession of a supra-brachial gland (apomorphy) in section Ba-bina. This gland is not found in section Hy-larana which at least as portrayed by Dubois(1992) and noted above, has no apomorphies.


Fig. 46. Maximum-likelihood tree of Matsui et al. (2005) for East Asian ranids, based on mito-chondrial 12S and 16S rRNA sequences (total of 1,283 bp). Sequence alignment was done underClustalX (Thompson et al., 1997) with cost functions not disclosed and subsequently adjusted manually,guided by secondary structure models as suggested by Kjer (1995). Modeltest 3.06 (Posada and Crandall,1998) was used to select nucleotide evolutionary model (GTR) assumed for analysis. Fejervarya andBuergeria were used to root the tree.

All other characters overlap or are identicalbetween the two sections.

Dubois placed the collection of subgenerathat he aggregated under section Hylaranainto two subsections: a humeral gland-bear-ing group (subsection Hydrophylax) and agroup characterized by having indistinct orabsent humeral glands (subsection Hylar-ana). The presence of a humeral gland is anapomorphy, so at least prior to analysis weconsidered this single character as evidenceof monophyly of Dubois’ subsection Hydro-phylax, leaving the condition ‘‘humeralglands indistinct or absent’’ as plesiomorphic(although we would have liked to know thedistribution of ‘‘indistinct’’ humeral glandswithin the groups where Dubois reportedthem as indistinct or absent). During analy-sis, however, Matsui et al. (2005; fig. 46)provided DNA sequence evidence suggestingthat that the subsection Hydrophylax is par-aphyletic at least with respect to Chalcorana

chalconota and (subgenus) Hylarana (sub-section Hylarana) and that subsection Hylar-ana is polyphyletic with Hylarana (subge-nus) and Chalcorana chalconota being in-dependently derived of the main group ofsubsection Hylarana, which included all oftheir exemplars of subgenera Eburana andOdorrana, as well as Chalcorana hosii.

Within the apomorphic subsection Hydro-phylax (well-developed humeral gland-bear-ing group) Dubois (1992) recognized severalweakly or undiagnosed (except in the no-menclatural sense) subgenera: Amnirana,Humerana, Hydrophylax, Papurana, Pul-chrana, and Sylvirana. According to Dubois(1992; his table II), Humerana is distin-guished from other members of the subsec-tion by the absence of an outer metatarsaltubercle; Amnirana and Pulchrana are notrigorously diagnosable from each other; Pa-purana and Pulchrana are not rigorously di-agnosable from each other; and Hydrophylax


can be diagnosed from Sylvirana only on thebasis of the absence of an expanded disc andlateral groove on finger III and toe IV. Mar-mayou et al. (2000; fig. 37) presented DNAsequence evidence that Sylvirana (a humeralgland-bearing taxon) is paraphyletic with re-spect to Hylarana (subgenus) and Pelophy-lax, both of which lack humeral glands, sug-gesting that his subsection Hydrophylax (ofsection Hylarana) is paraphyletic. We sam-pled Amnirana albilabris, Hydrophylax gal-amensis, Papurana daemeli, Sylviranaguentheri, S. maosonensis, S. nigrovittata,and S. temporalis. We were unable to sampleany member of Pulchrana, although Matsuiet al. (2005; fig. 46) provided evidence thatit is related to a group of subsection Hydro-phylax, including Sylvirana, as well as an im-bedded piece of subsection Hylarana, Chal-corana chalconota.

The ‘‘indistinct or absent’’ humeral-glandgroup (subsection Hylarana) is not rigorous-ly diagnosable on the basis of apomorphiesfrom any of the other sections of Rana (ex-cept for Amietia [now in Pyxicephalinae] andBabina) or from other genera of Ranidae.We, therefore, must assume that it is a mix-ture of groups with no necessary phyloge-netic propinquity or to the exclusion of otherranid groups. The subgenera coined and ag-gregated under subsection Hylarana by Du-bois (1992) are variably diagnosable. Mar-mayou et al. (2000; fig. 37) provided DNAsequence evidence for the polyphyly of sub-section Hylarana (as well as for the para-phyly of the other subsection, Hydrophylax;see above), by placing Hylarana (subgenus)and Chalcorana very distant from each otherevolutionarily.

Subgenus Chalcorana (Chalcorana chal-conota being our exemplar, and the type ofthe taxon) is a morphologically very poorlydiagnosed subgenus within the subsectionHylarana, with dermal glands present or notin the larvae, outer metatarsal tubercle pres-ent or not, male with paired subgular vocalpouches present or not, animal pole of eggpigmented or not, and the only likely syna-pomorphy is the relative size of the fingers(I , II; Dubois, 1992). Matsui et al. (2005;fig. 46) provided evidence that Chalcoranais broadly polyphyletic, with Chalcoranachalconota close to subsection Hydrophylax

and C. hosii close to members of Eburana.Matsui et al. (2005) suggested that this wasnot surprising as Chalcorana chalconota layspigmented eggs and has a larval keratodontformula of 4–5/3 (Inger, 1966), whereasChalcorana hosii has pigmentless eggs andlarvae with a keratodont formula of 5–6/4.Matsui et al. (2005) transferred Chalcoranahosii into Odorrana (sensu lato, as includingEburana), with the status of the remainingspecies of nominal Chalcorana left question-able.

Clinotarsus is a monotypic taxon (Clino-tarsus curtipes) that is also poorly diagnosed,with larvae attaining a large size and havinga somewhat high (but not exclusively) larvalkeratodont formula of 8/6–8 (Chari, 1962;Dubois, 1992), both characteristics found inNasirana as well. We sampled the single spe-cies, Clinotarsus curtipes.

Subgenera Eburana and Odorrana (sensuDubois, 1992) are putatively distinguishedfrom each other by Eburana having (1) discswith a circumlateral groove on finger III andtoe IV (present or absent in Odorrana); (2)external metatarsal tubercle present or absent(absent in Odorrana); (3) gular pouches (var-iable, including the Eburana condition, inOdorrana); (4) no unpigmented spines on thechest in males (putatively present in Odor-rana, according to Dubois, 1992, but absentin most species, being present in Odorranaonly in the Odorrana andersoni group [seeabove] and two species of the Odorranaschmackeri group [O. schmackeri and O.lungshuengensis]; see C.-C. Liu and Hu,1962; Hu et al., 1966, 1973; Yang and Li,1980; L. Wu et al., 1983; Fei, 1999; Fei andYe, 2001, Ye and Fei, 2001; see also Bain etal., 2003; Bain and Nguyen, 2004); (5) ani-mal pole of egg unpigmented (pigmented inOdorrana, except O. anlungensis, O. exiliv-ersabilis, O. hejiangensis, O. kwangwuensis,O. lungshengensis, O. nasuta, O. tiannanen-sis, O. versabilis [C.-C. Liu and Hu, 1962;Hu et al., 1966; Yang and Li, 1980; Fei,1999; Fei and Ye, 2001; Fei et al., 2001; Yeand Fei, 2001; see also Bain et al., 2003;Bain and Nguyen, 2004]).

Ye and Fei (2001; fig 45) on the basis ofmorphology, and Jiang and Zhou (2005; fig.41), on the basis of DNA sequence evidencehave demonstrated that recognition of Ebur-


ana renders Odorrana paraphyletic. With adifferent sampling of species of Eburana andOdorrana, Matsui et al. (2005; fig. 46) pro-vided DNA sequence evidence that nominalEburana is paraphyletic with respect to atleast one member of Odorrana (O. schmack-eri) and one species of Chalcorana (C. ho-sii). On this basis Matsui et al. (2005) con-sidered Eburana to be part of Odorrana(along with Chalcorana hosii).

As noted above, a number of characterssuggested by Dubois (1992) to diagnose var-ious taxa have taxonomic distributions tosuggest more widespread occurrence. Col-orless chest spinules (a putative character ofOdorrana) are also present in Huia nasica(B.L. Stuart and Chan-ard, 2005), Nidiranaadenopleura, and the holotype of N. cald-welli (R. Bain, personal obs.). The one pu-tative apomorphy of Eburana is character 5(lacking a pigmented animal pole on the egg)which is known from at least three other gen-era: Odorrana (see above), Amolops (e.g., A.chunganensis), and Chalcorana (e.g. C. ho-sii) (Bain et al., 2003; Bain and Nguyen,2004).

Bain et al. (2003) transferred Rana chlo-ronota (which they thought Dubois, 1992,had in hand as his exemplar of ‘‘Rana livi-da’’) from Eburana to Odorrana on the fol-lowing bases: it has odoriferous skin secre-tions (implied to be characteristic of Odor-rana by way of the formulation of the nameby Fei et al., 1991 ‘‘1990’’); its chromo-somes have submetacentric pairs and posi-tions of secondary constrictions more similar(in some cases almost identical) to other spe-cies of Odorrana than to other species ofEburana (Li and Wang, 1985; Wei et al.,1993; Matsui et al., 1995); and moleculardata (Murphy and Chen, unpublished), al-though it has unpigmented eggs and lackspectoral spinules. The implication is that (1)odoriferous skin secretions may be unreport-ed for other Eburana species, or (2) odorif-erousness, presence of spinules, and egg col-or may be homoplastic. We sampled Ebur-ana chloronota and Odorrana grahami. Al-though this will not allow us to test themonophyly of Eburana or Odorrana, it willhelp illuminate the extent of the problem.

Fei et al. (2005; fig. 45) have since dividedOdorrana (sensu Fei et al., 1991 ‘‘1990’’)

into two subgenera: Bamburana and Odor-rana. Bamburana was distinguished fromsubgenus Odorrana (sensu Fei et al., 2005)by the following characters: dorsolateralfolds present (absent in Odorrana), upper lipwith sawtooth spinules (absent in Odorrana);xiphisternum without notch (deeply notchedin Odorrana); sternum widened posteriorly(sternum not widened posteriorly in Odor-rana). Odorrana (Bamburana) versabilis(the type species) and O. (Bamburana) na-suta do not have white spines on the chestof the male, but the other species, O. (Bam-burana) exiliversabilis does. According tothis diagnosis, Bamburana should also in-clude O. trankieni (Orlov et al., 2003). Nev-ertheless, Ye and Fei (2001; fig. 45) provideda cladogram based on 29 character transfor-mations of morphology that suggest stronglythat Bamburana renders the subgenus Odor-rana as paraphyletic. We did not sample anyspecies of nominal Bamburana, but on thebasis of the study of Ye and Fei (2001) wecan reject its recognition.

Glandirana was coined by Fei et al. (1991‘‘1990’’) as a genus, a position they havemaintained consistently (Fei et al., 2005).Nevertheless, Glandirana was placed by Du-bois (1992) within subsection Hylarana,where it was diagnosed by Dubois as lackingdigital and toe pads, although it retains a lat-eral groove on the toe tips as found in othergroups that do have enlarged digital pads.With the exception of the lateral toe groovesin Glandirana, we are unaware of any mor-phological character that would prevent as-signment of Glandirana to sections Amer-ana, Pelophylax, or Rana. Jiang and Zhou(2005), on the basis of DNA sequence evi-dence, placed Glandirana as the sister taxonof Rugosa and together as the sister taxon ofa group composed of Amolops, Nidirana, Pe-lophylax, and Rana (fig. 41). We sampledGlandirana minima.

Subgenus Hylarana is also weakly diag-nosed by comparative characters, with theonly morphological apomorphies suggestedby Dubois (1992) being the low number ofrows of labial keratodonts in larvae (sharedwith Glandirana and sections Amerana, Pe-lophylax, and Rana; tadpoles unknown inPterorana and Tylerana). We sampled Hy-larana erythraea and H. taipehensis. Matsui


et al. (2005; fig. 46) suggested, on the basisof DNA sequence evidence that Hylarana (amember of Dubois’, 1992, subsection Hylar-ana) is imbedded within his subsection Hy-drophylax.

Subgenus Tylerana is diagnosed from theremaining Hylarana-like taxa by having alarge oval gland on the inner side of the armin males (Boulenger, 1920; Dubois, 1992).We sampled Tylerana arfaki.

Subgenera Sanguirana, Pterorana, andNasirana, which we did not study, were re-ported by Dubois (1992) to have dermalglands on the larvae (unknown in Ptero-rana), well-developed digital discs, and outermetatarsal tubercles (unknown in Pterorana).Two of the three subgenera, Nasirana andPterorana, contain single species that havedistinctive autapomorphies. Nasirana altico-la can be distinguished from other Hylarana-like frogs by the large size of its larvae(shared with Clinotarsus), the ocellated colorpattern on the larval tail (larvae of Pteroranaand Tylerana unknown), the fleshy promi-nence on the nose of the adult, and the rel-atively high 7–9/8–9 keratodont formula(Dubois, 1992), which may suggest that it isa member of one of the cascade-dwellingclades. Similarly, Pterorana khare is distin-guished from other ranid frogs by the fleshyfolds on the flanks of the adult. Matsui et al.(2005) did not study Sanguirana or Pteror-ana, but suggested that Nasirana is the sistertaxon of a group composed of subsection Hy-drophylax and Chalcorana chalconota (nom-inally part of subsection Hylarana).

RANIXALINAE (1 GENUS, 10 SPECIES): Ranix-alinae is another Indian endemic. It containsonly Indirana, and is characterized by terres-trial tadpoles with a keratodont formula of3–5/3–4. Otherwise, it is diagnostically iden-tical to Nyctibatrachinae (Dubois et al.,2001). Dubois (1999a: 89) doubted that Nyc-tibatrachinae was distinguishable from Ra-nixalinae and suggested that Blommers-Schlosser’s (1993) distinction between Ra-nixalinae (as Indiraninae), Nyctibatrachinae,and Nannophrys (which Blommers-Schlosserplaced in the otherwise African Cacosterni-nae and Dubois placed in Ranixalinae) mightbe substantiated by additional evidence.

Van der Meijden (2005; fig. 36), recentlyplaced, weakly, Indirana as the sister taxon

of Dicroglossinae on the basis of mtDNAand nuDNA sequence data.

We sampled two species of Indirana (In-dirana sp. 1 and Indirana sp. 2).

RHACOPHORIDAE (10 GENERA, 267 SPECIES)AND MANTELLIDAE (5 GENERA, 157 SPECIES):Some authors consider Afro-Asian Rhaco-phoridae and Madagascan Mantellidae to befamilies (e.g., Vences and Glaw, 2001; Vander Meijden et al., 2005). Others considerthem subfamilies of Ranidae (e.g., J.D.Lynch, 1973; Dubois, 1987 ‘‘1985’’, 1992;Roelants et al., 2004) or subfamilies of alarger Rhacophoridae (e.g., J.A. Wilkinsonand Drewes, 2000; J.A. Wilkinson et al.,2002). Regardless, their taxonomic historiesare deeply entwined and we treat them in ourdiscussion as families.

Liem (1970) provided the first character-analysis-based study of phylogeny of thegroup (including the mantellids in his sense)in which the mantellids were considered bas-al to the remaining rhacophorids (fig. 47A).Channing (1989) followed with a more rig-orous analysis of Old World treefrogs andproposed that Buergeria is the sister taxon ofthe remaining rhacophorids (including themantellines; fig. 47B), which he called Buer-geriinae and Rhacophorinae, respectively. Inhis arrangement the mantellids were includedas basal members of Rhacophorinae. Fordand Cannatella (1993) noted at least foursynapomorphies that distinguish Rhacophor-idae 1 Mantellidae from other ranoids: (1)presence of intercalary elements (presumingthat hyperoliids are not the sister taxon); (2)one slip of the m. extensor digitorum com-munis longus inserts on the distal portion ofthe fourth metatarsal; (3) outermost slip ofthe m. palmaris longus inserts on the proxi-molateral rim of the aponeurosis palmaris;and (4) possession of a bifurcate terminalphalanx. J.A. Wilkinson and Drewes (2000)discussed the analyses by Liem (1970) andreanalysis of these data by Channing (1989)and suggested further analytical refinementsbut noted considerable instability in the mor-phological evidence (fig. 47C).

More recent work has suggested that man-tellids are the sister taxon of rhacophorids(e.g., Emerson et al., 2000b; Richards et al.,2000; Roelants et al., 2004; Delorme et al.,2005), with this group imbedded within Ran-


←

Fig. 47. A, Rhacophorid and mantellid tree ofLiem (1970) based on 36 direct to dendritic mor-phological transformation series, rooted on a hy-pothetical generalized ranid ancestor. This is oneof six equally parsimonious trees constructed un-der the Combinatorial Method (Sharrock and Fel-senstein, 1975) that Liem considered to be the‘‘best’’; B, Tree of Rhacophoridae (includingMantellidae) by Channing (1989) based on a re-interpretation and reanalysis of character transfor-mations from Liem (1970); C, Rhacophorid sec-tion of consensus tree of J.A. Wilkinson andDrewes (2000; their fig. 14), based on reanalysisof Liem and Channing’s data, as well as reinter-pretation of some characters on the basis of spec-imen study. Quotation marks denote nonmono-phyly.

idae. Vences and Glaw (2001) suggested thatMantellidae is composed of three subfami-lies: Boophinae (Boophis), Laliostominae(Aglyptodactylus and Laliostoma), and Man-tellinae (Mantella and ‘‘Mantidactylus’’).Vences et al. (2003d) arranged these subfam-ilies as Boophinae 1 (Laliostominae 1 Man-tellinae), with ‘‘Mantidactylus’’ deeply par-aphyletic with respect to Mantella, and sev-eral of the subgenera of ‘‘Mantidactylus’’paraphyletic or polyphyletic.

J.A. Wilkinson et al. (2002; fig. 48) pro-posed a phylogeny of rhacophorines, basedon mtDNA sequence data. They found man-tellines to be the sister taxon of rhacophori-nes, and that within rhacophorines, thatBuergeria is the sister taxon of all others.They also found Chirixalus to be polyphy-letic, a problem that was addressed, in part,by the recognition of Kurixalus by Ye, Fei,and Dubois (In Fei, 1999), for ‘‘Chirixalus’’eiffingeri. Some other taxonomic problemswere left open by J.A. Wilkinson et al.(2002): the recognition of ‘‘Chirixalus’’ pal-bebralis, which is isolated phylogeneticallyfrom the majority of rhacophorids; the mono-phyletic grouping of the type species of Chi-rixalus (Chirixalus doriae) with that of Chi-romantis (Chiromantis xerampelina); and theweakly supported sister clade of Chirixalus-Chiromantis of Chirixalus vittatus, with thetype species of Polypedates, P. leucomystax.

Delorme et al. (2005) have since proposeda taxonomy of Philautini (Rhacophoridae;


Fig. 48. Consensus of weighted parsimony trees of Rhacophoridae suggested by J.A. Wilkinson etal. (2002), with their subfamily taxonomy on right. (This is Mantellidae and Rhacophoridae of otherauthors.) The tree was based on 2kb (of 12S and 16S mt rRNA as well as tRNAVal). Alignment wasmanual, guided by models of secondary structure with ambiguously aligned segments discarded. Inanalysis, transversions were weighted twice transitions. Whether reatment of gaps were treated as evi-dence of relationship or as missing data was not stated. Chirixalus eiffingeri was placed in Kurixalusby Ye, Fei, and Dubois (In Fei, 1999), and Chirixalus idiootocus was transferred into an explicitlypolyphyletic/paraphyletic Aquixalus by Delorme et al. (2005). The tree was rooted on Nidirana aden-opleura and Aquarana catesbeiana.


Fig. 49. Delorme et al.’s (2005) dendrogram of rhacophorids, based on undisclosed molecular andmorphological data (although characters were summarized for some genera and suprageneric groups),redrawn to illuminate the paraphyly of groupings.

fig. 49). Although a tree was provided, theevidence (molecular or morphological) thatprovided the tree structure was not provided,and inasmuch as phylogenetic propinquitywas not the organizing principle of their pro-posed taxonomy, their taxonomy is not con-sistent with the phylogeny they proposed.Although reported to be based largely on thesame data set as the rhacophorid study ofJ.A. Wilkinson et al. (2002; 12S and 16SrRNA), the tree proposed by Delorme et al.(2005) also included data from rhodopsinand from morphology (number and contentof transformations undisclosed), but Delormeet al. (2005) did not include the tRNAValine

gene included by J.A. Wilkinson et al.

(2002). Because none of the underlying datawere formally provided, methods of align-ment and analysis were also not provided.Substantially less resolution is evident in theDelorme et al. (2005) tree (fig. 49) than inthe J.A. Wilkinson et al. (2002) tree (fig. 48),although they agree that (1) mantellines arethe sister taxon of rhacophorines; (2) Buer-geria is the sister taxon of all remaining rha-cophorids; (3) Theloderma and Nyctixalusare sister taxa; (4) Chirixalus is paraphyleticwith respect to Chiromantis and likely poly-phyletic (see points 6 and 7); (5) Rhacopho-rus may be paraphyletic with respect to apossibly nonmonophyletic Polypedates; (6) amonophyletic unit exists that is composed of


Kurixalus eiffingeri and Aquixalus idiootocusand A. verrucosus (the latter two were trans-ferred, respectively, by Delorme et al., 2005,from ‘‘Chirixalus’’ and ‘‘Rhacophorus’’ intoan explicitly paraphyletic or polyphyleticAquixalus, without disclosure of phylogenet-ic evidence; see comment below); (7) ‘‘Chi-rixalus’’ palpebralis is demonstrably not ina monophyletic group with remaining Chi-rixalus.

Delorme et al. (2005) recognized a para-phyletic/polyphyletic Aquixalus containingtwo nominal subgenera: (1) Aquixalus (par-aphyletic/polyphyletic if Aquixalus idiooto-cus and A. verrucosus are included; if theyare excluded from Aquixalus the monophylyof the remaining subgenus Aquixalus remainsarguable); (2) Gracixalus (type species: Phi-lautus gracilipes Bourret, 1937) for the‘‘Chirixalus’’ gracilipes group, which theytreated as phylogenetically distant from ‘‘C.’’palpebralis, thereby suggesting that the pal-pebralis group of Fei (2001), composed, inFei’s usage, of Philautus palpebralis, P. gra-cilipes, P. medogensis, P. ocellatus, and P.romeri, is nonmonophyletic. Nevertheless,because J.A. Wilkinson et al. (2002) and De-lorme et al. (2005) presumably had so muchunderlying evidence in common, the fact oftheir substantial topological differences be-tween their results is surprising, althoughmany of the internal branches of the J.A.Wilkinson et al. (2002) tree are weakly sup-ported and possibly could be modified by theundisclosed rhodopsin and morphology dataof Delorme (2005). Nevertheless, a tree with-out associated evidence (that of Delorme etal., 2005) cannot test a tree that has evidenceattached to it (the tree of J.A. Wilkinson etal., 2002).

Because Delorme et al. (2005; fig. 49) donot accept (apparently) phylogenetic propin-quity as the organizing principle in taxono-my, they (1) created a new paraphyletic ge-nus, Aquixalus (including Chirixalus idioo-tocus and Rhacophorus verrucosus, whichthey simultaneously figured to be closer evo-lutionarily to Kurixalus eiffingeri than to oth-er members of their Aquixalus), (2) retaineda nonmonophyletic Chirixalus (with respectto Chiromantis and ‘‘Chirixalus’’ palpebral-is), and (3) recognized Philautini (Philautus1 Theloderma 1 Nyctixalus 1 ‘‘Aquixal-

us’’), for which the predominance of theirown evidence, as demonstrated by their tree,does not reject paraphyly. In particular, it isnot clear why these authors transferred Chi-rixalus idiootocus into a paraphyletic‘‘Aquixalus’’, so for our overall discussion,we will not follow the transfer of ‘‘Chirix-alus’’ idiootocus into a paraphyletic/poly-phyletic ‘‘Aquixalus’’, because this taxonom-ic change disagrees with the phylogenetictree (albeit, data free) proposed in the samepublication.

In our analysis we sampled Boophinae(Boophis albilabris, B. tephraeomystax); Lal-iostominae (Aglyptodactylus madagascarien-sis, Laliostoma labrosum); Mantellinae(Mantella aurantiaca, M. nigricans, Manti-dactylus cf. femoralis, M. peraccae); Buer-geriinae (Buergeria japonica); Rhacophori-nae (‘‘Aquixalus’’ (Gracixalus) gracilipes[formerly in Chirixalus or Philautus], ‘‘Chi-rixalus’’ idiootocus, Chirixalus doriae, C.vittatus, Chiromantis xerampelina, Kurixaluseiffingeri, Nyctixalus pictus, N. spinosus,Philautus rhododiscus, Polypedates cruciger,P. leucomystax, Rhacophorus annamensis, R.bipunctatus, R. calcaneus, R. orlovi, andTheloderma corticale).

RESULTS

SEQUENCE LENGTH VARIATION AND

NOTES ON ANALYSIS

Length variation among the four nuclearprotein coding genes was minimal. Follow-ing trimming of primers, all histone H3-com-plete products were 328 bp, and all SIA-complete products were 397 bp. All but oneof the rhodopsin-complete products were 316bp; the sequence for Alytes obstetricanswas 315 bp, as was the sequence of thisspecies deposited previously on GenBank(AY364385). Most tyrosinase products were532 bp, exceptions being Xenophrys majorand Ophryophryne hansi, which were 538bp. Tyrosinase was by far the most difficultfragment to amplify (tyrosinase sequenceswere sampled for only 38% of the terminals),and this difficulty impedes understanding ofthe significance of this length variation. The‘‘closest’’ taxa for which we were able to ob-tain sequences for this locus were Xenopuslaevis (from GenBank AY341764) and Hem-


Figure 50 is thetaxonomy tree of life,

inserted under the back cover.

isus marmoratus (both of which are 532 bp),so it is unclear whether the greater length ofthis tyrosinase fragment is characteristic ofsome megophryids or a more inclusive clade.The homologous tyrosinase sequence for Pe-tropedetes parkeri downloaded from Gen-Bank (AY341757) was 535 bp. As with themegophryids, the generality of this length isunclear. However, the length of Arthrolep-tides sp. is 532, so it is likely that the in-creased length is restricted to some or all spe-cies of Petropedetes.

Length variation was much more extensiveand taxonomically widespread in the ribo-somal loci. Among complete H1 sequences,the shortest length of 2269 bp was found inAfrana fuscigula. The longest sequence wasthat of the outgroup terminal Latimeria chal-umnae (2530 bp), followed by Ptychadenamascareniensis (2494 bp) and Silurana tro-picalis (2477 bp). Length variation was tooextensive for clear phylogenetic patterns toemerge. However, although extensive varia-tion in the length of the 28S sequences oc-curred even among closely related species(e.g., 744 bp in Schoutedenella schubotzi and762 bp in S. xenodactyloides), numerousclades may be characterized by their 28Slength. For example, of the 20 salamander28S fragments with no missing data, all hada length of 694 bp, except Pseudoeuryceaconanti and Desmognathus quadramacula-tus, which were 695 bp. The only other spe-cies of 694 bp in this study were the twoturtles (Pelomedusa subrufa and Chelydraserpentina) and the pelodryadine frog, Nyc-timystes dayi. Length variation in 28S isgreater among caecilians (683–727 bp), butit is still more restricted than in anurans(685–830 bp).

Among the sampled anurans, this 28Sfragment is . 700 bp in all but six species(appendix 3). Mantella nigricans and M. au-rantiaca differ from all other taxa in thattheir 28S sequence is 685 bp (28S sequenceswere not generated for Mantidactylus, butthey were for Laliostoma, Aglyptodactylus,and numerous rhacophorids, which have 28Ssequences of 709–712 bp). As mentionedearlier, the 28S sequence of Nyctimystes dayiis 694 bp, and that of the related Litoria gen-imaculata is 690. The remaining outliers areBufo punctatus (700 bp) and Microhyla sp.

(698 bp) which differ from close relatives by. 50 bp and . 25 bp, respectively. Ascaphustruei, Leiopelma archeyi, and L. hochstetteriare all 703 bp, as are the included species ofPelodytes and Spea. Similarly, Alytes andDiscoglossus are the only sampled specieswith a 28S fragment of 706 bp.

Although these variations in length do notprovide evidence of phylogeny independentof the underlying indel and nucleotide trans-formation events, their phylogenetic conser-vativeness makes them useful diagnostictools, and we therefore note 28S sequencelength, where relevant, in the taxonomic sec-tions that follow.

Parsimony analysis by POY of the com-bined data set resulted in a single most par-simonious solution of 127019 steps. Al-though optimizing the implied alignment onthe topology found in POY verified thelength reported in POY, ratcheting of the im-plied alignment in NONA spawned fromWinclada resulted in four most parsimonioustrees of length 127,017 steps, and these areour preferred hypotheses. The only differ-ences between the POY and NONA solutionsinvolve the placement of (1) Glandirana and(2) Brachytarsophrys feae. This conflict isalso seen among the four 127017-step trees,resulting in the polytomies seen in the strictconsensus (fig. 50 [provided as a multipageinsert]).

TOPOLOGICAL RESULTS AND DISCUSSION

A consensus of the four equally most par-simonious trees is shown in figure 50 (in-sert). Most clades are highly corroborated bymolecular evidence (and in some places bymorphological evidence). Although only animperfect surrogate for a measure of support(something that so far eludes us), the Bremer(5 decay index) and jackknife values allspeak to a highly corroborated tree. (See ap-


pendix 4 for branch length, Bremer support,and jackknife values.) Because this studyrests on the largest amount of data ever ap-plied to the problem of the relationshipsamong amphibians, we think that the ob-tained tree is a step forward in the under-standing of the evolutionary history of am-phibians. We do, of course, have reservationsabout parts of the overall tree. But, upon re-flection, we realized that most of the parts ofthe tree that concerned us were those that (1)we considered insufficiently sampled relativeto known species and morphological diver-sity (e.g., Bufonidae); or (2) are groups forwhich no other evidence-based suggestionsof phylogeny had ever been provided (e.g.,parts of traditionally recognized Ranoidea).Nevertheless, familiarity has much to do withnotions of plausibility, the root of the prob-lem of social conservatism in amphibian sys-tematics.

We discuss results under two headings andwith reference to several different figures.The primary focus in this first section, ‘‘Re-sults’’, is to address issues of relationshipamong, and monophyly of, major groups(nominal families and subfamilies and no-menclaturally unregulated taxa). We alsomake general taxonomic recommendations inthis section. Under the second heading,‘‘Taxonomy’’, we discuss further results andvarious taxonomic issues under the appro-priate taxonomic category. Bremer and jack-knife values are reported for each branch infigure 50 (insert; as well as in other figures,where relevant) but are otherwise only oc-casionally mentioned in text.

The general tree shown in figure 50 (in-sert), with 532 terminals, is obviously toocomplex and detailed for easy discussion, sowe will refer to subtrees in different figures.Relevant taxa (branches) have the moleculardata summarized by name and/or number inappendix 4. We first discuss the results rel-ative to the Review of Current Taxonomy ator above the nominal family-group level,with reference to families that appear to bemonophyletic and those that are paraphyleticand polyphyletic. In the case of paraphylyand polyphyly we offer remedies in this sec-tion that are paralleled in more detail in theTaxonomy section, where we propose amonophyletic taxonomy for all but a few

problematic amphibian groups and discussaspects of our results that are relevant to thesystematics of that particular group, such asmonophyly of nominal genera and varioustaxonomic remedies to problems that our re-sults highlighted.

OUTGROUP RELATIONSHIPS

In our results, Latimeria is outside of thetetrapod clade, and amniotes form the sistertaxon of amphibians. This topology was con-ventional, at least for paleontologists andmorphologists (e.g., Gauthier et al., 1988a,1988b; fig. 2A). Within Amniota, we foundturtles to be the sister taxon of diapsids (ar-chosaurs 1 lepidosaurs) and this inclusivegroup to be the sister taxon of mammals. Ourmolecular data do not support the suggestionby Rieppel and de Braga (1996), based onmorphology, that turtles are more closely re-lated to lepidosaurs than to archosaurs. Ourmolecular results disagree with the results ofMannen and Li (1999), Hedges and Poling(1999), and Iwabe et al. (2005), in which tur-tles were found to be closely related to ar-chosaurs, with lepidosaurs, and mammals assuccessively more distant relations. An anal-ysis of why our molecular results are con-gruent with the conventional tree of mor-phology (fig. 2A) and not with previous mo-lecular results is largely outside the scope ofthis paper. Nevertheless, our analysis was aparsimony analysis, as were the studies ofGauthier et al. (1988a; 1988b). The molec-ular study of Hedges and Poling (1999) rest-ed on a large amount of DNA evidence (ca.5.2kb), but their alignment was made undera different set of evolutionary assumptionsfrom that used in their phylogenetic analysis.A stronger test of amniote relationships willbe made by combining morphology and allavailable DNA evidence and analyzing thesedata under a common set of assumptions.

AMPHIBIA (LISSAMPHIBIA) AND BATRACHIA

Our results (figs. 50 [insert], 51) corrobo-rate the monophyly of amphibians (Lissam-phibia of Parsons and Williams, 1963; Am-phibia of Cannatella and Hillis, 1993) withreference to other living taxa, although ourdata obviously cannot shed any light on theplacement of the lissamphibians among fossil


Fig. 51. Basal structure of our consensus tree(fig. 50 [insert]) with respect to outgroups andmajor amphibian taxa.

Fig. 52. Caecilian section of general tree (fig. 50 [insert]).

groups. We also found the three groups oflissamphibians to be strongly supported (fig.50 [insert], branches 7, 24, 74). Furthermore,our DNA sequence data indicate that the cae-cilians are the sister taxon of the clade com-posed of frogs plus salamanders (Batrachia;fig. 50 [insert], branch 23), the topology pre-ferred by Trueb and Cloutier (1991). Ourdata reject (1) that living amphibians are par-aphyletic with respect to Amniota (Carrolland Currie, 1975; J.S. Anderson, 2001); (2)that salamanders are paraphyletic with re-spect to caecilians (Laurin, 1998a, 1998b,1998c); and (3) the hypothesis, based onsmaller amounts of evidence, that caeciliansand salamanders are closest relatives (Feller

and Hedges, 1998). Our data suggest strong-ly that the arrangement favored by morphol-ogists (e.g., Trueb and Cloutier, 1991; Ior-dansky, 1996; Zardoya and Meyer, 2000,2001; Schoch and Milner, 2004) is also thearrangement favored by the preponderance ofthe molecular evidence (e.g., San Mauro etal., 2005), that living amphibians form amonophyletic group with respect to Amniota,and that frogs and salamanders are moreclosely related to each other than either is tothe caecilians (contra Feller and Hedges,1998). The effect of including fossils and amuch more complete morphological data setare not known, but we note that our molec-ular data are consistent with the preponder-ance of morphological data so far published.

Salamanders (Caudata) and frogs (Anura)are each also monophyletic, a result that willsurprise no one, even though the morpholog-ical evidence for monophyly of the salaman-ders, in particular, is weak (Larson and Dim-mick, 1993).

GYMNOPHIONA

In general form our cladogram (fig. 50 [in-sert], fig. 52) agrees with the conventional


view of caecilian relationships (fig. 3). LikeNussbaum (1977, 1979) and later authors(e.g., Duellman and Trueb, 1986; San Mauroet al., 2004; San Mauro et al., 2005) we findthat Rhinatrematidae is the monophyletic sis-ter taxon of the remaining caecilians. Thisplacement appears well-corroborated on bothmorphological and molecular grounds.

Ichthyophiidae is paraphyletic with respectto Uraeotyphlidae (this being highly corrob-orated by our molecular data), and can berestated as Ichthyophis is paraphyletic withrespect to Uraeotyphlus. This outcome wasarrived at previously by Gower et al. (2002).There is a single morphological character,angulate annuli anteriorly, that supports themonophyly of the ichthyophiids (sensu stric-to, excluding Uraeotyphlus), but the amountof molecular evidence in support of Uraeo-typhlus being nested within Ichthyophis in-dicates that this character was either reversedin Uraeotyphlus or independently derived indifferent lineages of ‘‘Ichthyophis’’. Underthese circumstances, Uraeotyphlus must betransferred to Ichthyophiidae, and althoughtreatment of ‘‘Ichthyophis’’ is beyond thescope of this study, we expect subsequentwork (denser sampling of ichthyophiids andaddition of new data) to delimit the nature ofthis paraphyly and reformulate infrafamilialtaxonomy. The effect of this change is min-imal, because Uraeotyphlidae contains a sin-gle genus, and no hierarchical information islost by placing Uraeotyphlidae in the syn-onymy of Ichthyophiidae.

As expected from previously publishedDNA sequence (M. Wilkinson et al., 2003)and morphological evidence (M.H. Wake,1993; M. Wilkinson, 1997), we found Sco-lecomorphidae to be imbedded within Cae-ciliidae. The evidence for this is strong (ap-pendix 4, branches 12, 14, 16), and we there-fore consider Scolecomorphidae to be a sub-sidiary taxon (Scolecomorphinae) withinCaeciliidae. Similarly, Typhlonectidae isdeeply imbedded within Caeciliidae, a resultpreviously noted (M.H. Wake, 1977; Nuss-baum, 1979; M. Wilkinson, 1991; Hedges etal., 1993). Typhlonectidae is here regarded asa subsidiary taxon (as Typhlonectinae) with-in a monophyletic Caeciliidae, although thegenera of the former ‘‘Caeciliinae’’ remainincertae sedis within the Caeciliidae.

Our results differ slightly from those pre-sented by M. Wilkinson et al. (2003), whichwere based on a smaller amount of sequencedata (mt rRNA only). Like us, M. Wilkinsonet al. (2003) found Scolecomorphidae andTyphlonectidae to be imbedded within ‘‘Cae-ciliidae’’, although in a different and lessstrongly corroborated placement. Our place-ment of Siphonops (South America) as thesister taxon of Hypogeophis (Seychelles) andtogether the sister taxon of Gegeneophis (In-dia), is the only unanticipated result. In lightof the strong support it received in our anal-ysis, this conclusion deserves to be evaluatedcarefully.

CAUDATA

Among previously published cladogramsour results (fig. 53) most resemble the treeof salamander families suggested by Gao andShubin (2001; fig. 5) and diverge slightlyfrom the results presented by Larson andDimmick (1993; fig. 4) and Wiens et al.(2005; fig. 7) in placing sirenids (which lackspermatophore-producing organs) as the sis-ter taxon of Proteidae (which, like other sal-amandroid salamanders has spermatophore-producing organs), rather than placing thesirenids as the sister taxon of all other sala-mander families. (The Bayesian analysis ofWiens et al., 2005, however, placed crypto-branchoids as the sister taxon of remainingsalamanders, suggesting that there is internalconflict within their data set.) Other recentresults found, on the basis of RAG-1 DNAsequence evidence (Roelants and Bossuyt,2005; San Mauro et al., 2005), and on thebasis of RAG-1, nuRNA, and morphology(Wiens et al., 2005), Sirenidae to be the sistertaxon of remaining salamanders, the tradi-tional arrangement. Because our molecularevidence did not overlap with theirs, andwith the arguable example of Wiens et al.(2005), their amount of evidence is smallerthan ours, these results require additionaltesting. Our results do not reject the mono-phyly of any of the nominal families of sal-amanders, a result that is consistent with pre-vious studies. Except as noted later, the re-maining results are conventional.

HYNOBIIDAE AND CRYPTOBRANCHIDAE: Un-like the results of Larson and Dimmick


Fig. 53. Salamander section of general tree (fig. 50 [insert]). See discussion in ‘‘Taxonomy’’ forsubfamilies of Plethodontidae and Salamandridae. New taxonomy is on right.


(1993; fig. 4), San Mauro et al. (2005; fig.17), Roelants and Bossuyt (2005; fig. 16),and Wiens et al. (2005; fig. 7) our resultsplace these taxa as the sister taxon of all oth-er salamanders, and not as the sister taxon ofall salamanders excluding sirenids (the rela-tionship recovered by Larson and Dimmick,1993, San Mauro et al., 2005, and Roelantsand Bossuyt, 2005). The monophyly of hy-nobiids plus cryptobranchids is not contro-versial, nor is that of Cryptobranchidae. Inthe case of Hynobiidae, as noted in the tax-onomic review, our sampling is insufficientto address any of the generic controversies(summarized by Larson et al., 2003: 43–45)and is only a minimal test of the monophylyof Hynobiidae.

SIRENIDAE AND PROTEIDAE: Unlike Larsonand Dimmick (1993) and more recent mor-phological and molecular studies (Roelantsand Bossuyt, 2005; San Mauro et al., 2005;Wiens et al., 2005), but like Gao and Shubin(2001; fig. 5), we recovered Sirenidae not asthe sister taxon of all other salamanders butas the sister taxon of Proteidae. Our highlycorroborated results and the results of Gaoand Shubin (2001) suggest that the perenni-branch characteristics of Proteidae and Sir-enidae are homologous. On this topology thecloacal apparatus for spermatophore forma-tion is a synapomorphy at the level of allsalamanders, excluding Cryptobranchidaeand Hynobiidae, with a loss in Sirenidae. Al-ternatively, it is a convergent development inProteidae and in the ancestor of Salamandri-dae, Rhyacotritonidae, Dicamptodontidae,Plethodontidae, Amphiumidae, and Ambys-tomatidae. The effect of combining the mor-phological data presented by Wiens et al.(2005) with all of their and our moleculardata remains an open question, although wenote that their morphological-only data setproduced a result in which Sirenidae 1 Pro-teidae form a monophyletic group. Thus, itis not clear that this is a simple morphology-versus-molecules issue. Rather than oversim-plify and misrepresent that paper, we leavethe question open as to what the result willbe when all molecular and morphologicaldata are combined.

As noted earlier, our results reject a mono-phyletic Salamandroidea (all salamanders,excluding Cryptobranchidae, Hynobiidae,

and Sirenidae). This taxon was diagnosed byinternal fertilization through the productionof spermatophores (produced by a complexsystem of cloacal glands) and having angularand prearticular bones fused (also found inSirenidae). The hypothesis that sirenids andproteids form a taxonomic group is quite old:It was first suggested by Rafinesque (1815;as Meantia; see the discussion in appendix6).

RHYACOTRITONIDAE AND AMPHIUMIDAE: Weresolved the polytomy found in the tree ofGao and Shubin (2001) of Plethodontidae,Rhyacotritonidae, and Amphiumidae intoRhyacotritonidae 1 (Amphiumidae 1 Pleth-odontidae), a conclusion also of Wiens et al(2005). Although we did not test the mono-phyly of either Rhyacotriton or Amphiuma,in neither case is this seriously in question.As noted earlier, the position of Amphiumawith respect to plethodontids is conventional(Larson, 1991; Larson and Dimmick, 1993).

PLETHODONTIDAE: Our tree differs tren-chantly from those of authors prior to 2004(e.g., D.B. Wake, 1966; Lombard and Wake,1986), but is similar in general form to thoseof Mueller et al. (2004) on the basis of com-plete mtDNA genomes, Macey’s (2005) re-analysis of those data, and the tree of Chip-pindale et al. (2004), based on 123 charactersof morphology and about 2.9 kb of mtDNAand nuDNA. In those studies and in oursAmphiumidae and Rhyacotritonidae wereobtained as successively more distant out-groups of Plethodontidae. In the three pre-vious studies (Chippindale et al., 2004;Mueller et al., 2004; Macey, 2005) as wellas in ours, the desmognathines are in a cladewith the plethodontines (Ensatina, and Pleth-odon). Our data (as well as those of Muelleret al., 2004, and Macey, 2005) also foundHydromantes and Speleomantes to be in thisplethodontine clade, not with ‘‘other’’ boli-toglossines.

In our results, as well as those of Muelleret al. (2004) and Chippindale et al. (2004),all other plethodontids (the old Hemidacty-liinae and Bolitoglossini) are placed in agroup that forms the sister taxon of the firstgroup. The evidence for these groupings isstrong (appendix 4; fig. 53). The placementof Hydromantes and Speleomantes in the firstgroup by our data is strongly corroborated,


being placed within the desmognathines (aresult that runs counter to the morphologicalevidence as presented by Schwenk andWake, 1993). Mueller et al. (2004) obtainedHydromantes (including Speleomantes) inthe same general group as we did, but placedas the sister taxon of Aneides. In the detailsof placement of Batrachoseps, Hemidacty-lium, and our few overlapping bolitoglossinegenera, we differ mildly. Our differencesfrom the tree of Macey (2005) are difficultto explain. The amount of evidence mar-shalled by Macey (the same aligned data setas Mueller et al., 2004), is on the order of14kb of aligned mtDNA sequence. OurmtDNA set is a subset of that, but analyzeddifferently, particularly with respect to align-ment. Alignment of the data set of Muelleret al. (2004) was done with different trans-formation costs than used in analysis, andthis alignment was accepted for reanalysis byMacey (2005). Further, a number of our ex-emplars (i.e., Plethodon dunni, P. jordani,Desmognathus quadramaculatus, Phaeog-nathus, Hydromantes platycephalus, Euryceawilderae, Gyrinophilus porphyriticus, Thor-ius sp., Bolitoglossa rufescens, and Pseu-doeurycea conanti) are represented in ouranalysis by sequences that are not part of themtDNA genome. Although we provisionallyaccept the results of Macey (2005; fig. 10)as based on a much larger amount of datathan our results, it may be that the singlebiggest cause of different results between ouranalysis and his is the method of alignment.One will know only when that data set isanalyzed using direct optimization.

Chippindale et al. (2004; fig. 11) suggest-ed a taxonomy, consistent with their tree, forPlethodontidae. Plethodontinae in their sensecorresponds to the group composed of theformer Desmognathinae and former Pletho-dontini. Within the second group composedof hemidactyliines and bolitoglossines theyrecognized Hemidactyliinae (Hemidacty-lium), Spelerpinae Cope, 1859 (Eurycea[sensu lato], Gyrinophilus, Stereochilus, andPseudotriton), and Bolitoglossinae (for all ofthe bolitoglossine genera studied). Macey(2005) came to the same taxonomy, butplaced Hemidactyliinae as the sister taxon ofremaining plethodontids, the relative positionof the other groups remaining the same. He

also placed Hydromantes (including Speleo-mantes) in Plethodontinae. These two generahad previously been associated with Bolito-glossini (D.B. Wake, 1966; Elias and Wake,1983).

Our results regarding placement of Hydro-mantes and Speleomantes imply either thatthe morphological synapomorphies of theDesmognathinae, mostly manifestations ofthe bizarre method of jaw opening in whichthe lower jaw is held in a fixed position byligaments extending to the atlas–axis com-plex, are reversed in the hydromantine cladeor that this peculiar morphology is conver-gent in Desmognathus and Phaeognathus.

Previous to the study of Mueller et al.(2004), who found Plethodon to be mono-phyletic on the basis of analysis of mtDNAsequence data, all published evidence point-ed to paraphyly of Plethodon with respect toAneides (e.g., Larson et al., 1981; Mahoney,2001). Our analysis of a variety of DNA se-quence data suggests also that the eastern andwestern components of Plethodon do nothave a close relationship, being united solelyby symplesiomorphy. Had it not been for theappearance of the recent paper by Chippin-dale et al. (2004), we would have erected anew generic name for western Plethodon (forwhich no name is currently available). But,the denser sampling of plethodons and dif-ferent selection of genes in the Chippindaleet al. (2004) paper suggests that a study in-cluding all of the available data and a densersampling is required before making any tax-onomic novelties.

We recovered former Bolitoglossini aspolyphyletic, with the traditional three maincomponents (supergenera Batrachoseps, Hy-dromantes, and Bolitoglossa; D.B. Wake,1966) being found to have little in commonwith each other. Our tree of bolitoglossines(sensu stricto) is not strongly corroborated.Nevertheless, that the three groups of boli-toglossines should be recovered as polyphy-letic is not shocking inasmuch as the amountof evidence that traditionally held them to-gether was small.

SALAMANDRIDAE: Our results largely cor-respond to those of Titus and Larson (1995)and especially with those presented by Lar-son et al. (2003). Our tree differs from thetopology suggested by Larson et al. (2003),


which was based on more extensive taxonsampling but less DNA evidence, in that weget additional resolution of the group Neu-rergus 1 (Triturus 1 Euproctus), where inthe tree provided by Larson et al. (2003)these taxa are in a polytomy below the levelof Paramesotriton 1 Pachytriton.

DICAMPTODONTIDAE AND AMBYSTOMATI-DAE: Dicamptodon is recovered as the sistertaxon of Ambystomatidae, the same phylo-genetic arrangement found by previous au-thors (Sever, 1992; Larson and Dimmick,1993; Wiens et al., 2005). The monophyly ofDicamptodon was only minimally tested, al-though Dicamptodon monophyly is not se-riously in doubt (Good and Wake, 1992). In-asmuch as Dicamptodontidae was recognizedon the basis of its hypothesized phylogeneticdistance from Ambystomatidae (Edwards,1976), a hypothesis now rejected, we pro-pose the synonymy of Dicamptodontidaewith Ambystomatidae, which removes theredundancy of having two family-groupnames, each containing a single genus. Thereformulated Ambystomatidae contains twosister genera, Dicamptodon and Ambystoma.

Ambystomatidae was found to be mono-phyletic, at least with reference to our ex-emplar taxa, and the sister taxon of formerDicamptodontidae. Although we have not se-verely tested the monophyly of Ambystoma,others have done so (e.g., Shaffer et al.,1991; Larson et al., 2003), and its monophy-ly is well corroborated.

ANURA

As mentioned earlier and in the taxonomicreview, the amount of morphological andDNA sequence evidence supporting themonophyly of Anura is overwhelming. Wethink that our data make a strong case for anew understanding of frog phylogeny. Eventhough most of our results are conventionalwith respect to understanding of frog phy-logenetics, our purpose is not to conceal thisunderstanding, but to bring the taxonomy offrogs into line with their phylogenetic rela-tionships. For discussion we adopt the Fordand Cannatella (1993) tree (fig. 14) as thetraditional view of phylogeny (although notof nomenclature). We first discuss the non-neobatrachian frogs (fig. 54).

ASCAPHIDAE AND LEIOPELMATIDAE: Asca-phidae and Leiopelmatidae are recovered inour analysis as parts of a monophyleticgroup, mirroring the results of Green et al.(1989), Baez and Basso (1996), and more re-cent authors (Roelants and Bossuyt, 2005;San Mauro et al., 2005). The paraphyly ofthis grouping, as suggested by Ford and Can-natella (1993), is rejected. If our results areaccurate, the five morphological synapomor-phies suggested by Ford and Cannatella(1993) of Leiopelma plus all frogs excludingAscaphus must be convergences or synapo-morphies of all living frogs that were lost inAscaphus. Nevertheless, the hypothesis ofFord and Cannatella (1993) was based large-ly on the unpublished dissertation of Can-natella (1985; cited by Ford and Cannatella,1993), who rooted his analysis of primitivefrogs on Ascaphus on the basis of two ple-siomorphic characters found among frogsuniquely in Ascaphus: (1) facial nerve passesthrough the anterior acoustic foramen andinto the auditory capsule while still fused tothe auditory nerve; (2) salamander-type jawarticulation in which there is a true basal ar-ticulation. All other characters placing Leio-pelma as more closely related to all non-As-caphus frogs were optimized by this assump-tion, requiring their polarity to be verified.Furthermore, the support for the Ascaphus 1Leiopelma branch is very high (Bremer 541, jackknife 5 100%), so it is unlikely thatfive morphological characters (of which threehave not been rigorously polarized) can re-verse this. Placing Ascaphus and Leiopelmaas sister taxa allows some characters to beexplained more efficiently. Thus, the absenceof the columella in these two taxa can beseen to be a synapomorphic loss. Ritland’s(1955) suggestion that the m. caudalipubois-chiotibialis in Leiopelma and Ascaphus maynot be homologous with the tail-waggingmuscles of salamanders, and the more tradi-tional view of homology with these musclesare both consistent with our results. To re-move the redundancy of the family-groupnames with the two genera (Ascaphus andLeiopelma), we assign Ascaphus to Leiopel-matidae (as did San Mauro et al., 2005). Roe-lants and Bossuyt (2005) retained Ascaphi-dae and Leiopelmatidae as separate familiesand resurrected the name Amphicoela Noble,


Fig. 54. Part 1 of anurans from the general tree (fig. 50 [insert]): non-neobatrachian frogs.

1931, for this taxon. Amphicoela is redun-dant with Leiopelmatidae (sensu lato) whenAscaphidae and Leiopelmatidae are regardedas synonymous, as we do.

PIPIDAE AND RHINOPHRYNIDAE: We found,as did Haas (2003) and San Mauro et al.(2005), and as was suggested even earlier byOrton (1953, 1957), Sokol (1975), and Mag-lia et al. (2001) that Rhinophrynidae 1 Pip-idae is the sister taxon of all non-leiopel-matid frogs. This result is strongly supportedby our evidence (fig. 54; appendix 4, branch-es 77, 78, 84). Recent suggestions had alter-natively placed Pipoidea as the sister taxon

of Pelobatoidea (Ford and Cannatella, 1993;their Mesobatrachia) or as the sister taxon ofall other frogs (Maglia et al., 2001; Pugeneret al., 2003). All three of these arrangementsare supported by morphological characters,although Haas’ arrangement is more highlycorroborated. Haas (2003) suggested nineapomorphies that exclude Pipoidea and As-caphidae from a clade composed of all otherfrogs. Pugener et al. (2003) suggested threesynapomorphies for all frogs excluding pi-poids. (This statement is based on examina-tion of their figure 12; they provided no com-prehensive list of synapomorphies.) Ford and


Fig. 55. Trees of intergeneric relationships within Pipidae (from fig. 19). A, Cannatella and Trueb(1988). B, Baez and Pugener (2003); C, Roelants and Bossuyt (2005); D, De Sa and Hillis (1990; resultsconsistent with B, C, and E); E, This work. (Undirected network on lower right shows rooting pointsof each result, except for D.)

Cannatella (1993) suggested that four char-acters support Mesobatrachia: (1) closure ofthe frontoparietal fontanelle by juxtapositionof the frontoparietal bones (not in Pelodytesor Spea); (2) partial closure of the hyoglossalsinus by the ceratohyals; (3) absence of thetaenia tecti medialis; and (4) absence of thetaenia tecti transversum. However, on the ba-sis of Haas’ (2003) morphological dataalone, these characters are rejected as syna-pomorphies. However, the mtDNA molecularresults presented by Garcıa-Parıs et al.(2003) support the recognition of Mesobatra-chia (Pelobatoidea 1 Pipoidea). Neverthe-less, these authors included only three non-pipoid, non-pelobatoid genera (Ascaphus,Discoglossus, and Rana) as outgroups, whichdid not provide a strong test of mesobatra-chian monophyly. Placement of Pipoidea asthe sister taxon of all other non-leiopelmatidfrogs requires rejection of Discoglossanura,Bombinatanura, and Mesobatrachia of Fordand Cannatella (1993), a rejection that isstrongly supported by our study.

In our analysis, as well as in all recentones (Ford and Cannatella, 1993; Baez andPugener, 2003; Haas, 2003), Pipoidea (Rhin-ophrynidae 1 Pipidae) is monophyletic, as

are the component families. A novel arrange-ment in our tree is Hymenochirus beingplaced as the sister taxon of Pipa 1 (Silur-ana 1 Xenopus). This result differs from thecladograms of Cannatella and Trueb (1988),de Sa and Hillis (1990), Baez and Pugener(2003), and Roelants and Bossuyt (2005; fig.16). Although our results are highly corrob-orated by our data, a more complete testwould involve the simultaneous analysis ofall of the sequence data with the morpholog-ical data of all relevant living and fossil taxa.As noted in figure 55, the rooting point ofthe pipid network appears to be more impor-tant to the estimates of phylogeny than dif-ferences among networks.

The placement of Pipidae 1 Rhinophryn-idae as the sister taxon of all frogs, saveLeiopelmatidae 1 Ascaphidae, suggestsstrongly that the fusion of the facial and tri-geminal ganglia (Sokol, 1977) found in pe-lobatoids, pipoids, and neobatrachians, butnot in Discoglossidae and Bombinatoridae ishomoplastic. Similarly, the absence of freeribs in the adults of pelobatoids, neobatra-chians, and pipoids, but their presence inLeiopelma, Ascaphus, and Discoglossidae,requires either independent losses in pipoids


and pelobatoids 1 neobatrachians, or an in-dependent gain in discoglossids 1 bombi-natorids. Roelants and Bossuyt (2005) notedfossil evidence that would support the inde-pendent loss in pipoids and Acosmanura (Pe-lobatoidea 1 Neobatrachia).

DISCOGLOSSIDAE AND BOMBINATORIDAE:Ford and Cannatella (1993) partitioned theformer Discoglossidae (sensu lato) into Dis-coglossidae (sensu stricto) and Bombinato-ridae because their evidence suggested thatformer Discoglossidae was paraphyletic,with Bombinatoridae and Discoglossidaeforming a graded series between the Asca-phidae and Leiopelmatidae on one hand, andall other frogs on the other hand. As notedin the taxonomic review, this partition wasbased on two characters shared by discog-lossines and all higher frogs and absent inthe bombinatorines. Haas (2003) rejected thistopology with six character transformationssupporting the monophyly of Bombinatori-dae and Discoglossidae. In addition to Haas’characters, we have strong molecular evi-dence in support of the monophyly of thistaxon (Discoglossidae 1 Bombinatoridae), aswell as the subsidiary families.

Unlike Haas (2003), but like recent mo-lecular studies (Roelants and Bossuyt, 2005;San Mauro et al., 2005), we did not recoverAlytes as the sister taxon of the remainingdiscoglossines and bombinatorines. We in-cluded Haas’ six characters supporting thattopology in our analysis, and the taxon sam-pling for this part of the tree is nearly iden-tical in the two studies, so it appears that mo-lecular evidence in support of a topology ofAlytes 1 Discoglossus is decisive. The onlyrationale for considering Discoglossidae andBombinatoridae as separate families restedon the assertion of paraphyly of the group(Ford and Cannatella, 1993), a position nowrejected. Nevertheless, we retain the two-family arrangement because this reflects thestate of the literature and is consistent withrecovered phylogeny.

PELOBATOIDEA: Haas (2003) did not recov-er Pelobatoidea (Megophryidae, Pelobatidae,Pelodytidae, Scaphiopodidae) as monophy-letic. Although we included his morpholog-ical data in our analysis, we find Pelobato-idea to be highly corroborated, which sug-gests very interesting convergences in tad-

pole morphology. Garcıa-Parıs et al. (2003;fig. 18) also found Pelobatoidea to be mono-phyletic, on the basis of their DNA evidence,and suggested a topology of Scaphiopodidae1 (Pelodytidae 1 (Megophryidae 1 Pelo-batidae)), with relatively low Bremer valueson the branch tying Scaphiopodidae to theremaining taxa. In our results we recover allof these family-group units as monophyleticand highly supported. But, our data showstrongly a relationship of (Pelodytidae 1Scaphiopodidae) 1 (Pelobatidae 1 Mego-phryidae) (fig. 54).

NEOBATRACHIA: As in all previous studies,we found Neobatrachia to be highly corrob-orated by many transformations (figs. 50 [in-sert], 56, 58, 59, 60). What is particularlynotable in the broad structure of Neobatra-chia is the dismemberment of Leptodactyli-dae and Hylidae as traditionally formulated,as well as the placement of Heleophrynidaeoutside of the two major monophyletic com-ponents, for our purposes referred to here as(1) Hyloidea, excluding Heleophrynidae and(2) Ranoidea.

HELEOPHRYNIDAE: Haas (2003) suggestedthat Heleophryne may be related to Peloba-toidea, a suggestion that is not borne out byour simultaneous analysis of Haas’ data andour molecular data. Earlier authors (e.g., J.D.Lynch, 1973) addressed the phylogenetic po-sition of Heleophryne and associated it withLimnodynastidae on the basis of overall sim-ilarity, or with Limnodynastidae 1 Myoba-trachidae on the basis of DNA sequence data(Biju and Bossuyt, 2003). But recently SanMauro et al. (2005) suggested, on the basisof DNA sequence evidence, that Heleo-phrynidae is the sister taxon of remainingNeobatrachia. We obtained the same place-ment of Heleophrynidae as did San Mauroet al. (2005).

HYLOIDEA, EXCLUDING HELEOPHRYNIDAE:Hyloidea, as traditionally composed, consistsof all arciferal groups of neobatrachians andwas expected (on the basis of absence ofmorphological evidence) to be broadly par-aphyletic with respect to Ranoidea, or fir-misternal frogs (Microhylidae, Ranidae, andtheir satellites, Mantellidae, Rhacophoridae,Hyperoliidae, Arthroleptidae, Astylosterni-dae, and Hemisotidae), or monophyletic onthe basis of molecular data (Ruvinsky and


Fig. 56. Part 2 of anurans from the general tree (fig. 50 [insert]): Heleophrynidae and basal hyloids(Sooglossidae, Batrachophrynidae, Limnodynastidae, and Myobatrachidae).

Maxson, 1996; Feller and Hedges, 1998; Fai-vovich et al., 2005; San Mauro et al., 2005).In our results, Hyloidea is only narrowly par-aphyletic, with the bulk of the hyloids form-ing the sister taxon of ranoids and only He-leophrynidae outside of this large clade (aconclusion also reached by San Mauro et al.,2005). Within the restricted (non-heleo-phrynid) Hyloidea, a unit composed of Soog-lossidae and the newly discovered Nasika-batrachidae forms the sister taxon of the re-maining hyloids (cf. Biju and Bossuyt, 2003;San Mauro et al., 2005). For the most part,the traditional family-group units within Hy-loidea were found to be monophyletic, theexceptions being predictable from preexist-

ing literature: Leptodactylidae was found tobe composed of several only distantly relatedgroups, and Hylidae (in the sense of includ-ing Hemphractinae) was confirmed to be par-aphyletic or polyphyletic (see below).

SOOGLOSSIDAE AND NASIKABATRACHIDAE:The South Indian Nasikabatrachus and theSeychellean sooglossids form an ancient tax-on united by considerable amounts of molec-ular evidence (fig. 56). Biju and Bossuyt(2003) placed Nasikabatrachus as the sistertaxon of the sooglossids and our results cor-roborate this. We are unaware of any histor-ical (in the sense of history of systematics)or other reason to regard Nasikabatrachus asbeing in a family distinct from Sooglossidae,


and on the basis of the molecular evidencewe consider Nasikabatrachus to be the soleknown mainland member of Sooglossidae.The antiquity of this united group is evidentin its placement as the sister taxon of all oth-er non-heleophrynid hyloids. Its phylogenet-ic position as well as its presence both inIndia and in the Seychelles suggests that thetaxon existed before the final breakup of Pan-gaea in the late Mesozoic.

MYOBATRACHIDAE, LIMNODYNASTIDAE, AND

RHEOBATRACHIDAE: Because of the absenceof morphological synapomorphies unitingthe Australo-Papuan groups Myobatrachidae,Limnodynastidae, and Rheobatrachidae (inour usage), and because of the suggestion ofa special relationship between Myobatrachi-dae and Sooglossidae and between Limno-dynastidae and Heleophrynidae (J.D. Lynch,1973), we were surprised that the preponder-ance of evidence corroborates a monophy-letic Myobatrachidae 1 Limnodynastidae 1Rheobatrachidae (fig. 56). Nevertheless,there is only one morphological character in-volved in these alternatives (condition of thecricoid ring: complete or incomplete), so, inretrospect, our surprise was unwarranted.

With respect to Myobatrachidae (sensustricto; Myobatrachinae of other authors),our results are largely congruent with thoseof Read et al. (2001). The positions of Me-tacrinia and Myobatrachus are reversed inthe two studies. The trenchant difference be-tween our results is in the placement of Par-acrinia. Our results placed it strongly as thesister taxon of Assa 1 Geocrinia, whereasRead et al. (2001) placed it as the sister taxonof the myobatrachids that they studied, withthe exception of Taudactylus. Conclusiveresolution of this problem will require allavailable evidence to be analyzed simulta-neously.

We include Mixophyes (formerly in Lim-nodynastidae) and Rheobatrachus (solemember of former Rheobatrachidae) inMyobatrachidae (sensu stricto); Read et al.(2001) did not include those taxa in theirstudy. We obtain a sister-taxon relationshipbetween Mixophyes and Rheobatrachus (al-though this is only weakly corroborated) andassociation of Mixophyes (and Rheobatra-chus) with Myobatrachinae, inasmuch asMixophyes has traditionally been assigned to

Limnodynastinae. Further discussion can befound in the Taxonomy section.

‘‘LEPTODACTYLIDAE’’: The paraphyly andpolyphyly of ‘‘Leptodactylidae’’ is starklyexposed by this analysis, being paraphyleticwith respect to all hyloid taxa except Heleo-phrynidae and Sooglossidae (fig. 57). Be-cause of the extensiveness of the paraphylyand the complexity of the reassortment of thesubsidiary groupings, the various units of aparaphyletic/polyphyletic ‘‘Leptodactylidae’’must be dealt with before the remainder ofHyloidea can be addressed. Specifically thefollowing nominal families are imbeddedwithin ‘‘Leptodactylidae’’: Allophrynidae,Brachycephalidae, Bufonidae, Centrolenidae,Dendrobatidae, Hylidae, Limnodynastidae,Myobatrachidae, and Rhinodermatidae. Toprovide the tools to allow us to discuss theremainder of the hyloid families, we hereprovide a new familial taxonomy with ref-erence to the old taxonomy provided in fig-ure 50 (insert). We start at the top of figure56 and address the subfamilies of ‘‘Lepto-dactylidae’’ as we come to them.

‘‘TELMATOBIINAE’’: ‘‘Telmatobiinae’’ isfound to be polyphyletic (figs. 56, 57, 58,59), with the austral South American Calyp-tocephalellini (Telmatobiinae-1: Telmatobufo1 Caudiverbera) forming the sister taxon ofthe Australo-Papuan Myobatrachidae, Lim-nodynastidae, and Rheobatrachidae; Telma-tobiinae-2 being paraphyletic with respect toBatrachyla (Telmatobiinae-3: Batrachylini);and Ceratophryini (Lepidobatrachus (Cera-tophrys 1 Chacophrys)); and Telmatobiinae-4 (Hylorina, Alsodes, Eupsophus) being thesister taxon of a taxon composed of part ofthe polyphyletic Leptodactylinae (Limnome-dusa) and Odontophrynini (Proceratophrysand Odontophrynus; part of nominal Cera-tophryinae). As noted in the taxonomic re-view, Telmatobiinae was united by overallplesiomorphic similarity (e.g., exotrophictadpoles, non-bony sternum). That the mo-lecular data show Telmatobiinae to be poly-phyletic is neither surprising nor unconven-tional.

The Chilean and Peruvian telmatobiineclade composed of Caudiverbera and Tel-matobufo is monophyletic on both molecularand morphological grounds; is highly corrob-orated as the sister taxon of the Australo-


Fig. 57. Fate of former Leptodactylidae (sensu lato) on our general tree (fig. 50 [insert]). Imbeddednon-leptodactylid taxa are in bold.

Papuan Myobatrachidae 1 Limnodynastidae1 Rheobatrachidae; and is phylogeneticallydistant from all other telmatobiine ‘‘lepto-dactylids’’ (see also San Mauro et al., 2005;

fig. 17). (The inclusion of Batrachophrynusis discussed under Batrachophrynidae in theTaxonomy section.) This result is not unex-pected as calyptocephallelines have long


Fig. 58. Part 3 of anurans from the general tree (fig. 50 [insert]): Hemiphractidae, Brachycephalidae,Cryptobatrachidae, Amphignathodontidae, and Hylidae.


Fig. 59. Part 4 of anurans from the general tree (fig. 50 [insert]): Centrolenidae, Leptodactylidae,Ceratophryidae, and Cycloramphidae.

been suspected to be only distantly related toother telmatobiine leptodactylids (Cei, 1970;Burton, 1998a). Moreover, the region theyinhabitat is also home to Dromiciops, a mar-supial mammal most closely related to somegroups of Australian marsupials and not toother South American marsupials (Aplin andArcher, 1987; Kirsch et al., 1991; Palma andSpotorno, 1999). The previous association ofCalyptocephalellini with the South AmericanTelmatobiinae was based on overall similar-ity with geographically nearby groups. Asthe sister taxon of the Australian Myoba-trachidae 1 Limnodynastidae, it would beacceptable to place Calyptocephallelinae

within some larger familial group, but tomaintain familiar usage (and because wehave resolved Limnodynastidae, Myoba-trachidae, and Rheobatrachidae into rede-fined Limnodynastidae and Myobatrachidae)we consider it as the family Batrachophryn-idae (the oldest available name for calypto-cephallelines as currently understood; see‘‘Taxonomy’’ and appendix 6 for discussionof application of this name).

As suggested by Lynch (1978b), one partof Telmatobiinae-2; (fig. 59), Telmatobiini, isparaphyletic with respect to Batrachylini(Batrachylus) as well as to Ceratophryinae-1(Ceratophryini). The oldest name for the


clade Telmatobiinae-2 (Telmatobius, Batra-chyla, Atelognathus) 1 Ceratophryinae-1(Ceratophrys, Chacophrys, and Lepidobatra-chus) is Ceratophryidae. Within this familywe recognize two subfamilies, Telmatobiinae(Telmatobius) and Ceratophryinae (for all re-maining genera). Within Ceratophryinae werecognize two tribes: Batrachylini (Batrachyla1 Atelognathus) and Ceratophryini (for Cer-atophrys, Chacophrys, and Lepidobatrachus).(See the Taxonomy section for further dis-cussion.)

As noted earlier, another former compo-nent of Telmatobiinae (Telmatobiinae-3; seefigs. 57, 59) is recovered as the sister taxonof one piece of ‘‘Leptodactylinae’’ (Limno-medusa) plus Odontophrynini (Ceratophryi-nae-2, formerly part of Ceratophryinae).(The polyphyly of ‘‘Leptodactylinae’’ will beaddressed under the discussion of that sub-familial taxon.) Because no documentedmorphological synapomorphies join the twogroups of nominal Ceratophryinae (Odonto-phrynini and Ceratophrynini), and they hadpreviously been shown to be distantly related(Haas, 2003), this result does not challengecredibility. (See further discussion in theTaxonomy section.)

‘‘HEMIPHRACTINAE’’: ‘‘Hemiphractinae’’,which was transferred out of Hylidae andinto Leptodactylidae by Faivovich et al.(2005), is united by possessing bell-shapedgills in developing embryos and bearing eggson the dorsum in shallow depressions to ex-tensive cavities. The subfamily has not beenfound to be monophyletic by any recent au-thor (Darst and Cannatella, 2004; Faivovichet al., 2005). In our results (figs. 57, 58) wefound (1) Hemiphractus is the sister taxon ofhyloids, excluding Batrachophrynidae,Myobatrachidae (including Rheobatrachi-dae), Limnodynastidae, Sooglossidae (in-cluding Nasikabatrachidae), and Heleo-phrynidae; (2) Flectonotus 1 Gastrotheca;and (3) Stefania 1 Cryptobatrachus are suc-cessively more distant from a clade [branch371] bracketed by Hylidae and Bufonidae.The evidence for this polyphyly is quitestrong, so we recognized three families toremedy this: Hemiphractidae (Hemiphrac-tus), Cryptobatrachidae (Cryptobatrachus 1Stefania), and Amphignathodontidae (Flec-tonotus 1 Gastrotheca).

ELEUTHERODACTYLINAE AND BRACHYCE-PHALIDAE: Eleutherodactylinae is paraphylet-ic with respect to Brachycephalidae (Brachy-cephalus) (fig. 57, 58). There is nothingabout Brachycephalus being imbedded with-in Eleutherodactylus (sensu lato) that re-quires any significant change in our under-standing of morphological evolution, exceptto note that this allows the large eggs anddirect development of Brachycephalus to behomologous with those of eleutherodacty-lines. This result was suggested previously(Izecksohn, 1971; Giaretta and Sawaya,1998; Darst and Cannatella, 2004), and noevidence is available suggesting that weshould doubt it. Further, to impose a mono-phyletic taxonomy, we follow Dubois (2005:4) in placing Eleutherodactylinae Lutz, 1954,into the synonymy of BrachycephalidaeGunther, 1858. All ‘‘eleutherodactyline’’genera are therefore assigned to Brachyce-phalidae. Previous authors (e.g., Heyer, 1975;J.D. Lynch and Duellman, 1997) have sug-gested that Eleutherodactylus (and eleuthero-dactylines) is an explosively radiating lineage.Our results, which places brachycephalids asthe sister taxon of the majority of hyloid frogsrefocuses this issue. The questions now be-come (as suggested by Crawford, 2003): (1)Why are the ancient brachycephalids mor-phologically and reproductively conservativeas compared with their sister taxon (com-posed of Cryptobatrachidae, Amphignatho-dontidae, Hylidae, Centrolenidae, Dendro-batidae, and Bufonidae, as well as virtuallyall other ‘‘leptodactylid’’ species)? (2) Whyare there so few species in the brachyce-phalid (eleutherodactyline) radiation relativeto their sister group (the former composed ofsome 700 species, mostly in nominal Eleuth-erodactylus, and the latter consisting of morethan twice as many species)? Additionalcomments on this taxon will be found underBrachycephalidae in the Taxonomy section.

‘‘LEPTODACTYLINAE’’: Although ‘‘Lepto-dactylinae’’ has at least one line of evidencein support of its monophyly (bony sternum),the molecular data unambiguously expose itspolyphyly, with its species falling into twounits (fig. 57, 59). The first of these (Lepto-dactylinae 1–2), is paraphyletic with respectto the cycloramphine unit, called Cycloram-phinae-1 in figures 57 and 59, Paratelmato-


bius and Scythrophrys (an arrangement par-tially consistent with the suggestion of J.D.Lynch, 1971, that at least Paratelmatobiusbelongs in Leptodactylinae). The second unit(Leptodactylinae-3, Limnomedusa) is the sis-ter taxon of Odontophrynini (Ceratophryi-nae-2). Limnomedusa was previously unitedwith other leptodactylines solely by its pos-session of a bony sternum, but it lacks thefoam-nesting behavior found in most otherleptodactylines (exceptions being Pseudopa-ludicola, Paratelmatobius, and some speciesof Pleurodema). Regardless, the associationof Limnomedusa with Leptodactylinae hasalways been tentative (Heyer, 1975). So, ourdiscovery (corroborating the results of Fai-vovich et al., 2005) that Limnomedusa is notpart of Leptodactylinae is not unexpected;nor does it require extensive homoplasy inthe morphological data that are available. Werecognize this unit (Leptodactylinae-1 1 Cy-cloramphinae-1 1 Leptodactylinae-2; figs.57, 59, branch 430) as Leptodactylidae (sen-su stricto), a taxon that is much diminishedcompared with its previous namesake butthat is consistent with evolutionary history.Further discussion is found under Leptodac-tylidae in the Taxonomy section.

‘‘CERATOPHRYINAE’’: ‘‘Ceratophryinae’’(sensu lato) is polyphyletic, with its two con-stituent tribes, Odontophrynini (Ceratophryi-nae-2) and Ceratophryninae (Ceratophryi-nae-1) (sensu Laurent, 1986) being only dis-tantly related (figs. 57, 59, branches 446,458). As noted elsewhere in this section,there has never been any synapomorphic ev-idence to associate these two groups. Thus,their distant relationship is not surprising oreven unconventional, inasmuch as Barrio(1963; 1968) and Lynch (1971) suggestedthat these two units are distantly related. Cer-atophryini is imbedded in a taxon (figs. 57,59: Telmatobiinae-2; branch 441) that isweakly corroborated, but is here recognizedas a family Ceratophryidae. Odonotophry-nini is resolved as the sister taxon of Lim-nomedusa (formerly in Leptodactylinae), to-gether residing in a group composed largelyof former cycloramphines.

‘‘CYCLORAMPHINAE’’ AND RHINODERMATI-DAE: ‘‘Cycloramphinae’’ (sensu Laurent,1986) was also found to be polyphyletic(figs. 57, 59) in three distantly related

groups. Our molecular data overcome thefew morphological characters that might beconsidered synapomorphies of the relevantgroup. The first of these groups, labeled Cy-cloramphinae-1, is composed of Scythro-phrys and Paratelmatobius and is imbeddedwithin Leptodactylidae (sensu stricto; as partof Leptodactylinae, as discussed earlier.) Thesecond unit, which is labelled Cycloramphi-nae-2, is Elosiinae (5 Hylodinae) of Lynch(1971); although it is relatively weakly cor-roborated by molecular evidence, it is unitedby morphological evidence suggested byLynch (1971, 1973). Cycloramphus (part ofCycloramphinae-2) is tightly linked to Rhi-noderma (Rhinodermatidae), one of thepoints of paraphyly of former Leptodactyli-dae. Cycloramphinae-2 forms a paraphyleticgroup with respect to Rhinodermatidae, Tel-matobiinae-2, Leptodactylinae-3, and Odon-tophrynini (Ceratophryinae-2). Because nomorphological characteristics that we areaware of would reject this larger grouping,we place these five units into a single family,for which the oldest available name is Cy-cloramphidae. Within this, we recognize twosubfamilies: Hylodinae (for Crossodactylus,Megaelosia, and Hylodes) and Cycloramphi-nae for the remainder of this nominal family-group taxon.

Our DNA sequence evidence places Tho-ropa (Cycloramphinae-3) as the sister taxonof the monophyletic Dendrobatidae (figs. 57,60). We were surprised by this result, be-cause none of the morphological charactersthat had been suggested to ally Hylodinaewith Dendrobatidae are present in Thoropa(T. Grant, personal obs.), and Thoropa mostrecently has been associated with Batrachyla(J.D. Lynch, 1978b). Nevertheless, our mo-lecular data support this arrangement, andThoropa has never been more than tentative-ly associated with the grypiscines (5 cyclor-amphines; Heyer, 1975). Furthermore, man-ual rearrangements of hylodines and Thoro-pa used as starting trees for further analysisinevitably led to less parsimonious solutionsor returned to this solution as optimal (as im-plied by the Bremer values). Our first incli-nation was to place Thoropa into Dendro-batidae, so as not to erect a monotypic fam-ily. However, Dendrobatidae, as traditionallyconceived, is monophyletic and has a large


Fig. 60. Part 5 of anurans from the general tree (fig. 50 [insert]): Thoropidae, Dendrobatidae, andBufonidae.


literature associated with it that addresses acertain content and diagnosis that remainedlargely unchanged for nearly 80 years. Forthis reason, we place Thoropa into a mono-typic family, Thoropidae, to preserve thecore diagnostic features of Dendrobatidae forthe large number of workers that are familiarwith the taxon.

CENTROLENIDAE AND ALLOPHRYNIDAE: Assuggested by Noble (1931), Austin et al.(2002), and Faivovich et al. (2005), Allo-phryne is closely related to Centrolenidae, to-gether forming a monophyletic group that isthe sister taxon of a group composed of mostof the former Leptodactylinae (fig. 59;branch 426). Our data reject a close relation-ship of Centrolenidae to Hylidae, as well asthe suggestion by Haas (2003), made on thebasis of larval morphology, that Centroleni-dae may not be a member of Neobatrachia.Allophryne shares with the centrolenids T-shaped terminal phalanges (J.D. Lynch andFreeman, 1966), which is synapomorphic atthis level. We regard Allophryne as a part ofCentrolenidae, the sister taxon of a taxoncomposed of Centrolene 1 Cochranella 1Hyalinobatrachium (which has as a morpho-logical synapomorphy intercalary phalangealelements).

BRACHYCEPHALIDAE: Our study found Bra-chycephalus to be imbedded within Eleuth-erodactyinae, indeed, within Eleutherodac-tylus (sensu lato; fig. 57, 58). Previous au-thors (e.g., Izecksohn, 1971; Giaretta and Sa-waya, 1998) suggested that Brachycephalusis allied with Euparkerella (Eleutherodacty-linae) on the basis of sharing the character ofdigital reduction. We did not sample Eupar-kerella, which could be imbedded within aparaphyletic Eleutherodactylus. This propo-sition remains to be tested. As noted earlier,Brachycephalidae and Eleutherodactylinaeare synonyms, with Brachycephalidae beingthe older name.

RHINODERMATIDAE: We found Rhinodermato be imbedded within a clade composedlargely of South American cycloramphineleptodactylids (figs. 57, 59), more specifical-ly as the sister taxon of Cycloramphus. Be-cause the only reason to recognize Rhinod-ermatidae has been its autapomorphic lifehistory strategy of brooding larvae in the vo-

cal sac, we place Rhinodermatidae into thesynonymy of Cycloramphidae.

DENDROBATIDAE: We found Dendrobatidaeto be monophyletic and the sister taxon ofThoropa. The former statement is conven-tional, the latter, surprising. Nevertheless, thehighly corroborated nature of this placement(cladistically in the same neighborhood ashylodines, with which it was consideredclosely allied by some authors, e.g., Noble,1926, and Lynch, 1973) should close discus-sion of whether the firmisternal dendrobatidsare derived from some austral South Amer-ican arciferal group (here strongly supported;for dendrobatid girdle architecture see Noble,1926; Kaplan, 1995) or related to some ran-oid or ranid group, a conclusion suggestedby some lines of morphological evidence(Blommers-Schlosser, 1993; Ford, 1993;Grant et al., 1997). Thoropa 1 Dendrobati-dae form the sister taxon of Bufonidae. Thisphylogenetic arrangement is highly corrobo-rated and suggests that Ameerega Bauer,1986 (a senior synonym of EpipedobatesMyers, 1987; see Walls, 1994) is polyphy-letic, a result that is consistent with previousstudies (e.g., Santos et al., 2003; Vences etal., 2003b). Taxon sampling was limited inall studies to date, however, and we leave itto more exhaustive analyses to assess the de-tails of the relationships within Dendrobati-dae.

HYLIDAE: If hylids are considered to con-tain Hemiphractinae (see above), then Hyli-dae would be catastrophically paraphyleticwith respect to leptodactylids (excluding theformer calyptocephalellines [Batrachophryn-idae]), dendrobatids, bufonids, Allophryne,and centrolenids (figs. 57, 58, 59). This ar-rangement suggests that the claw-shaped ter-minal phalanges and intercalary cartilagestaken previously to be synapomorphies ofHylidae (sensu lato) are homoplastic and notsynapomorphic for Hylidae. Because Hylidae(sensu lato) is broadly para- or polyphyletic,we adopt the concept of Hylidae adopted byFaivovich et al. (2005), that is Hylinae 1Phyllomedusinae 1 Pelodryadinae.

Hylidae (sensu stricto, excluding ‘‘Hemi-phractinae’’) is monophyletic and highly cor-roborated. Our results are largely congruentwith the results of Faivovich et al. (2005),which were based on more sequence evi-


dence and denser sampling of hylids. Fai-vovich et al. (2005) should be referenced forthe evidentiary aspects of hylid phylogenet-ics. The only significant difference betweenour results and theirs is that our exemplarsof Hyla form a paraphyletic group with re-spect to Isthmohyla and Charadrahyla, andHypsiboas is paraphyletic with respect toAplastodiscus, and the tribe Dendropsophiniis not monophyletic as delimited by Faivov-ich et al. (2005). However, because our den-sity of sampling and evidence is less than inthat study, our results do not constitute a testof those results, and we leave their taxonomyunchanged.

Hylinae has long been suspected of beingparaphyletic, but our results and those of Fai-vovich et al. (2005) strongly corroborate thenotion that Hylinae is monophyletic and thesister taxon of Pelodyradinae 1 Phyllome-dusinae, both of which are also strongly cor-roborated as monophyletic.

The apparent polyphyly of Nyctimystes inour results may be real, although our paucityof sampling prevents us from delimiting theproblem precisely. Similarly, the long-rec-ognized (Tyler and Davies, 1978; King et al.,1979; Tyler, 1979; Maxson et al., 1985;Hutchinson and Maxson, 1987; Haas, 2003;Faivovich et al., 2005), pervasive paraphylyof Litoria in Pelodryadinae with respect toboth Cyclorana and Nyctimystes has obvi-ously been a major problem in understandingrelationships among pelodryadines. Ongoingresearch by S. Donnellan and collaboratorsaims to rectify these issues in the near future.

BUFONIDAE: That Bufonidae is a highlycorroborated monophyletic group is not sur-prising; that we have a reasonably well-cor-roborated phylogenetic structure within Bu-fonidae is a surprise (figs. 50 [insert], 60).Like Graybeal (1997; fig. 25), we found Me-lanophryniscus (which lacks Bidder’s or-gans) to form the sister taxon of the remain-ing bufonids (which, excluding Truebella,have Bidder’s organs). Within this clade, Ate-lopus 1 Osornophryne forms the sister taxonof the remaining taxa.

The paraphyly of Bufo with respect to somany other bufonid genera had previouslybeen detected (e.g., Graybeal, 1997; Cun-ningham and Cherry, 2004), but some asso-ciations are unconventional. The relationship

of Bufo margaritifer with Rhamphophryneconforms with their morphological similari-ty, but the nesting of this clade within agroup of Asian Bufo was unexpected. Theassociation of Bufo lemur (a species of for-mer Peltophryne in the Antilles) with Schis-maderma (Africa) is novel, as is the place-ment of this group with Bufo viridis and Bufomelanostictus, although Graybeal (1997), atleast in her parsimony analysis of moleculardata, suggested that Peltophryne was asso-ciated with Bufo melanostictus, an Asian tax-on.

Obviously, denser sampling will be re-quired to resolve bufonid relationships, butthe current topology provides an explicit hy-pothesis for further investigation. Clearly,Bufo must be partitioned into several generato remedy its polyphyly/paraphyly with re-spect to several other nominal genera and toprovide a reasonable starting place fromwhich to make progress. For more discussionand the beginnings of this partition, see Bu-fonidae in the Taxonomy section.

RANOIDEA: Monophyly of Ranoidea (in thesense of excluding Dendrobatidae) wasstrongly corroborated in our analysis, as wellas by other recent analyses (Roelants andBossuyt, 2005; San Mauro et al., 2005). Ran-oidea in our analysis is divided into two ma-jor groups (see figs. 50 [insert], 56, 61, 62,63, 65), which correspond to (1) a groupcomposed of a para- or polyphyletic Micro-hylidae, Hemisotidae, Hyperoliidae, para-phyletic Astylosternidae, and Arthroleptidae(figs. 61, 62); and (2) a giant paraphyletic‘‘Ranidae’’ and its derivative satellites, Man-tellidae and Rhacophoridae (fig. 63, 65). Thisis summarized on the general tree (fig. 50[insert]).

MICROHYLIDAE AND HEMISOTIDAE: Our re-sults (figs. 50, 61, 62) do not support the tra-ditional view of subfamilies and relationshipssuggested by Parker (1934) in the last revi-sion of the family. The notion of polyphy-letic Microhylidae falling into two monophy-letic groups—(1) Brevicipitinae (as the sistertaxon of Hemisotidae); and (2) the remainingmicrohylids—extends from the suggestionby Blommers-Schlosser (1993) that Hemi-sotidae and Brevicipitinae are closely related.Because the Type II tadpole that was consid-ered a synapomorphy in microhylids (Star-


Fig. 61. Part 6 of anurans from the general tree (fig. 50 [insert]): Microhylidae.

rett, 1973) is not present in brevicipitines(which have direct development) and hemi-sotids have a Type IV tadpole, there was nev-er any particular evidence tying brevicipiti-nes to the remaining microhylids. Moreover,only a single synapomorphy tied brevicipi-tines to hemisotines (Channing, 1995), so theevidence for paraphyly/polyphyly of micro-hylids also was not strong. As suggested byVan der Meijden et al. (2004; and consistentwith the results of Biju and Bossuyt, 2003,and Loader et al., 2004, but contrary to theScoptanura hypothesis of Ford and Canna-tella, 1993), we find Brevicipitinae and Hem-isotidae to form a monophyletic group, andthis taxon to be more closely related to Ar-throleptidae, Astylosternidae, and Hyperoli-idae than to remaining Microhylidae. For thisreason we regard brevicipitines as a distinct

family, Brevicipitidae. (We find Dubois’,2005, proposal that Arthroleptidae, Astylos-ternidae, Brevicipitidae, Hemisotidae, andHyperoliiidae be considered subfamilies ofan enlarged Brevicipitidae, to be an unnec-essary perturbation of familiar nomencla-ture.)

Within the larger group of ‘‘microhylids’’,Microhylinae is broadly paraphyletic with re-spect to the remaining subfamilies, withPhrynomantis (Phrynomerinae) being situat-ed near the base of our sampled microhy-lines, Hoplophryne (Melanobatrachinae)placed weakly next to Ramanella (Microhy-linae), and Cophylinae (based on our exem-plars of Anodonthyla, Platypelis, Plethodon-tohyla, and Stumpffia) being found to bemonophyletic and placed as the sister taxonof Ramanella (Microhylinae) 1 Hoplophry-


Fig. 62. Part 7 of anurans from the general tree (fig. 50 [insert]): Hemisotidae, Hyperoliidae, andArthroleptidae.

ne (Melanobatrachinae). Surprisingly, Sca-phiophryne (Scaphiophryninae) is deeply im-bedded among the microhylids and the sistertaxon of part of ‘‘Microhylinae’’ (branch130, subtending Kaloula, Chaperina, Cal-luella, and Microhyla). Ford and Cannatella(1993) and Haas (2003) had considered Sca-phiophryne to form the sister taxon of theremaining microhylids on the basis of larvalfeatures, but because we included Haas’(2003) morphological data in our analysis,we can see that these features must be ho-moplastic.

Microhylinae is nonmonophyletic, with(1) some taxa clustered around the base ofthe Microhylidae and weakly placed (e.g.,Kalophrynus, Synapturanus, Micryletta); (2)a group of Asian taxa (e.g., Kaloula–Micro-hyla) forming the sister taxon of Scaphio-phryne; and (3) a New World clade (i.e., thegroup composed of Ctenophryne, Nelsono-phryne, Dasypops, Hamptophryne, Elachis-tocleis, Dermatonotus, and Gastrophryne)placed as the sister taxon of Cophylinae 1Melanobatrachinae 1 Ramanella.

Our picture of ‘‘Microhylinae’’ runs coun-


ter to the little phylogenetic work that hasbeen done so far, especially with respect tothe cladogram of New World taxa by Wild(1995). Wild’s (1995; fig. 34) cladogram as-sumed New World monophyly, was rooted ona composite outgroup, and is strongly incon-gruent with our topology. Our solution is to(1) recognize Gastrophryninae for the NewWorld taxa that do form a demonstrablymonophyletic group (including Ctenophryne,Nelsonophryne, Dasypops, Hamptophryne,Elachistocleis, Dermatonotus and Gastro-phryne); and (2) restrict Microhylinae to amonophyletic group including Calluella,Chaperina, Kaloula, and Microhyla. The gen-era that we have not assigned to either Gas-trophryninae or Microhylinae (sensu stricto),or that are clearly outside of either group (e.g.,Synapturanus or Kalophrynus), we treat as in-certae sedis within Microhylidae. The ar-rangement asserted without evidence by Du-bois (2005), of an Old World Microhylini andNew World Gastrophrynini, within his Micro-hylinae, is specifically rejected by the basalposition in our tree of Kalophrynus and Syn-apturanus, far from our Microhylinae andGastrophryninae.

As suggested by Savage (1973), Dysco-phinae is polyphyletic, with Calluella deeplyimbedded within Asian microhylines andDyscophus placed as the sister taxon of agroup composed of members of Asterophryi-nae (Cophixalus, Choerophryne, Genyophry-ne, Sphenophryne, Copiula, Liophryne,Aphantophryne, Oreophryne) and Astero-phryinae (Callulops). Genyophryninae isclearly paraphyletic with respect to Astero-phryinae, as suggested by Savage (1973) andSumida et al. (2000a). For this reason we re-gard Asterophryinae and Genyophryninae assynonyms, with Asterophryinae being theolder name for this taxon. This allows theoptimization of direct development as a syn-apomorphy for the combined taxon.

ARTHROLEPTIDAE, ASTYLOSTERNIDAE AND

HYPEROLIIDAE: We found an African groupcomposed of Hyperoliidae, Astylosternidae,and Arthroleptidae to constitute a highly cor-roborated clade, the sister taxon of Hemiso-tidae 1 Brevicipitidae (fig. 62). This exis-tence of this group was suggested previouslybut has not been substantiated by synapo-morphies (Laurent, 1951; Dubois, 1981;

Laurent, 1984b; Dubois, 1987 ‘‘1985’’,1992). Within this group we found Hypero-liidae (excluding Leptopelis) to form amonophyletic group.

Phylogenetic structure within Hyperoliidaehas been contentious, with various arrange-ments suggested by different authors. Our re-sults differ significantly from all previouslypublished hyperoliid trees (Drewes, 1984;Channing, 1989; Vences et al., 2003c). LikeVences et al. (2003c), we found Leptopelis(Hyperoliidae) to form a monophyletic groupthat is separate from the remainder of Hy-peroliidae and placed with a group composedof the Astylosternidae 1 Arthroleptidae. Theconsideration of Leptopelinae as a subfamilyof Hyperoliidae cannot be continued becauseit renders Hyperoliidae (sensu lato) paraphy-letic. We restrict the name Hyperoliidae tothe former Hyperoliinae, which in additionto our molecular data, is supported by thesynapomorphic presence of a gular gland(Drewes, 1984).

We found Astylosternidae to be paraphy-letic with respect to Arthroleptidae, with Sco-tobleps (Astylosternidae) being the sister tax-on of Arthroleptidae (fig. 62). No previoushypotheses of relationship within Astyloster-nidae or Arthroleptidae have been rigorouslyproposed (Vences et al., 2003c), so our re-sults are the first to appeal to synapomorphy.Our finding that Schoutendenella is paraphy-letic with respect to Arthroleptis is particu-larly noteworthy because recognition ofSchoutedenella as distinct from Arthroleptishas been contentious (e.g., Laurent, 1954;Loveridge, 1957; Schmidt and Inger, 1959;Laurent, 1961; Poynton, 1964b; Laurent,1973; Poynton, 1976; Poynton and Broadley,1985; Poynton, 2003). Laurent and Fabrezi(1986 ‘‘1985’’) suggested that Schoutedenel-la is more closely related to Cardioglossathan to Arthroleptis, an hypothesis rejectedhere.

RANIDAE, MANTELLIDAE, AND RHACOPHOR-IDAE: Our results for this group are similar insome respects to those presented by Van derMeijden et al. (2005; fig. 36). Differences inresults may be due to our denser taxon sam-pling, to their greater number of analyticalassumptions, their inclusion of RAG-1 andRAG-2, which we did not include, or theirlack of 28S, seven in absentia, histone H3,


tyrosinase, and morphology, which we didinclude. Final resolution will require analysisof all of the data under a common assump-tion set.

We found a taxon composed of a broadlyparaphyletic ‘‘Ranidae’’, and monophyleticMantellidae 1 Rhacophoridae to form thesister taxon of Microhylidae 1 Hemisotidae1 Hyperoliidae 1 Arthroleptidae 1 Astylos-ternidae (fig. 50 [insert], 61, 63). The resultsare complex but are comparable to a groupof smaller studies that dealt overwhelminglywith Asian taxa (Tanaka-Ueno et al., 1998a,1998b; Bossuyt and Milinkovitch, 2000; Em-erson et al., 2000a; Marmayou et al., 2000;Bossuyt and Milinkovitch, 2001; Kosuch etal., 2001; Grosjean et al., 2004; Roelants etal., 2004; Jiang and Zhou, 2005). This over-all result varies widely from Bossuyt andMilinkovitch (2001), who found Mantellinae1 Rhacophorinae as the sister taxon of Nyc-tibatrachinae 1 Raninae; this clade sister toDicroglossinae 1 Micrixalinae, and Ranix-alinae sister to them all.

We find Ptychadeninae (Ptychadena beingour exemplar genus) to be the sister taxon ofthe remaining ‘‘Ranidae’’, a highly corrobo-rated result (fig. 63). The sister taxon of Pty-chadeninae is composed of Ceratobatrachi-nae (Ingerana, Discodeles, Ceratobatrachus,Batrachylodes, and Platymantis) and the re-maining ‘‘ranids’’. Here we differ signifi-cantly from Roelants et al. (2004), inasmuchas they considered Ingerana to be an occi-dozygine, whereas we find Ingerana to be inCeratobatrachinae, where it had originallybeen placed by Dubois (1987 ‘‘1985’’).

We find a major African clade (fig. 63;branch 192), similar to the results of Van derMeijden et al. (2005). One clade (branch193) is Phrynobatrachinae of Dubois (2005),composed of a paraphyletic Phrynobatra-chus, within which Phrynodon and Dimor-phognathus are imbedded. A second com-ponent (branch 200) is composed of Con-rauinae (Conraua), Ranixalinae (Indirana),Petropedetinae, and Pyxicephalinae sensuDubois (2005). Petropedetinae of Dubois(2005) (Petropedetes 1 Arthroleptides, sub-tended by branch 205), forms the sister taxonof Indirana (Ranixalinae of Dubois, 2005).Pyxicephalus 1 Aubria (branch 210) formthe sister taxon of the Pyxicephalinae of Du-

bois (2005), the ‘‘southern African clade’’ ofVan der Meijden et al. (2005): Tomopterna,Arthroleptella, Natalobatrachus, Afrana,Amietia, Strongylopus, Cacosternum, andAnhydrophryne. We place (1) Phrynobatra-chus (and its satellites Phrynodon and Di-morphognathus) in Phrynobatrachidae; (2)Arthroleptides, Conraua, Indirana, and Pe-tropedetes in Petropedetidae; (3) Afrana,Amietia, Anhydrophryne, Arthroleptella, Au-bria, Cacosternum, Natalobatrachus, Pyxi-cephalus, Strongylopus, and Tomopterna inPyxicephalidae, as had Dubois (2005). (Seefig. 63 and further discussion of these groupsin the Taxonomy section.)

Roelants et al. (2004), who did not includeany African taxa in their study, proposed In-dirana to be the sister taxon of Micrixalinae,although their evidence did not provide res-olution beyond a polytomy with (1) the Lan-kanectes–Nyctibatrachus clade; and (2) theranine-rhacophorine-mantelline clade. How-ever, we found Indirana to be deeply imbed-ded in an African clade otherwise composedof Conraua, Arthroleptides, and Petropede-tes (a clade we consider a family, Petrope-detidae). Dissimilarly, Van der Meijden et al.(2005) found, albeit weakly, Indirana as thesister taxon of Dicroglossinae. Nevertheless,our result is highly corroborated, although itis based on less overall evidence than that ofVan der Meijden et al. (2005), although asnoted previously, analyzed differently. Oursequence evidence for Indirana is the same12S and 16S GenBank sequences produced/used by Roelants et al. (2004), so contami-nation or misidentification is not an issue.

Like Roelants et al. (2004), we find occi-dozygines to form the sister taxon of Dicrog-lossinae, with the latter containing Paini (ourexemplares being members of Nanorana andQuasipaa), which had been transferred fromRaninae into Dicroglossinae by Roelants etal. (2004). Unlike their data, ours place Na-norana not within Paa, but as the sister tax-on of a clade composed of Fejervarya (whichwe show to be paraphyletic), Sphaerotheca,Nannophrys, Euphlyctis, and Hoplobatra-chus.

Our results are broadly consistent withseveral other studies showing that Hoploba-trachus (Limnonectini) is the sister taxon ofEuphlyctis (Dicroglossini) (Bossuyt and Mil-


Fig. 63. Part 8 of anurans from the general tree (fig. 50 [insert]): Ptychadenidae, Ceratobatrachidae,Micrixalidae, Phrynobatrachidae, Petropedetidae, Pyxicephalidae, and Dicroglossidae.


inkovitch, 2001; Kosuch et al., 2001; Gros-jean et al., 2004; Roelants et al., 2004). Lim-nonectini (sensu Dubois, 1992) is thereforerejected as nonmonophyletic. Limnonectes(including Taylorana Dubois, 1987 ‘‘1986’’,as a synonym; a result congruent with Em-erson et al., 2000a) forms the sister taxon ofa clade formed by Paini (Quasipaa), Nanor-ana, Nannophrys, and the remaining mem-bers of ‘‘Limnonectini’’ (Fejervarya,Sphaerotheca, and Hoplobatrachus) and Di-croglossini (Euphlyctis), a result congruentwith Grosjean et al. (2004). Marmayou et al.(2000) found Fejervarya 1 Sphaerotheca toform the sister taxon of a monophyletic Lim-nonectes 1 Hoplobatrachus, but they did notinclude Euphlyctis in their study. Roelants etal. (2004; fig. 35), and Jiang et al. (2005; fig.42), and Jiang and Zhou (2005; fig. 41)found Paini to be imbedded within this group(Dicroglossinae), and our results confirmtheir result. This suggests that a characterthat has been treated as of particular impor-tance to ranoid systematics, forked or entireomosternum, is considerably more variablethan previously supposed (see Boulenger,1920: 4), regardless of the weight placed onthis character by some taxonomists (e.g., Du-bois, 1992).

Our topology is not consistent with that ofRoelants et al. (2004), Jiang et al. (2005),and Van der Meijden et al. (2005) in that wedo not recover a monophyletic Paini, insteadfinding our exemplars (2 species of Quasipaaand 1 of Nanorana) to form a pectinate seriesleading to ‘‘Fejervarya’’ 1 Hoplobatrachus(Euphlyctis and Nannophrys were pruned forthis discussion because they were not part ofthe study of Jiang et al., 2005; fig. 42). Al-though our topological differences from theresults of Roelants et al. (2004) apparentlyreflect differences in evidence and sampling,we have more of both. The difference be-tween our results and those of Jiang et al.(2005) seemingly do not reflect differencesat the level of descriptive efficiency at thelevel of unrooted network. We do have a bitmore resolution between their groups 1 and2 as a paraphyletic grade, rather than as apolytomy. By treating Hoplobatrachus andFejervarya as their outgroups on which toroot a tree of Limnonectes 1 Paini, the studyby Jiang et al. (2005) inadvertantly forced

Paini to appear monophyletic. Examinationof the trees and associated unrooted networks(fig. 64) support this view. That Euphlyctis,Hoplobatrachus, and Nannophrys lackspines on the forearms and belly as in Painiis incongruent evidence. Nevertheless, itdoes strengthen our view that Group 1 ofJiang et al. (2005) deserves generic recog-nition, and that Paini, as nonmonophyletic,must be placed into the synonymy of Di-croglossinae. (See the account of Dicroglos-sinae in the Taxonomy section.)

A trenchant difference between our resultsand those of Roelants et al. (2004; but thesame as found by Van der Meijden et al.,2005) is in the placement of Lankanectes 1Nyctibatrachus. Roelants et al. (2004) placedthis taxon outside of most of ‘‘Ranidae’’ (ex-cepting Micrixalinae and Indiraninae, whichwe also found to be placed elsewhere). Wefind Lankanectes 1 Nyctibatrachus to be thesister taxon of Raninae, excluding Amietia,Afrana, and Strongylopus (and Batrachylo-des, transferred to Ceratobatrachidae, as dis-cussed earlier).

Dubois’ (1992) Amolops (containing thesubgenera Amo [which we did not study],Amolops, Huia, and Meristogenys) is dem-onstrated to be polyphyletic (a result congru-ent with Roelants et al., 2004; who did notstudy Huia; fig. 65). At least with respect toour exemplars, the character of a ventralsucker on the larva is suggested by our re-sults to be convergent in Amolops (in thesense of including Amo), Huia, and Meris-togenys (as well as in Pseudoamolops).

As expected, the genus Rana (sensu Du-bois, 1992) is shown to be wildly nonmon-ophyletic, with Dubois’ sections Strongylo-pus (Afrana and Strongylopus) and Amietia(Amietia) being far from other ‘‘Rana’’ inour results. (This result is consistent with thatof Van der Meijden et al., 2005, and was an-ticipated by Dubois, 2005.) In this position,Section Strongylopus is paraphyletic with re-spect to Cacosternum 1 Anhydrophyne (fig.63). As noted earlier, we transfer SectionsStrongylopus and Amietia out of Ranidae andinto a newly recognized family, Pyxicephal-idae, as was done by Dubois (2005). (See theTaxonomy section for further discussion.)

As noted in the Review of Current Tax-onomy, understanding the phylogeny of Hy-


Fig. 64. A, Original tree of Jiang et al. (2005; from fig. 42) of Paini and (on right) its equivalentundirected network; B, Tree rerooted and with augmented resolution as implied by our general results,and, at right, its equivalent undirected network. We have applied the name Nanorana to Group 1 ofJiang et al. (2005); Quasipaa was applied by Jiang et al. (2005) for their Group 2.


Fig. 65. Part 9 of anurans from the general tree (fig. 50 [insert]): Mantellidae, Rhacophoridae,Nyctibatrachidae, Ranidae.


larana-like frogs (Dubois’ sections Babinaand Hylarana) is critical to understanding ra-nid systematics. Our results show that Bou-lenger (1920) was correct that ‘‘Hylarana’’(sensu lato) is polyphyletic, or at least wildlyparaphyletic. The plesiomorphic condition inRanidae is to have expanded toe digits, as inRhacophoridae 1 Mantellidae and fartheroutgroups, so this discovery merely illumi-nates that ‘‘Hylarana’’ was constructed onthe basis of plesiomorphy. Dubois’ (1992)Section Hylarana is paraphyletic with re-spect to Amolops, Meristogenys, and Huia,as well as most of sections Babina, Amerana,Rana, Pelophylax, and Lithobates. Further,the Hylarana subsection Hydrophylax (hishumeral-gland group) is polyphyletic (ashinted at by the results of Matsui et al., 2005;fig. 46), in our results placing this group intwo places: (1) Sylvirana guentheri forms thesister taxon of subgenus Hylarana (in thenon-humeral-gland group) and (2) in a groupcontaining Hydrophylax galamensis and Pa-purana daemeli. Our findings are largelycongruent with the results of Roelants et al.(2004), who suggested ‘‘S.’’ guentheri as sis-ter to H. erythraea, but who also suggestedthat this ‘‘erythraea clade’’ is sister to a cladecontaining Sylvirana nigrovittata. Marmayouet al. (2000; fig. 37) found strong support forH. erythraea and H. taipehensis as sisters,and weak support for ‘‘S.’’ guentheri to bepart of that clade. They did show, weakly butconsistently, that Sylvirana is polyphyleticwith respect to Hylarana (Marmayou et al.,2000). Kosuch et al. (2001) found Amniranato be the sister taxon of Hydrophylax gala-mensis 1 Sylvirana gracilis. Differences indata size and taxon sampling may accountfor differences in tree topology among thesestudies, but the substantial results are similar.Roelants et al. (2004) included exemplars ofsubgenus Hydrophylax sensu Dubois andsubgenus Hylarana sensu Dubois, but notAmnirana as in our study. Kosuch et al.(2001) included exemplars of Hydrophylaxand Amnirana, but not Hylarana, as wasdone for our study; but Roelants et al.(2004), Kosuch et al. (2001), and Marmayouet al. (2000) did not include species of Pa-purana or Tylerana.

The subsection Hylarana (the non-humer-al-gland group) is polyphyletic as well. (This

is not surprising, as subsection Hylarananever did have any suggested synapomor-phies; again, this is consistent with the resultsof Matsui et al., 2005.) The component sub-genus Hylarana is most closely related toSylvirana guentheri (subsection Hydrophy-lax); subgenus Chalcorana (subsection Hy-larana) is most closely related to Hydrophy-lax 1 Amnirana (subsection Hydrophylax);Tylerana (subsection Hylarana) is mostclosely related to Papurana (subsection Hy-drophylax); and Clinotarsus (subsection Hy-larana) forms the sister taxon of Meristogen-ys (subgenus of Amolops sensu Dubois,1992). Glandirana (subsection Hylarana) isthe sister taxon of Pelophylax (section Pe-lophylax). Eburana (subsection Hylarana) isthe sister taxon of Huia (subgenus of Amo-lops sensu Dubois), and our exemplar ofOdorrana (subsection Hylarana) is the sistertaxon of ‘‘Amolops’’ chapaensis, a resultsimilar to those of Jiang and Zhou (2005; fig.41), who found Eburana nested within Odor-rana (see the Taxonomy section for furtherdiscussion).

As suggested by Hillis and Davis (1986)and confirmed by Hillis and Wilcox (2005),Dubois’ (1992) Section Pelophylax is poly-phyletic, with one part, Pelophylax (sensustricto), being found most closely related toGlandirana (section Hylarana) and the partcomposed of Aquarana and Pantherana be-ing paraphyletic with respect to Dubois’ Sec-tion Lithobates, as well as one species in hisSection Rana (R. sylvatica). Our results donot conflict with Roelants et al. (2004), whofound Pelophylax (P. lessonae, P. nigroma-culata) to be the sister taxon of Amolops cf.ricketti (A. ricketti and P. lessonae not in-cluded in our study). Roelants et al. (2004)also found that the Amolops–Pelophylaxclade is sister to a ‘‘Sylvirana’’–Hylarana–Chalcorana–Hydrophylax–Pulchrana clade,which is largely consistent with our findings.(We did not study Pulchrana.) Jiang andZhou (2005) had results that were only partlycongruent with ours and with those of Roe-lants et al. (2004). Jiang and Zhou (2005; fig.41) found Pelophylax to form a monophy-letic group with Nidirana and Rana, and thisgroup formed the sister taxon of Amolops.The next more inclusive group was found toinclude the Rugosa–Glandirana clade.


Dubois’ (1992) Section Amerana is recov-ered as monophyletic and the sister taxon ofPseudorana 1 Rana 1 Pseudoamolops. Sec-tion Rana (our exemplars being Rana japon-ica, R. temporaria, and R. sylvatica) is re-covered as polyphyletic, with one component(Rana japonica and R. temporaria) beingparaphyletic with respect to Pseudoamolops,and another (R. sylvatica) forming the sistertaxon of Pantherana (section Pelophylax) 1Section Lithobates.

Excluding Dubois’ (1992) section Amer-ana, we find American Rana (i.e., Aquarana,Lithobates, Trypheropsis, Sierrana, Panth-erana, and Rana sylvatica) to form a mono-phyletic group, a conclusion reached previ-ously by Hillis and Wilcox (2005; fig. 44).Section Amerana (subgenera Aurorana plusAmerana [former Rana aurora and R. boyliigroups]) is most closely related to the Ranatemporaria group (including Pseudorana andPseudamolops), an arrangement that suggeststhe results of Case (1978) and Post and Uz-zell (1981). Further discussion and genericrealignments are provided in the Taxonomysection.

MANTELLIDAE AND RHACOPHORIDAE: Wefind Mantellidae and Rhacophoridae to bemonophyletic sister taxa deeply imbeddedwithin the traditional ‘‘Ranidae’’, togetherplaced as the sister taxon of Raninae 1 Nyc-tibatrachinae (fig. 65). The monophyly of thecombined Mantellidae and Rhacophoridae isnot controversial and was suggested by anumber of authors on the basis of DNA se-quence data (e.g., Emerson et al., 2000b;Richards et al., 2000; J.A. Wilkinson et al.,2002; Roelants et al., 2004; Roelants andBossuyt, 2005; Van der Meijden et al., 2005)as well as the morphological data of Liem(1970).

For mantellids, the phylogenetic structurewe obtained is identical to that obtained byVences et al. (2003d): Boophis ((Aglyptodac-tylus 1 Laliostoma) 1 (Mantidactylus 1Mantella)), but different from that of Van derMeijden (2005) ((Aglyptodactylus 1 Lalio-stoma) 1 (Boophis 1 (Mantella 1 Manti-dactylus)). Although Vences et al. (2003d)demonstrated that Mantidactylus is deeplyparaphyletic with respect to Mantella, ourlimited taxon sampling did not allow us totest that result rigorously.

The basal dichotomy of Rhacophoridae isas suggested by Channing (1989), with Buer-geria forming the sister taxon of the remain-ing rhacophorids. But beyond that level,however, our results are quite different. Thisis not surprising, given the inherent conflictand lack of resolution in the morphologicaldata gathered so far, as discussed by J.A.Wilkinson and Drewes (2000). We will notdiscuss in detail the minor differences be-tween our results and those of J.A. Wilkinsonet al. (2002) because, although our taxonsampling was somewhat different, we includ-ed all of the same genes used in that study,as well as our own.

Our tree suggests polyphyly of Chirixalus,a conclusion to which others had previouslyarrived (e.g., J.A. Wilkinson et al., 2002): (1)one relatively basal clade (our Kurixalus eif-fingeri and ‘‘Chirixalus’’ idiootocus) notedpreviously by J.A. Wilkinson et al.’s (2002)study for which the name Kurixalus Ye, Fei,and Dubois (In Fei, 1999) is available; (2)the group associated with the name Chirix-alus (Chirixalus doriae and C. vittatus) form-ing a paraphyletic grade with respect to Chi-romantis (also illustrated by Delorme et al.,2005; fig. 49); and (3) our ‘‘Chirixalus’’ gra-cilipes, except for Buergeria, being the sistertaxon of all rhacophorids. We, unfortunately,did not sample ‘‘Chirixalus’’ palpebralis,which J.A. Wilkinson et al. (2002; fig. 48)found in a similar, basal, position, althoughas shown by the dendrogram published byDelorme et al. (2005; fig. 49), ‘‘Chirixalus’’palpebralis, which we did not study, willlikely be found to be quite distant fromAquixalus (Gracixalus) gracilipes, onceAquixalus is adequately sampled for molec-ular analysis.

A TAXONOMY OF LIVINGAMPHIBIANS

The taxonomy that we propose is consis-tent with the International Code of Zoologi-cal Nomenclature (ICZN, 1999). It will ap-pear to some that we have adopted an un-ranked taxonomy. This is partially true, butonly for above-family-group nomenclatureunregulated by the Code. Regardless ofwidespread perception, the Code does notgovern nomenclature above the family


group. In fact, it barely mentions the exis-tence of Linnaean nomenclature above therank of the family group, and it does notspecify particular ranks above that category.Our suggested taxonomy is predicated on therecognition that the community of taxono-mists has largely discarded its concerns re-garding ranks above the family-group level.For example, one no longer hears argumentsregarding whether Aves is a class, coordinatewith a Class Amphibia, or whether it is atmost a family within Archosauria. The rea-son for this withering of concerns aboutranks is that the concerns do not constitutean empirical issue. Notions of rank equiva-lency are always based on notions of levelsof divergence, age, content, or size that arebound to fail for a number of theoretical orempirical reasons24. But, because nominalfamilies and the ranks below them have beenregulated by a more or less universally ac-cepted rulebook for more than 160 years(Stoll, 1961), we are not inclined to easilythrow out that rulebook or the universal com-munication that it has fostered. Even thoughseveral of the criticisms of Linnaean nomen-clature are accurate, the alternatives so farsuggested have their own drawbacks. The In-ternational Code can be changed, and we ex-pect that changes will be made to meet theneeds of modern-day problems.

All taxonomies are rough and ready in thesense that, except for the most general levelof communication, they must be qualifiedimplicitly or explicitly with respect to vari-

24 A major underlying reason for this failure is thatthere are no natural classes in evolution that correspondto taxonomic ranks such as genus (contra Van Gelder,1977; Dubois, 1982, 1988b, 2005; see Fink, 1990), fam-ily, or phylum. A related logical error is the notion thatorganismal characteristics are transitive to their inclusiveclades, except in an operational sense that is dependenton simplifying analytical assumptions (Frost and Kluge,1994), rendering such mistaken ideas such that there are‘‘generic’’ or ‘‘family’’ characters (e.g., see recognitionof Taylorana by Dubois, 2005). Further, inasmuch as noobjective criteria can correspond to subjective and idi-osyncratic notions of organismal similarity and differ-ence (Ghiselin, 1966), the idea that ranks could be tiedto special characters or levels of organismal divergenceis seen to be particularly futile. Ranks in the Linnaeansystem are assigned to taxa as part of a formal nomen-clatural/mnemonic system, not through discovery ofLinnaean ranks.

ation in taxon content according to variousauthors, controversies regarding diagnosis,or, more subtly, the taxon sampling regime(Delorme et al., 2004) and underlying dataused to infer the existence of particular taxa.In other words, taxonomies are constructionsfor verbal and written communication thatare inherently limited because they representsets of theories of relationship and do notcommunicate information on underlying dataor assumptions of analysis. Precision in com-munication is enhanced by backgroundknowledge on the part of those using the sys-tem for communication or, even better, hav-ing the relevant tree(s) and data set(s) avail-able from which the taxonomy was derived.For an example of how taxonomies alwaysmust be qualified, Ford and Cannatella(1993) explicitly defined Hylidae as the mostrecent common ancestral species of Hemi-phractinae, Hylinae, Pseudinae, Pelodryadi-nae, and Phyllomedusinae and all of its de-scendants. This definition was implicitlychanged by Darst and Cannatella (2004) tobe the ancestor of Pelodryadinae, Phyllo-medusinae, and Hylinae, and all of its de-scendants, because Hemiphractinae was dis-covered to be paraphyletic and phylogeneti-cally distant from ‘‘other’’ hylids. A casualglance at our tree will show that an appli-cation of Ford and Cannatella’s (1993) cla-dographic definition of Hylidae would renderas hylids nearly all arciferal neobatrachians,with the exception of Batrachophrynidae,Heleophrynidae, Limnodynastidae, Myoba-trachidae, and Sooglossidae—a far cry fromany content familiar to any who have usedthese terms and certainly not promoting pre-cision in the discussion of synapomorphiesor even casual notions of similarity25. Fur-thermore, the molecular evidence that opti-mizes as synapomorphies for Hylidae (sensustricto) in the study of Darst and Cannatella(2004) must differ from those proposed byFaivovich et al. (2005) simply because the

25 Note that this kind of instability of nomenclatureand diagnosis is, in part, what Phylogenetic Nomencla-ture is supposed to address. Compare this with the ex-ample of Linnaean nomenclatural instability provided byde Queiroz and Gauthier (1992) to demonstrate that thiskind of instability is found in both systems but appar-ently is more typical of Phylogenetic Nomenclature.


ingroup and outgroup taxon sampling of thelatter is so much denser than that of the for-mer. As taxa are sampled more and moredensely, more and more nonhomology willbe detected, with concomitant improvementsin estimates of phylogeny (W.C. Wheeler,1992; Zwickl and Hillis, 2002). The contro-versy as it exists today, regardless of slogan-eering, is about how to portray in words hy-potheses of monophyly, and revolves notabout precision of communicating tree struc-ture or underlying data, but about how tomaintain consistency of communicationamong authors and across studies with a min-imum of qualification. All systems so farsuggested have limitations; like all maps theymust have limitations to be useful. Linnaeantaxonomy does promote useless rank contro-versies, but, as noted above and discussedmore fully below, rigid application of cla-dographic definitions of taxonomic names(such as the method proposed by de Queirozand Gauthier, 1992) brings other kinds of no-menclatural instability as well.

It is beyond the scope of this work to dis-cuss at length the theory and practice of tax-onomy and nomenclature. The ranked andrankless alternatives to expressing phyloge-netic relationships in words theoretically areendless but most recently and most clearlydiscussed by Kluge (2005). To oversimplifyhis paper, currently competing systems forexpressing phylogenetic relationships inwords are (1) Linnaean system (Linnaeus,1758); (2) Annotated Linnaean system (Wi-ley, 1981); (3) what Kluge termed ‘‘DescentClassification’’ and proponents call ‘‘Phylo-genetic Taxonomy’’ (de Queiroz and Gau-thier, 1992); (4) the ‘‘Set Theory Classifica-tion’’ system of Papavero et al. (2001), astermed by Kluge; and (5) Kluge’s (2005)‘‘Phylogenetic System’’.

We have taken a sixth approach, one thatwe think is based on common sense, espe-cially with respect to how systematists usetaxonomies and with respect to the state ofthe discussion, which is still very preliminaryand reflecting a deep ambivalence on the partof taxonomists (for all sides of the contro-versy see: Wiley, 1981; de Queiroz, 1988; deQueiroz and Gauthier, 1994; Cantino et al.,1997; Cantino et al., 1999; Benton, 2000;Nixon and Carpenter, 2000; Withgott, 2000;

Kress and DePriest, 2001; Niklas, 2001; Pa-pavero et al., 2001; Pennisi, 2001; Brummitt,2002; Carpenter, 2003; Keller et al., 2003;Kojima, 2003; Nixon et al., 2003; Schuh,2003; Kluge, 2005; Pickett, 2005). What wedo think is that the conversation will contin-ue for some time and that changes will takeplace, all discussed fully and not driven bythe overheated sloganeering that, unfortu-nately, characterizes so much of the rhetoricat this time—on all sides—inasmuch as thisis a political, not a scientific controversy (seePickett, 2005, for discussion). With respectto our approach to taxonomy, we, in effect,take the easy way out, we follow the Inter-national Code of Zoological Nomenclature(ICZN, 1999) for regulated taxa (familygroup and down) and apply an unranked tax-onomy for unregulated taxa (above familygroup), the hypotheses for these taxa beingderived from their included content and di-agnostic synapomorphies.

We expect that regulated nomenclaturewill increasingly be pushed toward the ter-minal taxa and that unregulated taxa will in-creasingly be rankless. The reason for this isthat there really is a practical limit to thenumber of ranks that workers are willing touse. Systematists seemingly are not enam-ored of new ranks such as grandorders, hy-perfamilies, epifamilies, and infratribes (e.g.,Lescure et al., 1986) or of the redundanciesand controversies over rank that are part andparcel of ranked nomenclature (e.g., see Du-bois, 2005). So, our observation is that so-ciological pressures will push workers to-wards ever smaller families, especially be-cause there is no scientific or sociologicalpressure to construct larger families. Regard-less, we think that this process will corre-spond with enormous progress in phyloge-netic understanding.

We suggest that the content of an above-family taxon as originally formed by an au-thor renders an implied hypothesis of de-scent, even if the concept of that taxon pre-dates any particular theory of descent withmodification. We spent considerable time de-termining the original intent of various tax-onomic names. Unfortunately, an examina-tion of the original content of the groups de-noted by these taxonomic names obviated theneed to use many of them because they de-


viated so widely from all but a few of ourphylogenetic hypotheses (e.g., Salientia inthe original sense of Laurenti, 1768, not onlyincludes all frogs, but shares Proteus with hisGradientia, a novel phylogenetic hypothe-sis!).

In some cases (e.g., Caudata), we set asidethe intent of the original author in favor ofwidespread current usage as suggested bysubsequent authors. The wisdom of this kindof action is open for discussion (see Dubois,2004b, 2005), but increasingly the Interna-tional Commission of Zoological Nomencla-ture appears to be moving toward usage rath-er than priority as an important criterion todecide issues, so we take this to be the ap-propriate strategy.

As noted above, we are unconvinced thatcladographic rules governing name assign-ment (sensu de Queiroz and Gauthier, 1992)necessarily engender enhanced stability orprecision of discussion (except in the specialcase of the crown-group approach to delim-itation). However, we do think that associ-ating names of extant taxa with content-spe-cific, ostensively derived concepts (cf. Pat-terson and Rosen, 1977) will go a long waytoward reducing the ‘‘wobble’’ of diagnosesassociated with extant taxa as membershipchanges. One need only look at the historyof the use of ‘‘Amphibia’’ to see how thelack of an overarching concept of the taxonhas resulted in considerable drift of contentand diagnosis. As noted by Laurin (1998a:10), until Huxley (1863), the term Amphibiaapplied only to Recent taxa. Haeckel (1866)and Cope (1880) rendered Amphibia para-phyletic by the addition of some fossil taxa,with other authors (e.g., Romer, 1933) con-tinuing the trend until all fossil tetrapods thatwere not ‘‘reptiles’’ were considered to bemembers of ‘‘Amphibia’’. Amphibia was re-turned to monophyly only by Gauthier et al.(1989) and subsequently restricted back tothe groups of original intent by de Queirozand Gauthier (1992).

Although the discussion is generating con-siderable self-examination by systematists,we think that cladographically assigned tax-onomic names (de Queiroz and Gauthier,1992) introduce a new kind of nomenclaturalinstability by tying names, not to content,

types, or diagnoses but to tree topology26.Avoiding this instability requires great cau-tion in the application of that naming con-vention. Nevertheless, in our judgment it isunlikely that a fourth ‘‘order’’ of living am-phibians will be discovered, so application ofthe cladographic rules suggested by de Quei-roz and Gauthier (1992) governing the ap-plication of the names Anura, Caudata, andGymnophiona could be salutary for purposesof discussing fossil relatives of these crowngroups.

Our strategy in designing a taxonomy forunregulated taxa is to preserve, as nearly aspractical, the originally implied phylogeneticcontent of named above-family-group taxa.We also attempted to apply older names forabove family-group taxa, but because of theconstant redefinition of many of these taxa,we could solve these only on an ad hoc basis,depending on use, original intent, and recen-cy of coining of the name(s).

In several cases, we changed the ranks ofsome regulated taxa from subfamilies to fam-ilies to provide flexibility and help workersin the future with the problems inherent inranked hierarchies. Because all names abovethe regulated family group are unaddressedby the International Code of Zoological No-menclature (ICZN, 1999) we have regardedall of these names as unranked, but withinthe zone normally associated with class andorder (whatever that might mean to the read-er). We have not been constrained by rec-ommendations regarding name formationsand endings for ranks above the level of fam-ily group simply because we believe thatthese are unworkable and that they merelyexacerbate the previously recognized prob-lems of taxonomic ranks (de Queiroz andGauthier, 1992).

Although we argue that taxonomy shouldreflect knowledge of phylogeny as closely aspossible, by eliminating all paraphyly and

26 If the application of a name for a taxon A (B 1 C)is governed by the cladographic rule ‘‘the ancestor of Aand B and all of its descendants’’, and if new data showthat the phylogenetic structure of this taxon has tochange to C (A 1 B), the cladographically assignedname has to apply to A 1 B and exclude C, even thoughthe content of the taxon A 1 B 1 C has not changed.Linnaean nomenclature would be unaffected by this to-pological change.


recognizing all clades, we focused our atten-tion primarily on the taxonomy of cladesabove the ‘‘genus level’’ for three reasons.First, for the most part our taxon samplingwas inadequate to test prior hypotheses ofintrageneric relationships for most genera.The practical implication of this inadequacyis that we lack evidence to refer the majorityof species in a more refined generic taxono-my, which would require those species to beplaced as incertae sedis, a cumbersome so-lution with little payoff. The other alterna-tive—expanding the content of genera to en-force monophyly is equally unsatisfactory inthese cases, as it overlooks the finer-levelknowledge of phylogeny that exists but, forpractical reasons was not brought to bear inthis analysis. Secondly, the bulk of phylo-genetic research since the mid-1970s has fo-cused primarily on ‘‘genus-level’’ diversity,which means that a considerable amount ofevidence, both molecular and morphological,has been generated for those groups, most ofwhich was not included in the present study.Third, we see the value of the present con-tribution to be in framing finer level prob-lems that are better addressed by regionalspecialists who can achieve more exhaustivetaxon and character sampling.

Our consensus tree is shown in figure 50(insert), which also displays the current andrecommended family-group taxonomy. Wemodify the current generic taxonomy in plac-es in this section, but those changes are notreflected in the figure for purposes of clarityin ‘‘Results’’. With minor exceptions, allclades are highly corroborated by molecularevidence (and morphological evidence onmany branches as well) as estimated by Bre-mer values and parsimony jackknife frequen-cies (see below and appendix 4 for these val-ues by branch). Because this study rests onthe largest amount of data applied to theproblem of the relationships among livingamphibians, we provide a new taxonomy thatwe think will provide a better reference foradditional progress.

This taxonomy of living amphibians isbased on a phylogenetic analysis of 532 ter-minals, on the basis of a total of 1.8 millionbp of nuDNA and mtDNA sequence data (x5 3.7 kb/terminal) in addition to the mor-phological data from predominantly larval

morphology presented by Hass (2003), theonly comparable data set across all frogs.Despite the fact that this is, so far, the mostdata-heavy analysis of amphibians, we ex-pect to be criticized for presenting this tax-onomy for four reasons:

(1) This taxonomy will be criticized bothas premature and as not conservative. How-ever, the underlying cladogram reflects thebest overall estimate of phylogeny on themost thorough dataset applied to the issue.The alternative—to stick for sociological rea-sons to an old taxonomy that is clearly mis-leading and based on relatively little evi-dence—certainly will not efficiently promoteadditional research. Some will attempt to de-fend as conservative the old arrangements,especially favored paraphyletic groups, butmostly this will mean socially conservative,not scientifically conservative, somethingdetrimental to scientific progress. As re-vealed in the ‘‘Review of the Current Tax-onomy’’, much of the existing taxonomy ofamphibians stands on remarkably little evi-dence and has simply been made plausiblethrough decades of repetition and reification.

A similar argument is that we should re-tain the status quo with respect to taxonomyuntil we are ‘‘more sure’’ of a number ofweakly recovered relationships. This positionignores how little evidence underlies the ex-isting classifications. Indeed, our taxonomyexplains more of the evolution of amphibiancharacteristics than the existing classifica-tion(s) and has the distinction of attemptingto be explicitly monophyletic over all of theevidence analyzed. We are surely mistakenin several places, but this is better than con-tinuing to recognize taxonomic groups thatare known to be inconsistent with evolution-ary history, regardless of social convention.We do go beyond our data in several places(e.g., Brachycephalidae, Bufonidae) and rec-ognize some groups whose monophyly wehave not rigorously tested. The reason forthis is to attempt to delimit new hypothesesand not sit idly by while major problems areconcealed by convention. Critics may chargethat this is no different from post facto ‘‘di-agnosis’’ of subjective similarity groupings(e.g., Dubois, 1987 ‘‘1985’’, 1992). Howev-er, in each case we think there is good reasonto expect our taxa to obtain as monophylet-


ic—and that leaving the taxonomy as it existsdoes nothing to promote improved under-standing of evolutionary history.

(2) Some will be critical of the fact thatwe have not included all of the morpholog-ical data that have been presented by otherauthors. Early in the development of thiswork, we made an attempt to marshal thedisparate but extensive number of characterspresented by such authors as J.D. Lynch(1973), Estes (1981), Duellman and Trueb(1986), Milner (1988), Nussbaum and Wil-kinson (1989), Trueb and Cloutier (1991),Ford and Cannatella (1993), Larson andDimmick (1993), Milner (1993 (1994),McGowan and Evans (1995), Shubin andJenkins (1995), M. Wilkinson and Nussbaum(1996), Laurin and Reisz (1997), Laurin(1998a), Maglia (1998), Carroll et al. (1999),M. Wilkinson and Nussbaum (1999), Carroll(2000a), Laurin et al. (2000), Milner (2000),J.S. Anderson (2001), Gardner (2001), Kap-lan (2001), Zardoya and Meyer (2001),Gardner (2002), Gower and Wilkinson(2002), Laurin (2002), Scheltinga et al.(2002), and Baez and Pugener (2003). Whatwe found, not surprisingly, is that differentstudies tended to generalize across differentexemplars, even if they were working on thesame groups, and that in some cases putativesynapomorphies had been so reified throughrepetition in the literature that it was difficult,if not impossible, to ascertain which taxa(much less which specimens) had actuallybeen evaluated for which characters. We alsofound that many of the new characters re-main in unpublished dissertations (e.g., Can-natella, 1985; Ford, 1990; S.-H. Wu, 1994;Graybeal, 1995; da Silva, 1998; Scott, 2002),where ethics dictates they not be mined forinformation if they are new, and prudencedictates that the information in them not betaken at face value if they are old and stillunpublished.

Further, most of the paleontological liter-ature reflects such incomplete sampling ofliving taxa as to oversimplify living diversi-ty. (One does not read evolution from therocks, but the rocks certainly are an under-sampled component of our study.) Reconcil-ing all morphological descriptions of char-acters in comparable form, obviously, is thenext big step, for someone else, and in com-

bined analysis this will constitute a test ofour results and taxonomy. This problem callsfor careful evaluation of all morphologicalcharacters across all taxonomic groups con-comitant with the evaluation of relevant fos-sil groups. This is a big task, but one worthdoing well. Unfortunately, this kind of in-frastructural science is not flashy and there-fore will not attract funding from alreadyoversubscribed and underfinanced grantingagencies. (See Maienschein, 1994, for an es-say on the dangers to science from the pre-occupation by administrators and fundingagencies with the ‘‘cutting edge’’.)

(3) Some will criticize our analyticalmethods. We have been conservative with re-spect to analytical assumptions. Beyond at-tempting to maximize explanatory efficiency,some workers prefer to incorporate assump-tions about the evolutionary process by theaddition of particular evolutionary models.This is obviously a discussion that we thinkwill continue for a long time because of theserious philosophical and evidentiary issuesinvolved.

Some will be uncomfortable that such alarge proportion of our data are molecular(even though most of our results are gener-ally conventional). We believe that it is betterto present a taxonomy that represents explic-it, evidence-based hypotheses of relation-ships than to retain a taxonomy solely be-cause we are used to it. Some will want toexclude all sequence data that require align-ment. Unfortunately, this assumes that same-length sequences lack evidence of havinghad length variation, an assumption not sup-ported by evidence (Grant, unpubl.). Otherswill want to ‘‘correct’’ alignments manually(although this is likely to increase the num-ber of transformations required to explain se-quence variation). Although such methodo-logical choices are crucial and should contin-ue to be debated (indeed, we urge authorsand editors of empirical papers to be moreexplicit about both their methods of align-ment and analysis and their reasons for em-ploying them), the issue at hand is that it istime to move away from a taxonomy knownto be fatally flawed and that promotes mis-understanding and into a scientific dialoguethat will promote a much improved under-


standing of the evolution of amphibian taxic,life history, and morphological diversity.

(4) We will be trivially criticized for for-mulating new taxonomic names with 19 au-thors. Times change and collaborations onthis scale are necessary to answer globalquestions. That a new name can have 19 au-thors may be cumbersome, but, authorship isnot part of the scientific name. And, regard-less of recommendations made in the Code(ICZN, 1999) this authorship reflects accu-rately the extensive effort in collecting sam-ples, sequencing, data analysis, and writingthat work on this scale requires.

Although our results will undoubtedly al-low considerable progress to be made, bynearly doubling the number of amphibianspecies for which DNA sequences are avail-able in GenBank, projects such as this onegenerate questions as well as answers. Ourresults therefore will provide a reasonablywell-tested departure point for future studiesby identifying outstanding problems that areespecially worthy of investigation.

TAXONOMIC ACCOUNTS

Below we present ancillary informationand discussion to accompany the taxonomypresented in figures 50 (insert) and 66 (a re-duced tree of family-group taxonomy). (Ta-ble 5 provides names of taxa/branches on theinterior of the tree shown in figure 66, andfigure 67 provides the taxonomy of amphib-ians in condensed form.) Most morphologi-cal evidence is addressed in accounts, butmolecular synapomorphies are providedwhere relevant in appendix 5, with branchnumbers corresponding with those noted inthe various figures. We are conservative inthe scientific sense in that we stick close tothe preponderance of evidence and not to tra-dition. Genera in bold listed under Contentrepresent those from which one or more spe-cies were included in our analysis (as DNAsequences either generated or by us or othersand available via GenBank). A justificationis provided for inclusion of taxa that werenot sampled. Synonymies provided in thefamily group and below conform to the In-ternational Code of Zoological Nomenclature(ICZN, 1999). We include citations only tooriginal uses and not to emendations, rank

changes, or incorrect subsequent spellings.More extensive discussion of specific no-menclatural issues are dealt with in appendix6. A summary of generic name changes ispresented in appendix 7. We do not addressfossil taxa, although they can be placed with-in this framework with relatively little effort.Dubois (2005) recently provided a taxonomyof living amphibians and their fossil relatives(Neobatrachii in his sense). Because his tax-onomy appeals to a taxonomic philosophydeeply steeped in the importance of ranksand personal authority and the unimportanceof evidence and logical consistency withevolutionary history, we comment on it onlywhere necessary.

For taxa above the family group, whichare not regulated by the Code, homonymyremains an unresolved issue in amphibiannomenclature because, even if the originalauthor intended one content (i.e., one hy-pothesis of relationship), subsequent authorssaw (and may see) little problem in redefin-ing these names to fit revised hypotheses ofrelationship. For these taxa we do not pro-vide a synonymy because in the absence ofany regulatory tradition of above-family-group nomenclature, we have tried to opti-mize on the hypothesis of relationship in-tended by the author (or redefiner) of thattaxon. Although we do not provide a ‘‘syn-onymy’’ in the accounts of unregulated taxa,we variably note in appendix 6 (‘‘Nomencla-ture’’) synonyms, near-synonyms, and prob-lematic nomenclatural issues.

The structure of the taxonomic accounts isstraight-forward with several categories ofinformation: (1) the name and author of thetaxon (and where appropriate and to enhancenavigation among records, bracketed num-bers are associated that correspond to thenumbered branches in our various figuresand tables in ‘‘Results’’); (2) a list of avail-able names if application of the name is reg-ulated by the International Code of Zoolog-ical Nomenclature; (3) an etymology if thename of a taxon is used for the first time; (4)the name and branch number of the imme-diately more inclusive taxon; (5) the nameand branch number of the sister taxon; (6) astatement of the geographic distribution ofthe taxon; (7) the concept of the taxon interms of content; and (8) a characterization


TABLE 5Branch Numbers and Taxon Names Corresponding to Internal Branches on Figure 50

Left side, sorted by branch number; right side, sorted by taxon name.

Branchnumber Taxon name

Branchnumber Taxon name

6789

23

AmphibiaGymnophionaRhinatrematidaeStegokrotaphiaBatrachia

91192143460244

AcosmanuraAfricanuraAfrobatrachiaAgastrorophryniaAglaioanura

2425293031

CaudataCryptobranchoideiDiadectosalamandroideiHydatinosalamandroideiPerennibranchia

109191

69274

AllodapanuraAmetrobatrachiaAmphibiaAnomocoelaAnura

3549507477

TreptobranchiaPlethosalamandroideiXenosalamandroideiAnuraLalagobatrachia

371319

2324

440

AthesphatanuraAustralobatrachiaBatrachiaCaudataChthonobatrachia

7884859192

XenoanuraSokolanuraCostataAcosmanuraAnomocoela

3668525

46129

CladophryniaCostataCryptobranchoideiDendrobatoideaDiadectosalamandroidei

9396

105107108

PelodytoideaPelobatoideaNeobatrachiaPhthanobatrachiaRanoides

4257

44830

314

DiphyabatrachiaGymnophionaHesticobatrachiaHydatinosalamandroideiHyloides

109143144148180183189

AllodapanuraAfrobatrachiaXenosyneunitanuraLaurentobatrachiaNatatanuraVictoranuraTelmatobatrachia

77148424349321180105

LalagobatrachiaLaurentobatrachiaLeptodactyliformesMeridianuraMyobatrachoideaNatatanuraNeobatrachia

191192200220244

AmetrobatrachiaAfricanuraPyxicephaloideaSaukrobatrachiaAglaioanura

348318

969331

NobleobatrachiaNotogaeanuraPelobatoideaPelodytoideaPerennibranchia

245269314318319

RhacophoroideaRanoideaHyloidesNotogaeanuraAustralobatrachia

10749

200269108

PhthanobatrachiaPlethosalamandroideiPyxicephaloideaRanoideaRanoides

321348349366368

MyobatrachoideaNobleobatrachiaMeridianuraCladophryniaTinctanura

2458

22084

9

RhacophoroideaRhinatrematidaeSaukrobatrachiaSokolanuraStegokrotaphia

371424425440448460461

AthesphatanuraLeptodactyliformesDiphyabatrachiaChthonobatrachiaHesticobatrachiaAgastorophryniaDendrobatoidea

189368

35183

7850

144

TelmatobatrachiaTinctanuraTreptobranchiaVictoranuraXenoanuraXenosalamandroideiXenosyneunitanura


Fig. 66. A simplied tree of our results (fig. 50) tree showing families. Numbers on branches allowbranch lengths, Bremer, and jackknife values, as well as molecular synapomorphies to be identified inappendices 4 and 5. See table 5 for taxon names associated with internal numbered branches and figure67 for a complete summary of taxonomy.


Fig. 67. Summary taxonomy of living amphibians. Quotation marks around names denote nonmon-ophyly.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


Fig. 67. Continued.


and diagnosis, which is merely a generalsummary of the salient features of the ani-mals that are included in the taxon under dis-cussion, and characters (either synapomorph-ic or not) that differentiate this taxon fromothers. Where a character is thought to be asynapomorphy, this is stated. If the explicitstatement is not made, then the charactershould be assumed to be of unknown polar-ity. Because we included Haas’ (2003) char-acters in the analysis, for each group we listall unambiguously optimized synapmorphiesfor that data set, reported using Haas’ origi-nal numbering scheme (e.g., Haas 34.1). Oth-erwise, we have not attempted to be exhaus-tive nor to make these differentia explicitlycomparable for the simple reason that thechallenge of sorting out the published recordregarding the morphological characteristicsof amphibians will be enormous and, clearly,is outside of the scope of this work27. Re-gardless, that next step is an important onein elucidating the morphological evolution ofamphibians. The characterization and diag-nosis is followed by (9) various systematiccomments and discussion. Considerable tax-onomic ‘‘sausage making’’ is evident in thesesections, particularly with respect to the larg-er and more chaotic genera, which we havenot been shy about partitioning because con-siderable redistribution of taxonomic namesneeds to happen if we are going to progresstowards a taxonomy that reflects evolution-ary history. In some places our changes havenot been successful in producing a taxonomythat is entirely monophyletic. Our rationalefor failing to propose a more precise taxon-omy was given earlier, and we are confidentthat future work will correct this shortcomingin our proposal. To that end, we emphasizeand discuss the specific problems and inad-equacies for each of these cases. Some work-ers will not appreciate the loose-ends that re-main untied and will prefer the old approachof concealing these questions. Our position,however, is that unless these problems areadvertised, the sociological response of the

27 For some clades, diagnosis by nongenetic charactersis not currently possible. To make molecular diagnosismore tangible and descriptively simple, we also reportsalient charateristics, such as length variation in 28S se-quences (appendix 3), as well as unambiguous moleculartransformations (appendix 5), where needed.

scientific community will be to let sleepingdogs lie.

In a few places in the taxonomy, we donot render taxonomic changes suggested byour tree. In the cases of ‘‘Eleutherodactylus’’and ‘‘Centrolene’’, our sampling density isso low compared to the species diversity thatour results could not be practically translatedinto an informative taxonomy. In two othercases, the reason is that we do not considerour results to constitute a sufficient test of apublished cladogram, based on a data set thatincludes as a subset the data over which wegeneralized. The first of these is in Hylinae,where our data represent a subset of the data(and concomitant results) of Faivovich et al.(2005), meaning that our analysis does notconstitute an adequate test of their results.The second is plethodontid salamanders,where the placement of certain taxa (i.e.,Hemidactylium and Batrachoseps) in our treeis based on a subset of data in a publishedtree (Macey, 2005), which came to differentconclusions regarding those critical taxa,based, at least with respect to those taxa, ona more inclusive data set (although the as-sumptions of analysis were subtly different).In these two cases we do not reject the con-clusions of these authors, pending even moreinclusive analyses.

[6] AMPHIBIA GRAY, 1825

Amphibia Gray, 1825: 213. (See appendix 6 forfurther nomenclatural discussion.)

RANGE: Worldwide on all continents ex-cept Antarctica and most oceanic islands, incold-temperate to tropical habitats.

CONCEPT AND CONTENT: Amphibia is amonophyletic taxon composed of [7] Gym-nophiona J. Muller, 1832, and [23] BatrachiaLatreille, 1800, constituting the crown group(i.e., living) amphibians (sensu AmphibiaGray, 1825; not Amphibia of Linnaeus,1758; cf. de Queiroz and Gauthier, 1992).

CHARACTERIZATION AND DIAGNOSIS: Be-yond our molecular data, Amphibia is diag-nosed by many morphological characters.Amphibians, like mammals, retain plesiom-orphically the glandular skin of ancestral tet-rapods. They do not have the apomorphy ofepidermal scales found in sauropsids (turtlesand diapsids).


Trueb and Cloutier (1991) and Ruta et al.(2003) provide extensive discussions of thesynapomorphies of Amphibia (as Lissamphi-bia) in the context of fossil groups. Syna-pomorphies of Amphibia include (Trueb andCloutier, 1991): (1) loss of the postparietalbones; (2) loss of the supratemporal bone; (3)loss of the tabular bone; (4) loss of the post-orbital bones; (5) loss of the jugal bone; (6)loss of the interclavicle; (7) loss of the cleith-rum; (8) papilla amphibiorum present in ear;(9) opercular element associated with thecolumella; (10) fat bodies present that orig-inate from the germinal ridge associated withthe gonads; and (11) pedicellate and bicuspidteeth that are replaced mediolaterally (re-versed in some taxa).

SYSTEMATIC COMMENTS: Amphibia is high-ly corroborated as a taxon, but this only im-plies that all living amphibians are moreclosely related to each other than to any otherliving species and does not address the place-ment of amphibian groups within the largerstructure of relevant fossil tetrapods. Allwork so far on the overall placement of am-phibians (lissamphibians) among fossilgroups has depended on inadequate samplingof living taxa and, with the exception of Gaoand Shubin (2001), has ignored availablemolecular data. We hope that additional workon fossil groups, combined with the data pre-sented here, and a better account of livingdiversity, will further elucidate those rela-tionships.

[7] GYMNOPHIONA J. MULLER, 1832

Gymnophiona J. Muller, 1832: 198. (See appendix6 for nomenclatural discussion.)

IMMEDIATELY MORE INCLUSIVE TAXON: [6]Amphibia Gray, 1825.

SISTER TAXON: [23] Batrachia Latreille,1800.

RANGE: Pantropical, except for Madagas-car and southeast of Wallace’s Line; not yetreported from central equatorial Africa.

CONCEPT AND CONTENT: Gymnophiona is amonophyletic taxon containing the livingcaecilians (cf. J. Muller, 1832; Cannatellaand Hillis, 1993): [8] Rhinatrematidae Nuss-baum, 1977, and [9] Stegokrotaphia Canna-tella and Hillis, 1993.

CHARACTERIZATION AND DIAGNOSIS: Caeci-

lians are a bizarre group of legless amphib-ians, primitively oviparous with aquatic lar-vae (Rhinatrematidae, Ichthyophiidae), al-though some species are ovoviparous (withor without direct development) and burrow-ing, as reflected by considerable numbers ofosteological modifications.

Beyond our molecular data, the followingmorphological characters have been suggest-ed to be synapomorphies (Nussbaum andWilkinson, 1989; Trueb and Cloutier, 1991):(1) lacking limbs and girdles (except for oneantecedent fossil taxon not included in thecrown group; Carroll, 2000b); (2) presenceof a dual jaw-closing mechanism; (3) pres-ence of an eversible phallodeum in malesformed by a portion of the cloacal wall; (4)annuli encircling the body; (5) paired sen-sory tentacles on the snout.

SYSTEMATIC COMMENTS: M. Wilkinson hasan extensive morphological matrix of morethan 180 character transformations (see alsoNussbaum and Wilkinson, 1995; M. Wilkin-son and Nussbaum, 1996, 1999), which willappear elsewhere, analyzed in conjunctionwith this and additional evidence.

[8] FAMILY: RHINATREMATIDAE NUSSBAUM,1977

Rhinatrematidae Nussbaum, 1977: 3. Type genus:Rhinatrema Dumeril and Bibron, 1841.

IMMEDIATELY MORE INCLUSIVE TAXON: [7]Gymnophiona J. Muller, 1832.

SISTER TAXON: [9] Stegokrotaphia Canna-tella and Hillis, 1993.

RANGE: Tropical northern South Americafrom Amazonian Peru and Brazil, througheastern Ecuador, Colombia, Venezuela, andthe Guianas.

CONTENT: Epicrionops Boulenger, 1883;Rhinatrema Dumeril and Bibron, 1841.

CHARACTERIZATION AND DIAGNOSIS: Rhina-trematids are oviparous with aquatic larvae.They are strongly annulated with numeroussecondary and tertiary grooves. Like ichth-yophiids, rhinatrematids have a short tail andthe eyes are visible, although they lie beneaththe skin in bony sockets. The tentacle arisesnear the anterior edge of each eye, and themiddle ear contains a stapes (Nussbaum,1977).

Beyond the molecular evidence, the fol-


lowing morphological characters have beensuggested to be synapomorphies (Duellmanand Trueb, 1986; M. Wilkinson and Nuss-baum, 1996): (1) dorsolateral process of theos basale present; (2) loss or fusion of theprefrontal with the maxillopalatine; (3) sec-ondary annulus/primary annulus greater thanone; and (4) fourth ceratobranchial absent. Inaddition, the prefrontals are fused with themaxillopalatine as in caeciliids, but not inichthyophiids and outgroups, rendering theoptimization of this character arguable.

[9] STEGOKROTAPHIA CANNATELLA ANDHILLIS, 1993

Stegokrotaphia Cannatella and Hillis, 1993: 2.

IMMEDIATELY MORE INCLUSIVE TAXON: [7]Gymnophiona J. Muller, 1832.

SISTER TAXON: [8] Rhinatrematidae Nuss-baum 1977.

RANGE: Tropics of southern North Ameri-ca, South America, equatorial East and WestAfrica, islands in the Gulf of Guinea, Sey-chelles, and India; Philippines and India tosouthern China, Thailand, Indochina and theMalayan archipelago.

CONCEPT AND CONTENT: Stegokrotaphia isa monophyletic group containing [10] Ich-thyophiidae Taylor, 1968, and [12] Caecili-idae Rafinesque, 1814 (cf. Cannatella andHillis, 1993).

CHARACTERIZATION AND DIAGNOSIS: Ste-gokrotaphian caecilians show variation in re-productive mode (from aquatic larvae toovoviviparity) and morphology, with someretaining tails (Ichthyophiidae) and others(Caeciliidae) having lost them (even thougha pseudotail may be present). The eyes maybe visible (e.g., Ichthyophis), completely hid-den beneath bone (e.g., Scolecomorphus), orcompletely absent (Boulengerula). Unlike inrhinatrematids, the tentacle originates in frontof the eye and may be nearly as far forwardas the nostril. A stapes is generally presentbut is lost in some taxa (Nussbaum, 1977).

Beyond the molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies (Duellmanand Trueb, 1986; M. Wilkinson and Nuss-baum, 1996): (1) mouth subterminal or re-cessed rather than terminal; (2) tentacularopening anterior to the anterior edge of the

eye; (3) frontal and squamosal articulate; (4)stegokrotaphic skull; (5) vomers in contactthroughout their entire length; (6) sides of theparasphenoid converge anteriorly; (7) quad-rate and maxillopalatine lack articulation; (8)squamosal and frontal in contact; (9) ptery-goid reduced; (10) basipterygoid present;(11) retroarticular process long and usuallycurved dorsally; (12) third and fourth cera-tobranchial fused; (13) anterior fibers of them. interhyoideus do not insert on ceratohyal;(14) m. interhyoideus posterior in two bun-dles; (15) orientation of m. interhyoideusposterior is longitudinal rather than oblique;and (16) m. depressor mandibulae longitu-dinally oriented rather than vertically orient-ed.

[10] FAMILY: ICHTHYOPHIIDAE TAYLOR, 1968

Epicria Fitzinger, 1843: 34. Type genus: EpicriumWagler, 1828. Suppressed for purposes of pri-ority but not homonymy in favor of Ichthy-ophiidae by Opinion 1604 (Anonymous, 1990:166).

Ichthyophiidae Taylor, 1968: 46. Type genus:Ichthyophis Fitzinger, 1826. Placed on OfficialList of Family-Group Names in Zoology byOpinion 1604 (Anonymous, 1990: 166–167).

Uraeotyphlinae Nussbaum, 1979: 14. Type genus:Uraeotyphlus Peters, 1880 ‘‘1879’’.

IMMEDIATELY MORE INCLUSIVE TAXON: [9]Stegokrotaphia Cannatella and Hillis, 1993.

SISTER TAXON: [12] Caeciliidae Rafin-esque, 1814.

RANGE: India to southern China, Thailand,and through the Malayan archipelago to theGreater Sunda Islands and Philippines.

CONTENT: Caudacaecilia Taylor, 1968;‘‘Ichthyophis’’ Fitzinger, 1826 (see System-atic Comments); Uraeotyphlus Peters, 1880‘‘1879’’.

CHARACTERIZATION AND DIAGNOSIS: Ichth-yophiids are oviparous with aquatic larvae,both features being plesiomorphies. Likerhinatrematids, ichthyophiids plesiomorphi-cally retain a true tail. Eyes are externallyvisible beneath the skin and are in bonysockets. The tentacle arises between the nos-tril and the eye, generally closer to the eyein Ichthyophis and Caudacaecilia and ante-rior near the nostril in Uraeotyphlus. A sta-pes is present (Nussbaum, 1977).

Beyond the molecular evidence supporting


the monophyly of this group the followingmorphological characters have been suggest-ed to be synapomorphies (M. Wilkinson andNussbaum, 1996): (1) vomers in contact an-teriorly (convergent in Siphonops, Scoleco-morphus, and Gegeneophis); (2) atria dividedexternally; (3) anterior pericardial sac longand extensive; (4) posterior internal flexuresin the m. rectus lateralis II; (5) tracheal lungpresent (also in Typhlonectes).

SYSTEMATIC COMMENTS: As noted in ‘‘Re-sults’’, the preponderance of evidence sug-gests that ‘‘Ichthyophis’’ is paraphyletic withrespect to Uraeotyphlus. Unfortunately, thenumber of species currently assigned to‘‘Ichthyophis’’ is large and mostly unsam-pled, and the relationships among them (andCaudacaecilia [unsampled by us] andUraeotyphlus) are unclear. Nussbaum andWilkinson (1989: 31) suggested that Cau-dacaecilia and Ichthyophis might both bepolyphyletic inasmuch as they are diagnosedsolely on single characters of known vari-ability. We do not place Caudacaecilia andUraeotyphlus into the synonymy of Ichthy-ophis, although to do so would certainly ren-der a monophyletic taxonomy. Ongoingwork by M. Wilkinson, Nussbaum, and col-laborators should provide a monophyletictaxonomy without resorting to that minimal-ly informative one. In the interim we placequotation marks around ‘‘Ichthyophis’’ (theonly ichthyophiid genus for which we haveevidence of paraphyly). In the face of strongevidence of paraphyly of ‘‘Ichthyophis’’,maintaining a family-group name for Uraeo-typhlus is unnecessary, and we thereforeplace Uraeotyphlinae in the synonymy ofIchthyophiidae. Other than assuming that themorphological synapomorphies are suffi-cient, stronger evidence of monophyly ofIchthyophiidae will require sampling of Cau-dacaecilia and more ‘‘Ichthyophis’’. Never-theless, we make the hypothesis that Ichth-yophiidae is a monophyletic taxon and trustthat others will elucidate this further.

[12] FAMILY: CAECILIIDAE RAFINESQUE, 1814

Cecilinia Rafinesque, 1814: 104. Type genus:Caecilia Linnaeus, 1758. See Dubois (1985:70). Authorship but not spelling to be con-served following Opinion 1830 (Anonymous,1996: 68–69).

Caeciliadae Gray, 1825: 217. Type genus: Cae-cilia Linnaeus, 1758.

Siphonopina Bonaparte, 1850: 1 p. Type genus:Siphonops Wagler, 1828.

Typhlonectidae Taylor, 1968: xi, 231. Type genus:Typhlonectes Peters, 1880 ‘‘1879’’.

Scolecomorphidae Taylor, 1969a: 297. Type ge-nus: Scolecomorphus Boulenger, 1883.

Dermophiinae Taylor, 1969b: 610. Type genus:Dermophis Peters, 1880 ‘‘1879’’.

Herpelinae Laurent, 1984a: 199–200. Type genus:Herpele Peters, 1875.

Geotrypetoidae Lescure et al., 1986: 162. Typegenus: Geotrypetes Peters, 1880.

Grandisoniilae Lescure et al., 1986: 164. Type ge-nus: Grandisonia Taylor, 1968.

Indotyphlini Lescure et al., 1986: 164. Type ge-nus: Indotyphlus Taylor, 1960.

Afrocaeciliiti Lescure et al., 1986: 164. Type ge-nus: Afrocaecilia Taylor, 1968.

Brasilotyphlili Lescure et al., 1986: 166. Type ge-nus: Brasilotyphlus Taylor, 1968.

Pseudosiphonopiti Lescure et al., 1986: 166. Typegenus: Pseudosiphonops Taylor, 1968.

Oscaecilioidae Lescure et al., 1986: 167. Type ge-nus: Oscaecilia Taylor, 1968.

Gymnopiilae Lescure et al., 1986: 168. Type ge-nus: Gymnopis Peters, 1874.

Potamotyphloidea Lescure et al., 1986: 169. Typegenus: Potamotyphlus Taylor, 1968.

Pseudotyphlonectini Lescure et al., 1986: 170.Type genus: Pseudotyphlonectes Lescure, Ren-ous, and Gasc, 1986.

IMMEDIATELY MORE INCLUSIVE TAXON: [9]Stegokrotaphia Cannatella and Hillis, 1993.

SISTER TAXON: [10] Ichthyophiidae Taylor,1968.

RANGE: Tropics of Mexico, Central Amer-ica, and South America; equatorial East andWest Africa and islands in the Gulf of Guin-ea, Seychelles, and India.

CONTENT: Atretochoana Nussbaum andWilkinson, 1995; Boulengerula Tornier,1896; Brasilotyphlus Taylor, 1968; CaeciliaLinnaeus, 1758; Chthonerpeton Peters, 1880;Crotaphatrema Nussbaum, 1985; Dermo-phis Peters, 1880; Gegeneophis Peters, 1880;Geotrypetes Peters, 1880; Grandisonia Tay-lor, 1968; Gymnopis Peters, 1874; HerpelePeters, 1880; Hypogeophis Peters, 1880; Idi-ocranium Parker, 1936; Indotyphlus Taylor,1960; Luetkenotyphlus Taylor, 1968; Micro-caecilia Taylor, 1968; Mimosiphonops Tay-lor, 1968; Nectocaecilia Taylor, 1968; Oscae-cilia Taylor, 1968; Parvicaecilia Taylor,


1968; Potomotyphlus Taylor, 1968; PrasliniaBoulenger, 1909; Schistometopum Parker,1941; Scolecomorphus Boulenger, 1883; Si-phonops Wagler, 1828; Sylvacaecilia Wake,1987; Typhlonectes Peters, 1880.

CHARACTERIZATION AND DIAGNOSIS: Caeci-liids represent the bulk of caecilian diversityand, not surprisingly, show considerablemorphological and reproductive variation.Some taxa are oviparous with aquatic larvae(e.g., Praslinia), whereas others are ovipa-rous with direct development in the egg (e.g.,Hypogeophis, Idiocranium, and Boulengeru-la), and others are viviparous (e.g., Schisto-metopum, Dermophis, and typhlonectines).Unlike Ichthyophiidae and Rhinatrematidae,no caeciliid possesses a true tail, althoughsome (e.g., typhlonectines) have a pseudotail.Most species are terrestrial and burrowing,although some (e.g., typhlonectines) are sec-ondarily aquatic. At least one species (Atre-tochoana eiselti: Typhlonectinae) is totallylungless (Nussbaum and Wilkinson, 1995).Most taxa have stapes, but all scolecomor-phines lack them (Nussbaum, 1977).

Beyond the molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies of thisgroup (M. Wilkinson and Nussbaum, 1996):(1) tail absent; (2) premaxillae and nasalbones fused; (3) septomaxillae reduced orabsent (reversed in Scolecomorphus); (4)pterygoid absent; (5) basiptergygoid processlarge (small in Scolecomorphus); (6) fusedthird and fourth ceratobranchials greatly ex-panded; and (7) vent circular or transverse,not longitudinally oriented (reversed in Sco-lecomorphus).

SYSTEMATIC COMMENTS: Recognition of thenominal families Typhlonectidae (Atreto-choana, Chthonerpeton, Nectocaecilia, Po-tomotyphlus, Typhlonectes) and Scolecomor-phidae (Crotaphatrema and Scolecomor-phus) renders Caeciliidae paraphyletic. Al-though we expect that ongoing work by M.Wilkinson, Nussbaum, and collaborators willprovide a more refined taxonomy, these cur-rently recognized taxa can be retained as sub-families (Scolecomorphinae Taylor, 1969,and Typhlonectinae Taylor, 1968) with noparaphyly implied as long as the remainingcaeciliids are not placed within a subfamily.(A Caeciliinae recognized as nomenclatural-

ly coordinate with Scolecomorphinae andTyphlonectinae would merely push the par-aphyly to the subfamily level, as was doneby Hedges et al., 1993.) Although molecularevidence corroborates the monophyly ofScolecomorphinae, the following morpho-logical characters also diagnose that taxon(Nussbaum and Wilkinson, 1989; M. Wilkin-son and Nussbaum, 1996): (1) temporal fossasecondarily large (also in Typhlonectinae,though not homologously); (2) premaxillaeseparate; (3) septomaxilla present; (4) pre-frontals present; (5) basipterygoid processsmall; and (6) no stapes. Similarly, for Ty-phlonectinae, the following apomorphiccharacters diagnose that taxon (Nussbaumand Wilkinson, 1989; M. Wilkinson andNussbaum, 1996): (1) temporal fossa second-arily large (also in Scolecomorphinae,though not homologously); and (2) choanaelarge, with well-developed valves.

[23] BATRACHIA LATREILLE, 1800

Batrachii Latreille, 1800: xxxvii. A Latinizationof Batraciens Brongniart, 1800b, emended toBatrachia by Rafinesque, 1814: 103. (See ap-pendix 6 for nomenclatural discussion.)

IMMEDIATELY MORE INCLUSIVE TAXON: [6]Amphibia Gray, 1825.

SISTER TAXON: [7] Gymnophiona J. Muller,1832.

RANGE: Cosmopolitan in cold-temperate totropical habitats, except for extreme northernlatitudes, Antarctica, and most oceanic is-lands.

CONCEPT AND CONTENT: Batrachia is amonophyletic taxon containing [24] CaudataFischer von Waldheim, 1813, and [74] AnuraFischer von Waldheim, 1831 (cf. Cannatellaand Hillis, 1993; cf. Latreille, 1800).

CHARACTERIZATION AND DIAGNOSIS: Batra-chia is a taxon whose living members of thetwo component groups (salamanders andfrogs) are so different (and mutually apo-morphic) that their synapomorphies are notobviously reflected in external appearance.The annectant members of the taxon are allfossil and not well known. For practical pur-poses, Batrachia is composed of living am-phibians that are not members of Gymno-phiona.

Beyond our molecular evidence, the fol-


lowing morphological characters have beensuggested to be synapomorphies of thisgroup (Trueb and Cloutier, 1991): (1) loss ofa postfrontal bone; (2) loss of the surangularbone; (3) loss of splenial bone; (4) loss ofdermal scales; (5) absence of an articulationof the anterior ptergygoid ramus with the pal-atine; (6) absence of an ectopterygoid; (7)absence of a stapedial foramen; (8) presenceof a papilla neglecta; (9) presence of a ca-rotid labyrinth; (10) choanal tube opens intothe archenteron during development; and(11) pronephros modified for sperm trans-port.

SYSTEMATIC COMMENTS: Feller and Hedges(1998) coined the name Procera (for whichHomomorpha Fitzinger [1835] is an avail-able older name) for a clade composed ofsalamanders and caecilians that they believedto be monophyletic. Procera was supportedby analysis of 2.7 kb of sequence from fourmtDNA genes. We have not attempted to re-analyze the data of Feller and Hedges (1998),but we note that we also used 12S and 16Sfragments of the mt rRNA genes and t-RNAValine. They also used sequences from aportion of the tRNALeucine gene, which we didnot. Unlike Feller and Hedges (1998), we in-cluded substantial evidence from nuDNA se-quences (see ‘‘Materials’’), with the resultthat we have employed almost half again asmuch sequence as they did and more than 43times as many terminals. Our results stronglysupport the relationship corroborated bymorphological evidence (Trueb and Cloutier,1991), which is caecilians 1 (frogs 1 sala-manders). This arrangement, in turn, is con-sistent with the recognition of Batrachia La-treille (1800) and as intended by Trueb andCloutier (1991). Furthermore, for our data al-ternative topologies required considerablymore steps: (1) frogs 1 (caecilians 1 sala-manders) required 84 additional steps; and(2) salamanders 1 (caecilians 1 frogs) so-lution required an additional 85 steps.

[24] CAUDATA FISCHER VON WALDHEIM, 1813

Caudati Fischer von Waldheim, 1813: 58, an ap-parent latinization and reranking of CaudatiA.M.C. Dumeril, 1806: 95 (which was coinedas a family-group taxon and is therefore un-available for above-family-group taxonomy).Emended here to conform to the traditional

spelling, Caudata (see Stejneger, 1907). NotCaudata Scopoli (1777), as attributed incorrect-ly by Stejneger, 1907: 215. (See appendix 6 fornomenclatural discussion.)

IMMEDIATELY MORE INCLUSIVE TAXON: [23]Batrachia Latreille, 1800.

SISTER TAXON: [74] Anura Fischer vonWaldheim, 1831.

RANGE: Temperate Eurasia, northwesternAfrica, and North America, and in disjunctpopulations throughout tropical America.

CONCEPT AND CONTENT: Caudata is amonophyletic group composed of all livingsalamanders (cf. Cannatella and Hillis,1993), the subsidiary taxa being [25] Cryp-tobranchoidei Noble, 1931, and [29] Diadec-tosalamandroidei new taxon.

CHARACTERIZATION AND DIAGNOSIS: Sala-manders are immediately recognizable be-cause they are the only living amphibians tohave both forelimbs and tails. Their primitiveaspect is restricted only to general body plan.Salamanders show many osteological lossesand morphological simplifications from theirnon-caudatan ancestors. Unlike the other twomajor clades of living amphibians, wholegroups of salamanders are known for pae-domorphic lineages with varying degrees ofretention of larval characteristics in theaquatic adults (e.g., Cryptobranchidae, Sir-enidae, Proteidae, and various members ofthe Ambystomatidae [e.g., Amybystoma du-merilii] and Plethodontidae [e.g., Euryceatridentifera]). Most salamanders transfersperm via the production of spermatophores,but like frogs and caecilians, salamandersprimitively have external fertilization withfree-living aquatic larvae.

Beyond our molecular evidence, Caudatais diagnosed by the following morphologicalcharacters, judged to be synapomorphies(modified from Trueb and Cloutier, 1991;Larson and Dimmick, 1993; Larson et al.,2003): (1) incomplete maxillary arcade; (2)presence of a tuberculum interglenoideum;(3) scapulocoracoid and scapula fused (re-versed in sirenids); (4) no operculum andcolumella detached (modified in some hy-nobiids, plethodontids, salamandrids, andambystomatids); and (5) male anterior ven-tral glands present (reversed in sirenids). Inaddition, Trueb and Cloutier (1991) dis-


cussed a number of other features that maybe synapomorphic but are highly contingenton cladogram topology.

[25] CRYPTOBRANCHOIDEI NOBLE, 1931

Cryptobranchoidea Noble, 1931: 473. Explicit or-der emended to Cryptobranchoidei by Tamaru-nov, 1964b: 159. (See appendix 6 for nomen-clatural note.)

IMMEDIATELY MORE INCLUSIVE TAXON: [24]Caudata Fischer von Waldheim, 1813.

SISTER TAXON: [29] Diadectosalamandro-idei new taxon.

RANGE: Eastern United States and south-eastern Canada in North America; in Eurasiafrom Kamchatka west through Siberia toeastern European Russia to Turkmenistan,Afghanistan, and Iran and eastward throughcentral China to Korea and Japan.

CONCEPT AND CONTENT: Cryptobranchoideiis a monophyletic taxon composed of [27]Cryptobranchidae Fitzinger, 1826, and [26]Hynobiidae Cope, 1859.

CHARACTERIZATION AND DIAGNOSIS: Cryp-tobranchoidei exhibits external fertilization(one genus showing a unique kind of sper-matophore formation) and other featuresprimitive for Caudata. Although one group(Cryptobranchidae) consists of paedomor-phic giants with distinctive apomorphiessuch as lateral folds of skin, the bulk of spe-cies (Hynobiidae) are generalized forms thatare similar in many ways to the ancestral sal-amander.

Beyond the molecular evidence, the fol-lowing morphological characters are likelysynapomorphies (Noble, 1931; Larson andDimmick, 1993; Larson et al., 2003): (1) fu-sion of the m. pubotibialis and m. pubois-chiotibialis; and (2) ribs unicapitate (also inAnura).

[27] FAMILY: CRYPTOBRANCHIDAEFITZINGER, 1826

Cryptobranchoidea Fitzinger, 1826: 42. Type ge-nus: Cryptobranchus Leuckart, 1821.

Menopomatidae Hogg, 1838: 152. Type genus:Menopoma Harlan, 1825.

Andriadini Bonaparte, 1839: 131. Type genus:Andrias Tschudi, 1837.

Protonopsina Bonaparte, 1840: 101 (p. 11 of off-print). Type genus: Protonopsis LeConte, 1824.

Salamandropes Fitzinger, 1843: 34. Type genus:Salamandrops Wagler, 1830.

Megalobatrachi Fitzinger, 1843: 34. Type genus:Megalobatrachus Tschudi, 1837.

Sieboldiidae Bonaparte, 1850: 1 p. Type genus:Sieboldia Gray, 1838.

Protonopsidae Gray, 1850a: 52. Type genus:‘‘Protonopsis Barton, 1824’’ (5 ProtonopsisLeConte, 1824).

IMMEDIATELY MORE INCLUSIVE TAXON: [25]Cryptobranchoidei Noble, 1931.

SISTER TAXON: [26] Hynobiidae Cope,1859.

RANGE: Central China; Japan; eastern tem-perate North America.

CONTENT: Andrias Tschudi, 1837; Cryp-tobranchus Leuckart, 1821.

CHARACTERIZATION AND DIAGNOSIS: Cryp-tobranchidae is a taxon composed of threespecies of giant, obligately aquatic paedo-morphs. Like other cryptobranchoids, theylack internal fertilization and share a suite ofinternal characters primitive for Caudata.Adults lack gills and the lungs are nonfunc-tional, so nearly all respiration is across theextensively folded and wrinkled skin (Noble,1931; Bishop, 1943).

Beyond the molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies (Larson andDimmick, 1993; Larson et al., 2003): (1) dor-soventrally flattened bodies; (2) presence offolds of skin forming flaps along the lateralmargins of the body; and (3) septomaxillaabsent (also in some salamandrids, Am-phiumidae, and Perennibranchia).

SYSTEMATIC COMMENT: The monophyly ofCryptobranchidae was never seriously indoubt, but our results (appendix 5) and thoseof Larson et al. (2003) demonstrate thatCryptobranchus is the sister taxon of An-drias, an arrangement suggested, but not sub-stantiated, by Estes (1981).

[26] FAMILY: HYNOBIIDAE COPE, 1859 (1856)

Ellipsoglossidae Hallowell, 1856: 11. Type genus:Ellipsoglossa Dumeril, Bibron, and Dumeril,1854.

Hynobiidae Cope, 1859: 125. Type genus: Hy-nobius Tschudi, 1838.

Protohynobiinae Fei and Ye, 2000: 64. Type ge-nus: Protohynobius Fei and Ye, 2000.


IMMEDIATELY MORE INCLUSIVE TAXON: [25]Cryptobranchoidei Noble, 1931.

SISTER TAXON: [27] Cryptobranchidae Fit-zinger, 1826.

RANGE: Japan, Korea, and Kamchatkawest through Siberia and China to easternEuropean Russia to Turkmenistan, Afghani-stan, and Iran.

CONTENT: Batrachuperus Boulenger,1878; Hynobius Tschudi, 1838; Onychodac-tylus Tschudi, 1838; Pachyhynobius Fei, Qu,and Wu, 1983; Protohynobius Fei and Ye,2000; Ranodon Kessler, 1866; Salamandrel-la Dybowski, 1870.

CHARACTERIZATION AND DIAGNOSIS: Hyno-biids are unremarkable salamanders, predom-inantly exhibiting a biphasic life history withexternal fertilization and females lackingspermathecae. Lungs are usually developed,except in Onychodactylus.

Beyond the molecular evidence (which isof limited value in testing the monophyly ofthis group; see ‘‘Review of Current Taxon-omy’’ and ‘‘Results’’), the following mor-phological characters are likely synapomor-phies (Larson and Dimmick, 1993; Larson etal., 2003): (1) first hypobranchial and firstceratobranchial fused (also in amphiumids);and (2) vomerine dentition replacement fromposterior (also in Rhyacotriton and Ambys-tomatidae).

SYSTEMATIC COMMENTS: Monophyly ofHynobiidae requires additional testing, es-pecially with respect to Cryptobranchidae.Larson et al. (2003) suggested that Batrachu-perus is polyphyletic. Unfortunately, al-though the resultant tree was published, theunderlying data were not, leaving the prob-lem unaddressable at this time. The status ofProtohynobiinae also requires phylogeneticcorroboration to determine the placement ofProtohynobius within the remaining hyno-biids.

[29] DIADECTOSALAMANDROIDEINEW TAXON

ETYMOLOGY: Diadectos (Greek: transmit-ter) 1 salamandroidei- (Greek: of the formof a salamander). (See appendix 6 for no-menclatural note.)

IMMEDIATELY MORE INCLUSIVE TAXON: [24]Caudata.

SISTER TAXON: [25] Cryptobranchoidei.

RANGE: Temperate and tropical regions ofNorth America, tropical South America, andPalearctic Eurasia and North Africa.

CONCEPT AND CONTENT: Diadectosalaman-droidei is a monophyletic group of salaman-ders containing [30] Hydatinosalamandroideinew taxon and [49] Plethosalamandroideinew taxon.

CHARACTERIZATION AND DIAGNOSIS: Dia-dectosalamandroids represent the bulk of liv-ing salamander diversity. All are character-ized by internal fertilization through the useof a spermatophore. The exception is Siren-idae, which in our analysis appears to havelost this complex reproductive feature (inas-much as the secretory structures are absent),although this is optimization-dependent, thealternative being that Proteidae gained thecharacteristic independently of other sala-mander families that have spermatophoreproduction. Morphological diversity is enor-mous, from the large and obligately aquaticamphiumas to arboreal web-footed tropicalbolitoglossine plethodontids to various pae-domorphic perennibranch lineages such as inAmbystoma. All families within Diadectosa-lamandroidei primitively show a biphasic lifehistory. However, because of the enormousspecies diversity of direct-developing pleth-odontids, most species within this taxon lacka free-living larval stage.

Beyond the molecular evidence (appendix5), the following are likely synapomorphies(modified from Larson and Dimmick, 1993;Larson et al., 2003): (1) maxilla with a singlecenter of ossification (maxilla lost in Nectu-rus); (2) angular bone absent; (3) spinalnerve foramina present in at least some ver-tebrae; (4) spermathecae present (lost in Sir-enidae); (5) posterior ventral glands present(lost in amphiumids and sirenids); (6) Kings-bury’s glands present (lost in sirenids); and(7) dorsal pelvic glands present in females(lost in sirenids).

[30] HYDATINOSALAMANDROIDEINEW TAXON

ETYMOLOGY: Hydatino- (Greek: of the wa-ter) 1 salamandroidei (Greek: of salamanderform), denoting that these salamanders gen-erally spend at least part of their lives in wa-ter.


IMMEDIATELY MORE INCLUSIVE TAXON: [29]Diadectosalamandroidei new taxon.

SISTER TAXON: [49] Plethosalamandroideinew taxon.

RANGE: Coextensive with Caudata, exclud-ing the Americas south of the Mexican Pla-teau.

CONCEPT AND CONTENT: Hydatinosalaman-droidei is a monophyletic group composed of[31] Perennibranchia Latreille, 1825, and[35] Treptobranchia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Hyda-tinosalamandroidei is the predominant groupof transforming salamanders, with a few pae-domorphic lineages in the major families.There are no morphological characters of un-ambiguous placement (i.e., morphologicalsynapomorphies) of this clade. Molecularsynapomorphies are summarized in appendix5.

[31] PERENNIBRANCHIA LATREILLE, 1825

Perennibranchia Latreille, 1825: 105. (See appen-dix 6 for nomenclatural note.)

IMMEDIATELY MORE INCLUSIVE TAXON: [30]Hydatinosalamandroidei new taxon.

SISTER TAXON: [35] Treptobranchia newtaxon.

RANGE: Extreme northeastern Mexiconorth through the eastern United States tosoutheastern Canada; Adriatic seaboard asfar north as Istrian region and as far south asMontenegro; isolated population in north-eastern Italy.

CONCEPT AND CONTENT: PerennibranchiaLatreille, 1825, is a monophyletic group asimplied by its original content, containing[32] Proteidae Gray, 1825, and [33] Sireni-dae Gray, 1825.

CHARACTERIZATION AND DIAGNOSIS: Peren-nibranchia is a clade composed of moderateto large obligately aquatic paedomorphicspecies, with permanent bushy external gills,no eyelids, and laterally compressed tails. Allspecies have well-developed forelimbs andone group has lost hindlimbs. Lungs are pre-sent, and although internal fertilization ap-pears to be the plesiomorphic condition inthis group, it may have been lost in sirenids,although this is optimization-dependent.

Beyond the molecular evidence, the fol-lowing morphological characters are likely

synapomorphies (from Larson and Dimmick,1993):(1) metamorphosis absent so adults re-tain numerous paedomorphic characteristics,such as large bushy external gills (also invarious paedomorphic lineages in Ambysto-matidae and Plethodontidae); and (2) ypsi-loid cartilage absent (also lacking in Am-phiumidae 1 Plethodontidae, and the hyno-biid Onychodactylus); (3) second ceratobran-chial in three or four elements; and (4)maxilla reduced or absent (also reduced inBatrachuperus).

SYSTEMATIC COMMENTS: The monophyly ofPerennibranchia requires additional testingalthough the preponderane of our evidencesupports strongly its recognition. Wiens et al.(2005) did not support the monophyly ofPerennibranchia in their parsimony analysis,instead placing Sirenidae as the sister taxonof all other salamanders. Their evidence in-cluded morphological and molecular evi-dence (from RAG-1) that we did not have,although our total amount of molecular evi-dence is greater. These authors treated in-ferred gaps as unknown characters, while wetreated inferred gaps as evidence. (As notedin ‘‘Methods’’, we see gaps as a logical con-sequence of indels and like other charactersthat are consequences of deductive reason-ing, such as morphological reversals, we areinclined to include them as evidence.) Astrong test of Perennibranchia will involveanalyzing all of the data of Wiens et al.(2005) along with our evidence, under a sin-gle analytical assumption-set (e.g., the sameassumption set for alignment and analysis,inclusion as evidence of gaps and morpho-logical reversals, and nonexclusion of mor-phological characters deemed paedomor-phic).

[32] FAMILY: PROTEIDAE GRAY, 1825

Proteina Gray, 1825: 215. Type genus: ProteusLaurenti, 1768.

Phanerobranchoidea Fitzinger, 1826: 43. Type ge-nus: Phanerobranchus Leuckart, 1821.

Necturi Fitzinger, 1843: 35. Type genus: NecturusRafinesque, 1819.

Hypochthonina Bonaparte, 1840: 101 (p. 11 ofoffprint). Type genus: Hypochthon Merrem,1820.

Necturina Bonaparte, 1845: 6. Type genus: Nec-turus Rafinesque, 1819.


Hylaeobatrachidae Abel, 1919: 329–330. TypeGenus: Hylaeobatrachus Dollo, 1884. (Whetherthis fossil taxon is inside the crown group isunknown and it is placed here provisionally.)

Menobranchida Knauer, 1883: 96. Type genus:Menobranchus Harlan, 1825.

IMMEDIATELY MORE INCLUSIVE TAXON: [31]Perennibranchia Latreille, 1825.

SISTER TAXON: [33] Sirenidae Gray, 1825.RANGE: Eastern United States and adjacent

southeastern Canada; Adriatic seaboard asfar north as Istrian region and as far south asMontenegro; isolated population in north-eastern Italy.

CONTENT: Necturus Rafinesque, 1819;Proteus Laurenti, 1768.

CHARACTERIZATION AND DIAGNOSIS: Protei-dae is a group of obligately aquatic paedo-morphic salamanders characterized by hav-ing bushy external gills throughout life, lack-ing eyelids, having laterally compressed tails.Unlike their sister taxon, Sirenidae, they ex-hibit internal fertilization and have hind legs(Noble, 1931). All of these characteristics areeither synapomorphic with their sister taxonor plesiomorphic with respect to Perenni-branchia.

Beyond our molecular evidence, the fol-lowing morphological characters are likelysynapomorphic (modified from Larson andDimmick, 1993; Larson et al., 2003): (1) re-cessus amphibiorum with vertical orientation(also in Plethodontidae); (2) basilaris com-plex absent (also in plethodontids and somesalamandrids); and (3) maxilla absent.

[33] FAMILY: SIRENIDAE GRAY, 1825

Sirenina Gray, 1825: 215. Type genus: Siren Lin-naeus, 1767 (5 Siren Osterdam, 1766).

Sirenes Fitzinger, 1843: 35. Type genus: SirenLinnaeus, 1767 (5 Siren Osterdam, 1766).

IMMEDIATELY MORE INCLUSIVE TAXON: [13]Perennibranchia Latreille, 1825.

SISTER TAXON: [32] Proteidae Gray, 1825.RANGE: Southeastern United States and ex-

treme northeastern Mexico.CONTENT: Pseudobranchus Gray, 1825;

Siren Osterdam, 1766.CHARACTERIZATION AND DIAGNOSIS: Sirens

are a group of slender, obligately aquatic pae-domorphic salamanders that exhibit the stan-dard suite of paedomorphic characteristics—

lack of eyelids, bushy external gills, and lat-erally compressed tail—but also lack pre-maxillary teeth and have keratinized jawpads (a synapomorphy). Unlike all other sal-amanders, sirens lack hind limbs; unlike nearrelatives they appear to have lost internal fer-tilization (Noble, 1931). They typically livein heavily vegetated lakes, ponds, andswamps (Bishop, 1943).

Beyond our molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies (Larson etal., 2003) or are synapomorphies in our to-pology: (1) hindlimbs lost; (2) scapulocora-coid and scapula separate elements (a rever-sal); (3) teeth absent (present in some fossilforms, outside of the crown group), replacedby keratinized beaklike pads; (5) all spinalnerves exit through foramina except for firsttwo vertebrae (also in salamandrids); and (7)all glands and spermathecae lost that wereassociated with spermatophore production.

ANATOMICAL COMMENT: Sirenid nasalbones have been suggested to be nonhomol-ogous with those in spermatophore-produc-ing taxa (Salamandroidea sensu Duellmanand Trueb, 1986) because they ossify fromanlagen positioned medially to the dorsalprocess of the premaxillae (laterally to thepaired premaxillary processes in ‘‘salaman-droids’’; Larson et al., 2003). Our placementof sirenids within Diadectosalamandroideisuggests that the ossification center hasmoved from lateral to medial in sirenids,with the nasal bones themselves remaininghomologous as nasal bones.

[35] TREPTOBRANCHIA NEW TAXON

ETYMOLOGY: Greek: Treptos (Greek:turned) 1 branchia (Greek: gill), noting thatthe bulk of the salamanders in this group aretransforming (or a few further derived inhaving direct development).

IMMEDIATELY MORE INCLUSIVE TAXON: [30]Hydatinosalamandroidei new taxon.

SISTER TAXON: [31] Perennibranchia La-treille, 1825.

RANGE: British Isles and Scandinavia east-ward to the Ural Mountains, southward intothe Iberian Peninsula and Asia Minor; north-central India and China to northern Indochi-na; extreme northwestern Africa; southern


Canada and southern Alaska south to thesouthern edge of the Mexican Plateau.

CONCEPT AND CONTENT: Treptobranchia isa monophyletic group containing Ambysto-matidae Gray, 1850, and SalamandridaeGoldfuss, 1820.

CHARACTERIZATION AND DIAGNOSIS: Am-bystomatids and salamandrids are commonlyencountered salamanders in North Americaand temperate Eurasia. Their life history isbiphasic and they have internal fertilization.With the exception of a few paedomorphiclineages, they transform into adults that lackgills and have eyelids. Their body forms runfrom moderately slender to robust; the limbsare well-developed and robust.

No morphological synapomorphies havebeen suggested for this taxon, and althoughthis group is uniformly characterized by sev-eral of the included morphological charac-ters, none of them optmizes unambiguouslyto this taxon. Unambiguously optimized mo-lecular synapomorphies of Treptobranchiaare listed in appendix 5.

[36] FAMILY: AMBYSTOMATIDAE GRAY, 1850

Ambystomina Gray, 1850a: 32. Type genus: Am-bystoma Tschudi, 1838.

Siredontina Bonaparte, 1850: 1 p. Type genus: Si-redon Wagler, 1830.

Dicamptodontinae Tihen, 1958: 3. Type genus:Dicamptodon Strauch, 1870. New synonymy.

IMMEDIATELY MORE INCLUSIVE TAXON: [35]Treptobranchia new taxon.

SISTER TAXON: [40] Salamandridae Gold-fuss, 1820.

RANGE: Alaska and southern Canada southto the southern edge of the Mexican Plateau.

CONTENT: Ambystoma Tschudi, 1838; Di-camptodon Strauch, 1870.

CHARACTERIZATION AND DIAGNOSIS: Am-bystomatids are thick-bodied salamanderswith well-developed limbs. They inhabit awide variety of habitats from semidesertgrassland to boreal conifer forest and decid-uous forest, generally returning to water onlyfor reproduction. Nevertheless, the most fa-mous paedomorphic lineage, Ambystomamexicanum (axolotl) of central Mexico, is inthis family. Some of the paedomorphic lake-form species have assumed extreme andlarge forms, with the formerly recognized ge-

nus Bathysiredon being distinguished fromAmbystoma on the basis of its catfish-likehabitus (Dunn, 1939).

Beyond our molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies: (1) vomer-ine dentition replacement from posterior(also in Hynobiidae and Rhyacotritonidae;Larson and Dimmick, 1993; Larson et al.,2003); (2) presence of conspicuous folds incloacal tube in males (also in Rhyacotriton-idae; Larson and Dimmick, 1993; Larson etal., 2003); and (3) ring-shaped otoglossalcartilage (also in Rhyacotriton; Cope, 1887;Tihen, 1958).

SYSTEMATIC COMMENTS: We place Dicamp-todon in Amybstomatidae, because doing sorenders a more efficient taxonomy and be-cause the reason for removing Dicamptodonoriginally from Ambystomatidae (that it wasthought to be distantly related to Ambystoma[Edwards, 1976]) has now been rejected(Larson et al., 2003).

[40] FAMILY: SALAMANDRIDAEGOLDFUSS, 1820

Salamandrae Goldfuss, 1820: 129. Type genus:Salamandra Laurenti, 1768.

Tritonidae Boie, 1828: 363. Type genus: TritonLaurenti, 1768.

Pleurodeles Tschudi, 1838: 91. Type genus: Pleu-rodeles Michahelles, 1830.

Salamandrinae Fitzinger, 1843: 33. Type genus:Salamandrina Fitzinger, 1826.

Molgidae Gray, 1850a: 14. Type genus: MolgeMerrem, 1820.

Seiranotina Gray, 1850a: 29. Type genus: Seir-anota Barnes, 1826.

Bradybatina Bonaparte, 1850: 1 p. Type genus:Bradybates Tschudi, 1838.

Geotritonidae Bonaparte, 1850: 1 p. Type genus:Geotriton Bonaparte, 1832 (5 Triturus Rafin-esque, 1815).

IMMEDIATELY MORE INCLUSIVE TAXON: [35]Treptobranchia new taxon.

SISTER TAXON: [36] Ambystomatidae Gray,1850.

RANGE: British Isles and Scandinavia east-ward to the Ural Mountains, southward intothe Iberian Peninsula and Asia Minor; north-central India and China to northern Indochi-na; extreme northwestern Africa; northeast-ern and extreme northwestern Mexico


through western and eastern United Statesnorth to Alaska and southeastern Canada.

CONTENT: Chioglossa Bocage, 1864; Cy-nops Tschudi, 1838; Echinotriton Nussbaumand Brodie, 1982; Euproctus Gene, 1838(see Systematic Comments); Lissotriton Bell,1838; Lyciasalamandra Veith and Steinfartz,2004; Mertensiella Wolterstorff, 1925; Me-sotriton Bolkay, 1927; Neurergus Cope,1862; Notophthalmus Rafinesque, 1820;Pachytriton Boulenger, 1878; Paramesotri-ton Chang, 1935; Pleurodeles Michahelles,1830; Salamandra Laurenti, 1768; Salaman-drina Fitzinger, 1826; Taricha Gray, 1850;Triturus Rafinesque, 1815 (see SystematicComments); Tylototriton Anderson, 1871.

CHARACTERIZATION AND DIAGNOSIS: Thesalamandrid body plans range from moder-ately slender to robust with four well-devel-oped limbs. Most species are periodically(e.g., Taricha, Notophthalmus) or completely(e.g., Cynops, Pleurodeles, and Pachytriton)aquatic and typically have biphasic life his-tories, except for Mertensiella, which has di-rect-development from terrestrial eggs, andsome populations of Salamandra that havelive birth. Notophthalmus exhibits three dis-tinct life-history stages, an aquatic larva, ter-restrial subadult (eft), and aquatic adult(Bishop, 1943). There are a few paedomor-phic populations of Notophthalmus and Tri-turus, that, although they retain external gills,do develop eyelids (Duellman and Trueb,1986; Zug et al., 2001).

Beyond our molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies (Larson andDimmick, 1993; Larson et al., 2003): (1)periotic connective tissue present (also inplethodontids); (2) periotic cistern small(also in plethodontids); and (3) vomerinedentition medially replaced.

SYSTEMATIC COMMENTS: Our results, al-though based on less dense sampling, arebroadly similar to those of Titus and Larson(1995; see ‘‘Results’’). Various authors (e.g.,Risch, 1985) have recognized subfamilies,although none so far suggested has been con-sistent with the phylogeny of the group. Cur-rent understanding of relationships amongsalamandrids (e.g., Larson et al., 2003) isconsistent with the recognition of two sub-families: Salamandrinae Goldfuss, 1820, for

the ‘‘true’’ salamanders (Chioglossa, Lycias-alamandra, Mertensiella, and Salamandra)and Pleurodelinae Tschudi, 1838 (for‘‘newts’’, the remaining genera). Salamandrais our sole exemplar of Salamandrinae andlikely some of the molecular characters forthis genus (appendix 5) are synapomorphiesof the subfamily. Branch 41 in appendix 5 isequivalent to Pleurodelinae as we hypothe-size it.

Garcıa-Parıs et al. (2004a: 602) suggestedin brief comment that the date of publicationof Euproctus Gene is not 1838, but 1839,rendering it a junior synonym of MegapternaSavi, 1838. They also suggested that ongoingmolecular work will show Euproctus to beparaphyletic and render Euproctus asper asCalotriton asper (Duges, 1852) as well asshow that Triturus vittatus should not be in-cluded within Triturus, the oldest availablename for this monotypic taxon being Om-matotriton Gray, 1850. Pending publicationof the relevant evidence we retain the statusquo.

[49] PLETHOSALAMANDROIDEI NEW TAXON

ETYMOLOGY: Pletho- (Greek: great num-ber) 1 salamandrodei (Greek: of salamanderform), to denote the large number of speciesin this taxon, and with passing reference tothe largest contributor to this enormity,Plethodontidae.

IMMEDIATELY MORE INCLUSIVE TAXON: [29]Diadectosalamandroidei new taxon.

SISTER TAXON: [30] Hydatinosalamandro-idei new taxon.

RANGE: Temperate and tropical North andtropical South America; Korea; and Mediter-ranean Europe.

CONCEPT AND CONTENT: Plethosalamandro-idei is a monophyletic group containing Rhy-acotritonidae Tihen, 1958, and [50] Xenosa-lamandroidei new taxon.

CHARACTERIZATION AND DIAGNOSIS: Ple-thosalamandroidei contains the vast majorityof species of salamanders, being dominatedby the very large family Plethodontidae.Morphological and life-history variation isextensive, from the obligately aquatic am-phiumas to the arboreal species of Bolito-glossa. Although primitively exhibiting a bi-


phasic life history, the bulk of the plethosa-lamandroids are direct-developers.

No unambiguous evidence for this taxonextends from morphology, and only molec-ular evidence documents the existence of thisclade, summarized in appendix 5.

FAMILY: RHYACOTRITONIDAE TIHEN, 1958

Rhyacotritoninae Tihen, 1958: 3. Type genus:Rhyacotriton Dunn, 1920.

IMMEDIATELY MORE INCLUSIVE TAXON: [49]Plethosalamandroidei.

SISTER TAXON: [50] Xenosalamandroideinew taxon.

RANGE: Extreme northwestern UnitedStates.

CONTENT: Rhyacotriton Dunn, 1920.CHARACTERIZATION AND DIAGNOSIS: Ani-

mals in this taxon are relatively small, semi-aquatic transforming salamanders of stoutbody and limbs, resembling the ambysto-matids in general aspect, a group with whichthey were once considered to be allied. Rhy-acotritonids exhibit a biphasic life historyand have internal fertilization.

Beyond our molecular evidence, the fol-lowing characters have been suggested to besynapomorphies (modified from Larson andDimmick, 1993; Larson et al., 2003): (1) vo-merine dentition replacement from posterior(also in Hynobiidae and Ambystomatidae);(2) conspicuous folds present in the male clo-acal tube (also in Ambystomatidae); (3) malevent gland extremely enlarged and secretesthrough pores lateral to the cloacal orificerather than into the cloacal orifice as in otherspermatophore-producing groups; and (4) nodorsal ossifications of the maxilla. In addi-tion, the otoglossal cartilage is ring-shapedas in Ambystomatidae (Dunn, 1920; Tihen,1958)

[50] XENOSALAMANDROIDEI NEW TAXON

ETYMOLOGY: Xenos (Greek: strange) 1salamandroidei (Greek: of salamander form),to denote the fact that some of the more ex-otic salamanders (e.g., Nyctanolis, Thorius,and Amphiuma) are in this clade and thatsome of the stranger biogeographical distri-butions of vertebrates on the planet are attri-buted to members of this group (e.g., Hydro-mantes 1 Speleomantes).

IMMEDIATELY MORE INCLUSIVE TAXON: [49]Plethosalamandroidei new taxon.

SISTER TAXON: Rhyacotritonidae Tihen,1958.

RANGE: Extreme southern Alaska andNova Scotia (Canada) south to AmazonianBrazil and central Bolivia; southern Europeand the Korean Peninsula.

CONCEPT AND CONTENT: Xenosalamandro-idei is a monophyletic group containing Am-phiumidae Gray, 1825, and [51] Plethodon-tidae Gray, 1850.

CHARACTERIZATION AND DIAGNOSIS: Xenos-alamandroids share no externally obvioussynapomorphies and have widely divergentlife histories and morphologies (e.g., troglob-itic paedomorphs; large eel-like obligatelyaquatic predators; burrowers; and arborealsalamanders). The two nominal families arealso dissimilar in most aspects of their biol-ogy.

Beyond our molecular evidence (appendix5), the following characters have been sug-gested to be synapomorphies (Larson andDimmick, 1993): (1) maxillae fused (also inNotophthalmus and some Hynobius); and (2)ypsiloid cartilage absent (also absent in sir-enids and Onychodactylus).

FAMILY: AMPHIUMIDAE GRAY, 1825

Amphiumidae Gray, 1825: 216. Type genus: Am-phiuma Garden, 1821.

IMMEDIATELY MORE INCLUSIVE TAXON: [50]Xenosalamandroidei new taxon.

SISTER TAXON: [51] Plethodontidae Gray,1850.

RANGE: Southeastern United States.CONTENT: Amphiuma Garden, 1821.CHARACTERIZATION AND DIAGNOSIS: Am-

phiumas are large, obligately aquatic sala-manders with cylindrical bodies up to 1.16meters in length, tiny legs, and unpleasantdispositions. Transformation is partial, thegills being lost but eyelids never developing.

Beyond our molecular evidence, the fol-lowing morphological characters have beensuggested to be synapomorphies (modifiedfrom Larson and Dimmick, 1993): (1) sep-tomaxilla absent (also absent in some sala-mandrids, Sirenidae, and Cryptobranchidae);(3) first hypobranchial and first ceratobran-chial fused (also in hynobiids); (4) second


ceratobranchial in four elements; and (5)posterior ventral glands absent. Beyond this,their elongate body and tiny limbs are clearlysynapomorphies.

SYSTEMATIC COMMENT: Because Amphiumais clearly the sister taxon of Plethodontidae,under normal circumstances it would be de-sirable to place them in a single family toavoid having a monotypic Amphiumidae.But, because Amphiumidae and Plethodon-tidae have never been considered to consti-tute one nominal family and there is no par-aphyly to be eliminated, little is to be gainedby a nomenclatural change, so we stay withtraditional usage.

[51] FAMILY: PLETHODONTIDAE GRAY, 1850

Plethodontidae Gray, 1850a: 31. Type genus:Plethodon Tschudi, 1838.

Desmognathina Gray, 1850a: 40. Type genus:Desmognathus Baird, 1850.

Oedipina Gray, 1850a: 42. Type genus: OedipusTschudi, 1838.

Ensatinina Gray, 1850a: 48. Type genus: EnsatinaGray, 1850.

Bolitoglossidae Hallowell, 1856: 11. Type Genus:Bolitoglossa Dumeril, Bibron, and Dumeril,1854.

Hemidactylidae Hallowell, 1856: 11. Type Genus:Hemidactylium Tschudi, 1838.

Spelerpinae Cope, 1859: 123. Type Genus: Spe-lerpes Rafinesque, 1832.

Thoriidae Cope, 1869: 110. Type Genus: ThoriusCope, 1869.

Typhlomolgidae Stejneger and Barbour, 1917: 2.Type Genus: Typhlomolge Stejneger, 1896.

IMMEDIATELY MORE INCLUSIVE TAXON: [50]Xenosalamandroidei new taxon.

SISTER TAXON: Amphiumidae Gray, 1825.RANGE: Extreme southeastern Alaska and

Nova Scotia (Canada) south to eastern Braziland central Bolivia; Mediterreanean Europe;southwestern Korea.

CONTENT: Aneides Baird, 1851; Batracho-seps Bonaparte, 1839; Bolitoglossa Dumeril,Bibron, and Dumeril, 1854; BradytritonWake and Elias, 1983; Chiropterotriton Tay-lor, 1944; Cryptotriton Garcıa-Parıs andWake, 2000; Dendrotriton Wake and Elias,1983; Desmognathus Baird, 1850; EnsatinaGray, 1850; Eurycea Rafinesque, 1822 (in-cluding Haideotriton Carr, 1939; see System-atic Comments and new combination in ap-pendix 7); Gyrinophilus Cope, 1869; Hem-

idactylium Tschudi, 1838; HydromantesGistel, 1848; Karsenia Min, Yang, Bonett,Vieites, Brandon, and Wake, 2005; Nototri-ton Wake and Elias, 1983; Nyctanolis Eliasand Wake, 1983; Oedipina Keferstein, 1868;Parvimolge Taylor, 1944; see SystematicComment; Phaeognathus Highton, 1961;Plethodon Tschudi, 1838; PseudoeuryceaTaylor, 1944 (including Ixalotriton Wakeand Johnson, 1989, and Lineatriton Tanner,1950; see Systematic Comments and newcombinations in appendix 7); PseudotritonTaylor, 1944; Speleomantes Dubois, 1984;Stereochilus Cope, 1869; Thorius Cope,1869.

CHARACTERIZATION AND DIAGNOSIS: Pleth-odontids demonstrate a spectacular radiationin the Americas, with representatives alsofound in Mediterranean Europe and one spe-cies on the Korean Peninsula. Plethodontidsare all lungless and uniquely exhibit distinc-tive nasolabial grooves in transformed adults.Most species show direct development,which has arisen within the clade severaltimes (Chippindale et al., 2004). A few lin-eages are perennibranch paedomorphs, butthey are all contained within genera that oth-erwise are composed of salamanders withterrestrial adults.

Beyond our molecular evidence, the fol-lowing morphological characters are likelysynapomorphies (modified from Larson andDimmick, 1993; Larson et al., 2003): (1) lossof stylus from opercular apparatus; (2) peri-otic connective tissue present (also in sala-mandrids); (3) periotic cistern small (also insalamandrids); (4) basilaris complex absent(also absent in proteids and some salaman-drids); (5) recessus amphibiorum with verti-cal orientation (also in Proteidae); (6) palataldentition replacement both laterally and pos-teriorly; and (7) loss of lungs.

SYSTEMATIC COMMENTS: Chippindale et al.(2004) suggested on the basis of their studyof DNA and morphology that two majorgroups could be discerned within Plethodon-tidae: (1) Plethodontinae, including formerDesmognathinae and Plethodontini (Aneides,Desmognathus, Ensatina, Plethodon, andPhaeognathus); and (2) an unnamed taxoncomposed of (a) Hemidactyliinae (Hemidac-tylium); (b) Spelerpinae (Eurycea, Gyrino-philus, Stereochilus, and Pseudotriton); and


(c) Bolitoglossinae (Batrachoseps, Bolito-glossa, Nyctanolis, and Pseudoeurycea).Chippindale et al. (2004) assumed the fol-lowing (which they had not included in theiranalysis) to be in Bolitoglossinae: Chiropter-otriton, Cryptotriton, Dendrotriton, Hydro-mantes, Nototriton, Oedipina, Speleomantes,and Thorius). However, our results and thoseof Mueller et al. (2004) and Macey (2005)suggest that Hydromantes and Speleomantesare not bolitoglossines, but fall inside Pleth-odontinae. Beyond this, the placement ofHemidactylium is problematic. Chippindaleet al. (2004) on the basis of mtDNA andnuDNA and morphology, placed it as the sis-ter taxon of Bolitoglossinae; Mueller et al.(2004), on the basis of a Bayesian analysisof mtDNA, placed it as the sister taxon ofBatrachoseps; Macey (2005), on the basis ofa parsimony analysis of mtDNA, placed it asthe sister taxon of all other plethodontids;and we place it as imbedded in a group com-posed of the traditional Bolitoglossinae andHemidactyliinae. But, our placement of sev-eral of the terminals in this group (notablyBatrachoseps and Hemidactylium) is basedsolely on a fraction of the mtDNA of Macey(2005) and barring differences due to align-ment, our placement of these taxa does notconstitute a strong test of Macey’s (2005)placement of these taxa or, concomitantly, ofthe taxonomy that he adopted. A strong test,of course, would be the analysis, using directoptimization, of all of the data presented byus, Mueller et al. (2004), and by Chippindaleet al. (2004) to see what the preponderanceof evidence actually is. Regardless, the ear-lier taxonomy (e.g., D.B. Wake, 1966) hasbeen specifically rejected.

We consider Lineatriton to be a junior syn-onym of Pseudoeurycea. Parra-Olea (2002)presented DNA sequence evidence for thepolyphyly of Lineatriton and that both ‘‘Li-neatriton’’ lineages rendered Pseudoeuryceaparaphyletic. She also provided DNA se-quence evidence that Parvimolge and Ixalo-triton extended from within a paraphyleticPseudoeurycea. She recommended, but didnot execute, a partition of Pseudoeurycea tomaintain ‘‘Lineatriton’’, Parvimolge, andIxalotrition, that presumably would requirethe recognition of several new genera to pre-serve the two Lineatriton clades (one of

which would require a new name). Inasmuchas a partition of Pseudoeurycea does not ap-pear to be forthcoming in the near future, weprefer to recognize a monophyletic Pseu-doeurycea, which requires the synonymy ofLineatriton and Ixalotriton. (See appendix 7for name changes caused by these genericchanges.) Although our results suggest thatIxalotriton and Parvimolge are outside ofPseudoeurycea, in the first case this conclu-sion is likely an illusion due to sparse taxonsampling. In the case of Parvimolge, our dataplace it outside of this clade and as the sistertaxon to Bolitoglossa, a taxon not in Parra-Olea’s (2002) analysis. We therefore retainParvimolge and regard the clade subtendedby our branch 72 to be Pseudoeurycea. Adensely sampled study including all bolito-glossine taxa (especially Bolitoglossa), andall available evidence, should be the nextstep.

We have been unable to discern any char-acters (see D.B. Wake, 1966) other thanthose related to paedomorphy (such as thosethat formerly distinguished Typhlomolge andTyphlotriton from Eurycea) to distinguish themonotypic Haideotriton Carr, 1939, fromEurycea Rafinesque, 1822. We, like Dubois(2005), regard the former to be a synonymof the latter. Bonett and Chippindale (2004)recently placed Typhlotriton Stejneger, 1892,into the synonymy of Eurycea as well. (Seeappendix 7 for new combinations producedby these generic changes.) As noted in ‘‘Re-sults’’, the status of Plethodon is equivocalinasmuch as our evidence suggests its para-phyly, but more densely sampled studiesbased on more and different assortments ofevidence (Chippindale et al., 2004; Macey,2005) suggest its monophyly.

[74] ANURA FISCHER VON WALDHEIM, 1813

Anuri Fischer von Waldheim, 1813: 58. Latini-zation and reranking of Anoures of A.M.C. Du-meril, 1806 (which was coined explicitly as afamily and therefore unavailable for regulatednomenclature). Emended to Anura by Hogg,1839a: 270. (See appendix 6 for nomenclaturalnote.)

IMMEDIATELY MORE INCLUSIVE TAXON: [23]Batrachia Latreille, 1825.

SISTER TAXON: [24] Caudata Fischer vonWaldheim, 1813.


RANGE: Worldwide in tropical to cold-tem-perate habitats, excluding Antarctica andmost oceanic islands.

CONCEPT AND CONTENT: Anura Fischer vonWaldheim, 1813, is a monophyletic groupcontaining all living frogs (i.e., [75] Leio-pelmatidae Mivart, 1869, and [77] Lalago-batrachia new taxon).

CHARACTERIZATION AND DIAGNOSIS: Frogsare so distinctive among tetrapods that littleintroduction is required. Among frogs, how-ever, there is enormous variation in mor-phology, behavior, reproductive mode, andlife-history. Plesiomorphically, frogs exhibitthe textbook amphibian biphasic life history,with an aquatic tadpole transforming to anair-breathing adult. However, many speciesof frogs exhibit mild to extreme variationson this theme, with many exhibiting directdevelopment within the egg capsule (e.g.,Eleutherodactylus) and others bearing the de-veloping young in dermal vacuities on thedorsum (Pipa), in vocal sacs (Rhinoderma),or even in the stomach (Rheobatrachus).

Beyond our molecular data, the followingmorphological characteristics have been sug-gested to be synapomorphies of this group(Trueb and Cloutier, 1991; Ford and Canna-tella, 1993): (1) loss of prefrontal bone; (2)loss of prearticular bone; (3) loss of a pala-tine (reversed in Acosmanura); (4) reductionof vertebrae to nine or fewer; (5) atlas witha single centrum; (6) first spinal nerve exitsfrom spinal nerve canal via intervertebral fo-ramen; (7) fusion of caudal vertebral seg-ments into a urostyle; (8) hindlimbs signifi-cantly longer than forelimbs (with excep-tions), including elongation of ankle bones;(9) fusions of radius and ulna and tibia andfibula; (6) fusion of hyobranchial elementsinto a hyoid plate; (10) presence of kerati-nous jaw sheaths and keratodonts on larvalmouthparts (lost in some lineages); (11) asingle median spiracle in the larva (a char-acteristic of Type III tadpoles—this beinghighly contingent on phylogenetic structure);and (12) skin with large subcutaneous lymphspaces; (13) two m. protractor lentis attachedto lens (based on very narrow taxon sam-pling; Saint-Aubain, 1981; Ford and Canna-tella, 1993).

In addition, Haas (2003) reported 19 un-ambiguous synapomorphies from larval mor-

phology, several of which appear to be re-lated to the major evolutionary step in anuranlarvae—suspension feeding—whereas othershave no apparent relation to feeding ecology:(1) operculum fused to abdominal wall (Haas16.1); (2) m. geniohyoideus origin from cer-atobranchials I/II (Haas 19.1); (3) m. inter-hyoideus posterior absent (Haas 23.0); (4)larval jaw depressors originate from palato-quadrate (Haas 42.1); (5) ramus maxillaris(cranial nerve V2) medial to the muscle (m.levator manidbulae longus; Haas 63.1); (6)ramus mandibularis (cranial nerve V3) ante-rior (dorsal) to the m. levator mandibulaelongus (Haas 64.2); (7) ramus mandibularis(cranial nerve V3) anterior (dorsal) to the ex-ternus group (Haas 65.2); (8) cartilago labi-alis superior (suprarostral cartilage) present(Haas 84.1; (9) two perilymphatic foramina(Haas 97.1); (10) hypobrachial skeletal partsas planum hypobranchiale (Haas 104.1); (11)processus urobranchialis short, not reachingbeyond the hypobranchial plates (Haas108.1); (12) commisura proximalis present(Haas 109.1); (13) commisura proximalis IIpresent (Haas 110.1); (14) commisura prox-imalis III present (Haas 111.1); (15) cerato-hyal with diarthrotic articulation present, me-dial part broad (Haas 115.1); (16) cleft be-tween hyal arch and branchial arch I closed(Haas 123.0); (17) ligamentum cornuquad-ratum present (Haas 125.1); (18) ventral val-vular velum present (Haas 128.1); and (19)branchial food traps present (Haas 134.1).

Haas (2003) also suggested that the fol-lowing are nonlarval synapomorphies notmentioned as such by Ford and Cannatella(1993): (1) amplexus present (Haas 138.1);(2) vertical pupil shape (Haas 143.0); (3)clavicle overlapping scapula anteriorly (Haas145.1); (4) cricoid as a closed ring (Haas148.1); and (5) tibiale and fibulare elongateand fused at ends (Haas 150.1).

In addition, the following optimize as syn-apomorphies (Trueb and Cloutier, 1991) ofSalientia (5 Proanura [fossil taxon] 1 Anu-ra): (1) loss of lacrimal bone; (2) presence ofa frontoparietal bone; (3) long and slenderilium; and (4) ribs unicapitate (also in Cryp-tobranchoidei).

[75] FAMILY: LEIOPELMATIDAE MIVART, 1869

Liopelmatina Mivart, 1869: 291. Type genus: Lio-pelma Gunther, 1869. Emended to Leiopelma-


tidae by N.G. Stephenson (1951: 18–28); Lio-pelmatina considered an incorrect originalspelling and Leiopelmatidae placed on the Of-ficial List of Family-Group Names in Zoologyby Opinion 1071 (Anonymous, 1977: 167).

Ascaphidae Fejervary, 1923: 178. Type genus:Ascaphus Stejneger, 1899.

IMMEDIATELY MORE INCLUSIVE TAXON: [74]Anura Fischer von Waldheim, 1813.

SISTER TAXON: [77] Lalagobatrachia newtaxon.

RANGE: New Zealand; Pacific northwest-ern United States and adjacent Canada.

CONTENT: Ascaphus Stejneger, 1899;Leiopelma Fitzinger, 1861.

CHARACTERIZATION AND DIAGNOSIS: Leio-pelmatidae is a group of pervasively ple-siomorphic frogs, in many aspects of theiranatomy, including vertical pupils (likely asynapomorphy of frogs), retention of shortribs in adults, and amphicoelous vertebrae.Nevertheless, they are apomorphic in manyways, including highly derived, high gradi-ent-adapted tadpoles in Ascaphus; and nidic-olous endotrophy to direct development inLeiopelma. Ascaphus is unique among frogsin having an intromittent organ.

In addition to our molecular evidence, alikely synapomorphy of Leiopelmatidae isloss of columella. Presence of an accessorycoccygeal head of the m. semimembranosus(Ritland, 1955; observationally equivalent tothe m. caudalipuboischiotibialis of other au-thors, although not homologous if so named)may be synapomorphic, but plesiomorphicretention of the m. caudalopuboischiotibialisis also consistent with our cladogram.

Larval characters in our analysis (fromHaas, 2003) that optimize on the Ascaphusbranch may be characters solely of Ascaphusor may be synapomorphies of Leiopelmati-dae (although possibly further modified with-in the endotrophy of Leiopelma). These char-acters are (1) larval subdermal serous glandspresent (Haas 2.1); (2) three heads of the m.subarcualis obliquus originates from cerato-branchialia II, III, and IV (Haas 31.2); (3)larval m. levator mandibulae externus insertson soft tissue (Haas 55.2); (4) larval m. le-vator mandibular internus inserts broadlyacross the jaw articulation (Haas 59.2); (5)distal end of cartilago meckeli broad and flatwith processus dorsomedialis absent and

without a fossa (Haas 94.3); (6) processuspostcondylaris of ceratohyals present (Haas118.1, shared with Alytes and Discoglossus);(7) intracranial endolymphatic system withanterior recessus ascendens present (Haas122.1, also present in Alytes, and Acosman-ura); and (8) larval lungs present and func-tional (Haas 133.1).

SYSTEMATIC COMMENTS: Ascaphus andLeiopelma had long been associated witheach other in Leiopelmatidae (e.g., Noble,1931), but were placed in different familiesby Savage (1973) on biogeographic groundsand by subsequent authors (Ford and Can-natella, 1993; Green and Cannatella, 1993)on the basis of suggested paraphyly with re-spect to all other frogs. We return them tothe same family-group taxon (as had Roe-lants and Bossuyt, 2005; but against thejudgment of D.M. Green) to avoid havingmonotypic families and to recognize that theonly reason for treating Ascaphus and Leio-pelma as representing separate families—thatthey are not each other’s closest living rela-tives—has not survived testing.

Characters suggested by Ford and Canna-tella (1993) to unite Leiopelma with all frogs,excluding Ascaphus, must be considered ei-ther convergences between Leiopelma and allother non-Ascaphus frogs, or characters thatare apomorphies of Anura that have beensecondarily lost in Ascaphus: (1) elongatearms on the sternum; (2) loss of the ascend-ing process of the patalatoquadrate; (3) sphe-nethmoid ossifying in the anterior position;(4) root of the facial nerve exits the braincasethrough the facial foramen, anterior to theauditory capsule, rather than via the anterioracoustic foramen into the auditory capsule(Slabbert and Maree, 1945; N.G. Stephenson,1951); and (5) palatoquadrate articulationwith the braincase via a pseudobasal process,rather than a basal process (Pusey, 1943).

[77] LALAGOBATRACHIA NEW TAXON

ETYMOLOGY: Lalago (Greek: calling) 1batrachos (Greek: frog), in reference to thefact that the frogs of the sister taxon of Lal-agobatrachia, Leiopelmatidae, do not call,whereas the vast majority of the Lalagoba-trachia have a wide variety of calls. Althoughit may be that vocal behavior is not a syna-


pomorphy of this taxon, it certainly is char-acteristic.

IMMEDIATELY MORE INCLUSIVE TAXON: [74]Anura Fischer von Waldheim, 1831.

SISTER TAXON: [75] Leiopelmatidae Mi-vart, 1869.

RANGE: Coextensive with the range of An-ura, excluding New Zealand.

CONCEPT AND CONTENT: LalagobatrachiaFischer von Waldheim, 1813, is a monophy-letic group containing [78] Xenoanura Sav-age, 1973, and [84] Sokolanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Mem-bers of Lalagobatrachia are the familiar frogsof pools and streams, forests and meadows,desert, and canyons throughout the world. Aswith Anura, morphological and life-historydiversity is so great that it defies detailed de-scription.

Larval characters (Haas, 2003) that opti-mize to this branch are (1) m. transversusventralis IV absent (Haas 22.1, reversed else-where but also absent in Heleophryne, Hem-isus, and hyperoliids among the taxa thatHaas studied); (2) single m. subarcualis ob-liquus originates from ceratobranchial II(Haas 31.0); (3) insertion of the m. rectuscervicis at the processus branchiales II or III(Haas 39.1); (4) m. hyoangularis present(Haas 43.1); (5) m. levator mandibulae in-ternus anterior (Haas 58.1); (6) m. levatormandibulae longus originates from posteriorpalatoquadrate (Haas 60.1); and (7) and pal-atoquadrate connection to trabecula craniirostral (Haas 69.1).

The synapomorphies associated with Dis-coglossanura of Ford and Cannatella (1993)optimize on this branch as well (with reversalin Bombinatoridae): (1) bicondylar sacrococ-cygeal articulation; and (2) episternum pre-sent.

Several characters suggested by Ford andCannatella (1993) as synapomorphies of theirPipanura would optimize on our tree alter-natively as synapomorphies of Lalagobatra-chia and reversed in Costata (Alytidae 1Bombinatoridae), or independently derivedin Xenoanura (Pipidae 1 Rhinophrynidae)and Acosmanura (Anomocoela 1 Neobatra-chia). These characters are (1) torsion of car-pal elements; (2) absence of free ribs inadults; (3) presence of vocal sacs; and (4)fusion of the trigeminal and facial ganglia.

Ford and Cannatella (1993) had also includ-ed the Type IV tadpole as a synapomorphyof Pipanura; however, besides the fact thatOrton’s larval types are not characters bythemselves but a complex mosaic of multi-ple, independent character transformations,the Type I tadpole of Xenoanura is most par-simoniously derived from the Type III tad-pole of Costata and Ascaphus, with the TypeIV tadpole a synapomorphy of Acosmanura.

In addition, Abourachid and Green (1999)noted that members of this taxon swim withcoordinated thrusts of the hind legs ratherthan alternating sweeps, as in Leiopelmati-dae. We think that this character may well bea unique and unreversed synapomorphy ofLalagobatrachia.

[78] XENOANURA SAVAGE, 1973

Xenoanura Savage, 1973: 352. (See appendix 6for nomenclatural comment.)

IMMEDIATELY MORE INCLUSIVE TAXON: [77]Lalagobatrachia new taxon.

SISTER TAXON: [84] Sokolanura new tax-on.

RANGE: Tropical Africa and South Amer-ica, north to southern North America.

CONCEPT AND CONTENT: Xenoanura Sav-age, 1973, is a monophyletic crown taxoncontaining [79] Pipidae Gray, 1825, andRhinophrynidae Gunther, 1859 ‘‘1858’’ (andpresumably a number of fossil taxa internalto this clade, including palaeobatrachids;Savage, 1973; cf. Ford and Cannatella,1993).

CHARACTERIZATION AND DIAGNOSIS: Thehighly aquatic bizarre pipids and equallystrange, but terrestrial, Rhinophrynus sharethe distinctive Type I tadpole (Orton, 1953;Starrett, 1973).

Several characters of larval morphology(originally from Haas, 2003) used in ouranalysis optimize on this branch: (1) eye po-sition lateral (Haas 11.1); (2) opercular canalabsent and spiracle paired (Haas 17.0); (3)m. constrictor branchialis I absent (Haas27.0); (4) m. levator mandibulae internus an-terior (Haas 58.2); (5) m. levator mandibulaelongus originates exclusively from the arcussuborcularis (Haas 60.2); (6) posterolateralprojections of the crista parotica are expan-sive flat chondrifications (Haas 67.2); (7) ar-


cus subocularis with a distinct processus la-teralis posterior projecting laterally from theposterior palatoquadrate (Haas 81.3); (8) ar-ticulation of cartilago labialis superior withcornu trabeculae fused into rostral plate(Haas 85.2); and (9) forearm erupts out oflimb pouch outside peribranchial space (Haas132.0).

Characters suggested by Ford and Canna-tella (1993) in support of their Mesobatrachia(Xenoanura 1 Anomocoela) are on our to-pology required to be convergent in their Pi-poidea (our Xenoanura) and their Pelobato-idea (our Anomocoela), and they are there-fore independent apomorphies for eachgroup: (1) closure of the frontoparietal fon-tanelle by juxtaposition of the frontoparietalbones; (2) partial closure of the hyoglossalsinus by the ceratohyals; (3) absence of thetaenia tecti medialis; and (4) absence of thetaenia tecti transversum (Sokol, 1981).

Characters that Ford and Cannatella(1993) listed as apomorphies of their Pipo-idea also optimize on this branch: (1) lack ofmentomeckelian bones; (2) absence of lateralalae of the parasphenoid; (3) fusion of thefrontoparietals into an azygous element; (4)greatly enlarged otic capsule; (5) tadpolewith paired spiracles and lacking keratinizedjaw sheaths and keratodonts (Type I tadpole).J.D. Lynch (1973: 169) reported Rhino-phrynidae to have opisthocoelous vertebrae,in which case opisthocoely may be a syna-pomorphy of Xenoanura (and independentlyof Costata), or alternatively opisthocoelymay be a character of Lalagobatrachia andsubsequently modified at the level of Acos-manura.

Xenoanura in our sense is coextensivewith the Recent content of the redundantranks Pipoidia Gray, 1825 (epifamily) andPipoidea Gray, 1825 (superfamily) of Dubois(2005).

[79] FAMILY: PIPIDAE GRAY, 1825

Piprina Gray, 1825: 214. Type genus: ‘‘PipraLaurent’’ (5 Pipa Laurenti, 1768). Incorrectoriginal spelling.

Dactylethridae Hogg, 1838: 152. Type genus:Dactylethra Cuvier, 1829.

Astrodactylidae Hogg, 1838: 152. Type genus:Astrodactylus Hogg, 1838 (5 AsterodactylusWagler, 1827).

Xenopoda Fitzinger, 1843: 33. Type genus: Xen-opus Wagler, 1827.

Hymenochiridae Bolkay, 1919: 348. Type genus:Hymenochirus Boulenger, 1896.

Siluraninae Cannatella and Trueb, 1988: 32. Typegenus: Silurana Gray, 1864.

IMMEDIATELY MORE INCLUSIVE TAXON: [78]Xenoanura Savage, 1973.

SISTER TAXON: Rhinophrynidae Gunther,1859 ‘‘1858’’.

RANGE: South American and Panamaniantropics; sub-Saharan Africa.

CONTENT: Hymenochirus Boulenger,1896; Pipa Laurenti, 1768; Pseudhymeno-chirus Chabanaud, 1920; Silurana Gray,1864; Xenopus Wagler, 1827.

CHARACTERIZATION AND DIAGNOSIS: Pipidsare highly aquatic frogs that have inguinalamplexus and that vocalize using the hyoidapparatus to make clicks (Rabb, 1960), acharacteristic that is likely synapomorphic.Pipids share with Rhinophrynidae the dis-tinctive Type I tadpole (Orton, 1953, 1957;Starrett, 1973) but are highly apomorphicwith respect to that group. Morphologicalcharacters (from Haas, 2003) addressed inour analysis provided a large number of lar-val and adult synapomorphies: (1) interbran-chial septum invaded by lateral fibers of them. subarcualis rectus I–IV (Haas 29.2); (2)anterior insertion of the m. subarcualis rectusII–IV on ceratobranchial III (Haas 37.2); (3)commissurae craniobranchiales present(Haas 75.1); (4) one perilymphatic foramenon the otic capsule (Haas 97.0); (5) ventralcentra formation perichordal (Haas 99.1; butsee Systematic Comment under Xenoanura);(6) free basihyal present (Haas 105.0); (7)processus urobranchialis absent (Haas108.0); (8) ventral valvular velum absent(Haas 128.0); (9) advertisement call withoutairflow (Haas 140.3); (10) pupil shape round(Haas 143.3); (11) shoulder girdle with epi-coracoids abutting and functionally fixed(Haas 144.2); (12) tongue absent (Haas149.0).

Ford and Canntella (1993) provided 11characters in support of the monophyly ofthis group, although we are not sure of thecharacter optimization of all of them becausethese authors did not provide a character ma-trix and our different placement of this taxonwithin Anura may have resulted in some


reoptimization: (1) lack of a quadratojugal;(2) presence of an epipubic cartilage; (3) un-paired epipubic muscle; (4) free ribs in lar-vae; (5) fused articulation between coccyxand sacrum; (6) short stocky scapula; (7)elongate septomaxillary bones; (8) ossifiedpubis; (9) a single median palatal opening ofthe eustachian tube; (10) lateral line organspersisting in adults; and (11) loss of tongue.

Baez and Trueb (1997) added to this list(fossil taxa pruned for purposes of this dis-cussion): (1) the possession of an optic fo-ramen with a complete bony margin formedby the sphenethmoid; (2) anterior ramus ofthe pterygoid arises near the anteromedialcorner of the otic capsule; (3) parasphenoidfused at least partially with the overlyingbraincase; (4) vomer lacks an anterior pro-cess, if the bone is present; (5) mandiblebears a broad-based, bladelike coronoid pro-cess along its posteromedial margin; (6) ster-nal end of the coracoid not widely expanded;(7) anterior ramus of pterygoids dorsal withrespect to the maxilla; and (8) premaxillaryalary processes expanded dorsolaterally.

Finally, Burton (1998a) suggested that thedorsal origin of the mm. flexores teretes IIIand IV relative to the corresponding mm.transversi metacarpum I and II is a synapo-morphy.

SYSTEMATIC COMMENT: Our data do notsupport the recognition of sister-subfamiliesPipinae Gunther, 1859 ‘‘1858’’ (Hymenochi-rus, Pseudhymenochirus, and Pipa) and Dac-tylethrinae Hogg, 1839 (Silurana and Xeno-pus), as found by de Sa and Hillis (1990) andBaez and Pugener (2003). Instead, our dataindicate that Hymenochirus (a member ofnominal Pipinae) is the sister taxon of theremainder of Pipinae 1 Dactylethrinae.

FAMILY: RHINOPHRYNIDAE GUNTHER,1859 ‘‘1858’’

Rhinophrynina Gunther, 1859 ‘‘1858’’: xiv. Typegenus: Rhinophrynus Dumeril and Bibron,1841.

IMMEDIATELY MORE INCLUSIVE TAXON: [78]Xenoanura Savage, 1971.

SISTER TAXON: [79] Pipidae Gunther, 1859‘‘1858’’.

RANGE: Tropical and subtropical lowlandNorth and Central America.

CONTENT: Rhinophrynus Dumeril and Bi-bron, 1841.

CHARACTERIZATION AND DIAGNOSIS: Rhino-phrynidae contains a single species, Rhino-phrynus dorsalis, which is of medium-size,with a cone-shaped head and globular body,reflecting its burrowing life history. Like thepipids, it has inguinal amplexus and a TypeI tadpole (Orton, 1953; J.D. Lynch, 1973).

Several larval characters in our analysisoptimize as synapomorphies of this group:(1) m. geniohyoideus lost (Haas 19.5); (2) m.levator mandibulae externus present in twoportions (profundus and superficialis; Haas54.1); (3) ramus mandibularis (of cranialnerve V3; Haas 65.0); (4) larval ribs absent,the feature convergent with the condition inLalagobatrachia (Haas 102.0); (5) processusurobranchialis reaching far beyond hyobran-chial plates (Haas 108.2); (6) endolymphaticspaces extend into more than half of verte-bral canal (presacral vertebrae IV or beyond;Haas 121.1); (7) branchial food traps dividedand crescentic (Haas 135.1); and (8) cartilag-inous cricoid ring with a dorsal gap (Haas148.3). In addition, Rhinophrynus has lostribs in the adults.

Ford and Cannatella (1993, followingHenrici, 1991) suggested the following assynapomorphies of the group: (1) division ofthe distal condyle of the femur into lateraland medial condyles; (2) modification of theprehallux and distal phalanx of the first digitinto a spade for digging; (3) tibiale and fi-bulare short and stocky, with distal endsfused; (4) an elongate atlantal neural arch;and (5) sternum absent. Although these char-acters are not available in matrix form, pre-cluding careful evaluation of level of univer-sality, we have no reason to doubt these sug-gestions.

[84] SOKOLANURA NEW TAXON

ETYMOLOGY: Sokol (Otto Sokol) 1 anoura(Greek: tailless, i.e., frog). We commemorateOtto Sokol with this name. Dr. Sokol was ananatomist of great talent who would havecontinued to make important contributions tocomparative larval anatomy had his life notbeen cut short by a tragic automobile acci-dent. (See appendix 6 for nomenclaturalnote.)


IMMEDIATELY MORE INCLUSIVE TAXON: [77]Lalagobatrachia new taxon.

SISTER TAXON: [78] Xenoanura Savage,1973.

RANGE: Coextensive with Anura, exclud-ing New Zealand.

CONCEPT AND CONTENT: Sokolanura is amonophyletic taxon composed of [85] Cos-tata Lataste, 1879, and [91] AcosmanuraSavage, 1973.

CHARACTERIZATION AND DIAGNOSIS: Larvalmorphological synapomorphies (from Haas,2003) optimized by our analysis on thisbranch are (1) m. mandibulolabialis present(Haas 48.1); upper jaw cartilages powered byjaw muscles (Haas 53.1); (2) main part oflarval m. levator mandibulae externus insertson on upper jaw cartilages (Haas 55.1); (3)insertion of the larval m. levator mandibulaeinternus is lateral to jaw articulation (Haas59.1); (4) m. levator mandibulae longus intwo portions (profundus and superficialis;Haas 61.1); (5) processus muscularis on thelateral margin of the palatoquadrate present(Haas 79.1); and (6) ligamentum mandibu-losuprarostrale present (Haas 127.1).

[85] COSTATA LATASTE, 1879

Costati Lataste, 1879: 339. Emended to Costataby Stejneger, 1907: 49. (See appendix 6 for no-menclatural note.)

IMMEDIATELY MORE INCLUSIVE TAXON: [84]Sokolanura new taxon.

SISTER TAXON: [91] Acosmanura Savage,1973.

RANGE: Western Europe, North Africa, andIsrael, possibly into Syria; east to easternRussia and Turkey, China, Korea, and north-ern Indochina; Borneo (western Kalimantan,Indonesia), and the Philippines.

CONCEPT AND CONTENT: Costata Lataste,1879, is a monophyletic group containing[86] Alytidae Fitzinger, 1843, and [88] Bom-binatoridae Gray, 1825.

CHARACTERIZATION AND DIAGNOSIS: Mem-bers of Costata are relatively small, unre-markable frogs in external appearance, whichexhibit the typically biphasic life history viaa Type III larva with postmetamorphs retain-ing ribs (Noble, 1931; J.D. Lynch, 1973; Zuget al., 2001). Larval characters (Haas, 2003)that optimize unambiguously in our analysis

on this branch are (1) origin of m. interman-dibularis restricted to the medial side of thecartilago meckeli corpus (Haas 52.1); (2) lar-val m. levator mandibulae externus in twoparts (profundus and superficialis; Haas54.1); (3) posterior processes of the pars alar-is double (Haas 88.0); (4) vertebral centralformation epichordal (Haas 99.1); and (5)processus urobranchialis absent (Haas108.0).

Costata is also characterized by opistho-coelous vertebrae, which is found in Xe-noanura (J.D. Lynch, 1973), making it eithera synapomorphy of Lalagobatrachia and sub-sequently modified at the level of Acosman-ura, or nonhomologous synapomorphies.

SYSTEMATIC COMMENTS: We could havecombined Alytidae and Bombinatoridae as asingle family with two subfamilies, but ratherthan continue an arbitrary rank controversy,we retain Alytidae and Bombinatoridae asfamilies for the sake of continuity of dis-course (but see comments by Dubois, 2005).Costata in our sense is identical in Recentcontent to the redundant taxa Bombinatoro-idia Gray, 1825 (epifamily), Bombinatoro-idea Gray, 1825 (superfamily, and Bombi-natoridae (family) of Dubois (2005).

[86] FAMILY: ALYTIDAE FITZINGER, 1843

Alytae Fitzinger, 1843: 32. Type genus: AlytesWagler, 1829.

Colodactyli Tschudi, 1845: 167. Type genus: Col-odactylus Tschudi, 1845 (5 Discoglossus Otth,1837).

Discoglossidae Gunther, 1858b: 346. Type genus:Discoglossus Otth, 1837. (See appendix 6 fornomenclatural comment.)

IMMEDIATELY MORE INCLUSIVE TAXON: [85]Costata Lataste, 1879.

SISTER TAXON: [88] Bombinatoridae Gray,1825.

RANGE: Western Europe, North Africa, andIsrael, possibly into Syria.

CONTENT: Alytes Wagler, 1830; Discoglos-sus Otth, 1837.

CHARACTERIZATION AND DIAGNOSIS: Alyti-dae represents small frogs that reproduce viatypical Type III pond-type larvae that post-metamorphically retain ribs and are generallyfound around water, with Alytes being moreterrestrial than Discoglossus (Noble, 1931;J.D. Lynch, 1973).


Haas (2003) did not consider our Alytidaeto have synapomorphies, because his shortesttree placed Alytes as the sister taxon of Dis-coglossus 1 Bombina. Nevertheless, com-bined with our molecular data, the larvalcharacters from Haas study that optimize onthis branch are (1) admandibular cartilagepresent (Haas 95.1, also found in Heleophry-ne); and (2) processus postcondylaris of cer-atohyal present (Haas 118.1). As noted underLalagobatrachia, characters suggested byFord and Cannatella (1993) to be synapo-morphies of Discoglossanura are here con-sidered to be synapomorphies of Lalagoba-trachia, with reversal of these in Bombina-toridae: (1) monocondylar sacrococcygeal ar-ticulation; and (2) episternum absent. Fordand Cannatella (1993) also suggested that V-shaped parahyoid bones (convergent in Pe-lodytes) and a narrow epipubic cartilage plateare synapomorphies of this taxon.

SYSTEMATIC COMMENTS: Haas (2003) sug-gested that Alytes is the sister taxon of Dis-coglossus 1 Bombina on the basis of threecharacters (epidermal melanocytes irregularin shape and not forming reticulaton [Haas1.1], inspiratory advertisement call [Haas140.1]; and pupil shape triangular [Haas143.2]) considered to be synapomorphies ofDiscoglossus 1 Bombina. Nevertheless,placing Alytes as the sister taxon of Discog-lossus requires only two additional steps inhis data set.

[88] FAMILY: BOMBINATORIDAE GRAY, 1825

Bombinatorina Gray, 1825: 214. Type genus:Bombinator Merrem, 1820.

Bombitatores Fitzinger, 1843: 32. Type genus:Bombitator Wagler, 1830.

Bombininae Fejervary, 1921: 25. Type genus:Bombina Oken, 1816.

IMMEDIATELY MORE INCLUSIVE TAXON: [85]Costata Latste, 1879.

SISTER TAXON: [86] Alytidae Fitzinger,1843.

RANGE: France and Italy east to westernRussia and Turkey; China, Korea, and north-ern Indochina; Borneo and the Philippines.

CONTENT: Barbourula Taylor and Noble,1924; Bombina Oken, 1816.

CHARACTERIZATION AND DIAGNOSIS: Mem-bers of Bombinatoridae are distinctive aquat-

ic frogs that are generally brightly coloredventrally (less so in Barbourula) and exhibita typically biphasic life history (unknown inBarbourula). Like Alytidae, they have TypeIII larvae. Postmetamorphs retain ribs (No-ble, 1931; J.D. Lynch, 1973). The only mor-phological synapomorphy from our analysis(originally from Haas, 2003) that optimizeson this branch is m. mandibulolabialis su-perior present (Haas 50.1).

The implication of our topology is that thetwo characters suggested by Ford and Can-natella (1993) as synapomorphies of Discog-lossanura (bicondylar sacrococcygeal articu-lation and episternum present) optimize toLalagobatrachia, with a loss in Bombinato-ridae (Bombina 1 Barbourula). Bombinato-ridae was suggested (Ford and Cannatella,1993) to have as synapomorphies (1) an ex-panded flange of the quadratojugal; and (2)presence of enchochondral ossifications inthe hyoid plate.

[91] ACOSMANURA SAVAGE, 1973

Acosmanura Savage, 1973: 354. (See appendix 6for nomenclatural comment.)

IMMEDIATELY MORE INCLUSIVE TAXON: [84]Sokolanura new taxon.

SISTER TAXON: [85] Costata Lataste, 1879.RANGE: Coextensive with Anura, exclud-

ing New Zealand.CONCEPT AND CONTENT: Acosmanura Sav-

age, 1973, is, as originally conceived, amonophyletic group containing [92] Anom-ocoela Nicholls, 1916, and [105] Neobatra-chia Reig, 1958.

CHARACTERIZATION AND DIAGNOSIS: As no-ted by Starrett (1973), Acosmanura is char-acterized by a Type IV tadpole, differingfrom the ancestral Type III tadpole (of Leio-pelmatidae and Costata) in having a sinistralspiracle in the larvae, although there are oth-er character differences (summarized below).

Beyond the molecular synapomorphies ofthe group, several larval morphological char-acters in our analysis (from Haas, 2003) op-timized on this branch: (1) labial ridge witha single row of keratodonts (Haas 4.0); (2)paired venae caudales laterales long (Haas15.1); (3) spiracle position sinistral (Haas18.1, also in Scaphiophryne); (4) m. subar-cualis rectus I portion with origin from cer-


atobranchial II present (Haas 34.1); (5) in-sertion site of the m. subarcualis rectus I onthe ventral muscle portion lateral (Haas35.1); (6) anterior insertion of m. subarcualisrectus II–IV on ceratobranchial II (Haas37.1); (7) m. suspensoriohyoideus present(Haas 45.1); (8) m. interhyoideus and m. in-termandibularis well separated by a gap(Haas 47.1); (9) functional larval m. levatormandibulae lateralis present (Haas 56.1; lostin Gastrotheca); (10) articulation of cartilagolabialis superior with cornua trabeculae bypars alaris (Haas 85.1); (11) larval ribs ab-sent (Haas 102.0; also in Rhinophrynus); (12)commissura proximalis I absent (Haas 109.0;109.1 in microhylids); (13) spicula presentand long (Haas 112.1; lost in Ceratophrys 1Lepidobatrachus and independently gainedin Alytes); (14) anterior processus ascendensof intracranial endolymphatic system present(Haas 122.1; also in Ascaphus, Alytes); (15)ligamentum cornuquadratum inserting oncornu trabeculae (Haas 126.1; reversed inCeratophrys); (16) clavicula in adult notoverlapping (Haas 145.2; see also J.D.Lynch, 1973: 147); (17) palatine bones pres-ent (Haas 146.1; independently lost in sev-eral groups, including microhylids, and den-drobatids).

SYSTEMATIC COMMENTS: Presence of a(neo)palatine bone as a synapomorphy ofAcosmanura could be seen as controversial.It is not controversial that a palatine is char-acteristic of Neobatrachia, but its presence inAnomocoela is. Some authors favored theview that the palatine develops in pelobatids(sensu lato) but later fuses to the maxilla(Zweifel, 1956; Kluge, 1966; Estes, 1970);others have asserted that the palatine is fusedwith either the vomer or maxilla (Jurgens,1971; Rocek, 1981 ‘‘1980’’). Wiens (1989)suggested that the palatine never forms, atleast not in Spea. Hall and Larsen (1998) dis-cussed the issue and provided evidence thatpalatine centers of ossification do exist inSpea and in other anomocoelans. Without ev-idence that the ‘‘palatine’’ center of ossifi-cation in anomocoelans is anything otherthan the palatine, Hennig’s auxiliary princi-ple (Hennig, 1966) suggests that we acceptit as homologous with the palatine of neo-batrachians.

J.D. Lynch (1973) noted that Leiopelma-

tidae is notochordal/amphicoelous; that Xe-noanura and Costata exhibit opisthocoelousvertebrae; and that Anomocoela and more‘‘basal’’ groups within Hyloides have inter-vertebral bodies unfused to the centra, atleast in subadults. (Sooglossidae most likelyhas amphicoelous vertebrae as an apomorphyat that level of universality.) Much workneeds to be accomplished, but currently it ap-pears that the fusion of intervertebral bodieshas taken place in Hyloides and Ranoides in-dependently.

[92] ANOMOCOELA NICHOLLS, 1916

Anomocoela Nicholls, 1916: 86.

IMMEDIATELY MORE INCLUSIVE TAXON: [91]Acosmanura Savage, 1973.

SISTER TAXON: [105] Neobatrachia Reig,1958.

RANGE: Southern Canada and UnitedStates south to south-central Mexico; Europeand northwestern Africa; western Asia totropical southeastern Asia southeast to theGreater Sunda Islands.

CONCEPT AND CONTENT: Anomocoela Nich-olls, 1916, is here conceived as originallyformed, a monophyletic group containing[96] Pelobatoidea Bonaparte, 1850, and [93]Pelodytoidea Bonaparte, 1850.

CHARACTERIZATION AND DIAGNOSIS: Onlyone of the morphological characters in ouranalysis optimized on this branch: partes cor-pores medially separate (Haas 87.0).

Characters suggested by Ford and Canna-tella (1993) in support of their Pelobatoidea(our Anomocoela) are (1) sternum ossifiedinto a bony style, and (2) pupil vertical (ple-siomorphic for Anura and possibly here; con-vergent with phyllomedusine and some pe-lodryadine hylids and Africanura, exceptBrevicipitidae and Hyperoliidae).

Characters suggested by Ford and Canna-tella (1993) in support of their Mesobatrachiawe found to be convergent in their Pipoidea(our Xenoanura) and their Pelobatoidea (ourAnomocoela), and therefore independentapomorphies for each group: (1) closure ofthe frontoparietal fontanelle by juxtapositionof the frontoparietal bones; (2) partial closureof the hyoglossal sinus by the ceratohyals;(3) absence of the taenia tecti medialis; and(4) absence of the taenia tecti transversum


(Sokol, 1981). We have some reservations,however, because the characters were notpresented in matrix form so we are not sureof the distribution of any of these charactersaway from their Mesobatrachia. J.D. Lynch(1973: 148) provided a character distributionthat suggests a dorsally incomplete cricoidring as a synapomorphy at this level (con-vergent in Rhinophrynus).

SYSTEMATIC COMMENT: The monophyly ofthis group seems assured and the reason formaintaining four families within it, ratherthan having a single larger Pelobatidae, isthat no clarity is gained by changing the cur-rent taxonomy (contra Dubois [2005: 3], whoaggregated the content as four subfamilieswithin a larger Pelobatidae).

[93] SUPERFAMILY: PELODYTOIDEABONAPARTE, 1850

IMMEDIATELY MORE INCLUSIVE TAXON: [92]Anomocoela Nicholls, 1916.

SISTER TAXON: [96] Pelobatoidea Bonapar-te, 1850.

RANGE: Southwestern Europe and the Cau-casus; southern Canada and United Statessouth to south-central Mexico.

CONTENT: Pelodytidae Bonaparte, 1850,and [94] Scaphiopodidae Cope, 1865.

CHARACTERIZATION AND DIAGNOSIS: Onlyone of the morphological characters in ouranalysis (originally from Haas, 2003) opti-mizes on this branch: basibranchial long(Haas 105.0). Nevertheless, the moleculardata are decisive (appendix 5). The length ofthe 28S fragment is diagnostic for this taxon,being 703 bp (appendix 3; as in Leiopelma-tidae), but differing from that taxon in all ofthe morphological characters of the interven-ing taxa.

FAMILY: PELODYTIDAE BONAPARTE, 1850

Pelodytina Bonaparte, 1850: 1 p. Type genus: Pe-lodytes Bonaparte, 1838.

IMMEDIATELY MORE INCLUSIVE TAXON: [93]Pelodytoidea Bonaparte, 1850.

SISTER TAXON: [94] Scaphiopodidae Cope,1865.

RANGE: Southwestern Europe and the Cau-casus.

CONTENT: Pelodytes Bonaparte, 1838.CHARACTERIZATION AND DIAGNOSIS: Pelod-

ytids are small terrestrial frogs that live inmoist habitats and have a typically biphasiclife history. A number of morphologicalcharacters (Haas, 2003) in our analysis op-timize on this branch (although some of thesemay actually apply to some subset of Pelod-ytes): (1) epidermal melanocytes of irregularshape not forming reticulation (Haas 1.1,also in Discoglossus and Bombina); (2) up-per labial papillae continuous (Haas 8.0); (3)interbranchial septum IV invaded by fibersof m. subarcualis rectus II–IV (Haas 29.1);(4) m. subarcualis rectus I portion with originfrom ceratobranchial I absent (Haas 33.0);(5) larval m. levator mandibulae externus intwo portions (profundus and superficialis;Haas 54.1); (6) dorsal connection from pro-cessus muscularis to commissura quadrato-orbitalis (Haas 78.2); (7) articulation of car-tilago labialis superior with cornua trabecu-lae by pars corporis (Haas 85.0); (8) verte-bral centra formation epichordal (Haas 99.1);(9) larval ribs present (Haas 102.1); (10)commissura proximalis II absent (Haas110.0); (11) eggs laid in strings (Haas 141.1;(also in Pelobates and elsewhere in Acos-manura); (12) parahyoid ossification present(Haas 147.1); and (13) tibiale and fibulareelongate and fully fused (Haas 150.2; con-vergent in Neobatrachia).

[94] FAMILY: SCAPHIOPODIDAE COPE, 1865

Scaphiopodidae Cope, 1865: 104. Type genus:Scaphiopus Holbrook, 1836.

IMMEDIATELY MORE INCLUSIVE TAXON: [93]Pelodytoidea Bonaparte, 1850.

SISTER TAXON: Pelodytidae Bonaparte,1850.

RANGE: Southern Canada and UnitedStates south to south-central part of the Pla-teau of Mexico.

CONTENT: Scaphiopus Holbrook, 1836;Spea Cope, 1866.

CHARACTERIZATION AND DIAGNOSIS: Sca-phiopodids are toad-like frogs characterizedby the possession of large metatarsal spades,as found in Pelobatidae, with which they bur-row. Their life-history is typically biphasicwith a Type IV tadpole and inguinal amplex-us. Morphological characters in our analysis(from Haas, 2003) that optimize on thisbranch are (1) paired venae caudales laterales


short (Haas 15.0); (2) m. subarcualis rectus Iportion with origin from ceratobranchial IIIabsent (Haas 35.0); and (3) m. mandibulo-labialis superior absent (Haas 50.0). BecauseHaas’ (2003) study included only Spea with-in Scaphiopodidae, these characters may ac-tually be synapomorphies of Scaphiopus 1Spea or some subset of Spea. Additional tax-on sampling is needed to elucidate the ap-propriate level of universality of these char-acters.

Other possible synapomorphies at this lev-el are (1) fusion of the sacrum and coccyx(although J.D. Lynch, 1973: 141, disagreedwith this); (2) exostosed frontoparietals; and(3) presence of a metatarsal spade supportedby a well-ossified prehallux (Ford and Can-natella, 1993). These appear convergently inPelobatidae, possibly relating to their bur-rowing habits.

[96] SUPERFAMILY: PELOBATOIDEABONAPARTE, 1850

IMMEDIATELY MORE INCLUSIVE TAXON: [92]Anomocoela Nicholls, 1916.

SISTER TAXON: [93] Pelodytoidea Bona-parte, 1850.

RANGE: Europe, western Asia, and north-western Africa; Pakistan and western China,Indochinese peninsula, east to the Philippinesand the Greater Sunda Islands.

CONTENT: [97] Pelobatidae Bonaparte,1850, and [98] Megophryidae Bonaparte,1850.

CHARACTERIZATION AND DIAGNOSIS: Mor-phological characters in our analysis (fromHaas, 2003) that optimized on this branch are(1) m. interhyoideus posterior present (Haas23.1); (2) m. diaphragmatopraecordialis pres-ent (Haas 25.1); (3) m. constrictor branchial-is I absent (Haas 27.0); (4) m. mandibulola-bialis superior present (Haas 50.1); and (5)adrostral cartilage very large and elongate(Haas 90.2). Because this generalization isbased solely on Pelobates, Megophrys, andLeptobrachium, taxon sampling needs to beexpanded for further elucidation of the dis-tribution of these characters. J.D. Lynch(1973) noted that Pelobates and mego-phryids have a monocondylar sacrococcy-geal articulation, which is likely a synapo-morphy at this level.

[97] FAMILY: PELOBATIDAE BONAPARTE, 1850

Pelobatidae Bonaparte, 1850: 1 p. Type genus:Pelobates Wagler, 1830.

IMMEDIATELY MORE INCLUSIVE TAXON: [92]Pelobatoidea Bonaparte, 1850.

SISTER TAXON: [98] Megophryidae Bona-parte, 1850.

RANGE: Europe, western Asia, and north-western Africa.

CONTENT: Pelobates Wagler, 1830.CHARACTERIZATION AND DIAGNOSIS: Pelo-

batids are toad-like frogs, that have a dis-tinctive metatarsal spade (as does Scaphio-podidae) and their life history is typically bi-phasic with inguinal amplexus and a Type IVtadpole. Morphological characters (fromHaas, 2003) that optimize on this branch are(1) larval eye positioned dorsolaterally (Haas11.1); (2) posterolateral projections of thecrista parotica present (Haas 67.1); (3) arcussubocularis with an irregular margin (Haas81.1); (4) vertebral centra epichordal (Haas99.1); (5) processus branchialis closed (Haas114.1); (6) endolymphatic spaces extend intomore than half of vertebral canal (presacralvertebra IV or beyond; Haas 121.1); (7) eggslaid in strings (Haas 141.1; convergent else-where within Acosmanura).

Because this diagnosis is based solely onPelobates fuscus, some of these charactersmay optimize on some subset of the speciesof Pelobates and not on the Pelobatidaebranch. Increased density of sampling isneeded.

Other possible synapomorphies at this lev-el are (1) fusion of the sacrum and coccyx;(2) exostosed frontoparietals; and (3) pres-ence of a metatarsal spade supported by awell-ossified prehallux (Ford and Cannatella,1993). These appear convergently in Sca-phiopodidae, possibly relating to their bur-rowing habits.

[98] FAMILY: MEGOPHRYIDAE BONAPARTE,1850

Megalophreidina Bonaparte, 1850: 1 p. Type ge-nus: Megalophrys Wagler, 1830 (5 MegophrysKuhl and Van Hasselt, 1822).

Leptobrachiini Dubois, 1980: 471. Type genus:Leptobrachium Tschudi, 1838.

Oreolalaxinae Tian and Hu, 1985: 221. Type ge-nus: Oreolalax Myers and Leviton, 1962.


IMMEDIATELY MORE INCLUSIVE TAXON: [96]Pelobatoidea Bonaparte, 1850.

SISTER TAXON: [97] Pelobatidae Bonaparte,1850.

RANGE: Montane Pakistan and westernChina, Indochinese peninsula, east to thePhilippines and the Greater Sunda Islands.

CONTENT: Atympanophrys Tian and Hu,1983; Brachytarsophrys Tian and Hu, 1983;Leptobrachella Smith, 1925; LeptobrachiumTschudi, 1838; Leptolalax Dubois, 1980;Megophrys Kuhl and Hasselt, 1822; Ophry-ophryne Boulenger, 1903; Oreolalax Myersand Leviton, 1962; Scutiger Theobald, 1868;Vibrissaphora Liu, 1945; Xenophrys Gun-ther, 1864.

CHARACTERIZATION AND DIAGNOSIS: Mego-phryids are small to large frogs that are gen-erally found hopping in leaf litter alongstreams, although some species extend up-wards in elevation to 5,100 meters on thesouthern slopes of the Himalayas (Lathrop,2003). Reproduction is typically biphasicwith inguinal amplexus and a Type IV tad-pole. Although our morphological data forthis group were restricted to Megophrysmontana and Leptobrachium hasseltii, ourpreferred tree (figs. 50, 54) suggests that syn-apomorphies subtending these two speciesare likely synapomorphies of Megophryidae.Characters of morphology (from Haas, 2003)that optimize on this branch are (1) m. su-barcualis rectus accessorius present (Haas32.1); and (2) suspensorium low (Haas 71.2).

In addition, Ford and Cannatella (1993)suggested that the following are synapomor-phies for Megophryidae: (1) complete or al-most complete absence of ceratohyals inadults; (2) intervertebral cartilages with anossified center; and (3) paddle-shapedtongue.

SYSTEMATIC COMMENTS: The recognition ofXenophrys as a genus distinct from Mego-phrys (e.g., Ohler et al., 2002) appears jus-tified, inasmuch as Megophrys and Xeno-phrys do not appear to be each other’s closestrelatives, with Megophrys most closely re-lated to Ophryophryne. The subfamilies[101] Megophryinae Bonaparte, 1850, andLeptobrachiinae Dubois, 1980, were not re-jected by our molecular data (fig. 54). Nev-ertheless, although Megophryinae has apo-morphies (an umbelliform oral disc in larvae

and a very large tubercle starting at the baseand extending out and onto the first finger[Lathrop, 2003]), ‘‘Leptobrachiinae’’ is rec-ognized solely on the basis of plesiomorphies(lacking the umbelliform mouth and the largetubercle extending out on the finger), so thereis little point in recognizing these taxa.Moreover, Delorme and Dubois’ (2001; fig.20) own analysis rejects leptobrachiinemonophyly. Beyond rejecting the monophylyof Leptobrachiinae, Delorme and Dubois’(2001; fig. 20) cladogram suggests that thecurrently recognized nominate subgenus ofthe genus Scutiger, Scutiger (paraphyleticwith respect to Aelurophryne), must be re-jected, as must the monotypic subgenus Ae-lurolalax of genus Oreolalax that renders thesubgenus Oreolalax paraphyletic.

[105] NEOBATRACHIA REIG, 1958

Neobatrachia Reig, 1958: 115. (See nomenclatur-al comment in appendix 6.)

IMMEDIATELY MORE INCLUSIVE TAXON: [91]Acosmanura Savage, 1973.

SISTER TAXON: [92] Anomocoela Nicholls,1916.


CONCEPT AND CONTENT: NeobatrachiaReig, 1958, is conceived here as it was orig-inally intended by Reig (1958), a monophy-letic group of all frogs excluding his Ar-chaeobatrachia (Leiopelmatidae, Discoglos-sidae [sensu lato], Pipidae, Rhinophrynidae,and Pelobatidae [sensu lato]). In other words,it is a monophyletic group composed of our[106] Heleophrynidae Noble, 1931, and[107] Phthanobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Neo-batrachia includes approximately 96% of thediversity of frogs, most of which have com-pletely ossified vertebrae. Only one characterin our analysis (from Haas, 2003) optimizeson this branch: m. sartorius discrete from them. semitendinosus (Haas 153.1). Althoughmany authors (e.g., Ford and Cannatella,1993; Trueb, 1993) have reported the pres-ence of palatine bones as a synapomorphy ofNeobatrachia, it is reasonably clear (Haas,2003; see also Acosmanura account) that thischaracteristic is a synapomorphy of Acos-manura. Nevertheless, one could argue that


the developmentally distinct palatine of neo-batrachians is a synapomorphy of this group,although polarization between the anomo-coelan condition and the neobatrachian con-dition has to be made on the basis of consid-erations other than outgroup comparison.

Ford and Cannatella (1993) suggestedthese additional characters as synapomor-phies of the Neobatrachia: (1) third distalcarpal fused to other carpals (convergent inPelodytes); (2) accessory head of m. adduc-tor longus present; and (3) parahyoid ossifi-cation present. In addition, there are substan-tial numbers of molecular synapomorphies(appendix 5) that support recognition of thistaxon.

COMMENT: Neobatrachia in our sense isequivalent to the Recent content of epifamilyRanoidia Rafinesque, 1814, of Dubois(2005).

[106] FAMILY: HELEOPHRYNIDAE NOBLE, 1931

Heleophryninae Noble, 1931: 498. Type genus:Heleophryne Sclater, 1898.

Heleophrynidae Hoffman, 1935: 2. Type genus:Heleophryne Sclater, 1898. Coined as new fam-ily apparently in ignorance of Noble, 1931.

IMMEDIATELY MORE INCLUSIVE TAXON:[105] Neobatrachia Reig, 1958.

SISTER TAXON: [107] Phthanobatrachianew taxon.

RANGE: Mountainous areas of the Capeand Transvaal regions of South Africa, fromsea level to about 3,000 meters elevation.

CONTENT: Heleophryne Sclater, 1898.CHARACTERIZATION AND DIAGNOSIS: Heleo-

phrynidae is composed of moderately smalltreefrog-like anurans with expanded trian-gular digit tips, a typically biphasic life his-tory, prolonged larval development, Type IVlarvae, and inguinal amplexus, that live inrocky, high-gradient habitats (J.D. Lynch,1973; Passmore and Carruthers, 1979). Con-siderable numbers of morphological charac-ters (from Haas, 2003) in our analysis opti-mized on this branch: (1) m. transversus ven-tralis IV present (Haas 22.1); (2) interbran-chial septum IV musculature invaded bylateral fibers of m. subarcualis rectus II–IV(Haas 29.1); (3) m. subarcualis rectus acces-sorius present (Haas 32.1); (4) processus as-cendens thin (Haas 72.1); (5) processus mus-

cularis absent (Haas 79.0); (6) partes cor-pores forming medial body (Haas 87.2); (7)adrostral cartilage very large and elongate(Haas 90.2); (8) admandibular cartilage pre-sent (Haas 95.1); (9) free basihyal absent(Haas 105.0); and (10) processus branchialisclosed (Haas 114.1). In addition, Ford andCannatella (1993) suggested that the loss ofkeratinous jaw sheaths in the larvae is a syn-apomorphy of this group. Channing (2003)corrected this, noting that larvae lack kera-tinized jaw sheaths, except for Heleophrynerosei, which retains the lower jaw sheath.Channing also noted that during the repro-ductive aquatic period, males develop foldsof loose skin that increase the respiratorysurface. Both of these characteristics are like-ly apomorphic.

[107] PHTHANOBATRACHIA NEW TAXON

ETYMOLOGY: Phthano- (Greek: anticipate,do first) 1 batrachos (Greek: frog). We pro-pose this name to honor Arnold G. Klugeand James S. Farris’s contribution to phylo-genetics generally and to amphibian system-atics specifically, especially with reference tothe paper that started modern quantitativephyletics—Kluge and Farris, 1969).

IMMEDIATELY MORE INCLUSIVE TAXON:[105] Neobatrachia Reig, 1958.

SISTER TAXON: [106] Heleophrynidae No-ble, 1931.


CONCEPT AND CONTENT: Phthanobatrachiais a monophyletic group composed of allneobatrachians, excluding HeleophrynidaeNoble, 1931. In other words, it is composedof our [314] Hyloides new taxon and [108]Ranoides new taxon.

CHARACTERIZATION AND DIAGNOSIS: Mor-phological characters (from Haas, 2003) thatoptimize on this branch are (1) upper mar-ginal papillae with a broad diastema (Haas8.1; reversed in several subsidiary lineages);(2) m. interhyoideus posterior present (Haas23.1); (3) m. diaphragmatopraecordialis pre-sent (Haas 25.1); (4) m. constrictor bran-chialis I absent (Haas 27.0); and (5) secretoryridges present (Haas 136.1).

COMMENTS ON CHARACTER DISTRIBUTIONS:Another likely synapomorphy at this level is


widely-separated atlantal cotyles (5 Type Iof J.D. Lynch, 1971, 1973), although appar-ently reversed in some taxa (e.g., Limnodyn-astidae, Bufonidae, part of Cycloramphidae[Rhinoderma, Hylorina, Alsodes, Eupsophus,Proceratophrys, Odontophrynus], and part ofCeratophryidae [Ceratophrys, Lepidobatra-chus]).

Presence of an outer metatarsal tubercle(J.D. Lynch, 1971, 1973) is coherent on ourtree and also may be a synapomorphy at thelevel of Phthanobatrachia, because outermetatarsal tubercles are never found outsideof this clade, although clearly this characterhas been lost and regained several timeswithin Phthanobatrachia. Optimization ofthis character requires more work, but wesuggest that it will provide additional evi-dence of relationship. Our current under-standing is that it is absent in Batrachophryn-idae, except for Batrachophrynus; absent inLimnodynastidae, except for Limnodynastestasmaniensis and Adelotus; and present inMyobatrachidae, except for six species ofCrinia and Taudactylus, and, presumably,Mixophyes and Rheobatrachus. Within Mer-idianura they are present, with the exclusionof some Hylidae, Centrolenidae, Rhinoderma(Cycloramphidae), and Lepidobatrachus(Ceratophryidae). Interestingly, within Ran-oides the trends are much less clear andmuch less well documented, the tubercle be-ing absent in most Arthroleptidae (includingAstylosternidae), most Hyperoliidae, Hemi-sotidae, and Rhacophoridae, some Microhy-linae, Cophylinae, Phrynomerus, and someRanidae (J.D. Lynch, 1973).

[314] HYLOIDES NEW TAXON

ETYMOLOGY: Hyloides is, for the most part,Hyloidea of traditional usage, excluding He-leophrynidae (as suggested by Haas, 2003),removed from regulated nomenclature, andwith the ending changed so as to not implyfamily-group regulation.

IMMEDIATELY MORE INCLUSIVE TAXON:[107] Phthanobatrachia new taxon.

SISTER TAXON: [108] Ranoides new taxon.RANGE: Coextensive with Anura, exclud-

ing New Zealand.CONCEPT AND CONTENT: Hyloides as con-

ceived here is the monophyletic group com-

posed of arciferal (at least plesiomorphicallywithin any of the groups) phthanobatrachianfrogs. In other words, it is composed of [315]Sooglossidae Noble, 1931, and [318] Noto-gaeanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Onlyone morphological character in our analysisoptimizes on this branch: m. diaphragmato-praecordialis meeting m. interhyoideus pos-terior in a smooth arch (Haas 26.0). Procoelymay also be a synapomorphy, but with re-versals to an anomocoelous condition in atleast some taxa (e.g., Myobatrachidae). Nev-ertheless, substantial numbers of molecularsynapomorphies support this clade (appendix5).

COMMENT: Hyloides in our sense is not co-extensive with the Recent content of Hylo-idea of Dubois (1983), which included He-leophrynidae; of Dubois (2005), which ex-cluded Heleophrynidae and Sooglossidae; orof Hyloidea (sensu stricto) of Biju and Bos-suyt (2003) and Darst and Cannatella (2004),which excluded Batrachophrynidae (by im-plication), Limnodynastidae, Myobatrachi-dae, and Sooglossidae, rendering Hyloidea(sensu stricto) of these authors coextensivewith our [348] Nobleobatrachia.

[315] FAMILY: SOOGLOSSIDAE NOBLE, 1931

Sooglossinae Noble, 1931: 494. Type genus:Sooglossus Boulenger, 1906.

Nasikabatrachidae Biju and Bossuyt, 2003: 711.Type genus: Nasikabatrachus Biju and Bossuyt,2003. New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[314] Hyloides new taxon.

SISTER TAXON: [318] Notogaeanura newtaxon.

RANGE: Granitic islands of the Seychellesand the Western Ghats of South India.

CONTENT: Nasikabatrachus Biju and Bos-suyt, 2003; Sooglossus Boulenger, 1906 (in-cluding Nesomantis Boulenger, 1909; seeSystematic Comments and appendix 7).

CHARACTERIZATION AND DIAGNOSIS: Soog-lossids are tiny to moderate-size frogs withweakly expanded digits in Sooglossus andunexpanded digits in Nasikabatrachus. Thespecies of Sooglossus and Nesomantis, thatare known, have inguinal amplexus and haveeither endotrophic larvae or direct develop-


ment (Nussbaum, 1980; Thibaudeau and Al-tig, 1999), whereas Nasikabatrachus hasfree-living exotrophic larvae (Dutta et al.,2004). Sooglossus sechellensis is biphasicwith presumably endotrophic larvae; Neso-mantis life history is unknown, but presum-ably has direct development as no larvaehave ever been found; and Sooglossus gar-dineri has direct development (Nussbaum,1980).

This taxon was not studied by Haas(2003), so none of our morphological char-acters could optimize on this branch. Nev-ertheless, substantial numbers of molecularsynapomorphies exist (appendix 5). Ford andCannatella (1993) suggested the following tobe synapomorphies of Sooglossidae, but be-cause these characters have not been reportedfor Nasikabatrachus, they may only be syn-apomorphies of Sooglossus 1 Nesomantisand should be verified for Nasikabatrachus,as well: (1) tarsal sesamoid bones present(see Nussbaum, 1982, for description anddiscussion of differences among sesamoidsamong several taxa); (2) ventral gap in cri-coid ring present (the universality of thischaracteristic is highly speculative); (3) m.semitendinosus passing dorsal to m. gracilis(level of universality highly speculative); (4)alary (5 anterolateral) process of hyoidwinglike (the level of universality specula-tive); and (5) sphenethmoid divided. In ad-dition, J.D. Lynch (1973) reported the colu-mella as absent in sooglossids, although hedid not examine Nasikabatrachus (not dis-covered for another 30 years). Biju and Bos-suyt (2003) reported the tympanum in Nasi-kabatrachus sahyadrensis as ‘‘inconspicu-ous’’, and Dutta et al. (2004) reported it tobe absent in their unnamed species of Nasi-kabatrachus. The condition of the columellain Nasikabatrachus remains unreported. J.D.Lynch (1973) also reported Sooglossidae asexhibiting an ossified omosternum, whichwould be a synapomorphy at this level ofuniversality.

SYSTEMATIC COMMENTS: Nussbaum et al.(1982) and Green et al. (1989) discussed thephylogeny of the Seychellean taxa (i.e., notincluding Nasikabatrachus) and suggestedthat Sooglossus is paraphyletic with respectto Nesomantis, although outgroup compari-son for this suggestion was lacking and the

evidence supporting this view rests on theassumption that a complex call (shared bySooglossus sechellensis and Nesomantis tho-masseti) is apomorphic (Nussbaum et al.,1982), as well as on the basis of allozymicdistance measures (Green et al., 1988). Nev-ertheless, there has never been any evidencesuggested to support the monophyly of thethree species of Sooglossus with respect toNesomantis, so the current taxonomy sug-gests a level of knowledge that is not war-ranted. For this reason we place Nesomantisinto the synonymy of Sooglossus. We couldhave placed quotation marks around ‘‘Soog-lossus’’ to note the lack of phylogenetic ev-idence, but this seems to us to be an extremestep to preserve a monotypic genus (i.e., Ne-somantis). (This synonymy affects only onespecies name, Nesomantis thomasseti Bou-lenger, 1909, which becomes Sooglossus tho-masseti [Boulenger, 1909].)

Because preservation of Nasikabatrachi-dae as a family would require us to have twosister families, each composed of monotypicgenera, we consider it beneficial for taxo-nomic efficiency to place Nasikabatrachidaeinto the synonymy of Sooglossidae. Our en-larged Sooglossidae is identical to Sooglos-soidea of Dubois (2005).

[318] NOTOGAEANURA NEW TAXON

ETYMOLOGY: Noto- (Greek: southern) 1Gaea (Greek: earth) 1 anoura (Greek: tail-less, i.e., frog), denoting the Gondwanalandorigin of this taxon.

IMMEDIATELY MORE INCLUSIVE TAXON:[314] Hyloides new taxon.

SISTER TAXON: [315] Sooglossidae Noble,1931.

RANGE: Coextensive with Anura, exclud-ing New Zealand and the Seychelles.

CONCEPT AND CONTENT: Notogaeanura is amonophyletic taxon composed of all hyloidtaxa except Sooglossidae Noble, 1931. Inother words, it is composed of our [319]Australobatrachia new taxon and [348] Nob-leobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof our morphological characters optimize atthis level of universality, so its diagnosis isbased completely on molecular data, which


are decisive. Unambiguous molecular trans-formations are listed in appendix 5.

[319] AUSTRALOBATRACHIA NEW TAXON

ETYMOLOGY: Australo- (Greek: southern)1 batrachos (Greek: frog), denoting thesouthern continental distribution of thesefrogs, primarily in Australia and New Guin-ea, with outliers in South America, in Chileand Peru.

IMMEDIATELY MORE INCLUSIVE TAXON:[318] Notogaeanura new taxon.

SISTER TAXON: [348] Nobleobatrachia newtaxon.

RANGE: New Guinea and Australia; south-ern Chile and north into southern AndeanPeru and Bolivia.

CONCEPT AND CONTENT: Australobatrachianew taxon is a monophyletic taxon com-posed of [320] Batrachophrynidae Cope,1875, and [321] Myobatrachoidea Schlegel,1850.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize unambiguously to this branchbecause the only exemplar of this group forwhich we have morphological data is Lim-nodynastes peronii. Therefore, any of the fol-lowing characters could be synapomorphiesof Australobatrachia, Myobatrachoidea, Lim-nodynastidae, Limnodynastes, or some subsetof Limnodynastes: (1) m. transversus ven-tralis IV present (Haas 22.1); (2) lateral fibersof m. subarcualis rectus II–IV invade inter-branchial septum IV (Haas 29.1); (3) twoclearly separate heads of m. subarcualis ob-liquus originate from ceratobranchialia II andIII (Haas 32.1); (4) processus ascendens thin(Haas 72.1); (5) processus muscularis present(Haas 79.0); (6) partes corpores forming me-dial body (Haas 87.2); (7) adrostral cartilagevery large and elongate (Haas 90.2); (8) ad-mandibular cartilage present (Haas 95.1); (9)free basihyal absent (Haas 105.0); (10) com-missura proximalis II absent (Haas 110.0);(11) commissura proximalis III absent (Haas111.0); and (12) processus branchialis closed(Haas 114.1). Unambiguous molecular trans-formations are listed in appendix 5.

[320] FAMILY: BATRACHOPHRYNIDAE COPE,1875

Batrachophrynidae Cope, 1875: 9. Type genus:Batrachophrynus Peters, 1873.

Calyptocephalellinae Reig, 1960: 113. Type ge-nus: Calyptocephalella Strand, 1928. New syn-onym. (See nomenclatural comment in appen-dix 6.)

IMMEDIATELY MORE INCLUSIVE TAXON:[319] Australobatrachia new taxon.

SISTER TAXON: [321] MyobatrachoideaSchlegel, 1850.

RANGE: Southern Chile and north intosouthern Andean Peru and Bolivia.

CONTENT: Batrachophrynus Peters, 1873;Caudiverbera Laurenti, 1768; TelmatobufoSchmidt, 1952.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize on this branch because no partof it was studied by Haas (2003). Neverthe-less, Burton (1998a) suggested that the pres-ence of the m. lumbricalis longus digiti III isa synapomorphy (although convergentlyfound in Heleophryne and Petropedetes). Inaddition, Batrachophrynus, Caudiverbera,and Telmatobufo share the presence of twoorigins of the m. lumbricalis brevis digiti III,otherwise unknown outside of Ranoides(e.g., Cardioglossa, Discodeles, most of Hy-peroliidae, Mantellidae [excluding Aglypto-dactylus], Petropedetes, Phrynomantis, Pla-typelis, Plethodonthyla, Rhacophoridae, Sco-tobleps, and Trichobatrachus). See appendix5 for molecular synapomorphies of Telma-tobufo 1 Caudiverbera, which we hypothe-size are synapomorphies of Batrachophryni-dae.

SYSTEMATIC COMMENTS: The association ofBatrachophrynus with Calyptocephalellini isarguable, Batrachophrynus more traditional-ly having been allied with Telmatobius (Lau-rent, 1983; Sinsch and Juraske, 1995; Sinschet al., 1995), although this association seemsto have been assumed because of overallsimilarity. (Of course, both Caudiverberaand Telmatobufo had also been associatedwith Telmatobius [J.D. Lynch, 1971].) J.D.Lynch (1971: 26) noted that Caudiverberaand Batrachophrynus (as well as Odonto-phrynus and Telmatobius) have dextral larvalvent tubes, possibly an apomorphy. Anothercharacter is pupil shape, vertical in Caudiv-erbera and Telmatobufo (presumably theapomorphic condition at this level of univer-sality) and horizontal in Batrachophrynus.


Telmatobufo and Caudiverbera exhibit thecondition of the trigeminal nerve passingmedial to the m. adductor mandibulae (the‘‘E’’ condition); the condition is unknown inBatrachophrynus. This characteristic is oth-erwise known sporadically in Ceratophrysand Lepidobatrachus, some bufonids, Crau-gastor, Mixophyes, some hyperoliids, mostmicrohylids, a few ranids, rhacophorids,Rhinophrynus, and in Sooglossus thomasseti(J.D. Lynch, 1986). We regard this conditionas a likely synapomorphy of Batrachophryn-idae (or minimally Caudiverbera 1 Telma-tobufo), although the distribution of this fea-ture across the anuran tree requires furtherstudy.

[321] SUPERFAMILY: MYOBATRACHOIDEASCHLEGEL, 1850

IMMEDIATELY MORE INCLUSIVE TAXON:[319] Australobatrachia new taxon.

SISTER TAXON: [320] BatrachophrynidaeCope, 1875.

RANGE: Australia and New Guinea.CONTENT: [322] Limnodynastidae Lynch,

1971, and [334] Myobatrachidae Schlegel,1850.

CHARACTERIZATION AND DIAGNOSIS: See thecharacterization and diagnosis of Australo-batrachia for morphological characters thatmay optimize on this branch with furtherstudy. At present, there are no morphologicalcharacters that can be documented to opti-mize on this branch so justification for rec-ognizing this taxon is based entirely on mo-lecular evidence (listed in appendix 5).

SYSTEMATIC COMMENTS: We recognize twofamilies within Myobatrachoidea, corre-sponding substantially to Limnodynastidaeand Myobatrachidae of previous usage (Zuget al., 2001; Davies, 2003a, 2003b), differingmildly only in the transfer of Mixophyesfrom Limnodynastidae to Myobatrachidaeand the firm attachment of Rheobatrachus(formerly Rheobatrachidae) to Myobatrachi-dae. See those accounts for further discus-sion. Haas (2003) suggested a number ofmorphological characters that optimize onhis terminal taxon, Limnodynastes peronii.Because this was the only myobatrachoid inthat study, all of these characters might besynapomorphies of various monophyleticgroups within this taxon. Hypothesized mo-

lecular synapomorphies are summarized inappendix 5. Further study is needed.

[322] FAMILY: LIMNODYNASTIDAE LYNCH, 1971

Limnodynastini J.D. Lynch, 1971: 83. Type ge-nus: Limnodynastes Fitzinger, 1843.

IMMEDIATELY MORE INCLUSIVE TAXON:[321] Myobatrachoidea Schlegel, 1850.

SISTER TAXON: [334] MyobatrachidaeSchlegel, 1850.

RANGE: Australia and New Guinea, includ-ing the Aru Islands.

CONTENT: Adelotus Ogilby, 1907; Heleio-porus Gray, 1841; Lechriodus Boulenger,1882; Limnodynastes Fitzinger, 1843; Neo-batrachus Peters, 1863; Notaden Gunther,1873; Opisthodon Steindachner, 1867 (seeSystematic Comments and appendix 7); Phi-loria Spencer, 1901 (including KyarranusMoore, 1958).

CHARACTERIZATION AND DIAGNOSIS: Lim-nodynastids are predominantly small to mod-erately-sized toad-like terrestrial frogs. Am-plexus is inguinal, and with the exception ofNeobatrachus and Notaden, all species arefoam-nesters (Martin, 1967).

See ‘‘Characterization and diagnosis’’ ofAustralobatrachia for morphological charac-ters that may optimize on this branch. Fordand Cannatella (1993) suggested the follow-ing to be a morphological synapomorphy ofLimnodynastidae: connection between the m.submentalis and m. intermandibularis. But,with the transfer of Mixophyes to Myoba-trachidae on the basis of molecular evidence,this morphological character requires verifi-cation. Davies (2003a) noted that Limnodyn-astidae are united by the character of fusionof the first two vertebrae. Molecular evidenceis decisive in support of this taxon; see ap-pendix 5 for diagnostic transformations.

SYSTEMATIC COMMENTS: Our results sug-gest strongly that Limnodynastes as currentlyformulated is polyphyletic. Schauble et al.(2000) provided a tree of species of Limno-dynastes which corresponds in some wayswith our results, but which differs in others.Their maximum-likelihood results, based on450 bp of 16S mtDNA and 370 bp of ND4,suggest that Adelotus sits within the Limno-dynastes ornatus group (L. ornatus and L.


spenceri), and that this overall group formsthe sister taxon of the remaing Limnodynas-tes in the arrangement Limnodynastes dor-salis group 1 (L. peronii group 1 L. salminigroup). Our results, based on denser taxonsampling and substantially more data, placeAdelotus outside of Limnodynastes (sensulato), but place Neobatrachus, Notaden,Lechriodus, and Heleioporus within a para-phyletic Limnodynastes, or, alternatively,place Limnodynastes ornatus as the sistertaxon of Lechriodus fletcheri, and far awayfrom Limnodynastes (including Megistolotisas a synonym as suggested by Schauble etal., 2000), which is the sister taxon of Hel-eioporus. In order to alleviate the polyphylyof Limnodynastes, we resurrect the name Op-isthodon Steindachner, 1867 (type species:Opisthodon frauenfeldi Steindachner, 1867,by monotypy [5 Discoglossus ornatus Gray,1842]) for the former Limnodynastes ornatusgroup (i.e., Opisthodon ornatus [Gray, 1842]and O. spenceri [Parker, 1940]). This rendersOpisthodon as the sister taxon of Lechriodus,and Limnodynastes as the sister taxon of Hel-eioporus, assuming that both Opisthodon andLechriodus are monophyletic. We suggestthat the molecular characters that optimize onthe branch labeled Limnodynastes ornatusare synapomorphies of Opisthodon (appen-dix 5). See appendix 7 for new combinationsproduced by this generic change.

J.D. Lynch (1971: 76) distinguished twotribes within his Cycloraninae (equivalent toour Limnodynastinae with the removal ofCyclorana to Pelodryadinae): Cycloranini(Cyclorana, Heleioporus, Mixophyes, Neo-batrachus, and Notaden), characterized bylaying eggs in dry burrows in a foam nest,and Limnodynastini (Adelotus, Lechriodus,Limnodynastes, and Philoria), which laytheir eggs in water or in moist terrestrialsites. When these characteristics are opti-mized on our cladogram, they provide a rath-er confusing picture of life history evolutionin limnodynastine frogs, and our data do notsupport recognition of these taxa.

[334] FAMILY: MYOBATRACHIDAE SCHLEGEL,1850

Myobatrachinae Schlegel In Gray, 1850b: 10.Type genus: Myobatrachus Schlegel, 1850.

Uperoliidae Gunther, 1858b: 346. Type genus:Uperoleia Gray, 1841.

Criniae Cope, 1866: 89. Type genus: CriniaTschudi, 1838.

Rheobatrachinae Heyer and Liem, 1976: 11. Typegenus: Rheobatrachus Liem, 1973.

IMMEDIATELY MORE INCLUSIVE TAXON:[321] Myobatrachoidea Schlegel, 1850.

SISTER TAXON: [322] LimnodynastidaeLynch, 1971.

RANGE: Australia and New Guinea.CONTENT: Arenophryne Tyler, 1976; Assa

Tyler, 1972; Crinia Tschudi, 1838; Geocri-nia Blake, 1973; Metacrinia Parker, 1940;Mixophyes Gunther, 1864; MyobatrachusSchlegel, 1850; Paracrinia Heyer and Liem,1976; Pseudophryne Fitzinger, 1843; Rheo-batrachus Liem, 1973; Spicospina Roberts,Horwitz, Wardell-Johnson, Maxson, and Ma-hony, 1997; Taudactylus Straughan and Lee,1966; Uperoleia Gray, 1841.

CHARACTERIZATION AND DIAGNOSIS: Myob-atrachids are predominantly small frogs ofheterogeneous appearance. All are assumedto have inguinal amplexus, except Mixophyes(which has axillary amplexus). Davies(2003b) noted that although Mixophyes hadtraditionally been associated with Limnodyn-astidae, its placement there was always prob-lematic due to its lack of most limnodynas-tinae characteristics. All myobatrachids areassumed to have a typical biphasic life his-tory (Martin, 1967). None of our morpholog-ical characters optimize on this branch be-cause no member of this taxon was studiedby Haas (2003), although Ford and Canna-tella (1993) suggested the following to be alikely synapomorphy: (1) broad alary processof premaxilla (absent in Mixophyes, but alsopresent in the leptodactylids Adenomera,Pseudopaludicola, and Physalaemus [in thesense of including Engystomops and Eupem-phix]). In our topology, this character couldbe reversed in Mixophyes or convergent inRheobatrachus and the clade bracketed byTaudactylus and Arenophryne. Regardless,the molecular evidence appears to be deci-sive (see appendix 5 for molecular synapo-morphies for branch 334).

SYSTEMATIC COMMENT: We expectedMyobatrachus and Arenophryne to obtain assister taxa because they both are head-firstburrowers in sandy soil (Tyler, 1989), with


all of the concomitant morphological featuresthat are associated with this behavior.

[348] NOBLEOBATRACHIA NEW TAXON

ETYMOLOGY: Noble (Gladwyn K. Noble)1 batrachos (Greek: frog), to note one of themost influential herpetologists of the twenti-eth century and the father of modern inte-grative herpetology. Although Noble diedrelatively young, at age 47 (Adler, 1989), hiscontributions to amphibian systematics, lifehistory, comparative anatomy, and experi-mental biology remain important milestones.

IMMEDIATELY MORE INCLUSIVE TAXON:[318] Notogaeanura new taxon.

SISTER TAXON: [319] Australobatrachianew taxon.


CONCEPT AND CONTENT: Nobleobatrachia isa monophyletic group containing Hemi-phractidae Peters, 1862, and [349] Meridi-anura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Opti-mization of claw-shaped terminal phalangesand intercalary elements is ambiguous,placed on this branch only under acceleratedoptimization. Under delayed optimization,however, the characters appear convergentlyin Hemiphractidae and in Cladophrynia. Thecharacter of bell-shaped gills optimizes onMeridianura, with a reversal at Athesphatan-ura. Nevertheless, the bulk of evidence forthe existence of this clade is molecular; seeappendix 5 for molecular synapomorphies.The length of the 28S fragment likely be-comes much longer (greater than 740 bp) atthis branch than found below this point (seeappendix 3), although this must be confirmedby examining the 28S fragment in Hemi-phractus.

FAMILY: HEMIPHRACTIDAE PETERS, 1862

Hemiphractidae Peters, 1862: 146. Type genus:Hemiphractus Wagler, 1828.

IMMEDIATELY MORE INCLUSIVE TAXON:[348] Nobleobatrachia new taxon.

SISTER TAXON: [349] Meridianura new tax-on.

RANGE: Panama; Pacific slopes of Colom-bia and northwestern Ecuador; Brazil, Co-lombia, Ecuador, Peru, and Bolivia in the up-

per Amazon Basin to the Amazonian slopesof the Andes.

CONTENT: Hemiphractus Wagler, 1828.CHARACTERIZATION AND DIAGNOSIS: None

of the morphological characters in our anal-ysis optimize on this branch because, asthese species are direct-developers and there-fore were not studied by Haas (2003). Nev-ertheless, Hemiphractus/Hemiphractidae iseasily diagnosed by its wild appearance andtriangular skull. Like most basal species ofMeridianura, Hemiphractus exhibits directdevelopment and bears the developing em-bryos on the back until hatching, but unlikespecies of Amphignathodontidae and Cryp-tobatrachidae, it does not have a dorsalpouch in which to carry developing embryos(Noble, 1931).

SYSTEMATIC COMMENT: Hemiphractus hastwo pairs of bell-shaped gills in embryos, de-rived from branchial arches I and II (del Pinoand Escobar, 1981; Mendelson et al., 2000),as do members of Cryptobatrachidae andAmphignathodontidae (except for Flectono-tus pygmaeus). This suggests that the char-acter of bell-shaped gills optimizes on Mer-idianura, with a reversal in Athesphatanura.

[349] MERIDIANURA NEW TAXON

ETYMOLOGY: Meridianus (Greek: southern)1 anoura (Greek: tailless, i.e., frog), refer-encing the South American center of distri-bution of this worldwide group.

IMMEDIATELY MORE INCLUSIVE TAXON:[348] Nobleobatrachia new taxon.

SISTER TAXON: Hemiphractidae Peters,1862.


CONCEPT AND CONTENT: Meridianura is amonophyletic group containing [350] Bra-chycephalidae Gunther, 1858, and [366] Cla-dophrynia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Nomorphological characters in our analysis op-timize on this branch, and no authors havesuggested morphological characters thatwould optimize here. Nevertheless, it is well-corroborated by molecular characters (seeappendix 5 for molecular synapomorphies).Meridianura is characterized by a length ofthe 28S DNA fragment in excess of 740 bp


(appendix 3). This may be plesiomorphic,shared with Sooglossidae and reversed inAustralobatrachia, but long 28S moleculesare characteristic nonetheless.

[350] FAMILY: BRACHYCEPHALIDAEGUNTHER, 1858

Brachycephalina Gunther, 1858a: 321. Type ge-nus: Brachycephalus Fitzinger, 1826.

Cornuferinae Noble, 1931: 521. Type genus:Cornufer Tschudi, 1838.

Eleutherodactylinae Lutz, 1954: 157. Type genus:Eleutherodactylus Dumeril and Bibron, 1841.

IMMEDIATELY MORE INCLUSIVE TAXON:[349] Meridianura new taxon.

SISTER TAXON: [366] Cladophrynia newtaxon.

RANGE: Tropical North and South Ameri-ca; Antilles.

CONTENT: Adelophryne Hoogmoed andLescure, 1984; Atopophrynus Lynch andRuiz-Carranza, 1982; Barycholos Heyer,1969; Brachycephalus Fitzinger, 1826; Dis-chidodactylus Lynch, 1979; CraugastorCope, 1862 (see Systematic Comments andappendix 7); ‘‘Eleutherodactylus’’ Dumeriland Bibron, 1841 (see Systematic Commentsand appendix 7); ‘‘Euhyas’’ Fitzinger, 1843(see Systematic Comments and appendix 7);Euparkerella Griffiths, 1959; GeobatrachusRuthven, 1915; Holoaden Miranda-Ribeiro,1920; Ischnocnema Reinhardt and Lutken,1862 ‘‘1861’’; ‘‘Pelorius’’ Hedges, 1989 (seeSystematic Comments and appendix 7);Phrynopus Peters, 1873; Phyllonastes Heyer,1977; Phyzelaphryne Heyer, 1977; Syrrho-phus Cope, 1878 (including TomodactylusGunther, 1900; see Systematic Commentsand appendix 7).

CHARACTERIZATION AND DIAGNOSIS: Bra-chycephalids are predominantly leaf-litterfrogs with axillary amplexus and direct de-velopment (J.D. Lynch, 1971, 1973). Noneof the morphological characters in our anal-ysis optimized on this branch due to incom-plete taxon sampling in our morphologicaldata set (from Haas, 2003, who restricted hisstudy to groups with larvae). Nevertheless,Brachycephalidae is characterized by pos-sessing very large terrestrial eggs and exhib-iting direct development in all species so farexamined (J.D. Lynch, 1971), with the ex-ception of Eleutherodactylus jasperi, which

exhibits the further derived character of ovo-viviparity (Drewery and Jones, 1976). In ad-dition, embryonic egg teeth have been re-ported for Brachycephalus and Eleuthero-dactylus (Duellman and Trueb, 1986; Pom-bal, 1999). Additional survey may find thatthis characteristic is synapomorphic for somelarger group; is likely coextensive with directdevelopment in this group; and therefore ispossibly synapomorphic for the entire Bra-chycephalidae. For molecular transformationsassociated with this taxon see appendix 5.

SYSTEMATIC COMMENTS: We find nominalEleutherodactylus (sensu lato—subtended bybranch 350) to be in the same situation asnominal ‘‘Hyla’’ prior to its partition by Fai-vovich et al. (2005) into several tribes andmany new genera—that of a gigantic and ill-defined group where the enormity of the tax-on and lack of understanding of its speciesdiversity has largely restricted taxonomicwork for the past 45 years to two individuals(John D. Lynch and Jay M. Savage)28. Nev-ertheless, the current taxonomy of Eleuther-odactylus (sensu lato, subdivided into thetaxa Craugastor, Euhyas, Eleutherodactylus[sensu stricto], Pelorius, and Syrrhophus) ex-tends from the work of Hedges (1989) inwhich he named Pelorius for the Eleuthero-dactylus inoptatus group and placed Tomo-dactylus as a synonym of Syrrhophus and hisenlarged Syrrhophus as a subgenus ofEleutherodactylus.

Hedges’ (1989) systematic arrangementwas based on an allozymic study of six loci(223 alleles) focused on West Indian species,with a narrative discussion of evidence sup-porting recognition of non-West Indian taxa.In his UPGMA tree, Hedges’ Group I (nativeJamaican species, except E. nubicola) ap-pears monophyletic. His Group II (E. ricordiigroup) obtained as polyphyletic, with twogroups placed far from each other, one group(paraphyletic to group I) and another groupmuch more basal. Group III (E. auriculatusgroup) obtained as polyphyletic, with both abasal and a ‘‘central’’ monophyletic group.Group IV (E. inoptatus group) obtained as a

28 G.A. Boulenger (1882), in his extraordinarily influ-ential ‘‘Catalogue of the Batrachia Salientia’’, had todeal with only about 50 species of what is now Eleuth-erodactylus (sensu lato). Life was much simpler then.


monophyletic group. In the same paper aDistance Wagner tree also obtained Group Ias monophyletic, Group II as polyphyletic,Group III as polyphyletic, and IV as mono-phyletic.

After performing these analyses, Hedgesrejected the idea that any significant evolu-tionary meaning attached to these results,and suggested that Groups I–IV are eachmonophyletic on the basis of possessingunique alleles (no overall analysis of pres-ence–absence provided): Group I (Icdq2),Group II (PgmjB), Group III (Icdf1), Group IV(Icdp5, Lgla1, Pgm0). (This survey of loci wasbased solely on Antillean taxa, without anysampling of the nominal subgenera Craugas-tor or Syrrhophus, and with very limitedsampling of mainland species of subgenusEleutherodactylus.) Hedges then consideredGroup I and Group II together to form hissubgenus Euhyas; the rationale for this uni-fication was not provided. His Group III heregarded as the E. auriculatus section of apresumed paraphyletic subgenus Eleuthero-dactylus (referred to later as Eleutherodac-tylus [sensu stricto]), and Group IV he con-sidered to be his monophyletic subgenus Pe-lorius. In subsequent discussion, he notedthat J.D. Lynch (1986) had provided a mor-phological synapomorphy for a group thatHedges had not examined, Craugastor (themandibular ramus of the trigeminal nerve ly-ing medial [deep] to the m. adductor man-dibulae externus superficialis, the ‘‘E’’ con-dition of Starrett in J.D. Lynch, 1986), whichHedges also accepted as a subgenus. Hedgesbriefly discussed why he rejected Savage’s(1987) contention that Tomodactylus andSyrrhophus are distantly related, and then re-garded them as synonymous (as Syrrhophus)and considered Syrrhophus to be a subgenusof Eleutherodactylus. As with other authorsbefore and since, Hedges provided no evi-dence for the monophyly of Eleutherodac-tylus (sensu lato) with respect to other eleuth-erodactyline genera. J.D. Lynch and Duell-man (1997) disputed some assignments toEuhyas, but otherwise accepted Hedges’ ar-rangement.

Our results showed Eleutherodactylus(sensu lato) to be rampantly nonmonophy-letic (indicated below by quotation markssurrounding the name), and there is no rea-

son to believe this will not worsen as sam-pling density increases. In addition to theparaphyly of ‘‘Eleutherodactylus’’ (sensulato) with respect to Brachycephalus, dis-cussed in ‘‘Results’’, we found Ischnocnema,Barycholos, and Phrynopus to be imbeddedwithin it, as was anticipated by Ardila-Ro-bayo (1979).

As regards Ischnocnema, J.D. Lynch(1972b: 9) noted its extreme resemblance tospecies of the E. binotatus group and couldnot eliminate the possibility that Ischnocne-ma represents ‘‘a single morphological di-vergence of the binotatus group of Eleuth-erodactylus’’. Our placement of E. binotatusand Ischnocnema quixensis as sister taxasupports that hypothesis (see below).

The sole basis for recognizing Phrynopusas distinct from ‘‘Eleutherodactylus’’ (sensulato or sensu stricto) is the absence of ex-panded digital discs (J.D. Lynch, 1975). Ex-panded discs are also absent in several spe-cies of ‘‘Eleutherodactylus’’ (sensu stricto),which J.D. Lynch (1994: 201) considered tobe evidence that ‘‘Phrynopus are simplyEleutherodactylus having greatly reduceddigital tips’’. Our taxon sampling was inad-equate to address the relationships among allbrachycephalids (i.e., eleutherodactylines)with unexpanded discs and provided only aminimal test of Phrynopus monophyly, butour results leave little doubt that Phrynopusis nested within ‘‘Eleutherodactylus’’ (sensulato).

J.D. Lynch (1980) considered Barycholosto be most closely related to Eleutherodac-tylus nigrovittatus (then placed in the E. dis-coidalis group but subsequently transferredto the new E. nigrovittatus group by J.D.Lynch, 1989). We did not sample any speciesof the E. nigrovittatus group in this study andtherefore did not test the assertion of a Bar-ycholos–E. nigrovittatus relationship direct-ly. However, our finding (following Cara-maschi and Pombal, 2001) that Barycholosternetzi is nested within ‘‘Eleutherodactylus’’(sensu lato) is consistent with J.D. Lynch’shypothesis. We also did not test the mono-phyly of Barycholos, which is characterizedby sternal architecture (primarily the occur-rence of a calcified sternal style; J.D. Lynch,1980), but the 3,200 km separation between


the only known species is strongly sugges-tive that it may not be monophyletic.

Adelophryne, Brachycephalus, and Eupar-kerella share the characteristic of reductionof phalanges in the fourth finger, a presumedsynapomorphy, but this does not prevent thisgroup from being imbedded within ‘‘Eleuth-erodactylus’’ (sensu lato or sensu stricto)29,nor are we aware of any other characters thatwould exclude any of the other nominal gen-era of Brachycephalidae (including formerEleutherodactylinae) from ‘‘Eleutherodacty-lus’’ (sensu lato or sensu stricto).

Given the extent of the demonstrated non-monophyly and lack of any evidence to dis-tinguish even a phenetic ‘‘Eleutherodacty-lus’’ assemblage from other brachycephalidgenera, the only immediately available rem-edy, and the most scientifically conservativeaction in that it enforces monophyly as theorganizing principle of taxonomy, would beto place all species of the former Eleuthero-dactylinae in a single genus (coextensivewith our Brachycephalidae), for which theoldest available name is Brachycephalus Fit-zinger, 1826. But, as much as this appeals tous in principle, we believe that, in this par-ticular case—where knowledge is so limitedand species diversity is so great, and wherewe have sampled so few of the nominal gen-era of Brachycephalidae (i.e., we have notsampled Adelophryne, Atopophrynus, Dis-chidodactylus, Euparkerella, Geobatrachus,Holoaden, Phyllonastes, or Phyzelaphry-ne)—the scientific payoff from enforcingmonophyly is not worth the practical cost ofobscuring so much diversity under a singlegeneric name and thereby concealing a con-siderable number of phylogenetic hypothesesthat we would rather advertise in order toattract more work. Moreover, we strongly be-lieve that progress in the scientific under-standing of these frogs will be achieved bypartitioning ‘‘Eleutherodactylus’’ into multi-ple monophyletic genera. Indeed, althoughevidence for the monophyly of the nominal

29 Complicating this, Adelophryne and Phyzelaphryne(Hoogmoed and Lescure, 1984) and at least some mem-bers of the Eleutherodactylus diastema group (T. Grant,personal obs.) possess conspicuously pointed tips on thetoe discs. This suggests that, beyond reformulation ofgenera within former ‘‘Eleutherodactylus’’ (sensu lato),some of the other genera will have to be redemarcated.

subgenera is meager or lacking, several lessinclusive species groups are delimited bysynapomorphy, and we anticipate that severalof these will be recognized formally asknowledge increases.

As a preliminary step in this direction, wetake the action of treating all of the nominalsubgenera of ‘‘Eleutherodactylus’’ (sensulato) as genera. (As noted in the ‘‘Review ofCurrent Taxonomy’’, Crawford and Smith,2005, on the basis of molecular data, recentlyconsidered Craugaster a genus.) As dis-cussed later, this is only partially successfulinasmuch as it leaves ‘‘Eleutherodactylus’’,‘‘Euhyas’’, and ‘‘Pelorius’’ of dubiousmonophyly or even demonstrated polyphyly(denoted by the quotation marks). Neverthe-less, this illuminates the attendant problemsof brachycephalid relationships and leaves usin an operationally healthier place thanwhere we had been. That is, the extent of ourknowledge of monophyly is represented bythe recognition of Brachycephalidae and thedemonstrably monophyletic units within it,and other genera are merely provisional unitsof convenience. (See appendix 7 for newcombinations produced by these genericchanges.)

Among the previous subgenera of‘‘Eleutherodactylus’’ (sensu lato) we found[358] Syrrhophus to be monophyletic (testedby inclusion of S. marnocki of the S. mar-nocki group of J.D. Lynch and Duellman,1997, and S. nitidus of the S. nitidus groupof J.D. Lynch and Duellman, 1997; see ap-pendix 5 for molecular synapomorphies).Our sole representative of the Antillean Eu-hyas (represented by E. planirostris of the E.ricordii group of J.D. Lynch and Duellman,1997) did not allow us to test the monophylyof this taxon.

In an admittedly weak test of monophyly,we included two species of Eleutherodacty-lus (sensu stricto), both of the E. binotatusgroup: E. binotatus and E. juipoca. Never-theless, we refuted the monophyly of‘‘Eleutherodactylus’’ (sensu stricto) (and theE. binotatus group), showing E. binotatusand E. juipoca to be more closely related toIschnocnema and Brachycephalus, respec-tively. Although this finding was unantici-pated (but see above regarding Ischnocne-ma), no synapomorphy has yet been identi-


fied to unite the species of ‘‘Eleutherodac-tylus’’ (sensu stricto) (J.D. Lynch andDuellman, 1997; but see below), and the E.binotatus group in particular was delimitedonly by overall similarity and biogeographicproximity (J.D. Lynch, 1976).

It should be noted that, although no syn-apomorphy is known for ‘‘Eleutherodacty-lus’’ (sensu stricto), J.D. Lynch and Duell-man (1997) argued that a large number of itsspecies form a clade delimited by the fifthtoe being much longer than the third. Insofaras neither of the species of ‘‘Eleutherodac-tylus’’ (sensu stricto) in our sample exhibitsthis state, this hypothesis remains to be testedcritically.

Our results also indicate that Craugastor,the so-called Middle American clade delim-ited by the synapomorphic ‘‘E’’ pattern ofthe m. adductor mandibulae (J.D. Lynch,1986), was polyphyletic. However, the Mid-dle American species we sampled, repre-senting 5 of the 11 Middle American groupsrecognized by J.D. Lynch (2000)—C. bufon-iformis, C. bufoniformis group; C. alfredi, C.alfredi group; C. augusti, C. augusti group;C. punctariolus and C. cf. ranoides, C. ru-gulosus group; and C. rhodopis, C. rhodopisgroup—were monophyletic, and the sole out-lier was the Bolivian species ‘‘Eleuthorodac-tylus’’ pluvicanorus. De la Riva and Lynch(1997) placed this species and ‘‘E.’’ frauda-tor (grouped subsequently with ‘‘E.’’ ash-kapara as the ‘‘E.’’ fraudator group by Koh-ler, 2000) in Craugastor on the basis of itsjaw musculature, although they noted that noother species of Craugastor is known to ex-tend farther south than northwestern Colom-bia (e.g., C. bufoniformis; J.D. Lynch, 1986;J.D. Lynch and Duellman, 1997), a possiblebut certainly unexpected biogeographic sce-nario.

Dissection of the jaw muscles of two spec-imens of ‘‘E.’’ pluvicanorus (both sides ofAMNH A165194, right side of AMNHA165211) showed it to differ from the ‘‘E’’pattern of other species (T. Grant, personalobs.). A single muscle (the m. adductor man-dibulae externus) originates on the zygomaticramus of the squamosal, and the mandibularramus of the trigeminal nerve (V3) does notlie lateral (superficial) to it (so it is not the‘‘S’’ pattern), but it does not extend poster-

oventrad between that muscle and the deeperm. adductor mandibulae posterior (‘‘E’’ mus-culature), either. Instead, V3 lies entirely pos-terior to both muscles and runs ventrolateradtoward the jaw—that is, it does not runaround the anterior face of the m. adductormandibulae posterior. J.D. Lynch (1986) re-ported a similar pattern for one of three spec-imens of ‘‘E.’’ angelicus and one of twospecimens of ‘‘E.’’ maussi (now ‘‘E.’’ bipor-catus—Savage and Myers, 2002; the otherspecimens exhibited the ‘‘E’’ condition), andfurther sampling could show the present ob-servations to be individual anomalies as well.It should also be noted that we have not ex-amined the m. adductor mandibulae of theother species of the ‘‘E.’’ fraudator group.Nevertheless, these observations are reasonenough to question the placement of this Bo-livian group in Craugastor, which is furthervalidated by the strongly supported place-ment of ‘‘E.’’ pluvicanorus well outside ofthe Craugastor clade. Consequently, we re-move the ‘‘E.’’ fraudator group from Crau-gastor and return it to the already demon-strably polyphyletic ‘‘Eleutherodactylus’’,where J.D. Lynch and McDiarmid (1987)placed ‘‘E.’’ fraudator originally. Anotheroption would be to name the ‘‘E.’’ fraudatorgroup as a new genus. However, the rela-tionship of this group to ‘‘E.’’ mercedesae(which shares with this group the occurrenceof a frontoparietal fontanelle; J.D. Lynch andMcDiarmid, 1987) and the hundreds of otherunsampled brachycephalids is unknown, andgiven that its placement in ‘‘Eleutherodac-tylus’’ (sensu stricto) simply inflicts addition-al damage on an already polyphyletic genus,we consider it to be premature to name thisgroup at present.

With the exclusion from nominal Crau-gastor of the ‘‘E.’’ fraudator group, whichJ.D. Lynch (2000) considered to be outsidethe scope of his paper, Craugastor corre-sponds to the clade subtended (appendix 5)our topology to branch 351, and generallycorroborates the topology of Craugastor sug-gested by J.D. Lynch (2000). Within Crau-gastor, J.D. Lynch (2000: 151, his fig. 9)proposed a clade delimited by extreme sex-ual dimorphism in tympanum size. In ourtree C. alfredi, C. augusti, and C. bufonifor-mis, all with nondimorphic tympana, form a


basal grade, while C. punctariolus, C. rho-dopis, and C. cf. ranoides, with strongly sex-ually dimorphic tympana, are monophyletic.

‘‘Pelorius’’ has had four allozymic fea-tures suggested to be synapomorphies(Hedges, 1989), but as noted earlier, this isbased on sparse taxon sampling. J.D. Lynch(1996) suggested not only that are there nomorphological synapomorphies of thisgroup, but that there is a lot less than meetsthe eye in Hedges’ (1989) study, particularlywith respect to how the allozymic data wereinterpreted. Alternatively, J.D. Lynch (1996:153) suggested that ‘‘Pelorius’’ is unitedwith at least some ‘‘Euhyas’’ by the posses-sion of an epiotic flange. So, the evidence for‘‘Pelorius’’ and ‘‘Euhyas’’ monophyly seemsto be equivocal as well.

In summary, we recognize 16 genera with-in Brachycephalidae. Based on our limitedsampling, we recognize as monophyleticCraugastor, Syrrhophus, Phrynopus, as du-biously monophyletic ‘‘Euhyas’’ and ‘‘Pelor-ius’’; and as demonstrably nonmonophyletic‘‘Eleutherodactylus’’ (sensu stricto). We in-cluded in our analysis, but did not test themonophyly of Barycholos, Brachycephalus,and Ischnocnema, all of which fall within‘‘Eleutherodactylus’’ (sensu stricto). We didnot include any representative of Adelophry-ne, Atopophrynus, Dischidodactylus, Eupar-kerella, Geobatrachus, Phyllonastes, andPhyzelaphryne. (See appendix 7 for newcombinations produced by these genericchanges.)

[366] CLADOPHRYNIA NEW TAXON

ETYMOLOGY: Clados (Greek: branch) 1phrynos (Greek: toad), referring to the ob-servation that this taxon is a clade but notobviously united by any morphological syn-apomorphies.

IMMEDIATELY MORE INCLUSIVE TAXON:[349] Meridianura new taxon.

SISTER TAXON: [350] BrachycephalidaeGunther, 1858.

RANGE: Coextensive with Anura, exclud-ing New Zealand, Madagascar, and the Sey-chelles.

CONCEPT AND CONTENT: Cladophrynia is amonophyletic taxon composed of [367]

Cryptobatrachidae new family and [368]Tinctanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis (from Haas, 2003) optimize on thisbranch, so its recognition depends entirely onmolecular evidence, which is decisive. (Seeappendix 5 for molecular synapomorphiesassociated with this taxon.)

[367] FAMILY: CRYPTOBATRACHIDAE NEWFAMILY

IMMEDIATELY MORE INCLUSIVE TAXON:[366] Cladophrynia new taxon.

SISTER TAXON: [368] Tinctanura new tax-on.

RANGE: Northern Andes and Sierra SantaMarta of Colombia; moderate to high ele-vations of the Guayana Shield in Guyana,Venezuela, and adjacent Brazil.

CONTENT: Cryptobatrachus Ruthven, 1916(type genus of the family); Stefania Rivero,1968 ‘‘1966’’.

CHARACTERIZATION AND DIAGNOSIS: Cryp-tobatrachidae is characterized by claw-shaped terminal phalanges and intercalary el-ements (like Hylidae, Hemiphractidae, andAmphignathodontidae) and endotrophic lar-vae that develop on the back of the adult(like Hemiphractidae and Amphignathodon-tidae). Unlike Amphignathodontidae, but likeHemiphractidae, Cryptobatrachidae does notdevelop a dorsal pouch but differs fromHemiphractus in lacking fang-like teeth.None of the morphological characters in ouranalysis (from Haas, 2003) optimize on thisbranch, because no member of Cryptoba-trachidae was studied by Haas (2003). (Mo-lecular transformations associated with thistaxon are listed in appendix 5.)

[368] TINCTANURA NEW TAXON

ETYMOLOGY: Tincta (Greek: colored, tint-ed) 1 anoura (Greek: frog), denoting the factthat many of the frogs in this clade are spec-tacularly colored (although some groupswithin it—notably, most species in Bufoni-dae—certainly lack this characteristic).

IMMEDIATELY MORE INCLUSIVE TAXON:[366] Cladophrynia new taxon.

SISTER TAXON: [367] Cryptobatrachidaenew family.


RANGE: Cosmopolitan in temperate andtropical areas of the continents, Madagascar,Seychelles, and New Zealand.

CONCEPT AND CONTENT: Tinctanura is amonophyletic taxon containing [369] Am-phignathodontidae Boulenger, 1882, and[371] Athesphatanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimized on this branch, so its recog-nition depends entirely on molecular data.(See appendix 5 for molecular synapomor-phies associated with this taxon.)

[369] FAMILY: AMPHIGNATHODONTIDAEBOULENGER, 1882

Amphignathodontidae Boulenger, 1882: 449.Type genus: Amphignathodon Boulenger, 1882.

Gastrothecinae Noble, 1927: 93. Type genus:Gastrotheca Fitzinger, 1843.

Opisthodelphyinae Lutz, 1968: 13. Type genusOpisthodelphys Gunther, 1859 ‘‘1858’’.

IMMEDIATELY MORE INCLUSIVE TAXON:[368] Tinctanura new taxon.

SISTER TAXON: [371] Athesphatanura newtaxon.

RANGE: Costa Rica and Panama, northernand western South America southward tonorthwestern Argentina; eastern and south-eastern Brazil; Trinidad and Tobago.

CONTENT: Flectonotus Miranda-Ribeiro,1920; Gastrotheca Fitzinger, 1843.

CHARACTERIZATION AND DIAGNOSIS: Haas(2003) suggested the following charactersthat optimize on his exemplar Gastrothecariobambae of amphignathodontids and maybe synapomorphies of Amphignathodonti-dae: (1) m. subarcualis rectus I portion withorigin from ceratobranchial III absent (Haas35.0); (2) functional larval m. levator man-dibulae lateralis present (Haas 56.0); (3) ra-mus mandibularis (cranial nerve V3) poste-rior runs through the m. levator mandibulaeexternus group (Haas 65.1); (4) posterior pal-atoquadrate clearly concave with bulging andpronounced margin (Haas 68.1); (5) proces-sus pseudopterygoideus long (Haas 77.2);and (6) dorsal connection from processusmuscularis to commissura quadrato-orbitalis(Haas 78.2). All of these have the potentialto be synapomorphies of Amphignathodon-tidae, although some or all may be locatedas less inclusive levels of universality within

the group. Amphignathodontidae can be dif-ferentiated from other frog taxa by its pos-session of a dorsal pouch for brooding eggs,a likely synapomorphy. Molecular synapo-morphies are presented in appendix 5.

[371] ATHESPHATANURA NEW TAXON

ETYMOLOGY: Athesphatos (Greek: inex-pressible, marvelous) 1 anoura (Greek: tail-less, i.e., frog), denoting the fact that eventhough much research has been done onthese frogs, they continue to surprise.

IMMEDIATELY MORE INCLUSIVE TAXON:[368] Tinctanura new taxon.

SISTER TAXON: [369] Amphignathodonti-dae Boulenger, 1882.

RANGE: Coextensive with Anura, exclud-ing Madagascar, Seychelles, and New Zea-land.

CONCEPT AND CONTENT: As here conceived,Athesphatanura is a monophyletic groupcomposed of [372] Hylidae Rafinesque,1815, and [424] Leptodactyliformes newtaxon.

CHARACTERIZATION AND DIAGNOSIS: Athes-phatanura is a monophyletic group composedof Hylidae and the bulk of the former non-brachycephalid, non-batrachophrynid lepto-dactylids. The following characters suggest-ed by Haas (2003) on the basis of a relativelysmall number of exemplars are potential syn-apomorphies of this group: (1) pars alaris andpars corporis separated by deep distal notch(Haas 86.1); (2) commissura proximalis IIabsent (Haas 110.0); and (3) commissuraproximalis III absent (Haas 111.0). In addi-tion, molecular synapomorphies are summa-rized in appendix 5.

[372] FAMILY: HYLIDAE RAFINESQUE, 1815

IMMEDIATELY MORE INCLUSIVE TAXON:[371] Athesphatanura new taxon.

SISTER TAXON: [424] Leptodactyliformesnew taxon.

RANGE: North and South America, theWest Indies, and the Australo-Papuan Re-gion; temperate Eurasia, including extremenorthern Africa and the Japanese Archipela-go.

CONTENT: [386] Hylinae Rafinesque, 18151 [373] ([374] Phyllomedusinae Gunther,1858 1 [377] Pelodryadinae Gunther, 1858).


CHARACTERIZATION AND DIAGNOSIS: Mor-phological characters in our analysis (fromHaas, 2003) that optimize on this branch are(1) m. mandibulolabialis superior present(Haas 50.1); and (2) shape of arcus subocu-laris in cross-section with margin slopingventrally and laterally (Haas 82.1). As notedby Haas (2003), traditional characters of Hy-lidae, such as claw-shaped terminal phalan-ges and intercalary phalangeal elements, donot optimize as synapomorphies of thisgroup because they are shared with Crypto-batrachidae, Hemiphractidae, and Amphig-nathodontidae.

COMMENT: Because Hylidae is so large, wedeviate from our practice of providing ac-counts only for families and higher taxa andhere provide accounts for the three nominalsubfamilies of Hylidae, which have beenvery recently revised (Faivovich et al.,2005).

[386] SUBFAMILY: HYLINAE RAFINESQUE, 1815

Hylarinia Rafinesque, 1815: 78. Type genus: Hy-laria Rafinesque, 1814.

Hylina Gray, 1825: 213. Type genus: Hyla Lau-renti, 1768.

Dryophytae Fitzinger, 1843: 31. Type genus: Dry-ophytes Fitzinger, 1843.

Dendropsophi Fitzinger, 1843: 31. Type genus:Dendropsophus Fitzinger, 1843.

Pseudae Fitzinger, 1843: 33. Type genus: PseudisWagler, 1830.

Acridina Mivart, 1869: 292. Type genus: AcrisDumeril and Bibron, 1841.

Cophomantina Hoffmann, 1878: 614. Type genus:Cophomantis Peters, 1870.

Lophiohylinae Miranda-Ribeiro, 1926: 64. Typegenus: Lophyohyla Miranda-Ribeiro, 1926.

Triprioninae Miranda-Ribeiro, 1926: 64. Type ge-nus: Triprion Cope, 1866.

Trachycephalinae Lutz, 1969: 275. Type genus:Trachycephalus Tschudi, 1838.

IMMEDIATELY MORE INCLUSIVE TAXON:[372] Hylidae Rafinesque, 1815.

SISTER TAXON: [373] unnamed taxon([374] Phyllomedusinae Gunther, 1858 1[377] Pelodryadinae Gunther, 1858).

RANGE: North and South America, theWest Indies; temperate Eurasia, including ex-treme northern Africa and the Japanese Ar-chipelago.

CONTENT: Acris Dumeril and Bibron,1841; Anotheca Smith, 1939; Aparaspheno-

don Miranda-Ribeiro, 1920; AplastodiscusLutz In Lutz, 1950; Argenteohyla Trueb,1970; Bokermannohyla Faivovich et al.,2005; Bromeliohyla Faivovich et al., 2005;Charadrahyla Faivovich et al., 2005; Cory-thomantis Boulenger, 1896; DendropsophusFitzinger, 1843; Duellmanohyla Campbelland Smith, 1992; Ecnomiohyla Faivovich etal., 2005; Exerodonta Brocchi, 1879; HylaLaurenti, 1768; Hyloscirtus Peters, 1882;Hypsiboas Wagler, 1830; Isthmohyla Fai-vovich, et al., 2005; Itapotihyla Faivovich etal., 2005; Lysapsus Cope, 1862; Megasto-matohyla Faivovich et al., 2005; MyersiohylaFaivovich et al., 2005; Nyctimantis Boulen-ger, 1882; Osteocephalus Steindachner,1862; Osteopilus Fitzinger, 1843; Phyllody-tes Wagler, 1830; Plectrohyla Brocchi, 1877;Pseudacris Fitzinger, 1843; Pseudis Wagler,1830; Ptychohyla Taylor, 1944; ScarthylaDuellman and de Sa, 1988; Scinax Wagler,1830; Smilisca Cope, 1865 (including Pter-nohyla Boulenger, 1882); SphaenorhynchusTschudi, 1838; Tepuihyla Ayarzaguena, Sen-aris, and Gorzula, 1993 ‘‘1992’’; TlalocohylaFaivovich et al., 2005; TrachycephalusTschudi, 1838 (including Phrynohyas Fitzin-ger, 1843); Triprion Cope, 1866; XenohylaIzecksohn, 1998 ‘‘1996’’.

CHARACTERIZATION AND DIAGNOSIS: Onlyone morphological character in our analysisoptimizes on this taxon: two clearly separateheads of m. subarcualis obliquus originatefrom ceratobranchialia II and III (character31.1 of Haas, 2003). Faivovich et al. (2005)noted another morphological synapomorphy:tendo superficialis digiti V (manus) with anadditional tendon that arises ventrally fromthe m. palmaris longus (da Silva In Duell-man, 2001) and, likely, the 24 chromosomecondition. Nevertheless, substantial numbersof molecular synapomorphies exist (appen-dix 5).

SYSTEMATIC COMMENTS: The latest revisionof this taxon was by Faivovich et al. (2005),who provided a much larger analysis, densertaxonomic sampling, and more moleculardata per terminal than we do. Our results,therefore, do not constitute a sufficient testof those results. Nevertheless, differenceswere noted. We did not find either Hypsiboasor Hyla to be monophyletic. We presume thatthese differences are due to our less-dense


taxon sampling and application of fewer datathan in the earlier study (Faivovich et al.,2005).

Faivovich et al. (2005) recognized fourtribes within Hylinae: (1) CophomantiniHoffmann, 1878 (Aplastodiscus, Bokerman-nohyla, Hyloscirtus, Hypsiboas, and Myer-siohyla); (2) Dendropsophini Fitzinger, 1843(Dendropsophus, Lysapsus, Pseudis, Scar-thyla, Scinax, Sphaenorhynchus, and Xeno-hyla); (3) Hylini Rafinesque, 1815 (Acris,Anotheca, Bromeliohyla, Charadrahyla,Duellmanohyla, Ecnomiohyla, Exerodonta,Hyla, Isthmohyla, Megastomatohyla, Plec-trohyla, Pseudacris, Ptychohyla, Smilisca,Tlalocohyla, Triprion); and (4) LophiohyliniMiranda-Ribeiro, 1926 (Aparasphenodon,Argenteohyla, Corythomantis, Itapotihyla,Nyctimantis, Osteocephalus, Osteopilus,Phyllodytes, Tepuihyla, and Trachycephal-us). We refer the reader to that revision fora detailed discussion of the phylogenetics ofthe group.

[377] SUBFAMILY: PELODRYADINAEGUNTHER, 1858

Pelodryadidae Gunther, 1858b: 346. Type genus:Pelodryas Gunther, 1858.

Chiroleptina Mivart, 1869: 294. Type genus: Chi-roleptes Gunther, 1858.

Cycloraninae Parker, 1940: 12. Type genus: Cy-clorana Steindachner, 1867.

Nyctimystinae Laurent, 1975: 183. Type genus:Nyctimystes Stejneger, 1916.

IMMEDIATELY MORE INCLUSIVE TAXON:[373] unnamed taxon composed of [374]Phyllomedusinae Gunther, 1858 1 [377] Pe-lodryadinae Gunther, 1858).

SISTER TAXON: [374] PhyllomedusinaeGunther, 1858.

RANGE: Australia and New Guinea; intro-duced into New Zealand.

CONTENT: Litoria Tschudi, 1838 (includingCyclorana Steindachner, 1867, and Nycti-mystes Stejneger, 1916; see Systematic Com-ments and appendix 7).

CHARACTERIZATION AND DIAGNOSIS: Nomorphological character optimizes unambig-uously as a synapomorphy of Pelodryadinae.The molecular data, however, are decisive(see Systematic Comments below and appen-dix 5).

SYSTEMATIC COMMENTS: Evidence of

monophyly of Pelodryadinae remains unset-tled. One character suggested by Haas (2003)that may optimize on this branch is larvalupper labial papillation complete (Haas 8.0),which is a reversal from the Phthanobatra-chian condition. However, the number of pe-lodryadines with complete papillation issmall, and because Cruziohyla and Phryno-medusa (basal taxa in Phyllomedusinae) alsohave complete papillation it may be that thischaracteristic is a synapomorphy of Phyllo-medusinae 1 Pelodryadinae. Alternatively,more dense sampling may show convergencebetween the phyllomedusinae condition andthat found in pelodryadines, with this con-dition in pelodryadines, a character of somesubset of ‘‘Litoria’’ 1 Nyctimystes 1 Cy-clorana.

Haas (2003) recovered the subfamily asparaphyletic with respect to phyllomedusineson the basis of six exemplars. Tyler (1971c)noted the presence of supplementary ele-ments of the m. intermandibularis in both Pe-lodryadinae (apical) and Phyllomedusinae(posterolateral). These characters were inter-preted by Duellman (2001) as nonhomolo-gous and therefore synapomorphies of theirrespective groups. If these conditions are ho-mologues, however, the polarity between thetwo states is ambiguous because either, thepelodryadine or the phyllomedusinae condi-tion, might be ancestral at the Phyllomedu-sinae 1 Pelodryadinae level of generality(Faivovich et al., 2005).

One character in our analysis (originallyfrom Haas, 2003) optimizes on an [373] un-named taxon joining Pelodryadinae andPhyllomedusinae: ramus mandibularis (cra-nial nerve V3) posterior runs through m. le-vator mandibulae externus group (Haas65.1). As noted by Faivovich (2005), how-ever, another morphological synapomorphyof Phyllomedusinae 1 Pelodryadinae is thepresence of a tendon of the m. flexor ossismetatarsi II arising only from distal tarsi 2–3. See also appendix 5 for molecular syna-pomorphies of Phyllomedusinae 1 Pelodry-adinae.

The extensive paraphyly of ‘‘Litoria’’ withrespect to Cyclorana and ‘‘Nyctimystes’’ re-mains the elephant in the room for Australianherpetology, and for reasons that escape usthis spectacular problem has largely been ig-


nored until recently; S. Donnellan and col-laborators are currently addressing pelodry-adine relationships. A further dimension ofthis problem is that our results not only rejectLitoria monophyly; they also show Nycti-mystes nonmonophyly, even though morpho-logical evidence would suggest that Nycti-mystes is monophyletic. Our resolution atthis time is to consider Nyctimystes as a syn-onym of Litoria and Cyclorana as a subge-nus within Litoria. It is unfortunate to haveto embrace such an uninformative taxonomy,but the generic taxonomy as it exists is se-riously misleading and no good alternativespresent themselves pending the resolution ofthis problem by S. Donnellan and collabo-rators. (See appendix 7 for new combinationsproduced by these generic changes.)

[374] SUBFAMILY: PHYLLOMEDUSINAEGUNTHER, 1858

Phyllomedusidae Gunther, 1858b: 346. Type ge-nus: Phyllomedusa Wagler, 1830.

Pithecopinae Lutz, 1969: 274. Type genus: Pithe-copus Cope, 1866.

IMMEDIATELY MORE INCLUSIVE TAXON:[373] unnamed taxon composed of [374]Phyllomedusinae Gunther, 1858 and [377]Pelodryadinae Gunther, 1858.

SISTER TAXON: [377] Pelodryadinae Gun-ther, 1858.

RANGE: Tropical Mexico to Argentina.CONTENT: Agalychnis Cope, 1864; Cru-

ziohyla Faivovich et al., 2005; HylomantisPeters, 1873 ‘‘1872’’; Pachymedusa Duell-man, 1968; Phasmahyla Cruz, 1991‘‘1990’’; Phrynomedusa Miranda-Ribeiro,1923; Phyllomedusa Wagler, 1830.

CHARACTERIZATION AND DIAGNOSIS: Phyl-lomedusinae is a group of bizarre hylidscharacterized by vertical pupils and a loris-like movement. Haas (2003) suggested sev-eral larval characters that are good candi-dates for being synapomorphies of Phyllo-medusinae, although they could also be syn-apomorphies of less inclusive groups: (1)suspensorium ultralow (Haas 71.3); (2) pro-cessus pseudopterygoideus short (Haas77.1); (3) arcus subocularis with three dis-tinct processes (Haas 81.2); (4) cartilaginousroofing of the cavum cranii with taeniaetransversalis et medialis (fenestrae parietales)

present (Haas 96.2); (5) cleft between hyalarch and branchial arch I closed (Haas123.0); and (6) pupil shape vertically ellip-tical (Haas 143.0). Additionally, Faivovich(2005) noted that ventrolateral position of thespiracle is a likely synapomorphy.

[424] LEPTODACTYLIFORMES NEW TAXON

ETYMOLOGY: Leptodactyli- (with referenceto the former leptodactylids [Greek: leptos 5narrow 1 dactylos 5 toe]) 1 formes [Greek:shaped]).

IMMEDIATELY MORE INCLUSIVE TAXON:[371] Athesphatanura new taxon.

SISTER TAXON: [372] Hylidae Rafinesque,1815.

RANGE: Coextensive with Anura, exclud-ing Australo-Papuan region, Madagascar,Seychelles, and New Zealand.

CONCEPT AND CONTENT: Leptodactylifor-mes is a monophyletic taxon composed of[425] Diphyabatrachia new taxon and [440]Chthonobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Be-yond our molecular data, no characters in ouranalysis (originally from Haas, 2003) opti-mize on this branch. (See appendix 5 for mo-lecular synapomorphies of this taxon.) J.D.Lynch (1973) reported most of the taxa out-side of Leptodactyliformes to have moder-ately to broadly dilated sacral diapophyses,so round sacral diapophyses may be a syna-pomorphy of this taxon, although reversed inCentrolenidae and Bufonidae.

[425] DIPHYABATRACHIA NEW TAXON

ETYMOLOGY: Diphya- (Greek: two-nature)1 batrachos (Greek: frog), referencing thefact that the two components of this taxon(Centrolenidae and Leptodactylidae) havevery different morphologies and life-histo-ries.

IMMEDIATELY MORE INCLUSIVE TAXON:[424] Leptodactyliformes new taxon.

SISTER TAXON: [440] Chthonobatrachianew taxon.

RANGE: Neotropics of North, Central, andSouth America.

CONCEPT AND CONTENT: Diphyabatrachia isa monophyletic taxon containing [426] Cen-trolenidae Taylor, 1951, and [430] Leptodac-tylidae Werner, 1896 (1838).


CHARACTERIZATION AND DIAGNOSIS: Nomorphological characters suggested by Haas(2003) optimize on this branch, althoughsubstantial amounts of molecular evidenceare synapomorphic (see appendix 5).

[426] FAMILY: CENTROLENIDAE TAYLOR, 1951

Centrolenidae Taylor, 1951: 36. Type genus: Cen-trolene Jimenez de la Espada, 1872.

Allophrynidae Goin et al., 1978: 240. Type genus:Allophryne Gaige, 1926. New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[425] Diphyabatrachia new taxon.

SISTER TAXON: [430] Leptodactylidae Wer-ner, 1896 (1838).

RANGE: Tropical southern Mexico to Bo-livia, northeastern Argentina, and southeast-ern Brazil.

CONTENT: Allophryne Gaige, 1926; ‘‘Cen-trolene’’ Jimenez de la Espada, 1872 (seeSystematic Comments); ‘‘Cochranella’’ Tay-lor, 1951; Hyalinobatrachium Ruiz-Carran-za and Lynch, 1991.

CHARACTERIZATION AND DIAGNOSIS: Haas(2003) suggested several characters for hisexemplar, Cochranella granulosa, that arecandidates for being synapomorphies of Cen-trolenidae (including Allophryne, which Haasdid not examine): (1) anterior insertion of m.subarcualis rectus II–IV on ceratobranchialIII (Haas 37.2); (2) larval m. levator man-dibulae externus present as one muscle body(Haas 54.0); (3) processus anterolateralis ofcrista parotica absent (Haas 66.0); (4) partescorpores medially separate (Haas 87.0); (5)cleft between hyal arch and branchial arch Iclosed (Haas 123.0); and (6) terminal pha-langes T-shaped (Haas 156.2). Cochranellagranulosa, Haas’ examplar species, lacks lar-val labial keratodonts (Haas 3.0) but this isunlikely to be a synapomorphy of the group(Altig and McDiarmid, 1999). Burton(1998a) provided evidence suggesting thatthe ventral origin of the m. flexor teretes IIIrelative to the corresponding m. transversimetacarporum I is a synapomorphy. Regard-less of whether all of these only apply toCentroleninae, there are substantial numbersof molecular synapomorphies (see appendix5).

SYSTEMATIC COMMENTS: The association ofAllophryne with centrolenids was first made

on the basis of anatomical and external sim-ilarity (Noble, 1931), but subsequent molec-ular work (Austin et al., 2002; Faivovich etal., 2005) has substantiated this relationship.We recognize within Centrolenidae the sub-families Allophryninae for Allophryne, and[427] Centroleninae, for Centrolene, Coch-ranella, and Hyalinobatrachium. Centrolen-inae is united by the possession of intercalaryelements between the ultimate and penulti-mate phalanges, fusion of the fibula and tibia(Taylor, 1951; but see Sanchız and de laRiva, 1993), and the presence of a medialprojection on the third metacarpal (Hayesand Starrett, 1981 ‘‘1980’’).

Our results showed ‘‘Centrolene’’ to beparaphyletic with respect to ‘‘Cochranella’’.Morphological evidence for the monophylyof Centrolene consists of a single synapo-morphy, the presence of a humeral spine inadult males (Ruiz-Carranza and Lynch,1991a), which is conspicuously present (al-beit morphologically different) in both ‘‘Cen-trolene’’ geckoideum and ‘‘Centrolene’’ pro-soblepon (Ruiz-Carranza and Lynch, 1991b:3, their fig. 1). Nevertheless, the humerus ofsome species of Cochranella exhibits a con-spicuously developed ventral crest (e.g., C.armata, C. balionota, and C. griffithsi; J.D.Lynch and Ruiz-Carranza, 1997 ‘‘1996’’; seealso Ruiz-Carranza and Lynch, 1991a),which at least suggests that coding this char-acter as the presence or absence of a humeralspine may be simplistic. Indeed, the basis isunclear for coding the bladelike ‘‘spine’’ ofCentrolene grandisonae as the same condi-tion as the smooth, rounded, and protrudingspine of C. geckoideum and as distinct fromthe strongly developed bladelike crest of C.armata. We urge centrolenid workers to ex-amine the different ‘‘spines’’ in greater detailand to evaluate hypothesized homologiescarefully. (Note that our findings do not ruleout homology of the humeral spines. It isequally parsimonious for it to have beengained independently in the two lineages of‘‘Centrolene’’ or gained once and lost inCochranella.)

We did not test the monophyly of Coch-ranella or Hyalinobatrachium. No synapo-morphy has been identified for Cochranella(Ruiz-Carranza and Lynch, 1991a) and Darstand Cannatella (2004; fig. 22) have presented


molecular evidence for its nonmonophyly,whereas Hyalinobatrachium is delimited bythe occurrence of a bulbous liver (Ruiz-Car-ranza and Lynch, 1991a, 1998).

Given our topology, the questions sur-rounding the homology of the humeralspines, and the lack of evidence for themonophyly of Cochranella, we were temptedto place Cochranella in the synonymy ofCentrolene. A behavioral synapomorphy forthe inclusive clade is male–male physicalcombat undertaken by hanging upside downby the feet and grappling venter-to-venter(Bolıvar-G. et al., 1999), a behavior other-wise known only in phyllomedusines (Py-burn, 1970; Lescure et al., 1995; Wogel etal., 2004) and some species of Hypsiboas andDendropsophus (Hylidae; J. Faivovich andC.F.B. Haddad, personal obs.). However, theresulting genus, though monophyletic, wouldbe unwieldy (with 100 species). In light ofthe poverty of our taxon sampling, and ouranticipation of more thorough phylogeneticstudies of this charismatic group, we retainthe current taxonomy and place quotationmarks around ‘‘Centrolene’’ to denote its ap-parent paraphyly and around ‘‘Cochranella’’to denote its nonmonophyly as well.

[430] FAMILY: LEPTODACTYLIDAE WERNER,1896 (1838)

Cystignathi Tschudi, 1838: 26, 78. Type genus:Cystignathus Wagler, 1830.

Leiuperina Bonaparte, 1850: 1 p. Type genus:Leiuperus Dumeril and Bibron, 1841.

Plectromantidae Mivart, 1869: 291. Type genus:Plectromantis Peters, 1862.

Adenomeridae Hoffmann, 1878: 613. Type genus:Adenomera Steindachner, 1867.

Leptodactylidae Werner, 1896: 357. Type genus:Leptodactylus Fitzinger, 1826.

Pseudopaludicolinae Gallardo, 1965: 84. Type ge-nus: Pseudopaludicola Miranda-Ribeiro, 1926.

IMMEDIATELY MORE INCLUSIVE TAXON:[425] Diphyabatrachia new taxon.

SISTER TAXON: [426] Centrolenidae Taylor,1951.

RANGE: Extreme southern USA and trop-ical Mexico throughout Central America andSouth America.

CONTENT: Edalorhina Jimenez de la Es-pada, 1871 ‘‘1870’’; Engystomops Jimenezde la Espada, 1872; Eupemphix Steindachner,

1863; Hydrolaetare Gallardo, 1963; Lepto-dactylus Fitzinger, 1826 (see SystematicComments and appendix 7 for treatment ofsubsidiary taxa and synonyms AdenomeraSteindachner, 1867, Lithodytes Fitzinger,1843, and Vanzolinius Heyer, 1974); Para-telmatobius Lutz and Carvalho, 1958; Phys-alaemus Fitzinger, 1826; Pleurodema Tschu-di, 1838; Pseudopaludicola Miranda-Ribei-ro, 1926; Scythrophrys Lynch, 1971; Somun-curia Lynch, 1978.

CHARACTERIZATION AND DIAGNOSIS: Thistaxon corresponds reasonably closely to theformer Leptodactylinae, excluding Limno-medusa (to Cycloramphidae) and addingParatelmatobius and Scythrophrys (from theformer Cycloramphinae). Most species arefound on the forest floor, although a diversityof tropical biomes are inhabited. Many spe-cies are foam-nest builders (excluding Par-atelmatobius, some Pleurodema, Pseudopa-ludicola, Scythrophrys, and Somuncuria;Barrio, 1977; Pombal and Haddad, 1999; C.Haddad, personal obs.), and this may be syn-apomorphic of the group. Several of thecharacters in our analysis (from Haas, 2003)optimize on our topology on the [431]branch subtending Physalaemus and Pleu-rodema. Because Haas did not study othermembers of our Leptodactylidae, these char-acters are candidates for being synapomor-phies of our Leptodactylidae: (1) m. subar-cualis rectus I portion with origin from cer-atobranchial III absent (Haas 35.0); and (2)dorsal connection from processus muscularisto neurocranium and pointed (Haas 78.1).

We also suggest that the bony sternum ofthe former Leptodactylinae (J.D. Lynch,1971) is a synapomorphy of this taxon, butreversed to the cartilaginous condition in the[435] branch subtending Paratelmatobius 1Scythrophrys. The bony sternum occurs in-dependently in Limnomedusa (J.D. Lynch,1971) in Cycloramphidae, and a calcifiedsternum occurs in Barycholos (Brachyce-phalidae; J.D. Lynch, 1980).

SYSTEMATIC COMMENTS: Hydrolaetare Gal-lardo, 1963, is associated with this group be-cause of its presumed association with Lep-todactylus (Heyer, 1970), although we sug-gest that this proposition needs to be evalu-ated carefully. We place Somuncuriaprovisionally in this group on the basis of the


evidence (though not the conclusions) sug-gested by J.D. Lynch (1978b), who placedSomuncuria as the sister taxon of Pleurode-ma. On the basis of our evidence, Leptodac-tylus is paraphyletic with respect to Vanzo-linius; this agrees with the results of Heyer(1998) who presented evidence to place Van-zolinius deeply within a paraphyletic Lepto-dactylus, and likely the sister taxon of Lep-todactylus diedrus. De Sa et al. (2005) alsocame to this conclusion and placed Vanzoli-nus in the synonymy of Leptodactylus. Weregard Vanzolinius as a subjective junior syn-onym of Leptodactylus. Although our dataare agnostic on the subject, Heyer (1998) andKokubum and Giaretta (2005) also presentedevidence that recognizing Adenomera ren-ders Leptodactylus paraphyletic and thatLithodytes is the sister taxon of Adenomera.On the basis of this evidence, as well as Hey-er’s (1998) and Kokubum and Giaretta’s(2005) evidence, we place Adenomera Stein-dachner, 1867, as a synonym of LithodytesFitzinger, 1843, and Lithodytes as a subgenusof Leptodactylus, without delimiting any oth-er subgenera so as not to construct or implyany paraphyletic groups (see appendix 7 fornew combinations). Leptodactylus, thereforeis equivalent to the taxon subtended bybranch 436 in our tree.

J.D. Lynch (1971: 26) noted that Pseudo-paludicola and Physalaemus (including En-gystomops and Eupemphix in his sense) sharethe feature of dextral vents in larvae, as doEdalorhina and some Paratelmatobius (Altigand McDiarmid, 1999).

[440] CHTHONOBATRACHIA NEW TAXON

ETYMOLOGY: Chthonos- (Greek: ground)1 batrachos (Greek: frog), referencing thefact that most of the included species areground-dwelling.

IMMEDIATELY MORE INCLUSIVE TAXON:[424] Leptodactyliformes new taxon.

SISTER TAXON: [425] Diphyabatrachia newtaxon.


CONCEPT AND CONTENT: Chthonobatrachiais a monophyletic group composed of [441]

Ceratophryidae Tschudi, 1838, and [448]Hesticobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the larval characters studied by Haas(2003) optimize on this branch, so the diag-nosis of this taxon rests entirely on molecularevidence. See appendix 5 for molecular syn-apomorphies.

[441] FAMILY: CERATOPHRYIDAE TSCHUDI,1838

Ceratophrydes Tschudi, 1838: 26. Type genus:Ceratophrys Wied-Neuwied, 1824.

Telmatobii Fitzinger, 1843: 31. Type genus: Tel-matobius Wiegmann, 1834. New synonym.

Stombinae Gallardo, 1965: 82. Type genus: Stom-bus Gravenhorst, 1825.

Batrachylinae Gallardo, 1965: 83. Type genus:Batrachylus Bell, 1843. New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[440] Chthonobatrachia new taxon.

SISTER TAXON: [448] Hesticobatrachia newtaxon.

RANGE: Southern Andean and tropicallowland South America from Colombia andVenezuela south to extreme southern Argen-tina and Chile.

CONTENT: Atelognathus Lynch, 1978; Ba-trachyla Bell, 1843; Ceratophrys Wied-Neu-wied, 1824; Chacophrys Reig and Limeses,1963; Insuetophrynus Barrio, 1970 (see Sys-tematic Comments); Lepidobatrachus Budg-ett, 1899; Telmatobius Wiegmann, 1834.

CHARACTERIZATION AND DIAGNOSIS: Mor-phological characters for this group were de-rived solely from Ceratophrys and Lepidob-atrachus. Inasmuch as these are very derivedtaxa, the characters in our analysis that op-timize on them are likely characters of Lep-idobatrachus 1 Ceratophrys, although someof them may optimize at other hierarchic lev-els (including Ceratophryidae in our sense)once relevant specimens have been exam-ined. Relevant morphological characters(from Haas, 2003) are (1) m. diaphragmato-praecordialis absent (Haas 25.0; a reversalfrom the phthanobatrachian condition, also inbufonids, microhylids, and some ranoids);(3) mm. levatores arcuum branchialium I andII narrow with a wide gap between them(Haas 40.0; a reversal from the phthanoba-trachian condition, also in some Litoria andAtelopus); (4) m. suspensoriohyoideus absent


(Haas 45.0; a reversal of the acosmanurancondition, also in some hylines and Atelo-pus); (5) ramus mandibularis (cranial nerveV3) runs through the m. levator mandibulaeexternus group (Haas 65.1; one of many re-versals on the overall tree); (6) anterolateralbase of processus muscularis without con-spicuous projection (Haas 86.0); (7) tectumof cavum cranii almost completely chondri-fied (Haas 96.4); (8) spicula short or absent(Haas 112.0); and (9) branchial food trapsabsent (Haas 134.0). Molecular synapomor-phies for Ceratophryidae appear in appendix5.

SYSTEMATIC COMMENTS: Within Cerato-phryidae, the association of the genera is rel-atively weak, with the exception of Lepidob-atrachus 1 Ceratophrys 1 Chacophrys andBatrachyla 1 Atelognathus.

We recognize two subfamilies within Cer-atophryidae: [442] Telmatobiinae (for Tel-matobius) and [444] Ceratophryinae. WithinCeratophryinae we recognize two tribes:[445] Batrachylini (for Atelognathus, Batra-chyla, and, presumably Insuetophrynus), and[446] Ceratophryini (for Lepidobatrachus,Ceratophrys, and Chacophrys). Ceratophryi-nae has a continuous row of papilla on theupper lip in larvae (Haas 8.0), a synapomor-phy. Batrachylini is also diagnosed on the ba-sis of molecular evidence (appendix 5), andCeratophryini is diagnosed on the basis ofmolecular evidence as well as on traditionalmorphological characters associated with thiscluster of genera (J.D. Lynch, 1971, 1982b):(1) transverse processes of anterior presacralvertebrae widely expanded; (2) cranial bonesdermosed; (3) teeth fang-like, nonpedicellate;and (4) absence of pars palatina of maxillaand premaxilla. Another character, presenceof a vertebral shield, may be a synapomor-phy of Ceratophryini although the optimi-zation of this feature is ambiguous, requiresdetailed study, and was not considered a syn-apomorphy by Lynch (1982b). The shield ispresent in Ceratophrys aurita, C. cranwelli,C. ornata, C. joazeirensis, and in Lepidoba-trachus asper and L. llanensis (in these twothe morphology of the shield is quite differ-ent from that of Ceratophrys; J. Faivovich,personal obs.), and absent in C. calcarata, C.cornuta, C. testudo, C. stolzmanni, Chaco-phrys pierottii, and Lepidobatrachus laevis.

We did not study Insuetophrynus and it istherefore only provisionally allocated to thisfamily. Lynch (1978bb), on the basis of aphylogenetic analysis of morphology, consis-tently recovered Insuetophrynus as the sistertaxon of Atelognathus, while Diaz et al.(1983) considered the relationships of Insue-tophrynus to lie with Alsodes (Cycloramphi-dae) or Telmatobius (Ceratophryidae). Thecharacters suggested by Diaz et al. (1983) insupport of their arrangement all are likelyplesiomorphies, however, so we retain thehypothesis of Lynch (1978bb) pending ad-ditional evidence.

[448] HESTICOBATRACHIA NEW TAXON

ETYMOLOGY: Hestico- (Greek: agreeable,pleasing) 1 batrachos (Greek: frog), denot-ing the agreeable nature of these frogs, par-ticularly with respect to the nature of the typegenus of their sister taxon, Ceratophryidae.

IMMEDIATELY MORE INCLUSIVE TAXON:[440] Chthonobatrachia new taxon.

SISTER TAXON: [441] CeratophryidaeTschudi, 1838.


CONCEPT AND CONTENT: Hesticobatrachia isa monophyletic group composed of [449]Cycloramphidae Bonaparte, 1858, and [460]Agastorophrynia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Char-acters proposed by Haas (2003) that optimizeon this branch are (1) posterior palatoquad-rate curvature clearly concave with bulgingand pronounced margin (Haas 68.1); and (2)presence of a dorsal connection from proces-sus muscularis to neurocranium ligament(Haas 78.1). Molecular synapomorphies aresummarized in appendix 5.

SYSTEMATIC COMMENTS: We did not studyRupirana Heyer, 1999, and cannot allocate it,even provisionally, although Heyer (1999)thought that it might have some kind of re-lationship, not close, with either Batrachyla(Cycloramphidae) or Thoropa (Thoropidae).The data to support either contention are am-biguous at best. The position of Rupirana re-mains to be elucidated.


[449] FAMILY: CYCLORAMPHIDAE BONAPARTE,1850

Cyclorhamphina Bonaparte, 1850: 1 p. Type ge-nus: Cycloramphus Tschudi, 1838.

Rhinodermina Bonaparte, 1850: 1 p. Type genus:Rhinoderma Dumeril and Bibron, 1841. Newsynonym, considered a junior synonym of Cy-clorhamphina Bonaparte, 1850, under Article24.2.1 (Rule of First Revisor) of the Interna-tional Code of Zoological Nomenclature(ICZN, 1999).

Hylodinae Gunther, 1858b: 346. Type genus: Hy-lodes Fitzinger, 1826. New synonym.

Alsodina Mivart, 1869: 290. Type genus: AlsodesBell, 1843. New synonym.

Grypiscina Mivart, 1869: 295. Type genus: Gry-piscus Cope, 1867 ‘‘1866’’.

Elosiidae Miranda-Ribeiro, 1923: 827. Type ge-nus: Elosia Tschudi, 1838.

Odontophrynini J.D. Lynch, 1969: 3. Type genus:Odontophrynus Reinhardt and Lutken, 1862‘‘1861’’. (Odontophrynini subsequently namedmore formally by J.D. Lynch, 1971: 142.)

IMMEDIATELY MORE INCLUSIVE TAXON:[448] Hesticobatrachia new taxon.

SISTER TAXON: [460] Agastorophrynia newtaxon.

RANGE: Southern tropical and temperateSouth America.

CONTENT: Alsodes Bell, 1843; Crossodac-tylodes Cochran, 1938; Crossodactylus Du-meril and Bibron, 1841; CycloramphusTschudi, 1838; Eupsophus Fitzinger, 1843;Hylodes Fitzinger, 1826; Hylorina Bell,1843; Limnomedusa Fitzinger, 1843; Macro-genioglottus Carvalho, 1946; MegaelosiaMiranda-Ribeiro, 1923; OdontophrynusReinhardt and Lutken, 1862 ‘‘1861’’; Pro-ceratophrys Miranda-Ribeiro, 1920; Rhinod-erma Dumeril and Bibron, 1841; ZachaenusCope, 1866.

CHARACTERIZATION AND DIAGNOSIS: One ofthe morphological characters suggested byHaas (2003) optimizes as a synapomorphy ofthis group: anterior insertion of m. subarcu-alis rectus II–IV on ceratobranchial I (Haas37.0). All decisive evidence for the existenceof this clade is molecular (see appendix 5).

SYSTEMATIC COMMENTS: Within Cyclor-amphidae we recognize two sister subfami-lies, [450] Hylodinae Gunther, 1858 (con-taining Crossodactylus, Megaelosia, and Hy-lodes) and [452] Cycloramphinae Bonaparte,1850 (for the remaining genera). Other than

molecular synapomorphies (see appendix 5),Hylodinae is diagnosed by the synapomor-phy of having a lateral vector to the alaryprocesses (J.D. Lynch, 1971: 39), T-shapedterminal phalanges, and dermal scutes on thetop of the digital discs (J.D. Lynch, 1971,1973). This latter character is also found inPetropedetidae (Ranoides) and Dendrobati-dae.

Cycloramphinae is not readily diagnosedon the basis of morphology, but it is com-posed of two tribes. The first of these is [453]Cycloramphini Bonaparte, 1850 (Cycloram-phus, Crossodactylodes, and Zachaenus),corresponding to Grypiscini Mivart, 1869, ofJ.D. Lynch (1971) with the addition of Rhi-noderma. The second is [454] Alsodini Mi-vart, 1869 (composed of the remaining gen-era). Alsodini is diagnosed by its possessionof Type II cotylar arrangement (cervical co-tyles narrowly separated with two distinct ar-ticular surfaces; J.D. Lynch, 1971). This oc-curs otherwise in Hyloides only in Batrach-ophrynidae, Limnodynastidae, Megaelosia,and Telmatobius (J.D. Lynch, 1971), so islikely synapomorphic at this level. (See ap-pendix 5 for relevant molecular synapomor-phies.)

[460] AGASTOROPHRYNIA NEW TAXON

ETYMOLOGY: Agastoro- (Greek: near kins-man) 1 phrynia (Greek: having the nature ofa toad), noting the surprisingly close rela-tionship of Dendrobatoidea and Bufonidae.

IMMEDIATELY MORE INCLUSIVE TAXON:[448] Hesticobatrachia new taxon.

SISTER TAXON: [449] Cycloramphidae Bon-aparte, 1850.


CONCEPT: Agastorophrynia is a monophy-letic taxon composed of [461] Dendrobato-idea Cope, 1865, and [469] Bufonidae Gray,1825.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters suggested byHaas (2003) optimize in a way that wouldsuggest their possible candidacy as synapo-morphies of Agastorophrynia. All decisiveevidence for the recognition of this taxa is


molecular. These molecular synapomorphiesare summarized in appendix 5.

[461] SUPERFAMILY: DENDROBATOIDEA COPE,1865

IMMEDIATELY MORE INCLUSIVE TAXON:[460] Agastorophrynia new taxon.

SISTER TAXON: [469] Bufonidae Gray,1825.

RANGE: Central America (Nicaragua toPanama) and South America (Guianas, Am-azon drainage, south to Bolivia and south-eastern Brazil).

CONTENT: Thoropidae new family and[462] Dendrobatidae Cope, 1865.

CHARACTERIZATION AND DIAGNOSIS: Evi-dence for Dendrobatoidea is derived entirelyfrom DNA sequence data, as summarized inappendix 5.

SYSTEMATIC COMMENT: The sister group re-lationship of Dendrobatidae and Thoropa, toour knowledge, has never been proposed,and this is one of the most heterodox of ourresults. No morphological synapomorphiesare apparent, and a large number of charac-ters differ between the two taxa. Neverthe-less, evidence for alternative placement ofThoropa appears to be lacking (although thelarvae of Thoropa and Cycloramphus arevery similar and semiterrestrial; Haddad andPrado, 2005), and most of the characters thatdiffer between Dendrobatidae and Thoropaare either of unclear polarity or unique toDendrobatidae among hyloids (e.g., thighmusculature, epicoracoid fusion and nonov-erlap). Furthermore, it does not appear thatthis result is due to inadequate algorithmicsearching. At numerous points in the analysiswe placed Dendrobatidae, Thoropa, the hy-lodine genera, and various other cycloram-phines and bufonids in alternative arrange-ments and submitted those topologies eitheras starting points or as constraint files for fur-ther searching, but our analysis invariably ledaway from those solutions. The Bremer val-ues and jackknife frequencies are both strongfor this clade (39% and 100%, respectively).The arrangement Thoropa (Hylodinae 1Dendrobatidae) requires 56 extra steps, andplacing Thoropa in the more conventional ar-rangement Thoropa 1 (Hylorina 1 (Alsodes1 Eupsophus) and (Hylodinae 1 Dendroba-tidae) requires 87 extra steps. The occurrence

of paired dermal scutes atop the digits hasbeen claimed as a synapomorphy of Dendro-batidae 1 Hylodinae (e.g, Noble, 1926), butits optimization on our optimal topology re-quires only a single extra step, versus the 39steps required to disrupt the relationship be-tween Thoropa and Dendrobatidae. Insofaras there is no compelling evidence againstour optimal solution, and despite our aston-ishment at the result, we recognize these sis-ter taxa as Dendrobatoidea and leave it tofuture tests based on greater character (in-cluding morphology) and taxon sampling toassess the reality of this clade. Alternatively,we could have left Thoropa insertae sedis—an obviously deficient solution—or haveplaced it inside Dendrobatidae.

FAMILY: THOROPIDAE NEW FAMILY

IMMEDIATELY MORE INCLUSIVE TAXON:[461] Dendrobatoidea.

SISTER TAXON: [462] Dendrobatidae Cope,1865.

RANGE: Eastern, southeastern, and south-ern Brazil.

CONTENT: Thoropa Cope, 1865.CHARACTERIZATION AND DIAGNOSIS: Be-

cause this taxon was not studied by Haas(2003) none of the morphological charactersin our analysis could optimize on this branch.All evidence for the phylogenetic placementof this taxon as distinct from Cycloramphi-nae is molecular, although Thoropa larvaecan be distinguished from all near relativesby being very attenuate and flattened (J.D.Lynch, 1971: 124). For additional differentiasee J.D. Lynch (1972a).

SYSTEMATIC COMMENTS: See comment un-der Hesticobatrachia regarding Rupirana.J.D. Lynch (1971) considered Thoropa to beclosely related to Batrachyla, sharing a TypeI cotylar arrangement, although the polarityof the character was unclear in his study, anddendrobatids have the Type I condition aswell, rendering this character uninformative.

[462] FAMILY: DENDROBATIDAE COPE, 1865(1850)

Phyllobatae Fitzinger, 1843: 32. Type genus:Phyllobates Dumeril and Bibron, 1841.

Eubaphidae Bonaparte, 1850: 1 p. Type genus:Eubaphus Bonaparte, 1831.

Hylaplesidae Gunther, 1858b: 345. Type genus:


Hylaplesia Boie, 1827 (5 Hysaplesia Boie,1826).

Dendrobatidae Cope, 1865: 100. Type genus:Dendrobates Wagler, 1830.

Colostethidae Cope, 1867: 191. Type genus: Co-lostethus Cope, 1866.

Calostethina Mivart, 1869: 293. Type genus: Ca-lostethus Mivart, 1869.

IMMEDIATELY MORE INCLUSIVE TAXON:[461] Dendrobatoidea Cope, 1865.

SISTER TAXON: Thoropidae new family.RANGE: Central America (Nicaragua to

Panama) and South America (Guianas, Am-azon drainage, south to Bolivia and central,southern, and southeastern Brazil).

CONTENT: Allobates Zimmermann andZimmermann, 1988; Ameerega Bauer, 1986(including Epipedobates Myers, 1987); Aro-mobates Myers, Paolillo O., and Daly, 1991;Colostethus Cope, 1866; CryptophyllobatesLotters, Jungfer, and Widmer, 2000; Dendro-bates Wagler, 1830 (including OophagaBauer, 1988, and Ranitomeya Bauer, 1986);Mannophryne La Marca, 1992; MinyobatesMyers, 1987; Nephelobates La Marca, 1994;Phobobates Zimmermann and Zimmermann,1988; Phyllobates Dumeril and Bibron,1841.

CHARACTERIZATION AND DIAGNOSIS: Den-drobatids are well-known, mostly diurnal,terrestrial, and frequently brightly coloredfrogs that have the exotic parental behaviorof carrying tadpoles on their back to water.Likely synapomorphies of Dendrobatidae (asoptimized on our topology) from those mor-phological characters reported by Haas(2003) are (1) insertion of m. rectus cervicison proximal ceratobranchialia III and IV(Haas 39.2); (2) adrostral cartilage presentbut small (Haas 90.1); (3) cartilaginous roof-ing of the cavum cranii formed by taeniaetecti medialis only (Haas 96.5); (4) larvaepicked up at oviposition site and transportedto body of water adhering to dorsum of adult(Haas 137.1); (5) amplectic position cephalic(Haas 139.2); (6) guiding behavior (Haas142.1); (7) firmisterny (Haas 144.1); and (8)terminal phalanges T-shaped (Haas 156.2).

Some of these characters may ultimatelybe found to be synapomorphies of Dendro-batoidea, because Thoropa has not been eval-uated for these characters.

The systematics of dendrobatids is cur-

rently in a state of flux. Dendrobatid mono-phyly has been upheld consistently (e.g.,Myers and Ford, 1986; Ford, 1993; Haas,2003; Vences et al., 2003b) since first pro-posed by Noble (1926; see Grant et al.,1997), but the relationships among dendro-batids remain largely unresolved.

The most generally accepted view of den-drobatid systematics, as summarized by My-ers et al. (1991; see also Kaplan, 1997), al-locates approximately two-thirds of the spe-cies to a ‘‘basal’’ grade of usually dully col-ored, nontoxic frogs (including Aromobates,Colostethus, Mannophryne, and Nepheloba-tes), while the remaining one-third is hypoth-esized to form a clade of putatively apose-matic frogs (including Allobates, Ameere-ga30, Dendrobates, Minyobates, Phobobates,and Phyllobates).

Compelling evidence for the monophylyof most genera is lacking. This is especiallythe case for the ‘‘basal’’ taxa. The nonmon-ophyly of Colostethus has been recognizedfor decades (J.D. Lynch, 1982a; J.D. Lynchand Ruiz-Carranza, 1982), and the naming ofAromobates, Epipedobates, Mannophryne,and Nephelobates has merely exacerbated theproblem (Kaiser et al., 1994; Coloma, 1995;Meinhardt and Parmalee, 1996; Grant et al.,1997; Grant, 1998; Grant and Castro-Herre-ra, 1998). Molecular evidence for the mono-phyly of Mannophryne and Nephelobateswas presented by La Marca et al. (2002) andVences et al. (2003b), but the relationshipsof those genera to other dendrobatids are un-clear. Aromobates has been hypothesized tobe the monotypic sister group of all otherdendrobatids (Myers et al., 1991), but syna-pomorphies shared with Mannophryne andNephelobates, also from the northern Andes,cast doubt on that claim. No molecular evi-dence has been presented for this taxon.

Among the ‘‘aposematic’’ taxa, only Phyl-lobates is strongly corroborated as monophy-letic (Myers et al., 1978; Myers, 1987;

30 As noted earlier, our recognition of AmeeregaBauer, 1986, as a senior synonym of Epipedobates My-ers, 1987, follows the recommendation of Walls (1994).Ranitomeya Bauer, 1988, and Oophaga Bauer, 1994, arenomenclaturally valid names, but insofar as they havenot achieved common usage, and our sampling did notaddress their monophyly or placement, we exclude themfrom this discussion.


Clough and Summers, 2000; Vences et al.,2000b; Widmer et al., 2000). No synapo-morphy is known for Ameerega, and it islikely paraphyletic or polyphyletic with re-spect to Allobates, Colostethus, Cryptophyl-lobates, and Phobobates. Schulte (1989) andMyers et al. (1991) rejected Allobates andPhobobates on the basis of errors in the anal-ysis of behavior, lack of evidence, unac-counted character conflict, incorrect charac-ter coding, and creation of paraphyly inAmeerega (as also found by Clough andSummers, 2000; Vences et al., 2000b; Santoset al., 2003; Vences et al., 2003b), but manyauthors continue to recognize them. In ad-dition, Phobobates was found to be mono-phyletic by Vences et al. (2000b) but para-phyletic by Clough and Summers (2000).Similarly, Minyobates may or may not benested within Dendrobates (Silverstone,1975; Myers, 1982, 1987; Myers and Bur-rowes, 1987; Jungfer et al., 1996; Cloughand Summers, 2000; Jungfer et al., 2000).Likewise, although neither study recognizedMinyobates, it was found to be monophyleticby Santos et al. (2003) but polyphyletic byVences et al. (2003b). Cryptophyllobates isthe most recently named genus, but it ismonotypic, and its relationship to other den-drobatids is unclear.

Difficulties in understanding the phyloge-ny of dendrobatid frogs are compounded bythe taxonomic problems that surround manynominal species and under appreciation ofspecies diversity (Grant and Rodriguez,2001). Sixty-nine valid species were namedover the past decade (more species than wereknown in 1960), 55 of which were referredto Colostethus. Many nominal speciesthroughout Dendrobatidae are likely com-posed of multiple cryptic species awaitingdiagnosis (e.g., Caldwell and Myers, 1990;Grant and Rodriguez, 2001; Grant, 2002),but the rapid increase in recognized diversityis not unaccompanied by error, and criticalevaluation of the limits of nominal taxa willundoubtedly result in some number of thesebeing placed in synonymy (e.g., Coloma,1995; Grant, 2004).

[469] FAMILY: BUFONIDAE GRAY, 1825

Bufonina Gray, 1825: 214. Type genus: Bufo Lau-renti, 1768.

Atelopoda Fitzinger, 1843: 32. Type genus: Ate-lopus Dumeril and Bibron, 1841.

Phryniscidae Gunther, 1858b: 346. Type genus:Phryniscus Wiegmann, 1834.

Adenomidae Cope, 1861 ‘‘1860’’: 371. Type ge-nus: Adenomus Cope, 1861.

Dendrophryniscina Jimenez de la Espada, 1871‘‘1870’’: 65. Type genus: DendrophryniscusJimenez de la Espada, 1871 ‘‘1870’’.

Platosphinae Fejervary, 1917: 147. Type genus:Platosphus d’Isle, 1877 (fossil taxon consideredto be in this synonymy because Platosophus 5Bufo [sensu lato]).

Bufavidae Fejervary, 1920: 30. Type genus: Bu-favus Portis, 1885 (fossil taxon considered tobe in this synonymy because Bufavus 5 Bufo[sensu lato]).

Tornierobatidae Miranda-Ribeiro, 1926: 19. Typegenus: Tornierobates Miranda-Ribeiro, 1926.

Nectophrynidae Laurent, 1942: 6. Type genus:Nectophryne Buchholz and Peters, 1875.

Stephopaedini Dubois, 1987 ‘‘1985’’: 27. Typegenus: Stephopaedes Channing, 1978.

IMMEDIATELY MORE INCLUSIVE TAXON:[460] Agastorophrynia new taxon.

SISTER TAXON: [461] DendrobatoideaCope, 1865.

RANGE: Cosmopolitan in temperate andtropical areas except for the Australo-Papuanregion, Madagascan, Seychelles, and NewZealand.

CONTENT: Adenomus Cope, 1861 ‘‘1860’’;Altiphrynoides Dubois, 1987 ‘‘1986’’ (in-cluding Spinophrynoides Dubois, 1987‘‘1986’’; see Systematic Comments); Amie-tophrynus new genus (see Systematic Com-ments and appendix 7); Anaxyrus Tschudi,1845 (see Systematic Comments and appen-dix 7); Andinophryne Hoogmoed, 1985; An-sonia Stoliczka, 1870; AtelophryniscusMcCranie, Wilson, and Williams, 1989; Ate-lopus Dumeril and Bibron, 1841; Bufo Lau-renti, 1768 (see Systematic Comments andappendix 7); Bufoides Pillai and Yazdani,1973; Capensibufo Grandison, 1980;Chaunus Wagler, 1828 (see SystematicComments and appendix 7); ChuramitiChanning and Stanley, 2002; CranopsisCope, 1875 ‘‘1876’’ (see Systematic Com-ments and appendix 7); CrepidophryneCope, 1889; Dendrophryniscus Jimenez dela Espada, 1871 ‘‘1870’’; Didynamipus An-dersson, 1903; Duttaphrynus new genus (seeappendix 7); Epidalea Cope, 1865 (see Sys-


tematic Comments and appendix 7); FrostiusCannatella, 1986; Ingerophrynus new ge-nus; Laurentophryne Tihen, 1960; Lepto-phryne Fitzinger, 1843; MelanophryniscusGallardo, 1961; Mertensophryne Tihen,1960 (including Stephopaedes Channing,1979 ‘‘1978’’; see Systematic Comments andappendix 7); Metaphryniscus Senaris, Ayar-zaguena, and Gorzula, 1994; NannophryneGunther, 1870 (see Systematic Commentsand appendix 7); Nectophryne Buchholz andPeters, 1875; ‘‘Nectophrynoides’’ Noble,1926 (see Systematic Comment); Nimba-phrynoides Dubois, 1987 ‘‘1986’’; Oreo-phrynella Boulenger, 1895; OsornophryneRuiz-Carranza and Hernandez-Camacho,1976; Parapelophryne Fei, Ye, and Jiang,2003; Pedostibes Gunther, 1876 ‘‘1875’’; Pe-lophryne Barbour, 1938; Peltophryne Fitzin-ger, 1843; Phrynoidis Fitzinger, 1843 (seeSystematic Comments and appendix 7);Poyntonophrynus new genus (see SystematicComments and appendix 7); PseudobufoTschudi, 1838; Pseudepidalea new genus(see appendix 7); Rhaebo Cope, 1862 (seeSystematic Comments and appendix 7);Rhamphophryne Trueb, 1971; Rhinella Fit-zinger, 1826 (see Systematic Comments andappendix 7); Schismaderma Smith, 1849;Truebella Graybeal and Cannatella, 1995;Vandijkophrynus new genus (see SystematicComments and appendix 7); Werneria Po-che, 1903; ‘‘Wolterstorffina’’ Mertens, 1939(see Systematic Comments).

CHARACTERIZATION AND DIAGNOSIS: Severalof the larval characters in our analysis (fromHaas, 2003) optimize as synapomorphies ofBufonidae: (1) diastema in larval lower lippapillation (Haas 9.1); (2) m. diaphragmato-praecordialis absent (Haas 25.0); (3) lateralfibers of m. subarcualis rectus II–IV invadeinterbranchial septum IV (Haas 29.1); (4)processus anterolateralis of crista paroticaabsent (Haas 66.0); (5) larval lungs rudimen-tary or absent (Haas 133.0, also in Ascaphusand some Litoria). Graybeal and Cannatella(1995) noted the fusion of the basal processof the palatoquadrate with the squamosal(Baldauf, 1959), although they noted that notenough taxa had been evaluated to ensurethat this is the appropriate level of optimi-zation of this character.

Because Melanophyniscus (and Truebella,

unexamined by us; Graybeal and Cannatella,1995) lacks a Bidder’s organ and because ourmolecular data place Melanophryniscus firm-ly as the sister taxon of remaining bufonids,the presence of a Bidder’s organ is a syna-pomorphy not of Bufonidae, but of branch470, Bufonidae excluding Melanophryniscus(and presumably Truebella). Larval charac-ters (from Haas, 2003) that are synapomor-phies of bufonids excluding Melanophrynis-cus (and possibly Truebella) are (1) ramusmandibularis (cranial nerve V3) runs throughthe m. levator mandibulae externus group(Haas 65.1); (2) dorsal connection from pro-cessus muscularis to commissura quadrato-orbitalis (Haas 78.2); (3) eggs deposited instrings (Haas 141.1, diversely modified high-er up in the bufonid tree). Atlantal cotylesjuxtaposed (J.D. Lynch, 1971, 1973) is alsoa likely synapomorphy of this taxon.

SYSTEMATIC COMMENTS: As evidenced byour results Bufo is wildly paraphyletic witha number of other nominal genera (as docu-mented by Graybeal, 1997). Our samplinghas likely hardly scratched the surface of thisproblem, and we hope that subsequent workwill continue to add to the evidence so farpresented so that a more universal resolutionmay be reached. A complete remedy of thepolyphyly/paraphyly of Bufo is beyond thescope of this study, although we take limitedactions to start this inevitable process. Wecould place all of the names that are demon-strably derived from ‘‘Bufo’’ into the syn-onymy of Bufo, thereby providing a mono-phyletic taxonomy. However, because muchof this paraphyly was understood in 1972(various papers in Blair, 1972a), it is clearthat social inertia is standing in the way ofprogress. We judge that progress will requirethe partition of ‘‘Bufo’’ into more informa-tive natural units.

A recent study on New World Bufo byPauly et al. (2004) had not appeared whenwe were designing our sampling strategy.That work provides additional guidance inour development of an improved taxonomy,although the study differs from ours in ana-lytical methods and assumptions, taxon sam-pling, and amount of data involved (2.5 kbof mtDNA in the study by Pauly et al., 2004,and ca. 3.7 kb/terminal of mtDNA andnuDNA in our study). Our results are shown


in figure 50 and 60; the results of Pauly etal. (2004) are shown in figure 68, and a com-parison of the taxa held in common by thetwo studies is shown in figure 69. Both stud-ies found the position of Bufo margaritiferto be remarkable. The difference is that wethink further resolution should come fromadditional data and denser sampling ratherthan from invoking one from among a re-stricted set of published models of molecularevolution to explain the issue away.

On the basis of our data analysis, as wellas other information (e.g., Pauly et al., 2004),we can partition the following hypothesizedmonophyletic units out of ‘‘Bufo’’ (fig. 70):

(1) [476] Rhaebo Cope, 1862 (type spe-cies: Bufo haematiticus Cope, 1862). We rec-ognize the species of the Bufo guttatusgroup, the sister group of all bufonids exceptMelanophryniscus, Atelopus, Osorphophry-ne, and Dendrophryniscus (see figs. 50, 60),as Rhaebo (see appendix 5 for molecularsynapomorphies, appendix 6 for nomencla-tural comment, and appendix 7 for content)on the basis of their lack of cephalic crests,their yellowish-orange skin secretions (whitein other nominal Bufo; R.W. McDiarmid,personal commun.), presence of an omoster-num (otherwise found, among bufonids, onlyin Nectophrynoides and Werneria [J.D.Lynch, 1973: 146], Capensibufo [Grandison,1981], and the Cranopsis valliceps group [J.R. Mendelson, III, personal commun.]), andhypertrophied testes (Blair, 1972c, 1972d),which in combination differentiate Rhaebofrom all other bufonids. (See appendix 6 fornote under Bufonidae on this name.)

(2) Phrynoidis Fitzinger, 1843: 32 (typespecies: Bufo asper Gravenhorst, 1829). Be-cause it is more closely related to Pedostibesthan to other ‘‘Bufo’’, we recognize the Bufoasper group (see appendix 7 for content) asPhrynoidis. Inger (1972) provided morpho-logical differentia that serve to distinguishPhrynoidis from other bufonid taxa. Whichof the suggested characters is synapomorphicis not obvious, and additional morphologicalwork is needed. Further, the monophyly ofthis taxon with respect to Pedostibes, andpossibly to other unsampled genera, is anopen question. The relationship of Bufo gal-eatus to this taxon is arguable. Dubois andOhler (1999) provisionally allocated it to the

Bufo asper group on the basis of morpholo-gy, while Liu et al. (2000) allied it with theB. melanostictus group on the basis of mo-lecular evidence. For the present we acceptits assignment to Duttaphrynus (the Bufo me-lanostictus group). Fei et al. (2005) regardedTorrentophryne to be part of this clade, aconclusion not supported either by the studyof Liu et al. (2000) or by our analysis, whichplace Torrentophryne in Bufo (sensu stricto).We restrict Phrynoidis to the Bufo aspergroup. We also suggest that some of the char-acters that optimize to this branch in our tree(appendix 5) are synapomorphies of Phry-noidis.

(3) Rhinella Fitzinger, 1826: 39 (type spe-cies by monotypy: Bufo [Oxyrhynchus] pro-boscideus Spix, 1824). We apply this nameto the Bufo margaritifer group (see appendix6 for nomenclatural comment and appendix7 for content). The most recent morphologi-cal characterization of the group (as the Bufotyphonius group) was by Duellman andSchulte (1992), although their diagnoses ex-plicitly refer to overall similarity, not syna-pomorphy. Hass et al.’s (1995) study of im-munological distances found the group to bemonophyletic, but their outgroup sampleswere limited to Bufo marinus and B. spinu-losus. Baldissera et al. (1999) provided evi-dence (restricted to R. margaritifer) from thenucleolar organizer region (NOR) that Rhi-nella may be distantly related to Chaunus.Most species of Rhinella have distinctive andextremely expanded postorbital crests in old-er adult females, although this does not ap-pear to be the rule, so the diagnosis of thegroup needs refinement. Should Rhinella Fit-zinger, 1826, be found to be nested withinChaunus Wagler, 1828, the name Rhinellawill take precedence for the inclusive group.

Given our taxon sampling, we cannot ruleout the possibility that Rhinella and Rham-phophryne are not reciprocally monophylet-ic. However, although placing all the in-volved species in a single genus would min-imize the risk that we are wrong, we believesuch caution to be counter-productive. Also,from a more pragmatic position, this wouldrequire all species currently placed in Rham-phophryne to be transferred to Rhinellabased only on the possibility of nonmono-phyly, not evidence. The genera may be di-


Fig. 68. Maximum-likelihood tree of predominantly New World Bufonidae suggested by Pauly etal. (2004) on the basis of 2,370 bp (730 informative sites) of mitochondrial DNA (12S, tRNAVal, and16S). Alignment was done under Clustal (Thompson et al., 1997; cost functions not disclosed) thenmodified manually. Gaps were considered to be missing data and the substitution model assumed forthe maximum-likelihood analysis was GTR 1 G1 I.


Fig. 69. Comparison of our bufonid parsimony results, via terminals held in common (see fig. 50,60) with those of Pauly et al. (2004) (fig. 68). Taxa whose relative placement differs substantiallybetween the two studies are in boldface.

agnosed by the number and size of eggs(many and small in Rhinella; few and largein Rhamphophryne); by the adductor man-dibulae musculature (both the m. adductormandibulae posterior subexternus and m. ad-ductor mandibulae externus superficialis [‘‘S1 E’’ of Starrett in J.D. Lynch, 1986] presentin Rhinella; only m. adductor mandibulaesubexternus [‘‘E’’ of Starrett in J.D. Lynch,1986] present in Rhamphophryne); by thethigh musculature (m. adductor longus pre-sent in Rhinella, absent in Rhamphophryne);by liver morphology (trilobed with left sidelarger than right side in Rhinella, bilobedwith right side massive, conspicuously largerthan left side in Rhamphophryne); and by ex-tensively webbed hands and feet in Rham-phophryne (T. Grant, personal obs.). Most(but not all) species of Rhamphophryne dif-

fer from all species of Rhinella in possessinga conspicuously elongate snout, reducednumber of vertebrae, and vocal sacs with slit-like openings. Likewise, most (but not all)species of Rhinella differ from all species ofRhamphophryne in possessing protuberantvertebral spines, greatly expanded alate post-orbital crests, and a leaf-like dorsal pattern.

Many questions remain regarding the re-lationships between these and other NewWorld bufonids. For example, Crepidophry-ne epiotica possesses the same jaw muscu-lature and liver morphology as Rhampho-phryne and shares large, unpigmented eggs,similar hand and foot morphology, and ab-sence of the ear, suggesting it may be closelyrelated to Rhamophophryne. However, themorphological results of Graybeal (1997;data undisclosed) suggest that Crepidophry-


Fig. 70. Generic changes suggested for bufonid taxa that we studied. This figure shows our terminalsand the new genera, but the text should be consulted for additional generic changes that involve speciesnot addressed in our phylogenetic analysis.


ne is imbedded within Cranopsis. Similarly,Andinophryne is characterized as possessingan omosternum, anteriorly ‘‘firmisternal’’and posteriorly ‘‘arciferal’’ pectoral girdle(for pectoral girdle morphology see Kaplan,2004), a complete ear, partially webbedhands, elongate paratoid glands, and lackingthe m. adductor longus of the thigh (Hoog-moed, 1989b). However, none of these char-acters is unique or clearly derived relative tolikely relatives (e.g., Rhamophryne or Rhi-nella), and their relationships require furtherinvestigation.

(4) [491] Ingerophrynus new genus (typespecies: Bufo biporcatus Gravenhorst, 1829;etymology: Robert F. Inger 1 Greek: phry-nos [toad]). This name commemorates theextensive contributions of Robert F. Inger tothe herpetology of tropical Asia and the Sun-das, as well as to the systematics of Asianbufonids. The topology described by our ex-emplars Bufo celebensis, B. galeatus, B. div-ergens, and B. biporcatus suggests a majorclade of tropical Asian bufonids. We pre-sume that this clade contains all species ofthe Bufo biporcatus group (see appendix 7for content) in addition to B. celebensis Gun-ther, 1859 ‘‘1858’’, and B. galeatus Gunther,1864. Inger (1972) provided differentia thatdistinguish the Bufo biporcatus group fromthe remaining Bufo, although it is not obvi-ous which of these characters are synapo-morphies. We also suggest that our branch491 (see appendix 5) contains several molec-ular synapomorphies that distinguish thisclade from all others.

Association of Bufo celebensis and B. gal-eatus with the Bufo biporcatus group as partsof Ingerophrynus rests entirely on molecularevidence (summarized in appendix 5), al-though we expect that some of the charactersthat differentiate the B. biporcatus groupfrom other ‘‘Bufo’’ also apply to these twospecies. Bufo celebensis had not previouslybeen associated with any other species ofBufo, so our hypothesis of relationship isnovel and suggests that Ingerophrynus sitsastride Wallace’s Line.

Dubois and Ohler (1999) provisionally al-located B. galeatus to the B. asper group (5Phrynoidis), but this allocation is not consis-tent with our molecular evidence. Liu et al.(2000) placed B. galeatus as the sister taxon

of the B. melanostictus group, although this,too, is not consistent with our molecular ev-idence.

(5) Epidalea Cope, 1864 (type species:Bufo calamita Laurenti, 1768) is availablefor Bufo calamita (see appendix 6 for no-menclatural comment and appendix 7 forcontent). We had hoped to associate the nameEpidalea Cope, 1864, through its type (Bufocalamita Laurenti, 1768), to the Bufo viridisgroup. However, association of Bufo calam-ita with the Bufo viridis group is seeminglybased solely on overall similarity (Inger,1972). The results based on DNA sequencespresented by Graybeal (1997; fig. 25) do notplace B. calamita and B. viridis as closestrelatives. Because the phylogenetic evidenceso far published (Graybeal, 1997) does notsuggest that B. calamita is a member of theB. viridis group (but see caveat regardingGraybeal’s data in ‘‘Review of Current Tax-onomy’’), we place them in separate generaas an interim measure. We expect that, as bu-fonid phylogenetics become better under-stood, the name Epidalea will be attached toa larger group than just this one species.

(6) Pseudepidalea new genus (type spe-cies: Bufo viridis Laurenti, 1768; etymology:in reference to the overall morphologicalsimilarity of members of the ‘‘Bufo’’ viridisgroup to Epidalea calamita; see appendix 7for content). Liu et al. (2000) presented weakevidence that Bufo raddei is not part of theBufo viridis complex (their exemplars beingBufo oblongus danatensis and B. viridis). Forthis reason we regard B. raddei as being onlyprovisionally assigned to this genus. A set ofdifferentia provided by Martin (1972) willserve to distinguish this group from other bu-fonid taxa, although, as in many such diag-nostic summaries, we cannot identify whichcharacters are apomorphies and which areplesiomorphic. We do, however, suggest thatthe molecular synapomorphies provided inappendix 5 will serve to diagnose this taxon.

(7) Duttaphrynus new genus (type spe-cies: Bufo melanostictus Schneider, 1799; et-ymology: S.K. Dutta 1 Greek: phrynos[toad]) reflects the contributions to herpetol-ogy by Sushil Kumar Dutta, noted Indianherpetologist). We erect this generic name forthe Bufo melanostictus group as defined byInger (1972) and subsequent authors. Al-


though decisive evidence for the monophylyof Duttaphrynus is currently lacking, we hy-pothesize that the group is monophyletic andsuggest that detailed analysis of this groupand close relatives will document this. Mor-phological differentia provided by Inger(1972) serve to distinguish this group fromother ‘‘Bufo’’, although which characters areapomorphies and which are plesiomorphiesremains unknown. We also suggest that atleast some of the molecular synapomorphiesfor ‘‘Bufo’’ melanostictus in our tree are syn-apomorphies for Duttaphrynus (see appendix5, for Bufo melanostictus).

(8) Peltophryne Fitzinger, 1843 (type spe-cies: Bufo peltocephalus Tschudi, 1838, byoriginal designation) is a monophyletic ra-diation within nominal ‘‘Bufo’’ and was mostrecently synonymized with Bufo by Pramuk(2000). In the most recent study of the rela-tionships of this group, Pramuk (2000) ana-lyzed morphological characters and mtDNAsequence data and found Peltophryne (as theBufo peltocephalus group) to be most closelyrelated to the American Bufo granulosusgroup (see also Pregill, 1981; Pramuk, 2000;Pramuk et al., 2001). Nevertheless, Pramuk(2000) rooted her cladogram on the Bufo re-gularis group and otherwise had relativelysparse outgroup taxon sampling. Our data in-dicate strongly that the Bufo peltocephalusgroup is not closely related to the Bufo gran-ulosus group or any other American toad, butis, instead, the sister taxon of the African tax-on Schismaderma, which was not included inprevious studies of Peltophryne. The biogeo-graphic track suggested by this finding in-vites further work. We therefore resurrectPeltophryne (see appendix 7 for content) forthe Bufo peltocephalus group, as distantly re-lated to other Neotropical toads. (See the no-menclatural comment in appendix 6.)

(9) [499] Bufo Laurenti, 1768 (type spe-cies: Rana vulgaris Laurenti, 1768, by sub-sequent designation of Tschudi, 1838: 50).We restrict the generic name Bufo (sensustricto) to the monophyletic Bufo bufo groupof Inger (1972) and subsequent authors (seeappendix 7 for content). Inger (1972) sug-gested morphological differentia for this tax-on that separate it from other bufonid taxa,although their polarity remains to be docu-mented. Liu et al. (2000) found a paraphy-

letic Torrentophryne to be nested within theotherwise monophyletic Bufo bufo group,which is consistent with our results. Wetherefore follow Liu et al. (2000) in placingTorrentophryne in the synonymy of Bufo(sensu stricto). Clearly, our taxon samplingis insufficient to allocate all species of re-maining ‘‘Bufo’’ to identified clades and, aswe suggest later, we think that ‘‘Bufo’’ spe-cies not allocated to this or other nominalclades should be associated with this genericname in quotation marks pending resolutionof their phylogeny.

(10) Vandijkophrynus new genus (typespecies: Bufo angusticeps Smith, 1848; ety-mology: E. Van Dijk 1 Greek: phrynos[toad], commemorating Eddie Van Dijk, not-ed South African herpetologist and indefati-gable tadpole specialist). (See appendix 7 forcontent and new combinations.) We erect thisgenus for the Bufo angusticeps group as dif-ferentiated by Tandy and Keith (1972; ex-cluding Bufo/Capensibufo tradouwi and C.rosei, which do not have the distinctive re-ticulate dorsal pattern of the core group andare placed phylogenetically far away in ouranalysis) and by Cunningham and Cherry(2004). Our discovery of the exemplar of thisgroup, B. angusticeps, as the sister taxon ofStephopaedes is consistent with the results ofCunningham and Cherry (2004). ShouldVandijkophrynus be found to be synonymouswith Poyntonophrynus (see below), we selectVandijkophrynus to have priority under theprovisions of Article 24.2.1 (Rule of FirstRevisor) of the International Code of Zoo-logical Nomenclature (ICZN, 1999).

(11) Mertensophryne Tihen, 1960 (typespecies: Bufo micranotis rondoensis Lover-idge, 1942). We suggest that at least some ofthe molecular synapomorphies (appendix 5)that optimize to our Stephopaedes anotis aresynapomorphies for a larger Mertensophry-ne. Complicating discussion of phylogeny inthe vicinity of Stephopaedes is Mertenso-phryne and the Bufo taitanus group (see ap-pendix 7 for content), which is a group ofAfrican toads that lack tympani and colu-mellae; that frequently show digit reduction(Tandy and Keith, 1972); and that have beenbeen suggested to be related to Capensibufo(Tandy and Keith, 1972). Graybeal and Can-natella (1995) and Graybeal (1997) suggest-


ed that Stephopaedes and Mertensophryneare nested within at least some component ofthe B. taitanus group; Cunningham andCherry (2004) arrived at similar conclusions.Muller et al. (2005) described the tadpole ofB. taitanus and reported that it has a crownthat encircles the eyes as in Stephopaedes butis not so well developed. In no studies havethe relationships of Mertensophryne, Stepho-paedes, and the Bufo taitanus group beenevaluated with adequate taxon sampling, andthe questions of relationship have remainedrecognized (e.g., Tandy and Keith, 1972) butunresolved for more than 30 years. What isknown is that the Bufo taitanus group, Mer-tensophryne, and Stephopaedes lack colu-mellae (convergently in the clades composedof [1] Wolterstorffina, Werneria, Nectophry-ne, and likely Laurentophryne [Tihen, 1960;Grandison, 1981]; [2] Didynamipus; and [3]Capensibufo rosei), and likely form a mono-phyletic group. Furthermore, Stephopaedes,Mertensophryne, and at least one member ofthe Bufo taitanus group (B. taitanus; H.Muller et al., 2005) have accessory respira-tory structures on the head of the larva.(Nevertheless, differences among these struc-tures suggest the possibility of nonhomolo-gy; Dubois, 1987 ‘‘1985’’; Poynton andBroadley, 1988.) Mertensophryne is current-ly monotypic, and Stephopaedes containsthree species. Our action to promote furtherresearch is to place the Bufo taitanus group,Mertensophryne, and Stephopaedes into anenlarged Mertensophryne, retaining Stepho-paedes as a subgenus, in order not to loserecognition of this monophyletic group. (Seeappendix 7 for new combinations.) Loss ofthe middle ear is synapomorphic at this leveland, although larvae are unknown for severalmembers of the Bufo taitanus group, we sus-pect that the accessory repiratory structureson the head of larvae is a synapomorphy aswell. Ongoing work by Channing and col-laborators will address this further.

(12) Poyntonophrynus new genus (typespecies: Bufo vertebralis Smith, 1848; ety-mology: J.C. Poyton [commemorating JohnC. Poynton, noted South African herpetolo-gist] 1 phrynos [Greek: toad]). We recognizePoyntonophrynus for the Bufo vertebralisgroup of Tandy and Keith (1972; cf. Poyn-ton, 1964) and Cunningham and Cherry

(2004). Poytonophrynus is characterized bylacking a tarsal fold (a presumed apomor-phy), having parotoid glands indistinct andflattened (Poynton, 1964a), and the tympa-num being small but distinct (Tandy andKeith, 1972). We did not study any memberof this group, but on the basis of the DNAsequence results presented by Cunninghamand Cherry (2004), it is a monophyleticgroup, closely related to Mertensophryne(sensu lato) and Vandijkophrynus. See ap-pendix 7 for content and new combinations.See appendix 7 for content and new combi-nations.

(13) [506] Amietophrynus new genus(type species: Bufo regularis Reuss, 1833; et-ymology: Jean-Louis Amiet, an influentialherpetologist of West Africa, 1 Greek: phry-nos [toad]). We erect this taxon for all Afri-can 20-chromosome ‘‘Bufo’’ discussed byCunningham and Cherry (2004; the cladesubtended by our branch 506), as well as the22-chromosome ‘‘Bufo’’ imbedded withinthis clade (the Bufo pardalis group of Cun-ningham and Cherry, 2004). This includestoads previously included by various authorsin the Bufo blanfordi group, B. funereusgroup, B. kerinyagae group, B. latifronsgroup, B. lemairii group, B. maculatusgroup, B. pardalis group, B. perreti group,B. regularis group, B. superciliaris group,and B. tuberosus group. Although at leastsome of these groups are monophyletic, wedo not recognize species groups within Amie-tophrynus at this time, because several of theexisting groups are monotypic (e.g., B. le-mairii) or clearly nonmonophyletic (e.g., B.regularis group). We think that recognitionof species groups should follow a moredensely sampled study of the Amietophrynusand near relatives. Although not previouslysuggested to be a member of the 20-chro-mosome group, our phylogenetic results al-low us to predict that Bufo tuberosus is a 20-chromosome frog.

Beyond the 20-chromosome condition thatis apomorphic for group (Bogart, 1968; Cun-ningham and Cherry, 2004), molecular trans-formations diagnose the taxon unambiguous-ly (see appendix 5). Moreover, the monophy-ly of this taxon is a testable proposition.

Other than the Bufo pardalis group (seeabove), we have no unambiguous evidence


tying the African 22-chromosome toadgroups (B. gracilipes and B. mauritanicusgroups) or such African species of unknownkaryotype such as the B. pentoni group andB. arabicus group to any of the African (orother) bufonid groups. Additional evidenceand study will be needed to resolve theirplacement, which very clearly is not withinBufo (sensu stricto). For the moment, wemerely place the generic name ‘‘Bufo’’ inquotation marks in combination with thesespecies to denote their formal exclusion fromBufo (sensu stricto).

(14) Nannophryne Gunther, 1870 (typespecies: Nannophryne variegata Gunther,1870, by monotypy). We resurrect the nameNannophryne for Bufo variegatus (Gunther,1870). Although we did not include this tax-on in our analysis, the molecular evidenceprovided by Pauly et al. (2004) suggestsstrongly that this taxon, like Rhinella (theBufo margaritifer group), is only distantly re-lated to other New World ‘‘Bufo’’. Martin(1972) provided osteological differentia thatserve to diagnose the taxon among ‘‘Bufo’’,but its exact phylogenetic position amongbufonids remains to be determined. Prior toPauly et al. (2004), some authors placed B.variegatus near the B. spinulosus group (e.g.,Blair, 1972c), whereas others (e.g., Cei,1980) have declined to place it in any speciesgroup. Pauly et al. (2004) placed it far fromthe B. spinulosus group, and attaching nearthe base of the bufonid exemplars that theystudied. It remains possible that Nannophry-ne will be found to be most closely relatedto Rhaebo, in which case Rhaebo will takenomenclatural precedence for the largergroup.

(15) [513] Anaxyrus Tschudi, 1845 (typespecies: Anaxyrus melancholicus Tschudi,1845 [5 Bufo compactilis Wiegmann,1833]). We recognize the North Americanclade of ‘‘Bufo’’ subtended by branch 513(see appendix 5) as the genus AnaxyrusTschudi, 1845. We are unaware of any mor-phological synapomorphy for this group, al-though, with exceptions, they do have a dif-ferent look and feel than the predominantlyMiddle-American (Cranopsis) and South-American (Chaunus) taxa. Recognition ofthis taxon is consistent with our results andthose of Pauly et al. (2004). Formerly, this

taxon was considered to comprise a numberof casually-defined species groups, most ofwhich require reevaluation. Although Tschu-di (1845) provided an erroneous SouthAmerican type locality for the type species,it was recognized as early as 1882 (Boulen-ger, 1882) that Anaxyrus melancholicusTschudi, 1845, is a junior synonym of theMexican Bufo compactilis Wiegmann, 1834.This was most recently detailed by Pramukand Mendelson (2003). (See appendix 7 forcontent and new and revived combinations.)

A partial junior synonym of Anaxyrus isIncilius Cope (1863: 50). Under the provi-sions of the ‘‘Principle of First Revisor’’(Art. 24; ICZN, 1999) we designate Bufocognatus Say, 1823, as the type species ofIncilius to solidify this synonymy, which oth-erwise could have been assigned through oneof the originally included species to threatenthe priority of Cranopsis.

(16) [519] Cranopsis Cope, 1875 ‘‘1876’’(type species: Bufo fastiodosus Cope, 1875‘‘1876’’). We apply the name Cranopsis tothe predominantly Middle American taxonsubtended by branch 519. Although we knowof no morphological synapomorphy for thistaxon, species within it generally exhibit adistinctive appearance. Nevertheless, see ap-pendix 5 for molecular synapomorphies. Thisgroup is composed of the former Bufo val-liceps group and allies. See appendix 7 forcontent and new and revived combinations.

(17) [522] Chaunus Wagler, 1828 (typespecies: Chaunus marmoratus Wagler, 1828[5 Bufo granulosus Spix, 1824]). We rec-ognize the predominantly South Americantaxon subtended by branch 522 as Chaunus.No morphological characters are known todiagnose this group, which is diagnosedcompletely on the basis of molecular data(see appendix 5, branch 522). Rhamphophry-ne and Rhinella may well be found to benested within Chaunus (see Graybeal, 1997:her fig. 13; Pauly et al., 2004), in which case,Rhinella Fitzinger, 1826, will take prece-dence, but evidence has yet to be producedto support this synonymy without recourse toaccepting a specific model of molecular evo-lution (Pauly et al., 2004).

Pauly et al. (2004) suggested on the basisof fewer data, more analytical assumptions,but denser sampling that the Bufo margari-


tifer group (see below) is imbedded withinthis group. This remains an open question,but we suggest that decisive resolution willrequire denser taxon sampling and more data,not additional analytical assumptions.

There are several other groups of ‘‘Bufo’’and various individual species we have notaddressed because we did not include any ofthem in our analysis and because there is nosubstantial published evidence on their phy-logenetic placement. All of these we simplytreat as incertae sedis within Bufonidae,tacked to the generic label ‘‘Bufo’’ (see ap-pendix 7 for a list). The reader will note thatthe bulk are Asian taxa, residing in geo-graphic areas suggesting that they will befound to be related to a number of non-Bufogenera. Only additional work will elucidatethis.

We think that our proposed breakup of‘‘Bufo’’ will promote more rapid progress inthe field, because the sociological principlethat drives much of systematics is to showthat other workers are wrong (Hull, 1988),and many graduate students will certainlytake aim at our hypotheses. Most systema-tists recognize that, traditionally, the firstspecies to receive novel generic names havebeen those that are highly autapomorphic,and subsequent authors are usually hesitantto apply these names to more generalizedforms. Having taken the controversial firststep, we hope that other workers will step inand address the rather large number of prob-lems that we have identified. There is muchwork to be done in bufonids, and we intendour taxonomic proposal to serve as a frame-work that will guide additional studies.

We do not find any compelling reason tomaintain the sister monotypic genera Alti-phrynoides Dubois, 1987 ‘‘1986’’ and Spi-nophrynoides Dubois, 1987 ‘‘1986’’. Gran-dison (1981) and Graybeal and Cannatella(1995) showed these African toads to be eachother’s closest relatives. Acting as First Re-visor, we consider Altiphrynoides Dubois,1987 ‘‘1986’’, to be a senior synonym of Spi-nophrynoides Dubois, 1987 ‘‘1986’’. (Seeappendix 7 for the single new combination.)‘‘Nectophrynoides’’ cryptus in their tree (fig.26) is not part of a monophyletic group withother Nectophrynoides. We were tempted toname a new genus for Nectophrynoides cryp-

tus. But, because we did not study that spe-cies, and because its sole reason for beingplaced outside of Nectophrynoides is its lossof columella, a character strongly contingenton immediate outgroups, we refrain from thisaction until the appropriate phylogeneticcomparisons can be made.

In addition, the following monotypic gen-era have been named since the publication ofGraybeal and Cannatella (1995) and Gray-beal (1997): Churamiti Channing and Stan-ley, 2002, and Parapelophryne Fei, Ye, andJiang, 2003. Neither obviously renders anyother taxon paraphyletic. Clearly, a detailedrevision of Bufonidae without reference togeographic boundaries is badly needed.

[108] RANOIDES NEW TAXON

ETYMOLOGY: Rana (Latin: frog) 1 oides(Greek: having the form of). The taxon isidentical in content to the regulated super-family name Ranoidea, but with an endingchange made to remove the implication thatit is regulated by the International Code ofZoological Nomenclature (ICZN, 1999).(See nomenclatural comment under Ranoidesin appendix 6.)

IMMEDIATELY MORE INCLUSIVE TAXON:[107] Phthanobatrachia new taxon.

SISTER TAXON: [314] Hyloides new taxon.RANGE: Worldwide temperate and tropical

regions, except New Zealand, most of Aus-tralia, and southern South America.

CONCEPT AND CONTENT: Ranoides new tax-on is a monophyletic group composed of[109] Allodapanura new taxon and [180]Natatanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Haas(2003) suggested the following charactersthat we regard as synapomorphies of ourRanoides: (1) insertion of m. rectus cervicison proximal ceratobranchialia III and IV(Haas 39.2); (2) ramus mandibularis (cranialnerve V3) is either posterior (ventral) to m.levator mandibulae externus group or runsthrough it—a change from being anterior(dorsal) to the externus group (Haas 65.0/1);and (3) firmisternal shoulder girdle (epicor-acoids are fully fused along their length;Haas 144.2; convergent in Dendrobatidae).J.D. Lynch (1973: 146) suggested that an os-sified omosternum is a synapomorphy of


‘‘Ranoidea’’ (our Ranoides, excluding Mi-crohylidae and Brevicipitidae). This may be,but there are alternative optimizations.Among others, the ossified omosternum mayhave been gained at the level of Ranoidesand lost independently in Microhylidae andBrevicipitidae; gained at the level of Rano-ides, lost at Allodapanura, and regained atLaurentobatrachia; or gained independentlyin Laurentobatrachia, Natatanura, and Hem-isotidae. (See also appendix 5, branch 108,for molecular synapomorphies.)

SYSTEMATIC COMMENTS: Ranoides in oursense is coextensive with the Recent contentof the superfamily Ranoidea Rafinesque,1814, of Dubois (2005).

A preliminary survey of literature (Liem,1970; Tyler, 1972, 1982; Burton, 1986,1998b) as well as examination of a few ex-emplars of selected genera of several familiessuggests another likely synapomorphy ofRanoides, worthy of additional investigation.Anteromedially differentiated elements ofthe m. intermandibularis are present in Ar-throleptidae, Brevicipitidae, Cacosterninae(Pyxicephalidae), Ceratobatrachidae, Hemi-sotidae, Hyperoliidae, Microhylidae, Pty-chadenidae (however, absent in Hildebrand-tia), Petropedetidae, Phrynobatrachidae, andare absent in Alytidae, Batrachophrynidae(although present in Batrachophrynus brach-ydactylus), Bombinatoridae, Heleophrynidae,Limnodynastidae, Myobatrachidae, Peloba-tidae, Sooglossidae, and Hemiphractidae(Beddard, 1908 ‘‘1907’’, 1911; Tyler, 1972;Tyler and Duellman, 1995; Burton, 1998b).This taxonomic distribution suggest that thepresence of differentiated elements of the m.intermandibularis is a synapomorphy of Ran-oides. Many details about the morphologicaldiversity and taxonomic distribution of thischaracter remain unknown and several in-stances of homoplasy are known within Hy-loides (see Tyler, 1971b, 1971c, 1972;Burton, 1998b, and Tyler and Duellman,1995, for examples within Noblebatrachia),and there are possibly multiple subsequenttransformations within Natatanura. (Thischaracter does not seem to occur in at leastsome Dicroglossidae [exemplars of Occidoz-yga, Euphlyctis, Nannophrys] or Nyctiba-trachidae [Lankanectes, Nyctibatrachus], butis present in Mantellidae and Rhacophoridae;

Liem, 1970). In addition, Tyler (1971a) sug-gested that the presence of the m. cutaneouspectoris could be a synapomorphy of Rano-ides, although with several reversals.

[109] ALLODAPANURA NEW TAXON

ETYMOLOGY: Allodapos- (Greek: strange,foreign, or belonging to another kind) 1 an-oura (Greek: without a tail, i.e., frog), refer-encing the exotic diversity of morphotypesin this taxon.

IMMEDIATELY MORE INCLUSIVE TAXON:[108] Ranoides new taxon.

SISTER TAXON: [180] Natatanura new tax-on.

RANGE: North and South America; sub-Sa-haran Africa; India and Korea to northernAustralia.

CONCEPT AND CONTENT: Allodapanura newtaxon is a monophyletic group composed of[110] Microhylidae Gunther, 1858 (1843),and [143] Afrobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Mor-phological characters in our analysis (fromHaas, 2003) that are synapomorphies are (1)m. tympanopharyngeus present (Haas 20.1);and (2) arcus subocularis round in cross sec-tion (Haas 82.2). In addition, absence of thepalatine bone in adults (Haas 146.0; a rever-sal from the acosmanuran condition), mayoptimize on this branch (to reappear on thebranch subtending Afrobatrachia), or, alter-natively, the palatine may be lost in Micro-hylidae and independently in Xenosyneuni-tanura. Similarly, the presence of palatalfolds may optimize on this branch and bereversed in Laurentobatrachia, or may appeartwice, once on the branch subtending Micro-hylidae as well as on the branch subtendingXenosyneunitanura. Regardless, the primaryevidence for the recognition of this taxon ismolecular (see appendix 5).

[110] FAMILY: MICROHYLIDAE GUNTHER, 1858(1843)

Hylaedactyli Fitzinger, 1843: 33. Type genus: Hy-laedactylus Dumeril anbd Bibron, 1841.

Gastrophrynae Fitzinger, 1843: 33. Type genus:Gastrophryne Fitzinger, 1843.

Micrhylidae Gunther, 1858b: 346. Type genus:Micrhyla Dumeril and Bibron, 1841 (an incor-rect subsequent spelling of Microhyla Tschudi,1838).


Asterophrydidae Gunther, 1858b: 346. Type ge-nus: Asterophrys Tschudi, 1838.

Kalophrynina Mivart, 1869: 289. Type genus:Kalophrynus Tschudi, 1838.

Xenorhinidae Mivart, 1869: 286. Type genus: Xe-norhina Peters, 1863.

Dyscophidae Boulenger, 1882: 179. Type genus:Dyscophus Grandidier, 1872.

Cophylidae Cope, 1889: 248. Type genus: Cophy-la Boettger, 1880.

Genyophrynidae Boulenger, 1890: 326. Type ge-nus: Genyophryne Boulenger, 1890.

Rhombophryninae Noble, 1931: 529. Type genus:Rhombophryne Boettger, 1880.

Sphenophryninae Noble, 1931: 531. Type genus:Sphenophryne Peters and Doria, 1878, by mon-otypy.

Melanobatrachinae Noble, 1931: 538. Type ge-nus: Melanobatrachus Beddome, 1878.

Kaloulinae Noble, 1931: 538. Type genus: Kal-oula Gray, 1831.

Hoplophryninae Noble, 1931: 538–539. Type ge-nus: Hoplophryne Barbour and Loveridge,1928.

Scaphiophryninae Laurent, 1946: 337. Type ge-nus: Scaphiophryne Boulenger, 1882.

Pseudohemisiinae Tamarunov, 1964a: 132. Typegenus: Pseudohemisus Mocquard, 1895.

Otophryninae Wassersug and Pyburn, 1987: 166.Type genus: Otophryne Boulenger, 1900.

Phrynomantini Burton, 1986: 405–450. Type ge-nus: ‘‘Phrynomantis Peters, 1867’’.

Barygenini Burton, 1986: 405–450. Type genus:Barygenys Parker, 1936.

Callulopini Dubois, 1988a: 3. Type genus: Cal-lulops Boulenger, 1888.

IMMEDIATELY MORE INCLUSIVE TAXON:[109] Allodapanura new taxon.

SISTER TAXON: [143] Afrobatrachia newtaxon.

RANGE: North and South America; Eastand South Africa; India and Korea to north-ern Australia.

CONTENT: [135] Asterophryninae Gunther,1858 (including Genyophryninae Boulenger,1890), [118] Cophylinae Cope, 1889, Dys-cophinae Boulenger, 1882, [121] Gastro-phryninae Fitzinger, 1843, [130] Microhyli-nae Gunther, 1858 (1843), ScaphiophryninaeLaurent, 1946, as well as several nominalgenera unassigned to subfamily either be-cause we did not study them and assignmentto subfamily based on published evidence isnot possible, or because they fall outside ofexisting subfamilies: Adelastes Zweifel,

1986; Altigius Wild, 1995; Arcovomer Car-valho, 1954; Chiasmocleis Mehely, 1904;Gastrophrynoides Noble, 1926; Glyphoglos-sus Gunther, 1869 ‘‘1868’’; Hyophryne Car-valho, 1954; Hypopachus Keferstein, 1867;Kalophrynus Tschudi, 1838; MetaphrynellaParker, 1934; Micryletta Dubois, 1987;Myersiella Carvalho, 1954; Otophryne Bou-lenger, 1900; Paradoxophyla Blommers-Schlosser and Blanc, 1991; Phrynella Bou-lenger, 1887; Phrynomantis Peters, 186731;Ramanella Rao and Ramanna, 1925; Relic-tivomer Carvalho, 1954; Stereocyclops Cope,1870 ‘‘1869’’; Synapturanus Carvalho,1954; Syncope Walker, 1973; Uperodon Du-meril and Bibron, 1841. (See SystematicComments.)

CHARACTERIZATION AND DIAGNOSIS: A largenumber of morphological characters in ouranalysis (from Haas, 2003) are synapomor-phies of Microhylidae: (1) keratodonts absentin larvae (Haas 3.0); (2) keratinized jawsheaths absent in larvae (Haas 6.0); (3) venacaudalis dorsalis present in larvae (Haas14.1); (4) spiracle position median posterior(Haas 18.2); (5) m. geniohyoideus origin inlarvae from connective tissue lateral to glan-dula thyroidea (Haas 19.4); (6) m. interhyoi-deus posterior in larvae extensive and strong-ly developed (Haas 24.2); (7) m. diaphrag-matopraecordialis absent in larvae (Haas25.0); (8) lateral fibers of m. subarcualis rec-tus II–IV invade interbranchial septum IVmusculature in larvae (Haas 29.1); (9) m. su-barcualis rectus II–IV split into medial andlateral separate muscles (Haas 30.1); (10) m.subarcualis rectus I portion with origin fromceratobranchial III absent (Haas 35.0); (11)ventral portion of the m. subarcualis rectus Iinserts laterally on ceratohyal (Haas 36.1);(12) origin of m. suspensoriohyoideus fromposterior palatoquadrate (Haas 46.1); (13) m.interhyoideus and m. intermandibularis inclose proximity (Haas 47.0); (14) m. man-dibulolabialis inserting exclusively on carti-lago labialis inferior (Haas 49.1); (15) m. le-vator mandibulae internus anterior (Haas

31 We realize, of course, that Phrynomantis Peters,1867, is the sole member of Phrynomerinae Noble,1931. But, beyond the autapomorphic intercalary pha-langeal elements, we have only weak evidence for itsplacement. In this case, recognition of a monotypic sub-family serves no purpose.


58.2); (16) m. levator mandibulae longusoriginates exclusively from arcus subocularis(Haas 60.2); (17) profundus and superficialisportions of m. levator mandibulae longus notoverlapping and parallel (Haas 62.1); (18) ra-mus mandibularis (cranial nerve V3) betweenportions of m. levator mandibulae longusmuscle (Haas 64.1); (19) processus suboticusquadrati present (Haas 76.1); (20) partes cor-pores forming medial body (Haas 87.2); (21)distal end of cartilago meckeli expanded andflattened with no fossa (Haas 94.2); (22) hy-pobranchial plates fused (Haas 107.1); (23)commissura proximalis I present (Haas109.1); (24) processus branchialis closed(Haas 114.1); (25) accessory longitudinalbars of cartilage dorsal to ceratobranchialiaII and III present (Haas 120.1); (26) posteriormargin of ventral velum discontinuous (Haas129.1); (27) glottis position posterior (Haas130.1); (28) nostrils closed in larval stages(Haas 131.1); (29) branchial food traps di-vided and crescentic (Haas 135.1); and (30)eggs floating (Haas 141.2). Although most ofthese characters will survive denser taxonsampling, the placement of some of them iscurrently ambiguous inasmuch as some ofthe characters listed could actually be sittingon branches from which Synapturanus andKalophrynus are derived.

Presence of palatal folds is optimization-dependent. Presence of palatal folds may beconvergent in Microhylidae and Xenosyneu-nitanura, or a synapomorphy of Allodapan-ura and lost in Laurentobatrachia.

SYSTEMATIC COMMENTS: The obtained phy-logenetic structure of Microhylidae surprisedus as we expected Scaphiophryninae to formthe sister taxon of the remaining microhylids,because the scaphiophrynine tadpole mor-phology (Blommers-Schlosser, 1975; Haas,2003), is annectant in many ways betweenthe ranid and more typical microhylid con-dition. As in several other parts of the tree,the density of our taxon sampling was inad-equate to address all problems in microhylidsystematics, and we intend our results toguide more thorough studies. Rafael de Saand collaborators have begun such a study,and we anticipate further revision of micro-hylid systematics as a result. For this reasonwe leave several taxa unnamed and unad-dressed. As an initial step toward an entirely

monophyletic taxonomy we propose the fol-lowing taxonomic changes: (1) place Aster-ophryinae and Genyophryninae in one sub-family, Asterophryinae (following Savage,1973); (2) restrict Dyscophinae to Dyscophus(also following Savage, 1973) and transferCalluella from Dyscophinae to Microhyli-nae; (3) retain Cophylinae, but note that itappears to be imbedded within a cluster of‘‘microhyline’’ genera that, once their phy-logeny is better resolved, may require somereconstitution of Cophylinae; and (4) parti-tion Microhylinae into a New World group,Gastrophryninae, and an Old World group,Microhylinae, with several genera left incer-tae sedis until they can be adequately studiedor placed in a more densely sampled frame-work. Another group of genera (i.e., Kalo-phrynus, Synapturanus, Phrynomantis, Mi-cryletta) is left incertae sedis, as well, al-though the phylogenetic structure we ob-tained among these taxa is instructive andpoints to new questions for systematists toaddress. Nevertheless, our obtained structuresuggests that the biogeography of Microhy-lidae is complex and old.

Our data show that the former ‘‘Micro-hylinae’’ (sensu lato) is heterogenous mix-ture of basal taxa (e.g., Synapturanus, Mi-cryletta) and two distantly related clades withwhich we have associated the names Micro-hylinae (Asia) and Gastrophryninae (Ameri-cas). There is no published evidence thatwould allow us to allocate any of the un-studied Asian taxa to Microhylinae or to anyother position in our cladogram beyond theirbeing microhylids. Similarly, although weassume that such taxa as Hypopachus are inGastrophryninae, our molecular results are soincongruent with results from morphology(e.g., Zweifel, 1986; Donnelly et al., 1990;Wild, 1995) that we hesitate to conjecture.

Morphological characters that are candi-dates as synapomorphies of [134] Dyscophi-nae 1 Asterophryninae 1 Scaphiophryninae1 Microhylinae clade are (1) double-layereddermis (Haas 13.1, also in Hemisus and Kas-sina); (2) anterior insertion of m. subarcualisrectus II–IV on ceratobranchial I (Haas37.0); and (3) partes corpores forming medialbody (Haas 87.2).

Because the nominal subfamilies of Mi-crohylidae are large and morphologically dis-


parate, we include separate accounts for thenominal subfamilies.

[135] SUBFAMILY: ASTEROPHRYINAEGUNTHER, 1858

Asterophrydidae Gunther, 1858b: 346. Type ge-nus: Asterophrys Tschudi, 1838.

Xenorhinidae Mivart, 1869: 286. Type genus: Xe-norhina Peters, 1863.

Genyophrynidae Boulenger, 1890: 326. Type ge-nus: Genyophryne Boulenger, 1890. New syn-onym.

Sphenophryninae Noble, 1931: 531. Type genus:Sphenophryne Peters and Doria, 1878, by mon-otypy. New synonym.

Phrynomantini Burton, 1986: 405–450. Type ge-nus: ‘‘Phrynomantis Peters, 1867’’.

Barygenini Burton, 1986: 405–450. Type genus:Barygenys Parker, 1936.

Callulopini Dubois, 1988a: 3. Type genus: Cal-lulops Boulenger, 1888.

IMMEDIATELY MORE INCLUSIVE TAXON:[134] unnamed taxon.

SISTER TAXON: Dyscophinae Boulenger,1882.

RANGE: Southern Philippines, Sulawesi,and Lesser Sunda Islands and Moluccas east-wards through New Guinea and satellite is-lands to Australia.

CONTENT: Albericus Burton and Zweifel,1995; Aphantophryne Fry, 1917 ‘‘1916’’;Asterophrys Tschudi, 1838; AustrochaperinaFry, 1912; Barygenys Parker, 1936; Callu-lops Boulenger, 1888; Choerophryne Kam-pen, 1914; Cophixalus Boettger, 1892; Cop-iula Mehely, 1901; Genyophryne Boulenger,1890; Hylophorbus Macleay, 1878; Liophry-ne Boulenger, 1897; Mantophryne Boulen-ger, 1897; Oreophryne Boettger, 1895; Ox-ydactyla Kampen, 1913; Pherohapsis Zwei-fel, 1972; Sphenophryne Peters and Doria,1878; Xenorhina Peters, 1863 (including Xe-nobatrachus Peters and Doria, 1878; see ap-pendix 7 for new combinations).

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis apply to this taxon because as direct de-velopers they were not part of the tadpolestudy by Haas (2003). Among microhylids,only Asterophryinae and Myersiella (Micro-hylinae; Izecksohn et al., 1971; Zweifel,1972; Thibaudeau and Altig, 1999) exhibitdirect development, the development taking

place completely within the egg capsule, al-though others (e.g., Cophylinae, some Gas-trophryninae) are endotrophic and nidicolous(Blommers-Schlosser, 1975). (See appendix5 for molecular synapomorphies.)

SYSTEMATIC COMMENTS: Former Geny-ophryninae is paraphyletic with respect tothe old Asterophryinae, and for this reasonthe two nominal taxa were synonymized in‘‘Results’’. Parker (1934) noted Genyophry-ninae (as Sphenophryninae) to be procoelousand Asterophryinae as diplasiocoelous, andthis clearly influenced later authors (e.g.,Zweifel, 1972) in retaining a distinction be-tween the nominal subfamilies. The place-ment in our tree of Australo-Papuan Aster-ophryinae (sensu lato) as the sister taxon ofthe Madagascan Dyscophinae is a remark-able biogeographic signature.

Burton (1986: 443) provided evidence thatXenorhina is paraphyletic with respect to Xe-nobatrachus, the latter differing only in lack-ing large odontoids on the vomeropalatine.Zweifel (1972) provided no evidence for themonophyly of Xenorhina. On the basis ofthese works we consider them to be syno-nyms, with Xenorhina being the older name(see appendix 7 for new combinations).Burton (1986: 443) also noted that ‘‘Manto-phryne’’ and ‘‘Hylophorbus’’ are dubiouslymonophyletic, so we place these names inquotation marks until their monophyly canbe substantiated. Although Burton (1986)provided a number of morphological char-acters and a character matrix, no one so farhas analyzed these data phylogenetically.

[118] SUBFAMILY: COPHYLINAE COPE, 1889

Cophylidae Cope, 1889: 248. Type genus: Cophy-la Boettger, 1880.

Rhombophryninae Noble, 1931: 529. Type genus:Rhombophryne Boettger, 1880.


SISTER TAXON: [117] An unnamed taxon inour analysis composed of our exemplars Ho-plophryne Barbour and Loveridge, 1928(Melanobatrachinae Noble, 1931) and Ra-manella Rao and Ramanna, 1925 (formerlyof ‘‘Microhylinae’’). Together these are thesister taxon of [121] Gastrophryninae Fitzin-ger, 1843.


RANGE: Madagascar.CONTENT: Anodonthyla Muller, 1892; Co-

phyla Boettger, 1880; Madecassophryne Gui-be, 1974; Platypelis Boulenger, 1882; Pleth-odontohyla Boulenger, 1882 (see SystematicComments); Rhombophryne Boettger, 1880(see Systematic Comments and appendix 7);Stumpffia Boettger, 1881.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimizes on this branch; because ourmorphological characters were largely de-rived from larvae, and cophylines (as tradi-tionally defined) are endotrophic and nidic-olous. Nevertheless, endotrophy is a syna-pomorphy at this level. Also, cophylineshave unfused sphenethmoids, which appearas paired elements (Parker, 1934), otherwisefound convergently in Dyscophus (Dysco-phinae) and Calluella (Microhylinae). (Seeappendix 5 for molecular synapomorphies onthis branch [118].)

SYSTEMATIC COMMENTS: The association byour molecular data of Cophylinae (Madagas-car) with our exemplars Hoplophryne (EastAfrica) and Ramanella (India) is suggestive.Madagascar–India is a repeated pattern inbiogeography, as is an apparently later con-nection of India–Africa (e.g., Chiromantis inAfrica 1 Chirixalus in Asia [Rhacophori-dae]; Petropedetes 1 Arthroleptides in Af-rica and Indirana in India [Petropedetidae]).The association of Gastrophryninae with thisoverall clade also speaks to a standard bio-geographic pattern, that of South America–Madagascar.

Andreone et al. (2004 ‘‘2005’’) providedconsiderable DNA sequence evidence thatPlethodontohyla is polyphyletic (not para-phyletic as suggested in the original publi-cation; see fig. 33). As noted by Andreone etal. (2004 ‘‘2005’’) the name PlethodontohylaBoulenger, 1882 (type species: Callula no-tosticta Gunther, 1877) adheres to his Pleth-odontohyla Group 1. Their second group of‘‘Plethodontohyla’’ falls into a monophyleticgroup with Rhombophryne testudo. Rhom-bophryne Boettger, 1880, is substantially old-er than the next older name for this taxon,Mantiphrys Mocquard, 1901 (type species:Mantiphrys laevipes Mocquard, 1895), andto provide a monophyletic taxonomy, this in-clusive taxon should be known as Rhombo-

phryne (see appendix 7 for the species namechanges that this causes). Andreone et al.(2004 ‘‘2005’’) hesitated to take this step be-cause they did not feel there was sufficientstatistical support for their maximum-likeli-hood conclusion. They did, however, notethat their parsimony tree arrived at the sameconclusion. We therefore think that it is bet-ter to recognize two clades that might befound to be each other’s closest relativeswhen more data are added to the analysis,than to retain a taxon, ‘‘Plethodontohyla’’(sensu lato) for which the preponderance ofdata does not support its monophyly. Thereare a number of species, nominally in Pleth-odontohyla, but not treated by Andreone etal. (2004 ‘‘2005’’). We retain those in Pleth-odontohyla, although some of may be foundto be members of Rhombophryne.

SUBFAMILY: DYSCOPHINAE BOULENGER, 1882

Dyscophidae Boulenger, 1882: 179. Type genus:Dyscophus Grandidier, 1872.


SISTER TAXON: [135] Asterophryinae Gun-ther, 1858.

RANGE: Madagascar.CONTENT: Dyscophus Grandidier, 1872.CHARACTERIZATION AND DIAGNOSIS: Haas

(2003) suggested the following larval char-acters that are presumed synapomorphies ofthe taxon: (1) ramus mandibularis (cranialnerve V3) runs through the m. levator man-dibulae externus group (Haas 65.1); and (2)free basihyal absent (Haas 105.0).

SYSTEMATIC COMMENT: Our data reject theassociation of Calluella with Dyscophinae(Blommers-Schlosser, 1976), which insteadplace Calluella deeply within Microhylinae.This is not surprising, inasmuch as the onlycharacteristics suggested to ally Calluellawith Dyscophinae are apparent plesiomor-phies (e.g., presence of teeth, diplasiocoelousvertebral column, large vomer). The molec-ular synapomorphies supporting a relation-ship of this taxon to Asterophryinae (branch134, appendix 5) is novel.

[121] SUBFAMILY: GASTROPHRYNINAEFITZINGER, 1843

Gastrophrynae Fitzinger, 1843: 33. Type genus:Gastrophryne Fitzinger, 1843.



SISTER TAXON: [116] unnamed taxon.RANGE: Southern United States south to

Argentina.CONTENT: Ctenophryne Mocquard, 1904;

Dasypops Miranda-Ribeiro, 1924; Derma-tonotus Mehely, 1904; Elachistocleis Parker,1927; Gastrophryne Fitzinger, 1843; Hamp-tophryne Carvalho, 1954; NelsonophryneFrost, 1987.

CHARACTERIZATION AND DIAGNOSIS: Opti-mization is problematic because none of thedirect-developing microhylids were sampledin our morphological data set. Neverthelessthe following are candidates for being syna-pomorphies of Gastrophryninae, althoughthey could be synapomorphies of Gastro-phryninae 1 Cophylinae or some subset ofGastrophryninae inasmuch as the exemplarson which this supposition is built are Gas-trophryne carolinensis, Hamptophryne boli-viana, and Elachistocleis ovalis): (1) m. le-vator arcuum branchialium III split into twocrossing bundles (Haas 41.1); (2) origin ofm. suspensoriohyoideus from otic capsule(Haas 46.2); (3) posterolateral projections ofthe crista parotica processus otobranchialis(Haas 67.2); (4) processus muscularis absent(Haas 79.0); (5) anterolateral base of proces-sus muscularis bearing ventrolateral process(Haas 80.1); and (6) ligamentum mandibu-losuprarostrale absent (Haas 127.0).

Molecular evidence (branch 121, appendix5) is strong that the New World microhylids(with the exception of Synapturanus, andpossibly several others for which we had notissues) form a clade that is most closely re-lated to the Madagascan Cophylinae.

SYSTEMATIC COMMENTS: The exclusion ofSynapturanus from this taxon comes assomething of a surprise, inasmuch as bothZweifel (1986) and Wild (1995) provided ev-idence for its placement within a New Worldclade. Nevertheless, neither Zweifel (1986)nor Wild (1995) presented morphological ev-idence for the monophyly of the New Worldmicrohylids (of which our Gastrophryninaeis a part). We expect that further research willshow the New World microhylids to be acomposite of gastrophrynines, some basaltaxa (e.g., Synapturanus), and possibly somewith relations in Asia.

SUBFAMILY: MELANOBATRACHINAE NOBLE,1931

Melanobatrachinae Noble, 1931: 538. Type ge-nus: Melanobatrachus Beddome, 1878.

Hoplophryninae Noble, 1931: 538–539. Type ge-nus: Hoplophryne Barbour and Loveridge,1928.


SISTER TAXON: Ramanella Rao and Ra-manna, 1925.

RANGE: Montane Tanzania and southernIndia.

CONTENT: Hoplophryne Barbour and Lov-eridge, 1928; Melanobatrachus Beddome,1878; Parhoplophryne Barbour and Lover-idge, 1928.

CHARACTERIZATION AND DIAGNOSIS: Melan-obatrachinae shares two synapomorphies(Parker, 1934): (1) middle and outer ear ab-sent; (2) parasphenoid and sphenethmoidfused.

SYSTEMATIC COMMENTS: Although we pro-visionally retain Melanobatrachinae as an un-tested taxon, the placement of Hoplophryne(our exemplar) in the general tree (see figs.50 and 61) suggests that a more densely sam-pled analysis will provide results that rendera Melanobatrachinae containing several moregenera (such as Ramanella) than as currentlycomposed. Hoplophryne and Parhoplophry-ne were placed in Hoplophrynine by Noble(1931) on the basis of sharing the apomorphyof a greatly reduced first finger. (Noble alsoallied these genera with Brevicipitidae on thebasis of retaining a complete clavicle, butthis alliance is not supported by our data.)Parker (1934) placed Hoplophryninae in thesynonymy of Melanobatrachinae (India) be-cause they share the absence of the auditoryapparatus and fusion of the parasphenoid tothe sphenenthmoid. We could not sampleMelanobatrachus, but it remains possiblethat it is the sister taxon of Hoplophryninaeand that Hoplophryne and Parhoplophryneare African outliers of a predominantly In-dian group. This is conjecture, however, andonly more data and denser sampling will re-solve the issue.

[130] SUBFAMILY: MICROHYLINAE GUNTHER,1858 (1843)

Hylaedactyli Fitzinger, 1843: 33. Type genus: Hy-laedactylus Dumeril anbd Bibron, 1841.


Micrhylidae Gunther, 1858b: 346. Type genus:Micrhyla Dumeril and Bibron, 1841 (an incor-rect subsequent spelling of Microhyla Tschudi,1838).

Kaloulinae Noble, 1931: 538. Type genus: Kal-oula Gray, 1831.


SISTER TAXON: Scaphiophryninae Laurent,1946.

RANGE: India, China, Japan, and Korea tothe Philippines and Greater Sunda Islands.

CONTENT: Calluella Stoliczka, 1872;Chaperina Mocquard, 1892; Kaloula Gray,1831; Microhyla Tschudi, 1838.

CHARACTERIZATION AND DIAGNOSIS: Haas(2003) examined only Kaloula within thisclade, so this is our only morphological ex-emplar for this subfamily, but the followingare candidates for being synapomorphies ofthe Microhylinae: (1) vena caudalis dorsalisabsent (Haas 14.0); (2) origin of m. suspen-soriohyoideus from otic capsule (Haas 46.2);and (3) posterolateral projections of the cristaparotica expansive flat chondrifications(Haas 67.2). Nevertheless, the molecular ev-idence is decisive for the recognition of thistaxon (see appendix 5).

COMMENT: See Microhylidae account forcomment on East Asian ‘‘microhylines’’ ex-cluded from this taxon because of lack ofevidence to place them.

SUBFAMILY: SCAPHIOPHRYNINAE LAURENT,1946

Scaphiophryninae Laurent, 1946: 337. Type ge-nus: Scaphiophryne Boulenger, 1882.

Pseudohemisiinae Tamarunov, 1964a: 132. Typegenus: Pseudohemisus Mocquard, 1895.


SISTER TAXON: [130] Microhylinae Gun-ther, 1858 (1843).

RANGE: Madagascar.CONTENT: Scaphiophryne Boulenger,

1882.CHARACTERIZATION AND DIAGNOSIS: In our

topology Scaphiophryne is deeply imbeddedwithin Microhylidae, requiring a remarkablenumber of reversals. Nevertheless, we sug-gest these reversals are likely synapomor-phies of the taxon, while noting that most of

these are highly contingent on topologicalposition of Scaphiophryne: (1) keratinizedjaw sheaths present (Haas 6.1; reversal fromthe microhylid condition); (2) eye positiondorsolateral (Haas 11.0; reversal from themicrohylid condition); (3) spiracle positionsinistral (Haas 18.1; reversal from the micro-hylid condition); (4) m. interhyoideus pos-terior absent (Haas 23.0; reversal from thephthanobatrachian condition); (5) m. subar-cualis rectus II–IV represented by a singleflat tract of fibers (Haas 30.0; reversal fromthe microhylid condition); (6) insertion of m.rectus cervicis on proximal ceratobranchialiaIII and IV (Haas 39.2; reversal from micro-hylid condition); (7) m. interhyoideus and m.intermandibularis well separated by a gap(Haas 47.1; reversal from the microhylidcondition); (8) m. mandibulolabialis insertingin soft tissue of lip (Haas 49.0; reversal frommicrohylid condition); (9) m. levator man-dibulae internus low (Haas 58.1; reversalfrom microhylid condition); (10) m. levatormandibulae longus originates from posteriorpalatoquadrate (Haas 60.1; reversal from mi-crohylid condition); (11) ramus mandibularis(cranial nerve V3) anterior (dorsal) to the m.levator mandibulae longus (Haas 64.2); (12)processus suboticus quadrati absent (Haas76.0; reversal from microhylid condition);(13) arcus subocularis with irregular margin(Haas 81.1; reversal of microhylid condi-tion); (14) cartilaginous roofing of the cavumcranii absent (Haas 96.0; reversal of predom-inant microhylid condition); and (15) glottisposition posterior (Haas 130.0; reversal ofmicrohylid condition).

SYSTEMATIC COMMENTS: Ford and Canna-tella (1993: 94–117), found no evidence forthe monophyly of this taxon. Haas (2003: 50)suggested on the basis of tadpole morphol-ogy that Paradoxophyla is more closely re-lated to Phrynomantis than to the remainingScaphiophryninae, rendering the latter non-monophyletic. On that basis alone, becausewe did not have tissues of Paradoxophyla,we transfer Paradoxophyla from Scaphio-phryninae to incertae sedis under Microhy-lidae. The association (branch 129, appendix5) of Madagascan Scaphiophryninae withMicrohylinae may suggest an Indian originof Microhylinae. (See Systematic Commentunder Cophylinae.)


[143] AFROBATRACHIA NEW TAXON

ETYMOLOGY: Afro- (Latin: of Africa) 1batrachos (Greek: frog), in reference to thepredominantly African range of this taxon.

IMMEDIATELY MORE INCLUSIVE TAXON:[109] Allodapanura new taxon.

SISTER TAXON: [110] Microhylidae Gun-ther, 1858 (1843).

RANGE: Sub-Saharan Africa, Madagascar,and the Seychelles.

CONCEPT AND CONTENT: Afrobatrachia is amonophyletic taxon composed of [144] Xe-nosyneunitanura new taxon and [148] Lau-rentobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Likelycandidates for being synapomorphies are thelarval characters: (1) m. transversus ventralisIV present (Haas 22.1); (2) posterolateralprojections of the crista parotica formingprocessus otobranchialis (Haas 67.3); (3)processus ascendens thin (Haas 72.1); (4)dorsal connection from processus muscularisto ‘‘high’’ commissura quadrato-orbitalis(Haas 78.3); and (5) anterolateral base ofprocessus muscularis bearing ventrolateralprocess (Haas 80.1). See characterisation ofAllodapanura for additional discussion ofpossible synapomorphies.

COMMENT: Our Afrobatrachia is identicalin content to the enlarged Brevicipitidae ofDubois (2005).

[144] XENOSYNEUNITANURA NEW TAXON

ETYMOLOGY: Xeno- (Greek: strange) 1syneunitos (Greek: bed sharer) 1 anoura(Greek: frog). In other words, the namemeans ‘‘strange bedfellows’’ inasmuch asHemisotidae and Brevicipitidae, althoughcladistic nearest relatives, are dissimilar ani-mals.

IMMEDIATELY MORE INCLUSIVE TAXON:[143] Afrobatrachia new taxon.

SISTER TAXON: [148] Laurentobatrachianew taxon.

RANGE: Sub-Ssaharan Africa.CONCEPT AND CONTENT: Xenosyneunitanu-

ra new taxon is a monophyletic taxon con-taining Hemisotidae Cope, 1867, and [145]Brevicipitidae Bonaparte, 1850.

CHARACTERIZATION AND DIAGNOSIS: Hemi-sotidae and Brevicipitidae share the absenceof the palatine bones (De Villiers, 1931),

which at this position in the general clado-gram is a synapomorphy. Breviceps andHemisus also share a single median thyroidgland (Blommers-Schlosser, 1993), so wepresume that this, too, is a synapomorphyjoining the two taxa. Breviceps and Hemisusalso exhibit nasal plugs (De Villiers, 1931)which may be homologous. (See also ‘‘Char-acterization and Diagnosis’’ under Hemiso-tidae for other characters that may optimizeon this taxon.) Molecular synapomorphiesare provided in appendix 5.

[145] FAMILY: BREVICIPITIDAE BONAPARTE,1850

Brevicipitina Bonaparte, 1850: 1 p. Type genus:Breviceps Merrem, 1820.

Engystomidae Bonaparte, 1850: 1 p. Type genus:Engystoma Fitzinger, 1826.

IMMEDIATELY MORE INCLUSIVE TAXON:[144] Xenosyneunitanura new taxon.

SISTER TAXON: Hemisotidae Cope, 1867.RANGE: Sub-Saharan East Africa and

southern Africa, from Ethiopia south to An-gola and South Africa.

CONTENT: Balebreviceps Largen andDrewes, 1989; Breviceps Merrem, 1820;Callulina Nieden, 1911 ‘‘1910’’; Probrevi-ceps Parker, 1931; Spelaeophryne Ahl, 1924.

CHARACTERIZATION AND DIAGNOSIS: Parker(1934) noted that brevicipitids lack ossifiedsphenethmoids, which is clearly a synapo-morphy at this level. In addition, the loss ofthe pterygoid, palatoquadrate, and m. oper-cularis (De Villiers, 1931) are likely syna-pomorphies for this group. The extremelyshort head and direct development exhibitedby this taxon (Parker, 1934) are also syna-pomorphies.

SYSTEMATIC COMMENT: Loader et al. (2004)suggested a phylogeny of Breviceps (Spe-laeophryne 1 (Callulina 1 Probreviceps));they, like us, did not include Balebrevicepsin their analysis. On the basis of our largeramount of evidence but less dense sampling,we placed Probreviceps nearer to Brevicepsin our tree. Nevertheless, both arrangementsconflict with the character of fusion of theurostyle and sacrum found in Probrevicepsand Breviceps but not in Spelaeophryne andCallulina (Parker, 1934), suggesting that ad-ditional testing is warranted.


FAMILY: HEMISOTIDAE COPE, 1867

Hemisidae Cope, 1867: 198. Type genus: HemisusGunther, 1859 ‘‘1858’’. Emended to Hemisotinaby Gunther, 1870: 119.

IMMEDIATELY MORE INCLUSIVE TAXON:[144] Xenosyneunitanura new taxon.

SISTER TAXON: [145] Brevicipitidae Bona-parte, 1850.

RANGE: Sub-Saharan Africa.CONTENT: Hemisus Gunther, 1859

‘‘1858’’.CHARACTERIZATION AND DIAGNOSIS: All of

the characters in our analysis (from Haas,2003) that optimize on Hemisus (our onlymorphological exemplar in this clade) maybe synapomorphies of this clade, the Hemi-sotidae, or some subset of Hemisus: (1) dou-ble-layered dermis in larvae (Haas 13.1); (2)posterior dorsal process of pars alaris ex-panded terminally, almost rectangular in lat-eral view (Haas 89.1); (3) larvae are guidedby the female from the nest to pond (Haas137.1); and (4) amplexus absent (Haas139.0). Some of these may be synapomor-phies at the level of Xenosyneunitanura in-asmuch as Brevicipitidae was not studied byHaas (2003) because they lack exotrophiclarvae, which were the focus of Haas’ study.

Hemisus lacks vomers, middle ear, andductus lacrimosus, and exhibits fusion of ver-tebrae 8 and 9 (De Villiers, 1931). Further,Hemisus burrows head-first (Channing,1995). All of these characters can safely beconsidered synapomorphies of Hemisotidae.

[148] LAURENTOBATRACHIA NEW TAXON

ETYMOLOGY: R.L. Laurent 1 batrachia(Greek: batrachos, frog). This name cele-brates the enormous contributions to amphib-ian systematics by the father of central Af-rican herpetology and a prominent figure inArgentinian herpetology, Raymond L. Lau-rent.


SISTER TAXON: [144] Xenosyneunitanuranew taxon.

RANGE: Sub-Saharan Africa, Madagascar,and the Seychelles.

CONTENT AND CONCEPT: Laurentobatrachiais a monophyletic group composed of [149]

Hyperoliidae Laurent, 1943, and [164] Ar-throleptidae Mivart, 1869.

CHARACTERIZATION AND DIAGNOSIS: Thecharacters (from Haas, 2003) 54.1 (larval m.levator manidbulae externus in two portion),111.0 (commissura proximalis III absent),and 151.0 (intercalary elements absent) arelikely synapomorphies of this group, al-though because of the low density of taxonsampling this requires additional specimenexamination. In addition, claw-shaped ter-minal phalanges appear to optimize on thisbranch, appearing convergently in Ptychad-ena and several of the hyloids (Liem, 1970),although the distribution of this character iscomplicated, and further work may show thatthis optimization is mistaken. Drewes (1984)suggested that thyrohyals borne on cartilag-inous stalks (his character 10.1) might be asynapomorphy, although this is optimization-dependent inasmuch as this character is notin Leptopelis (Laurent, 1978). The externalmetatarsal tubercle is absent or poorly de-veloped throughout Laurentobatrachia (Lau-rent, 1986), but the exact distribution of thisrequires verification. Molecular synapomor-phies for this taxon are summarized in ap-pendix 5.

SYSTEMATIC COMMENT: Vences and Glaw(2001) and Van der Meijden et al. (2005) rec-ognized this taxon as the epifamily Arthro-leptoidae, and originally Laurent (1951) con-sidered this clade (with the possible inclusionof Scaphiophryninae) to be a single family,and Dubois (2005) considered our Lauren-tobatrachia to be 4 of the 6 subfamilies ofhis Brevicipitidae. We attempted to retain fa-miliar usage, with the exception of movingLeptopelinae from Hyperoliidae to Arthro-leptidae. Because we think that the diversityof this taxon has been greatly underestimat-ed, our approach leaves considerable roomfor more informative taxonomies as evidencebecomes available.

[149] FAMILY: HYPEROLIIDAE LAURENT, 1943

Hyperoliinae Laurent, 1943: 16. Type genus: Hy-perolius Rapp, 1842.

Kassinini Laurent, 1972: 201. Type genus: Kas-sina Girard, 1853.

Tachycneminae Channing, 1989: 127. Type ge-nus: Tachycnemis Fitzinger, 1843.



SISTER TAXON: [164] Arthroleptidae Mi-vart, 1869.

RANGE: Sub-Saharan Africa and Madagas-car; Seychelles.

CONTENT: Acanthixalus Laurent, 1944;Afrixalus Laurent, 1944; Alexteroon Perret,1988; Arlequinus Perret, 1988; CallixalusLaurent, 1950; Chlorolius Perret, 1988;Chrysobatrachus Laurent, 1951; Cryptothy-lax Laurent and Combaz, 1950; HeterixalusLaurent, 1944; Hyperolius Rapp, 1842 (in-cluding Nesionixalus Perret, 1976); KassinaGirard, 1853; Kassinula Laurent, 1940; Op-isthothylax Perret, 1966; Paracassina Per-acca, 1907; Phlyctimantis Laurent and Com-baz, 1950; Semnodactylus Hoffman, 1939;Tachycnemis Fitzinger, 1843.

CHARACTERIZATION AND DIAGNOSIS: Onelarval character in our analysis that may besynapomorphy of this group is (from Haas,2003): commissura proximalis II absent. Be-yond that, hyperoliids are unique amongfrogs in having a distinctive gular gland(Drewes, 1984). Drewes (1984) summarizeda character distribution suggesting that lack-ing sphincter control of the vocal slits mayalso be a synapomorphy of Hyperoliidae.

The presence of intercalary phalangeal el-ements per se is not a synapomorphy of thisgroup (or at least not without making as-sumptions of character optimization), beingfound also in the Leptopelinae of Arthrolep-tidae. Nevertheless, Drewes (1984) notedthat hyperoliid and leptopeline intercalary el-ements are histologically quite different fromeach other. The latter does not accept eitherAlizarin or Alcian Blue stain, suggesting thatthese elements may not be homologous.

SYSTEMATIC COMMENTS: The position inour tree of Acanthixalus is heterodox com-pared with previous studies (e.g., Drewes,1984) and implies a number of reversals andconvergences in the morphology of hypero-liid frogs. We considered recognizing sub-families within Hyperoliidae, correspondingto the two major clades of exemplars, forwhich the name Kassininae Laurent, 1972, isavailable for the Kassina–Phlyctimantis–Acanthixalus clade and Hyperoliinae Lau-rent, 1943, for the remainder of our exemplar

taxa. We did not sample Chrysobatrachus orCallixalus and cannot guess into whichgroup they would fall. Their association withAcanthixalus in the tree of Drewes (1984)suggests that they might follow Acanthixalusinto Kassininae, but this is merely conjectureand a combined study of morphology andmolecules is ongoing by Drewes and collab-orators. Our results differ substantially fromthe results of Vences et al. (2003d; figs. 28,29) with respect to the relative placement ofseveral genera. This is presumably due to ourapplication of much denser sampling andmore evidence.

The association by the molecular data ofTachycnemis (Seychelles) and Heterixalus(Madagascar) is of some biogeographic in-terest. We expected Alexteroon to be imbed-ded within Hyperolius, but our sampling ofHyperolius was insufficient to test this prop-osition adequately. On the basis of our lim-ited exemplar selection, Alexteroon may bethe sister taxon of Hyperolius (sensu lato).However, we found, as did Drewes and Wil-kinson (2004), that Nesionixalus is clearlydeeply imbedded in Hyperolius, but also rep-resents a monophyletic group. We suggestthat Nesionixalus be treated as a subgenus ofHyperolius with no coordinate taxon to im-ply that the remaining species of Hyperoliusare a monophyletic group (see appendix 7 fornew combinations). We expect that Chloro-lius and Arlequinus will also be found to beimbedded within Hyperolius, although at thistime no data can be brought to bear to testthis proposition.

[164] FAMILY: ARTHROLEPTIDAE MIVART, 1869

Arthroleptina Mivart, 1869: 294. Type genus: Ar-throleptis Smith, 1849.

Astylosterninae Noble, 1927: 110. Type genus:Astylosternus Werner, 1898.

Leptopelini Laurent, 1972: 201. Type genus: Lep-topelis Gunther, 1859. New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[147] Laurentobatrachia new taxon.

SISTER TAXON: [149] Hyperoliidae Laurent,1943.

RANGE: Sub-Saharan Africa.CONTENT: Arthroleptis Smith, 1849 (in-

cluding Schoutedenella De Witte, 1921; see


Systematic Comments); Astylosternus Wer-ner, 1898; Cardioglossa Boulenger, 1900;Leptodactylodon Andersson, 1903; Lepto-pelis Gunther, 1859; Nyctibates Boulenger,1904; Scotobleps Boulenger, 1900; Trichob-atrachus Boulenger, 1900.

CHARACTERIZATION AND DIAGNOSIS: Arthro-leptids are small frogs exhibiting forkedomosterna that, with the exception of Arthro-leptis, have a typically biphasic life history.Like many of the taxa within Afrobatrachia,many of the arthroleptids have vertical pu-pils, with the exceptions of Leptodactylodon(quadrangular) and Arthroleptini (horizontal,except for Scotobleps). None of the morpho-logical characters in our analysis optimizeunambiguously to this branch [164]. Regard-less, the molecular data are decisive in sup-port of recognition of this group (see appen-dix 5).

Larval characters of Haas’ (2003) exem-plar Leptopelis—a distinct medial ossifica-tion center of vertebral centra ventral to no-tochord present (Haas 100.1)—may be syn-apomorphies of Arthroleptidae, of Leptope-linae, or of some subset of Leptopelis. Thedirect development of Arthroleptis is subse-quently derived.

SYSTEMATIC COMMENTS: We recognize twosubfamilies within Arthroleptidae, [165]Leptopelinae Laurent, 1972, for Leptopelis,formerly associated with Hyperoliidae (al-though shown to be phylogenetically distantfrom them by Vences et al., 2003c), and[168] Arthroleptinae Mivart, 1869, contain-ing two tribes, [169] Astylosternini Noble,1931 (Leptodactylodon, Nyctibates, Trichob-atrachus, and Leptodactylodon) and [172]Arthroleptini Mivart, 1869 (Arthroleptis [in-cluding Schoutedenella], Cardioglossa, andScotobleps). Scotobleps formerly was asso-ciated with Astylosterninae, so its transfer toArthroleptini is something of a surprise (onthe basis of evidence shown in appendix 5).

[165] Leptopelinae Laurent, 1972, is dis-tinguished morphologically from its nearneighbors by the possession of an entire,rather than forked, omosternum and by his-tologically distinct intercalary phalangeal el-ements (Drewes, 1984).

[168] Arthroleptinae Mivart, 1869, is notdiagnosable via morphology, although theabsence of intercalary elements may be syn-

apomorphic should one be willing to makeassumptions about character optimizationand that the phalangeal elements of lepto-pelines and hyperoliids are homologous.

Arthroleptis renders Schoutedenella para-phyletic, and we therefore consider them tobe synonyms. Laurent and Fabrezi’s (1986‘‘1985’’) contention that Schoutedenella andArthroleptis are not each other’s closest rel-atives is rejected, although the position ofPoynton (1964a) and Poynton and Broadley(1967), that Schoutedenella are merely smallArthroleptis is also rejected. (Our tree sug-gests that if size were characteristic, wewould have to say that Arthroleptis are bigSchoutedenella.) Our molecular data supportthe notion that nominal Arthroleptis is im-bedded within Schoutedenella and we placethem in synonymy. (See appendix 7 for newand revived combinations.)

Perret (1966) suggested that Nyctibates isa synonym of Astylosternus, but Amiet (1971‘‘1970’’, 1973 ‘‘1972’’) resurrected Nycti-bates on the basis of tadpole morphology be-ing more similar to Leptodactylodon and Tri-chobatrachus. Our molecular data supportrecognition of Nyctibates.

[180] NATATANURA NEW TAXON

ETYMOLOGY: Natata- (Greek: swim) 1 an-oura (Greek: tailless, i.e., frog), referencingthat many of the frogs in this clade are semi-aquatic.

IMMEDIATELY MORE INCLUSIVE TAXON:[108] Ranoides new taxon.

SISTER TAXON: [109] Allodapanura newtaxon.

RANGE: Worldwide temperate and tropicalhabitats on all continents and major islands,except most of Australia and New Zealand.

CONCEPT AND CONTENT: Natatanura is amonophyletic group composed of [181] Pty-chadenidae Dubois, 1987 ‘‘1986’’, and [183]Victoranura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Nata-tanura is identical to the epifamily Ranoidaeof Dubois (1992) and Ranidae (sensu lato) ofLaurent (1986). Characters in our analysis(from Haas, 2003) that are likely synapo-morphies of this taxon are (1) anterior inser-tion of m. subarcualis rectus II–IV on cera-tobranchial III (Haas 37.2); (2) commissura


proximalis II absent (Haas 110.0); and (3)commissura proximalis III absent (Haas111.0).

J.D. Lynch (1973) and Laurent (1986)suggested that an ossified metasternal style isa synapomorphy at this level of universality,but this requires corroboration inasmuch asseveral groups within Natatanura have carti-laginous metasterna (Laurent, 1986).

SYSTEMATIC COMMENT: Burton (1998a)noted that several genera of Natatanura sharethe presence of an extra slip of the m. flexorteres digiti IV, which is ventral to the m.transversus metacarpus II: Altirana, Aubria,Ceratobatrachus, Conraua, Hildebrandtia,Mantella, Mantidactylus, Petropedetes, Pty-chadena, Pyxicephalus, and Rana, but not inBatrachylodes, Cacosternum, Discodeles,Laliostoma, Meristogenys, Micrixalus, Nan-nophrys, Nanorana, Natalobatrachus, Nyc-tibatrachus, Occidozyga, Palmatorappia,Platymantis, or Strongylopus (with manytaxa not examined). If this character is opti-mized on our most parsimonious tree, the im-plication is that this character arose at leastsix times, of which the following is one ofseveral equally parsimonious arrangements:(1) Ceratobatrachus; (2) in the branch sub-tending Conraua 1 Petropedetes, and there-fore likely to be in Indirana and Arthrolep-tides); (3) Ptychadenidae (Hildebrantia, Pty-chadena, and presumably in Lanzarana); (4)Pyxicephalini (Pyxicephalus and Aubria); (5)Altirana (5 part of Nanorana); (6) Aglaioan-ura (Rhacophoroidea 1 Ranidae). Neverthe-less, considerably more specimens of moretaxa need to be examined before the opti-mization of this feature can confidently beconsidered settled.

[181] FAMILY: PTYCHADENIDAE DUBOIS, 1987‘‘1986’’

Ptychadenini Dubois, 1987 ‘‘1985’’: 55. Type ge-nus: Ptychadena Boulenger, 1917.

IMMEDIATELY MORE INCLUSIVE TAXON:[180] Natatanura new taxon.

SISTER TAXON: [183] Victoranura new tax-on.

RANGE: Sub-Saharan tropical and subtrop-ical Africa; Seychelles and Madagascar.

CONTENT: Hildebrandtia Nieden, 1907;

Lanzarana Clarke, 1982; Ptychadena Bou-lenger, 1917.

CHARACTERIZATION AND DIAGNOSIS: In ouranalysis, the morphological (larval) charac-ters that attach to the only exemplar of thistaxon, Ptychadena, are (1) m. subarcualisrectus I portion with origin from ceratobran-chial III absent (Haas 35.0); (2) partes cor-pores medially separate (Haas 87.0); and (3)eggs float as a surface film (Haas 141.2). Be-cause of our limited sampling for morphol-ogy, it is possible that these characters do notapply to Hildebrandtia or Lanazarana; it isalso possible that they apply only to a subsetof Ptychadena. Only denser sampling willtell.

Other features that are likely synapomor-phies, although originally suggested in asomewhat different outgroup structure(Clarke, 1981), are (1) otic plate absent orrudimentary; (2) (neo)palatines absent; (3)point overlap of the medial ramus of the pter-ygyoid and the anterior lateral border of theparasphenoid ala in an anterior–posteriorplane; (4) clavicles reduced and well-sepa-rated at midline; (5) sternal style a shortcompact bony element; (6) eight presacraland sacral vertebrae fused (also in some Lith-obates); and (7) dorsal protuberance on iliumnot or only slightly differentiated from dorsalprominence, which is smooth surfaced andconfluent with a well-developed ilial crest.

SYSTEMATIC COMMENT: See SystematicComments under Natatanura. Our associationof Hildebrandtia and Lanzarana with thistaxon rests on the morphological data anal-ysis of Clarke (1981), who suggested a num-ber of synapomorphies for the group (seeabove).

[183] VICTORANURA NEW TAXON

ETYMOLOGY: Victor (Latin: conqueror) 1anoura (Greek: tailless; i.e., frog), alluding tothe remarkable success of this taxon world-wide.

IMMEDIATELY MORE INCLUSIVE TAXON:[180] Natatanura new taxon.

SISTER TAXON: [181] Ptychadenidae Du-bois, 1987 ‘‘1986’’.

RANGE: Worldwide continents and majorislands in temperate and tropical regions, ex-


cept southern Australia, the Seychelles, andNew Zealand.

CONCEPT AND CONTENT: Victoranura is amonophyletic group composed of [184] Cer-atobatrachidae Boulenger, 1884, and [189]Telmatobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis diagnose on this taxon, although the mo-lecular data are decisive (see appendix 5 forsummary of molecular synapomorphies).

[184] FAMILY: CERATOBATRACHIDAEBOULENGER, 1884

Ceratobatrachidae Boulenger, 1884: 212. Type ge-nus: Ceratobatrachus Boulenger, 1884.

Platymantinae Savage, 1973: 354. Type genus:Platymantis Gunther, 1859.

IMMEDIATELY MORE INCLUSIVE TAXON:[183] Victoranura new taxon.

SISTER TAXON: [189] Telmatobatrachia newtaxon.

RANGE: Western China (Xizang and Yun-nan); Myanmar, adjacent Thailand and pen-insular Malaysia; Philippines, Borneo; NewGuinea; Admiralty, Bismarck, and SolomonIslands; Fiji; Palau.

CONTENT: Batrachylodes Boulenger, 1887;Ceratobatrachus Boulenger, 1884; Discode-les Boulenger, 1918; Ingerana Dubois, 1987‘‘1986’’; Palmatorappia Ahl, 1927 ‘‘1926’’;Platymantis Gunther, 1858.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize as synapomorphies of this tax-on, although all ceratobatrachids are charac-terized by large eggs and direct development(Noble, 1931). Many of the species have ex-panded toe tips, but this is likely plesiom-orphic at this level of universality. Molecularsynapomorphies for the clade are summa-rized in appendix 5.

SYSTEMATIC COMMENT: Dubois (1987‘‘1985’’, 1992) placed his CeratobatrachiiniBoulenger, 1884, within a larger Dicroglos-sinae Anderson, 1871. The subsequent im-plication of Dubois et al. (2001) that Cera-tobatrachidae (his Ceratobatrachinae) is ofuncertain relationship to Dicroglossinae wasjustified inasmuch as an inclusive Dicroglos-sinae (including Ceratobatrachiini Boulenger,1884, Conrauini Dubois, 1992, and Dicrog-

lossini Anderson, 1871) is rejected by ourevidence.

Dubois (1992) placed Batrachylodes out-side of his Ceratobatrachini, because, unlikethe more typical members of Ceratobatrachi-nae, it lacks a forked omosternum. Neverthe-less, Batrachylodes does have endotrophiclarvae (Thibaudeau and Altig, 1999), and ourmolecular evidence places Batrachylodesfirmly within the ceratobatrachine clade.

Roelants et al. (2004) provided molecularevidence suggesting that Ingerana is in Oc-cidozyginae rather than Ceratobatrachinae,but this is not corroborated by our densertaxonomic sampling and larger amount ofdata, which place Ingerana in the more con-ventional location in Ceratobatrachidae andas the sister taxon of the remaining generawithin Ceratobatrachinae. Like Roelants etal. (2004), we did not evaluate species of thenominal subgenus Liurana, a taxon that Du-bois (1987 ‘‘1985’’) erected as a subgenus ofIngerana, but subsequently was recognizedby some workers as a genus (Fei et al., 1997)and later (Dubois, 2005, without discussion)as a synonym of Taylorana (5 Limnonectes).Liurana is reported to be differentiated fromIngerana by condition of the finger disc (ab-sent in Liurana, present in Ingerana) andmedian lingual papilla (present in Liurana,absent in Ingerana; Dubois, 1987 ‘‘1985’’),but some species of Liurana possess smallfinger discs (Zhao and Li, 1984; Fei et al.,2005), and the condition of the tongue isknown for only two of the five species ofIngerana (Smith, 1930; Inger, 1954, 1966).We treat Liurana as a synonym of Ingerana,pending evidence being published to sub-stantiate Dubois’ (2005) assertion of itsplacement in Limnonectini (Dicroglossidae).

[189] TELMATOBATRACHIA NEW TAXON

ETYMOLOGY: Telmato- (Greek: of a marsh)1 batrachos (Greek: frog), referencing thepreference of these frogs for wet microhab-itats.

IMMEDIATELY MORE INCLUSIVE TAXON:[183] Victoranura new taxon.

SISTER TAXON: [184] CeratobatrachidaeBoulenger, 1884.

RANGE: Worldwide continents and majorislands in temperate and tropical environ-


ments, except for southern South America,Madagascar, New Zealand, and most of Aus-tralia.

CONCEPT AND CONTENT: Telmatobatrachiais a monophyletic taxon composed of [190]Micrixalidae Dubois, Ohler, and Biju, 2001,and [191] Ametrobatrachia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize on the branch subtending thistaxon although our molecular data decisivelysupport its recognition. (See appendix 5 forlisting of molecular synapomorphies.)

[190] FAMILY: MICRIXALIDAE DUBOIS, OHLER,AND BIJU, 2001

Micrixalinae Dubois et al., 2001: 54. Type genus:Micrixalus Boulenger, 1888.

IMMEDIATELY MORE INCLUSIVE TAXON:[189] Telmatobatrachia new taxon.

SISTER TAXON: [191] Ametrobatrachia newtaxon.

RANGE: India.CONTENT: Micrixalus Boulenger, 1888.CHARACTERIZATION AND DIAGNOSIS: None

of the morphological characters in our anal-ysis optimize on this taxon and the decisiveevidence for its recognition is entirely mo-lecular (see appendix 5 for summary). UnlikePtychadenidae, Ceratobatrachidae, and basal-ly in Ametrobatrachia, the omosternum is un-forked in Micrixalidae (Dubois et al., 2001),which at this level of universality is a syna-pomorphy of the group as is the low kera-todont formula 1/0 (Dubois et al., 2001). Thepresence of digital discs in Micrixalinae islikely a plesiomorphy at this level of univer-sality.

[191] AMETROBATRACHIA NEW TAXON

ETYMOLOGY: Ametros (Greek: beyondmeasure) 1 batrachos (Greek: frog), denot-ing the enormity of this taxon in terms ofspecies and with respect to the enormousnumbers of questions that remain about itsinternal phylogenetic structure.

IMMEDIATELY MORE INCLUSIVE TAXON:[189] Telmatobatrachia new taxon.

SISTER TAXON: [190] Micrixalidae Dubois,Ohler, and Biju, 2001.

RANGE: Worldwide in temperate and trop-ical continental areas and major islands, ex-

cluding Madagascar, New Zealand, Sey-chelles, and Australia except for the farnorth.

CONCEPT AND CONTENT: Ametrobatrachia isa monophyletic taxon composed of [192] Af-ricanura new taxon and [220] Saukrobatra-chia new taxon.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize as synapmorphies of this taxon.Nevertheless, the molecular data are deci-sive. (See appendix 5 for summary of mo-lecular synapomorphies for this taxon.)

[192] AFRICANURA NEW TAXON

ETYMOLOGY: Afric- (Latin: of Africa) 1anoura (Greek: tailless, i.e., frog).

IMMEDIATELY MORE INCLUSIVE TAXON:[191] Ametrobatrachia new taxon.

SISTER TAXON: [220] Saukrobatrachia newtaxon.

RANGE: Sub-Saharan Africa.CONTENT: [193] Phrynobatrachidae Lau-

rent, 1941 ‘‘1940’’, and [200] Pyxicephalo-idea Bonaparte, 1850.

CHARACTERIZATION AND DIAGNOSIS: Noneof the morphological characters in our anal-ysis optimize on this taxon. Nevertheless,molecular data are decisive. (See appendix 5for summary of molecular transformation as-sociated with this taxon.)

SYSTEMATIC COMMENT: The existence ofthis taxon had not been suspected prior to thepublication of Van der Meijden et al. (2005),although it certainly meets biogeographic ex-pectations.

[193] FAMILY: PHRYNOBATRACHIDAELAURENT, 1941 ‘‘1940’’

Hemimantidae Hoffmann, 1878: 613. Type genus:Hemimantis Peters, 1863.

Phrynobatrachinae Laurent, 1941 ‘‘1940’’: 79.Type species: Phrynobatrachus Gunther, 1862.

IMMEDIATELY MORE INCLUSIVE TAXON:[192] Africanura new taxon.

SISTER TAXON: [200] Pyxicephaloidea Bon-aparte, 1850.

RANGE: Sub-Saharan Africa.CONTENT: Ericabatrachus Largen, 1991

(see Systematic Comments); Phrynobatra-chus Gunther, 1862 (including Dimorphog-


nathus Boulenger, 1906, and PhrynodonParker, 1935; see Systematic Comments).

CHARACTERIZATION AND DIAGNOSIS: Phry-nobatrachids are small terrestrial and semi-aquatic frogs with poorly understood speciesboundaries and with a typically biphasic lifehistory, with eggs laid in water. Like manymembers of Ranoides, phrynobatrachids fre-quently have T-shaped terminal phalanges,although they lack digital discs. They usuallyretain an outer metatarsal tubercle (Laurent,1986) and are characterized by a tarsal tu-bercle (Channing, 2001) that is distinctiveand may be synapomorphic. Phrynobatra-chus species exhibit a median lingual tuber-cle (Grant et al., 1997), which may be syn-apomorphic, although this needs to be care-fully surveyed. Its presence also in Indirana,Arthroleptides, and Petropedetes suggeststhat it may be synapomorphic at a more gen-eral level.

Nevertheless, none of the morphologicalcharacters in our analysis optimize on thistaxon, although the molecular data are deci-sive in recognition of this taxon. (See appen-dix 5 for listing of molecular synapomor-phies for this taxon.)

SYSTEMATIC COMMENTS: Our data showthat Phrynobatrachus is paraphyletic with re-spect to Phrynodon and Dimorphognathus.Surprisingly, Amiet (1981) suggested a closerelationship of Phrynodon with Petropedetes(Petropedetidae) to the exclusion of Phry-nobatrachus. Our data do not support this re-lationship and because this nominal genusand Dimorphognathus are both monotypicand imbedded within Phrynobatrachus, weplace Phrynodon and Dimorphognathus intothe synonymy of Phrynobatrachus, which af-ter this action is monophyletic. Nevertheless,Phrynobatrachus remains one of the largertaxonomic problems in Africa in terms ofspecies boundaries and infrageneric clades. Itwill yield its secrets only with a considerableamount of morphological, behavioral, andmolecular work. (See appendix 7 for newand revivied combinations caused by thesesynonymies.) Our inclusion in Phrynoba-trachidae of Ericabatrachus Largen, 1991(not studied by us) rests on the original pub-lication, which suggests that Ericabatrachusis ‘‘Phrynobatrachus-like’’. Likely, it will befound to be imbedded within Phrynobatra-

chus as currently arrayed, but at present wecannot reject the possibility that it is the sis-ter taxon of Phrynobatrachus. We presumethat Dubois’ (2005) association of Ericaba-trachus with his Phrynobatrachinae is basedon similar reasoning although he provided nojustification for this inclusion.

[200] SUPERFAMILY: PYXICEPHALOIDEABONAPARTE, 1850

IMMEDIATELY MORE INCLUSIVE TAXON:[192] Africanura new taxon.

SISTER TAXON: [193] PhrynobatrachidaeLaurent, 1941 ‘‘1940’’.

RANGE: Sub-Saharan Africa.CONTENT: [201] Petropedetidae Noble,

1931, and [209] Pyxicephalidae Bonaparte,1850.

CHARACTERIZATION AND DIAGNOSIS: Al-though no morphological characters in ourstudy optimize to this branch, our moleculardata are decisive. See appendix 5 for sum-mary of molecular synapomorphies.

COMMENT: This taxon is highy heteroge-nous morphologically, at least with respect tooverall appearance. Nevertheless, the molec-ular evidence is strong, and the taxon shouldsurvive additional testing.

[201] LFAMILY: PETROPEDETIDAE NOBLE, 1931

Petropedetinae Noble, 1931: 520. Type genus: Pe-tropedetes Reichenow, 1874.

Ranixalini Dubois, 1987 ‘‘1985’’: 66. Type genus:Ranixalus Dubois, 1986. New synonym.

Conrauini Dubois, 1992: 314. Type genus: Con-raua Nieden, 1908. New synonym.

Indiraninae Blommers-Schlosser, 1993: 211. Typegenus: Indirana Laurent, 1986. New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[200] Pyxicephaloidea Bonaparte, 1850.

SISTER TAXON: [209] Pyxicephalidae Bon-aparte, 1850.

RANGE: South India; tropical West andEast Africa.

CONTENT: Arthroleptides Nieden, 1911‘‘1910’’; Conraua Nieden, 1908; IndiranaLaurent, 1986; Petropedetes Reichenow,1874.

CHARACTERIZATION AND DIAGNOSIS: Petro-pedetidae is heterogeneous morphologically,with forked omosterna. No morphologicalsynapomorphies are evident to us, althoughthe molecular data are decisive. (See appen-


dix 5 for molecular synapomorphies for thistaxon.)

SYSTEMATIC COMMENTS: The association ofIndirana (India), Conraua (tropical West Af-rica; Ethiopia and Eritrea), and Arthrolep-tides 1 Petropedetes (tropical West Africa;Tanzania and Kenya) at first surprised us,even though we had expected the undiagnos-able Petropedetidae (sensu lato, now distrib-uted among Petropedetidae, Phrynobatrachi-dae, and Dicroglossidae) to be obliterated.

The stream-dwelling larvae of Arthrolep-tides and stream-dwelling and arboreal tad-poles of Indirana are amazingly similar(compare Altig and Johnston, 1989, andChanning et al., 2002b, with Annandale andRao, 1918) in having elongate tails with verylow caudal fins, large bulging eyes, a dor-soventrally flattened body, and a laterallycompressed jaw sheath with prominent lat-eral processes (Annandale, 1918; Rao, 1920;Amiet and Perret, 1969; Inger et al., 1984;Dubois, 1986 ‘‘1985’’; Drewes et al., 1989;Channing et al., 2002b). Only larvae of Pe-tropedetes natator and P. palmipes havebeen fully described (Lamotte and Zuber-Vo-geli, 1954; Lamotte et al., 1959; Lamotte andLescure, 1989), but some superficial refer-ences to morphology or behavior are avail-able for the larvae of P. cameronensis (Bou-lenger, 1906 ‘‘1905’’; Lawson, 1993), P.newtoni (Perret, 1966; Amiet and Perret,1969; Lawson, 1993), and P. parkeri and P.johnstoni (Amiet and Perret, 1969; Amiet,1983; Lawson, 1993). Drewes et al. (1989)noted inconsistencies in the description ofthe larva of P. palmipes. Regardless, fromthe comments or illustrations presented bythe authors mentioned above, larvae of Pe-tropedetes seem to have the same morpho-logical peculiarities as do those of Arthrolep-tides and Indirana. The only exception is thelarva of P. natator, which has an abdominaldisc and an oral disc that is proportionallylarger, with conspicuous lateral folds, andjaw sheaths that are not compressed laterally(Lamotte and Zuber-Vogeli, 1954; Lamotteand Lescure, 1989).

In transforming larvae of Arthroleptides,Indirana, and Petropedetes, the hind legs arelarge and seem to develop precociously, ona different growth trajectory from the frontlegs (Annandale, 1918; Lamotte et al., 1959;

Amiet and Perret, 1969; Inger et al., 1984;Drewes et al., 1989).

Adults of Arthroleptides, Indirana, andPetropedetes also share characters whose po-larity is less clear. Males of most Petrope-detes and Arthroleptides, and males of Indi-rana (where they are known) share the pres-ence of femoral glands of variable size andthe presence of spicules around the marginsof jaw and/or chin in the pectoral area(Amiet, 1973; Inger et al., 1984; Perret,1984; Dubois, 1986 ‘‘1985’’; Klemens, 1998;however spicules are absent in Petropedetesparkeri [Amiet, 1983], and femoral glandsare absent in A. yakusini [Channing et al.,2002b]). Note that spicules around the mar-gins of jaw and/or chin and pectoral area,occur also in Conraua and in at least severalphrynobatrachids as redefined here (Perret,1966). Until this character can be widely as-sessed its level of generality remains un-known.

Dubois (1987 ‘‘1985’’) proposed the rec-ognition of the tribe Ranixalini (later treatedas a subfamily by Dubois, 1992), for the gen-era Nannophrys, Nyctibatrachus, and Indi-rana on the basis of the presence of femoralglands in males of Nyctibatrachus and Indi-rana (unknown in Nannophrys), and themorphological proximity of Nannophrys andNyctibatrachus was noted by Clarke (1981).Nannophrys and Indirana further share themodifications of larval morphology associ-ated with semiterrestrial life that were men-tioned earlier (Kirtisinghe, 1958). From amorphological perspective, the evidence sup-porting the monophyly of Nannophrys 1 In-dirana is the same as that favoring a rela-tionship among Indirana, Arthroleptides, andPetropedetes. As discussed earlier, othercharacters of still unclear polarity that couldfurther support this hypothesis are the pres-ence of femoral glands and spicules aroundthe margins of jaw and/or chin and pectoralarea.

Petropedetes and Arthroleptides havelarge digital discs, a long metasternal style,and T-shaped terminal phalanges. Indiranahas Y-shaped terminal phalanges (Laurent,1986), which may be synapomorphic withthe T-shaped terminal phalanges of Petro-pedetes 1 Arthroleptides although in our to-pology the simple terminal phalanges of


Conraua presumably represent the apomor-phy. Roelants et al. (2004) suggested that In-dirana would find its closest relatives in In-dia. However, inasmuch as these authors didnot include any African taxa in their analysis,it was impossible for them to detect a rela-tionship with African taxa. Van der Meijdenet al. (2005) placed Indirana as the sister tax-on of our Dicroglossinae. They also placedConraua outside of a clade composed of Pe-tropedetes 1 Pyxicephalinae, in both caseson the basis of fewer data and more analyt-ical assumptions. Additional data or densertaxon sampling may rearrange these taxa, butat present our molecular data are decisiveand, as discussed earlier, they are consistentwith the distribution of various larval andadult characteristics.

[209] FAMILY: PYXICEPHALIDAE BONAPARTE,1850

Pyxicephalina Bonaparte, 1850: 1. Type genus:Pyxicephalus Tschudi, 1838.

Phrynopsinae Noble, 1931: 518. Type genus:Phrynopsis Pfeffer, 1893.

Cacosterninae Noble, 1931: 540. Type genus: Ca-costernum Boulenger, 1887.

Tomopternini Dubois, 1987 ‘‘1985’’: 56. Type ge-nus: Tomopterna Dumeril and Bibron, 1841.New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[200] Pyxicephaloidea Bonaparte, 1850.

SISTER TAXON: [201] Petropedetidae Noble,1931.

RANGE: Sub-Saharan Africa.CONTENT: Amietia Dubois, 1987 ‘‘1986’’

(including Afrana Dubois, 1992, see Sys-tematic Comments); Anhydrophryne Hewitt,1919; Arthroleptella Hewitt, 1926; AubriaBoulenger, 1917; Cacosternum Boulenger,1887; Microbatrachella Hewitt, 1926; Na-talobatrachus Hewitt and Methuen, 1912;Nothophryne Poynton, 1963; PoyntoniaChanning and Boycott, 1989; PyxicephalusTschudi, 1838; Strongylopus Tschudi, 1838;Tomopterna Dumeril and Bibron, 1841.

CHARACTERIZATION AND DIAGNOSIS: Al-though we know of no morphological syna-pomorphies for this group, the molecular ev-idence is decisive in support of this branch.(See appendix 5 for molecular synapomor-phies of this taxon; also see Systematic Com-ments.)

SYSTEMATIC COMMENTS: This morphologi-cally heterogeneous taxon is coherent geo-graphically. Although the association ofthese genera was only noted recently (Vander Meijden et al., 2005), much of the earliertaxonomy was based on very general notionsof overall similarity, which are significantlyinfluenced by perceptions of body size. Theassociation of Afrana and Strongylopus (for-merly in Ranini of Dubois, 1992) with An-hydrophryne, Arthroleptella, Cacosternum,and Natalobatrachus (formerly of Phryno-batrachidae [Petropedetidae] of Dubois,1992), and with Pyxicephalus and Aubria (inPyxicephalinae of Dubois, 1992), was some-thing of a surprise (at least for us, as this wasbefore Van der Meijden et al., 2005, ap-peared), although no evidence beyond over-all similarity ever supported the older tax-onomy. We still have three ‘‘flavors’’ of frogsin this group: those that look like Rana (Af-rana and Strongylopus); those that are stockyand big (Pyxicephalus and Aubria); andthose that are generally small and have notattracted from systematists the attention theydeserve (the remainder). The absence of amedian lingual process may be synapo-morphic, as this feature is present in Petro-pedetidae and Phrynobatrachidae (Grant etal., 1997). Dubois (2005), anticipating thepublication of Van der Meijden et al. (2005),recognized this taxon as a subfamily of Ran-idae, Pyxicephalinae, which we recognize asa family.

Within Pyxicephalidae, we recognize twosubfamilies: [210] Pyxicephalinae Bonapar-te, 1850 (Pyxicephalus and Aubria) and[212] Cacosterninae Noble, 1931 (for the re-maining genera). Pyxicephalinae is united bythe following synapomorphies: (1) skull ex-ostosis; (2) occipital canal present; (3) zy-gomatic ramus much longer than otic ramus,articulating with the postorbital process ofthe pars facialis of the maxilla; and (4) strongoverlap of the medial ramus of the pterygoidand the parasphenoid ala (Clarke, 1981). Ca-costerninae in our sense is not united by anymorphological feature that we can identifywith any certainty, although the moleculardata are decisive (see appendix 5).

We place Afrana Dubois, 1992, into thesynonymy of [218] Amietia Dubois, 1987‘‘1986’’, to resolve the paraphyly of Afrana.


No characteristics of ‘‘Afrana’’ or Amietiareject this placement.

Clearly, our data do not support the notion(Poynton, 1964a) that Cacosternum is close-ly related to Phrynobatrachus. Our associa-tion of Microbatrachella, Nothophryne, andPoyntonia with this clade is provisional,based on the assertion by Blommers-Schlos-ser (1993) that these genera are allied by re-duced ossification of the omosternal styleand procoracoid clavicular bar.

[220] SAUKROBATRACHIA NEW TAXON

ETYMOLOGY: Saukro- (Latin: graceful,pretty) 1 batrachos (Greek: frog), referenc-ing the beauty of many of the species in-cluded in this clade.

IMMEDIATELY MORE INCLUSIVE TAXON:[191] Ametrobatrachia new taxon.

SISTER TAXON: [192] Africanura new tax-on.

RANGE: Eurasia, Africa, and Madagascar,to northern Australia; North and Central-America to central South America.

CONCEPT AND CONTENT: Saukrobatrachianew taxon is a monophyletic taxon com-posed of [221] Dicroglossidae Anderson,1871, and [244] Aglaioanura new taxon.

CHARACTERIZATION AND DIAGNOSIS: Al-though no morphological characters that weare aware of optimize on this branch, the mo-lecular data are decisive in support of thistaxon. (See appendix 5 for listing of molec-ular synapomorphies.)

[221] FAMILY: DICROGLOSSIDAE ANDERSON,1871

IMMEDIATELY MORE INCLUSIVE TAXON:[220] Saukrobatrachia new taxon.

SISTER TAXON: [244] Aglaioanura new tax-on.

RANGE: Northwestern and sub-Saharan Af-rica; southern Arabian Peninsula; Pakistan,Afghanistan, India, Sri Lanka, and Nepal,through southern China (including part ofXizang) and Indochina to Japan and the Phil-ippines; islands of the Sunda Shelf as far asFlores.

CONTENT: [225] Dicroglossinae Anderson,1871, and [222] Occidozyginae Fei, Ye, andHuang, 1991 ‘‘1990’’.

CHARACTERIZATION AND DIAGNOSIS: None

of the morphological characters in our anal-ysis optimize on this taxon although the mo-lecular data decisively support recognition ofthis taxon. (See appendix 5 for moleculartransformations.) We recognized two sub-families within Dicroglossidae, which arediscussed in separate accounts because of thesize and complexity of discussion.

[225] SUBFAMILY: DICROGLOSSINAEANDERSON, 1871

Dicroglossidae J. Anderson, 1871: 38. Type ge-nus: Dicroglossus Gunther, 1860.

Limnonectini Dubois, 1992: 315. Type genus:Limnonectes Fitzinger, 1843.

Paini Dubois, 1992: 317. Type genus: Paa Du-bois, 1975.

IMMEDIATELY MORE INCLUSIVE TAXON:[221] Dicroglossidae Anderson, 1871.

SISTER TAXON: [222] Occidozyginae Fei,Ye, and Huang, 1991 ‘‘1990’’.

RANGE: Northwestern and sub-Saharan Af-rica; southern Arabian Peninsula; Pakistan,Afghanistan, India, Sri Lanka, and Nepal,through southern China (including part ofXizang) and Indochina to the islands of theSunda Shelf; Japan.

CONTENT: Annandia Dubois, 1992 (seeSystematic Comments); Eripaa Dubois,1992 (see Systematic Comments); Euphlyc-tis Fitzinger, 1843; ‘‘Fejervarya’’ Bolkay,1915 (see Systematic Comments); Hoploba-trachus Peters, 1863; Limnonectes Fitzinger,1843 (including Taylorana Dubois, 1987‘‘1986’’); Minervarya Dubois, Ohler, andBiju, 2001; Nannophrys Gunther, 1869‘‘1868’’; Nanorana Gunther, 1896 (includ-ing Altirana Stejneger, 1927; ChaparanaBourret, 1939; and Paa Dubois, 1975; seeSystematic Comments); Ombrana Dubois,1992 (see Systematic Comments); QuasipaaDubois, 1992; Sphaerotheca Gunther, 1859‘‘1858’’.

CHARACTERIZATION AND DIAGNOSIS: Al-though the molecular evidence is decisive forthe existence of Dicroglossinae, we areaware of no morphological synapomorphiesthat optimize to this branch. (See SystematicComments.) Appendix 5 shows the molecu-lar transformations associated with this tax-on.

SYSTEMATIC COMMENTS: Within Dicroglos-sinae Anderson, 1871, we recognize two


monophyletic tribes, [226] Limnonectini Du-bois, 1992, for Limnonectes (including assynonyms Elachyglossa Anderson, 1916;Taylorana Dubois, 1987), and [232] Dicrog-lossini Anderson, 1871, for the remaininggenera, Annandia, ‘‘Fejervarya’’ (see be-low), Nanorana (including Chaparana andPaa), Quasipaa, Sphaerotheca, Nannophrys,Euphlyctis, and Hoplobatrachus. (Evidencefor both is listed in appendix 5.) This agreeswith several other phylogenetic analyses thatused DNA evidence (e.g., Bossuyt and Mil-inkovitch, 2000; Emerson et al., 2000b; Mar-mayou et al., 2000; Vences et al., 2000c; Ko-such et al., 2001; Grosjean et al., 2004; Roe-lants et al., 2004; Jiang et al., 2005; Jiangand Zhou, 2005), although our expanded tax-on sampling and data altered some relation-ships within Dicroglossini.

As noted in ‘‘Results’’, our results arestrongly congruent with those of Jiang et al.(2005), especially when the rooting point iscorrected by our larger outgroup sampling(see fig. 64). Because their analysis providedDNA sequence evidence unrejected by mor-phological synapomorphies, we take their re-sults at face value: Nanorana as they viewedit is imbedded within a paraphyletic ‘‘Paa’’,and ‘‘Chaparana’’ is polyphyletic with thetwo components both imbedded within‘‘Paa’’. Nevertheless, they provided evi-dence that their Group 1 (composed of nom-inal Paa, Nanorana, and Chaparana, and ex-cluding Quasipaa), is monophyletic. Group1 is characterized by paired patches of spineson the chest (Jiang et al., 2005), which maynot be synapomorphic but distinguishes thistaxon morphologically from Quasipaa. Theoldest name for Group 1 is Nanorana Gun-ther, 1896. (See appendix 7 for the namechanges that extend from the synonymy ofChaparana Bourret, 1939, and Paa Dubois,1975, with Nanorana Gunther, 1896.) An-nandia Dubois, 1992, and Ombrana Dubois,1992, were originally named as subgenera ofChaparana, and Eripaa Dubois, 1992, wasoriginally named as a subgenus of Paa. Noneof these three taxa were included, discussed,or even mentioned in the study of Jiang etal. (2005). Without discussion, Dubois(2005) transferred Annandia into Limnonec-tini. The placement of these taxa in Dicrog-lossinae is presumably not controversial, so

pending the publication of evidence, we re-gard these as monotypic genera of uncertainplacement within Dicroglossidae (see appen-dix 7 for combinations).

Previous authors (Dubois and Ohler, 2000;Dubois et al., 2001; Grosjean et al., 2004)demonstrated that Sphaerotheca and Fejer-varya are closely related. Our data permit usto go further and suggest strongly that rec-ognition of Sphaerotheca (as well as Eu-phlyctis, Hoplobatrachus, and Nannophrys)renders Fejervarya sensu Dubois and Ohler(2000) paraphyletic, as does a group com-posed of Nannophrys, Euphlyctis, and Ho-plobatrachus. J. M. Hoyos (in Dubois andOhler, 2000) suggested that Fejervarya doeshave a morphological synapomorphy: ven-trolateral edge of the m. pectoralis pars ab-dominalis slightly attached to muscles thatare dorsal relative to it, which results in adark ventrolateral line from axilla to groin,especially visible in live specimens. Thisneeds to be verified with reference to thecondition in Sphaerotheca and the other sat-ellite genera as well as to assure that this isuniversal in Fejervarya and not just in somesubset of the nominal genus. Serious system-atic and nomenclatural issues impede reso-lution of this paraphyly. The most importantis that there are many species of nominal Fe-jervarya that we did not study, and there maybe several species of frogs masquerading un-der the name Fejervarya limnocharis (Du-bois and Ohler, 2000). Because our exemplarof Fejervarya limnocharis is from Vietnamand the type locality of this same nominaltaxon is Java, we are reluctant to assume toomuch about the phylogenetic placement of F.limnocharis sensu stricto. Ongoing researchby Dubois and Ohler (cited in Dubois andOhler, 2000) should provide some resolutionin the near future to this problem. In the in-terim we recommend using quotation marksaround the name ‘‘Fejervarya’’ to denote theparaphyly of this taxon.

We reaffirm that placement of Limnonec-tes limborgi in the monotypic genus Taylor-ana renders Limnonectes paraphyletic andtherefore continue the synonymy of Taylor-ana with Limnonectes, following Inger(1996) and Emerson et al. (2000a). Emersonet al. (2000a) and Evans et al. (2004) pro-vided considerable evidence that Elachyglos-


sa (formerly Bourretia) renders Limnonectesparaphyletic as well. We therefore reject theuse of subgenera—at least as currently for-mulated—within Limnonectes, even thoughsome authors (e.g., Delorme et al., 2004)have retained their use even though they mis-lead about evolutionary relationship.

Although Minervarya exhibits the ‘‘Fejer-varyan line’’ (of Dubois and Ohler, 2000; seeDubois et al., 2001), it was not included inour study, so we are unable to make anycomments about its position in the tree. Ourinclusion of Minervarya in Dicroglossinae isobviously provisional; additional study isneeded.

[222] SUBFAMILY: OCCIDOZYGINAE FEI, YE,AND HUANG, 1991 ‘‘1990’’

Occydozyginae Fei et al., 1991 ‘‘1990’’: 123.Type genus: Occidozyga Kuhl and Van Hasselt,1822.

IMMEDIATELY MORE INCLUSIVE TAXON:[221] Dicroglossidae Anderson, 1871.

SISTER TAXON: [225] Dicroglossinae An-derson, 1871.

RANGE: Southern China (Guangxi, Yun-nan, and Hainan), Thailand, Indochina, Ma-laya, Greater and Lesser Sunda Islands as faras Flores, and Philippines.

CONTENT: Occidozyga Kuhl and Hasselt,1822 (including Phrynoglossus Peters, 1867;see Systematic Comments).

CHARACTERIZATION AND DIAGNOSIS: Al-though the molecular data are decisive (seeappendix 5), Occidozyginae has other syna-pomorphies: (1) aquatic larvae with a kera-todont formula of 0/0; and (2) a lateral linesystem that persists into adulthood (absent inOccidozyga lima; Dubois et al., 2001; con-vergent in Euphlyctis: Dicroglossinae).

SYSTEMATIC COMMENTS: Our data demon-strate that Phrynoglossus (which retains thelateral line system into adulthood) is para-phyletic with respect to Occidozyga (whichdoes not). We therefore agree with Inger(1996) that Phrynoglossus is a synonym ofOccidozyga (the senior name), providing amonophyletic Occidozyga. (See appendix 7for new and revived combinations resultingfrom this synonymy.)

[244] AGLAIOANURA NEW TAXON

ETYMOLOGY: Aglaio- [Greek: splendid ornoble] 1 anoura [Greek: tailless, i.e., frog].

IMMEDIATELY MORE INCLUSIVE TAXON:[220] Saukrobatrachia new taxon.

SISTER TAXON: [221] Dicroglossidae An-derson, 1871.

RANGE: Eurasia, Africa, and Madagascar,to northern Australia; the Americas exclud-ing southern South America.

CONCEPT AND CONTENT: Aglaioanura is amonophyletic group composed of [245] Rha-cophoroidea Hoffman, 1932 (1858), and[269] Ranoidea Rafinesque, 1814.

CHARACTERIZATION AND DIAGNOSIS: On thebasis of our few exemplars for morphology(Chiromantis xerampelina, Rhacophoruspardalis, Rana nigrovittata, and Rana tem-poraria) the following characters are sug-gested as possibly synapomorphies of thisgroup: (1) functional larval m. levator man-dibulae lateralis absent (Haas 56.0); and (2)terminal phalanges bifurcated T-shape or Y-shaped (Haas 156.2; reversed in several lin-eages of Ranidae). (Molecular synapomor-phies are provided in appendix 5.)

[245] SUPERFAMILY: RHACOPHOROIDEAHOFFMAN, 1932 (1858)

IMMEDIATELY MORE INCLUSIVE TAXON:[244] Aglaioanura new taxon.

SISTER TAXON: [269] Ranoidea Rafinesque,1814.

RANGE: Tropical sub-Saharan Africa; Mad-agascar; South India and Sri Lanka; Japan;northeastern India to eastern China souththrough the Philippines and Greater Sundas;Sulawesi.

CONTENT: [246] Mantellidae Laurent,1946, and [253] Rhacophoridae Hoffman,1932 (1858).

CHARACTERIZATION AND DIAGNOSIS: SeeRhacophoridae. One character in our analysisdefinitely optimizes on this taxon: intercalaryelement present (Haas 151.1). Channing(1989) also suggested the following as syn-apomorphies: (1) only one slip of the m. ex-tensor digitorum communis longus, insertingon distal portion of fourth metatarsal; and (2)outermost slip of the m. palmaris longus in-serting on the proximolateral rim of the apo-neurosis palmaris. Ford and Cannatella


(1993) also suggested that bifurcate terminalphalanges are a synapomorphy of this taxon,although this character may optimize at amore general level inasmuch as expanded toetips seem to optimize on or near Aglaioan-ura.

SYSTEMATIC COMMENTS: Our study puts torest whether mantellids and rhacophorids aresister taxa (e.g., Emerson et al., 2000b) ormantellids are imbedded in some way withinthe rhacophorids (Liem, 1970). Whether theyshould be considered mutual subfamilies ofa larger Rhacophoridae (5 Rhacophoroideain our use) is not a scientific proposition. Wefollow the usage of Glaw and Vences (e.g.,Vences et al., 2002; Vallan et al., 2003;Vences et al., 2003a; Vences and Glaw,2004).

[246] FAMILY: MANTELLIDAE LAURENT, 1946

Mantellinae Laurent, 1946: 336. Type genus:Mantella Boulenger, 1882.

Boophinae Vences and Glaw, 2001: 88. Type ge-nus: Boophis Tschudi, 1838.

Laliostominae Vences and Glaw, 2001: 88. Typegenus: Laliostoma Glaw, Vences, and Bohme,1998.

IMMEDIATELY MORE INCLUSIVE TAXON:[245] Rhacophoroidea Hoffman, 1932(1858).

SISTER TAXON: [253] Rhacophoridae Hoff-man, 1932 (1858).

RANGE: Madagascar.CONTENT: Aglyptodactylus Boulenger,

1919 ‘‘1918’’; Boophis Tschudi, 1838; Lal-iostoma Glaw, Vences, and Bohme, 1998;Mantella Boulenger, 1882; ‘‘Mantidactylus’’Boulenger, 1895.

CHARACTERIZATION AND DIAGNOSIS: Man-tellids are small to medium-size terrestrial orarboreal frogs, predominantly found in semi-arid to wet forested habitats. Although mostare drab or cryptically colored, species ofMantellini in particular are brightly colored.Life history is varied, from the usual biphasiclife history with aquatic eggs and feedingtadpoles (Boophis) to nidicolous larvae (e.g.,many Mantidactylus). At least some (e.g.,Mantidactylus eiselti) have direct develop-ment. Most species lay eggs away from wa-ter, in some cases in a suspended nest fromwhich the tadpoles drop into water (Glaw

and Vences, 1994). They share with their sis-ter taxon, Rhacophoridae, intercalary phalan-geal elements.

Laurent (1986: 764) distinguished mantel-lids from rhacophorids solely on basis of thethird carpal being fused with the fourth andfifth in rhacophorids, but being free in man-tellids (this feature is likely synapomorphicat this level of universality). Nevertheless,this feature has not been adequately assayed,so at present the molecular evidence is par-ticularly decisive in distinguishing this as amonophyletic group that forms the sister tax-on of Rhacophoridae. None of the morpho-logical characters in our analysis optimize onthis taxon. (Molecular transformations arelisted in appendix 5.)

SYSTEMATIC COMMENTS: Vences and Glaw(2001) recognized three subfamilies on thebasis of molecular data arranged phylogenet-ically: Laliostominae (Boophinae 1 Mantel-linae). We consider Mantellinae and Lalios-tominae of Vences and Glaw (2001) to betribes within a larger subfamily [248] Man-tellinae, this subfamily forming the sister tax-on of [247] Boophinae. Aglyptodactylus andLaliostoma are in [249] Laliostomini, andwithin Boophini, only Boophis, and [252]Mantella and [251] ‘‘Mantidactylus’’ are in[250] Mantellini. Although ‘‘Mantidactylus’’is clearly paraphyletic with respect to Man-tella (e.g., Vences and Glaw, 2001), our lim-ited taxon sampling did not reveal this. Itshould be noted that there are many nominalsubgenera that require reformulation as well(Raxworthy, Grant, and Faivovich, in prep-aration). For instance, Vences et al. (2002)revised the species of the ‘‘Mantidactylus’’subgenus Laurentomantis and presented ev-idence in their resulting tree of the paraphylyof ‘‘Mantidactylus’’ with respect to Mantella,the paraphyly of the subgenus Brygoomantis,and the polyphyly of Guibemantis and Ge-phyromantis, as well as a lack of evidencefor either paraphyly or monophyly of Pan-danusicola. Much remains to be done, andwe cannot recommend the use of subgenerawithin ‘‘Mantidactylus’’ until the inconsis-tency of taxonomy with phylogeny is ad-dressed within that group.

Pseudophilautus Laurent, 1943, wasplaced in the synonymy of Philautus by R.F.Inger (In Frost, 1985). This was accepted by


Dubois (1999b: 5) although the assignmentto Mantellidae by Laurent (1986) has notbeen directly challenged through discussionof evidence. A second look is warranted.

[253] FAMILY: RHACOPHORIDAE HOFFMAN,1932 (1858)

Polypedatidae Gunther, 1858b: 346. Type genus:Polypedates Tschudi, 1838.

Rhacophoridae Hoffman, 1932: 581. Type genus:Rhacophorus Kuhl and Van Hasselt, 1822.

Philautinae Dubois, 1981: 258. Type genus: Phi-lautus Gistel, 1848.

Buergeriinae Channing, 1989. Type genus: Buer-geria Tschudi, 1838.

IMMEDIATELY MORE INCLUSIVE TAXON:[244] Rhacophoroidea.

SISTER TAXON: [246] Mantellidae.RANGE: Tropical sub-Saharan Africa;

South India and Sri Lanka; Japan; northeast-ern India to eastern China south through thePhilippines and Greater Sundas; Sulawesi.

CONTENT: Aquixalus Delorme, Dubois,Grosjean, and Ohler, 2005 (see SystematicComments); Buergeria Tschudi, 1838; Chi-romantis Peters, 1854 (including ChirixalusBoulenger, 1893; see Systematic Comments);Feihyla new genus (see Systematic Com-ments); Kurixalus Ye, Fei, and Dubois, 1999(see Systematic Comments); NyctixalusBoulenger, 1882; Philautus Gistel, 1848; Po-lypedates Tschudi, 1838; Rhacophorus Kuhland Hasselt, 1822; Theloderma Tschudi,1838.

CHARACTERIZATION AND DIAGNOSIS: Al-though a few groups are primarily terrestrial,rhacophorids are predominantly treefrogs,sharing with basal ranids expanded digitalpads and with mantellids the characteristic ofintercalary phalangeal elements. Most spe-cies have T-shaped terminal phalanges. Sev-eral larval characters that optimized on thisbranch may actually be synapomorphies ofRhacophoroidea, or some part of Rhaco-phoridae: (1) anterior insertion of m. subar-cualis rectus II–IV on ceratobranchial II(Haas 37.1); (2) larval m. levator mandibulaeexternus present as two portions (profundusand superficialis; Haas 54.1); (3) posteriordorsal process of pars alaris expanded ter-minally, almost rectangular in lateral view(Haas 89.1); (4) cartilaginous roofing of thecavum cranii composed of taeniae tecti me-

dialis only (Haas 96.5); (5) free basihyal ab-sent (Haas 105.0); (6) commissura proximal-is II present (Haas 110.1); and (7) commis-sura proximalis III present (Haas 111.1).

SYSTEMATIC COMMENTS: Taxonomic deci-sions taken here are guided by our results(figs. 50, 65), the DNA sequence study ofJ.A. Wilkinson et al. (2002; fig. 48) and theessentially data-free tree of Delorme et al.(2005; fig. 49), which was presented alongwith a system of morphological differentiathat delimited a number of monophyletic andparaphyletic groups, seemingly without ref-erence to the tree itself. Results of the threehave basic agreements.

Buergeriinae Channing, 1989, may be rec-ognized for Buergeria and RhacophorinaeHoffman, 1932 (1858), for the remainingrhacophorines, as was suggested by Chan-ning (1989) and as diagnosed by J.A. Wil-kinson et al. (2002). We cannot subscribe tothe tribal taxonomy of Delorme et al. (2005)because their Philautini is not monophyleticon their own figure (fig. 49), and because theevidence in support of their tree was largelyundisclosed.

On the basis of our results, and the studiesof J.A. Wilkinson et al. (2002) and Delormeet al. (2005), two problems of generic delim-itation appear to persist in the taxonomy. Thefirst of these, the paraphyly/polyphyly of‘‘Rhacophorus’’ is beyond the scope of thispaper; more taxa need to be analyzed beforethis problem can be addressed. The secondproblem is that nominal ‘‘Chirixalus’’ seem-ingly falls into four generic units. We canhelp correct the problems surrounding thepolyphyly/paraphyly ‘‘Chirixalus’’, althoughthe phylogenetic position of many species ofboth ‘‘Chirixalus’’ and nominal Philautusneeds to be evaluated.

(1) Kurixalus Fei, Ye, and Dubois (in Fei,1999). As noted in ‘‘Results’’, we apply thisname to a taxon that includes K. eiffingeriand K. idiootocus, which is diagnosed by ourmolecular evidence (see appendix 5, branch256). We provisionally include K. verruco-sus, which Delorme et al. (2005), without ev-idence or discussion, figured as the sister tax-on of Kurixalus eiffingeri 1 K. idiootocus.(These authors included idiootocus and ver-rucosus without discussion in their new poly-phyletic/paraphyletic ‘‘Aquixalus’’, even as


they illustrated these species as being in anexclusive monophyletic group with Kurixal-us eiffingeri). Under this concept, there arecurrently no identified morphological syna-pomorphies of Kurixalus, because the pur-ported synapomorphies associated with Ku-rixalus eiffingeri (well-developed prepollexand oophagus tadpoles) are not exhibited inK. idiootocus or K. verrucosus (Kuramotoand Wang, 1987; Ziegler and Vences, 2002;Matsui and Orlov, 2004). Excluding ‘‘Aquix-alus’’ idiootocus and ‘‘A.’’ verrucosus from‘‘Aquixalus’’, we suggest, renders Aquixalus(sensu stricto) monophyletic (see below), ifwe assume that the tree of Delorme et al.(2005) survives testing by evidence.

(2) Feihyla new genus (type species: Phi-lautus palpebralis Smith, 1924. Etymology:Fei Liang 1 hyla [Greek: vocative form ofHylas, a traditional generic root for treefrogs]to commemorate the extensive contributionsto Chinese herpetology by Fei Liang). J.A.Wilkinson et al. (2002) found his exemplarof the ‘‘Philautus’’ palpebralis group of Fei(1999), ‘‘Chirixalus’’ palpebralis, to be thesister taxon of a group composed of all rha-cophorids except Buergeria. Delorme et al.(2005) placed ‘‘Chirixalus’’ palpebralis intheir Rhacophorini, which otherwise corre-sponds to a monophyletic group recoveredby us and by J.A. Wilkinson et al. (2002). Infact, this is the major point of disagreementbetween J.A. Wilkinson et al. (2002) and De-lorme et al. (2005). What is clear is that‘‘Chirixalus’’ palpebralis is not in a mono-phyletic group with Chirixalus (sensu stric-to), nor obviously associated closely withany other generic grouping. For this reasonwe have named Feihyla to recognize its dis-tinctiveness. We cannot construe Feihyla tothe ‘‘Philautus’’ palpebralis group of Fei(1999) because the diagnosis of this group isinsufficient to distinguish it from many otherspecies outside of China (i.e., Fei, 1999,diagnosed his ‘‘Philautus’’ palpebralis groupas ‘‘Philautus’’ from China, with an Xor )( shape on the dorsum and lacking vo-merine teeth), such as Aquixalus gracilipesand A. supercornutus; see discussion below).We therefore diagnose Feihyla by the char-acters for the species ‘‘Philautus’’ palpe-bralis provided by Fei (1999). Association of

other species with this taxon will requireconsiderable additional work.

Although ‘‘Chirixalus’’ palpebralis hasbeen demonstrated to be phylogeneticallydistinct (J.A. Wilkinson et al., 2002; Delormeet al., 2005) and deserving a new genericname, the status of presumably closely relat-ed species ‘‘Chirixalus’’ romeri and ‘‘C.’’ocellatus of the ‘‘Philautus’’ palpebralisgroup of Fei, 1999) remains an open ques-tion, although no evidence so far has sug-gested that these species form a monophy-letic group. Morphological evidence provid-ed by Delorme et al. (2005) differentiatingtheir Rhacophorini (including ‘‘Chirixalus’’palpebralis on their tree) and Philautini (aparaphyletic group that on their tree includes‘‘Philautus’’ gracilipes [5 Aquixalus graci-lipes]), suggests that Aquixalus (including‘‘Chirixalus’’ gracilipes) is not close to Feih-yla (see discussion below under Aquixalus).

(3) Chiromantis Peters, 1854, and Chirix-alus Boulenger, 1893. A third unit is thecluster of species paraphyletic with respectto Chiromantis. The paraphyly of Chirixalus(sensu stricto) with respect to Chiromantiswas not a surprise to us. J.A. Wilkinson etal. (2002) had suggested that Chirixalus do-riae is the sister taxon of Chiromantis, andthat Chirixalus vittatus is close to Polype-dates (compare their results with ours, whichare based on substantially more data). Weplace Chirixalus Boulenger, 1893, into thesynonymy of Chiromantis Peters, 1854, tocorrect this paraphyly. (See appendix 7 fornew combinations that extend from thischange and appendix 5 for molecular syna-pomorphies.)

(4) Aquixalus Delorme, Dubois, Grosjean,and Ohler, 2005. We recognize a monophy-letic Aquixalus (i.e., Aquixalus sensu Delor-me et al., 2005, but excluding ‘‘Aquixalus’’idiootocus and ‘‘Aquixalus’’ verrucosus; thatis, without the molecular synapomorphies ofbranch 256—see above). Delorme et al(2005) diagnosed this taxon (although we donot know which of the listed species theyactually evaluated for these characters), butour exclusion of Kurixalus idiootocus (andprovisionally K. verrucosus) from Aquixaluson the basis of the molecular synapomor-phies that place Kurixalus distant fromAquixalus should render Aquixalus mono-


phyletic if the tree provided by Delorme etal. (2005) is correct. We suggest, on the basisof the tree provided by Delorme et al (2005),that the morphological similarities shared byKurixalus and Aquixalus are plesiomorphic.

We follow the recognition by Delorme etal. (2005) of a putatively monophyletic sub-genus Gracixalus for ‘‘Philautus’’ gracilipesBourret, 1937, and ‘‘Philautus’’ supercor-nutus Orlov, Ho, and Nguyen, 2004 (notstudied by us). The morphological diagnosisof Gracixalus (spines on the upper eyelid,rictal gland connected to the mouth, footvery thin, two outer palmar tubercles, whitespot on snout tip of tadpole, five pairs of pre-lingual papillae on the tadpole, crescent-shaped crest on the tadpole) purportedly sep-arates it from the nominate subgenus Aquix-alus, but the absence of adequate publishedtadpole descriptions suggest that this diag-nosis should be treated as provisional (Bainand Nguyen, 2004; Matsui and Orlov, 2004;Delorme et al., 2005). Although Gracixaluscan be separated from Feihyla palpebralis(the latter in parentheses): snout triangularlypointed (obtusely pointed); skin translucent(not translucent); small white tubercles alongthe head, anal region, and large conical tu-bercles on upper eyelid (all absent), thesecharacters do not unambiguously separateGracixalus from ‘‘P.’’ romeri, ‘‘P.’’ ocella-tus, the other members of the ‘‘P.’’ palpe-bralis group of Fei (1999). The placement ofthese two species, as well as higher level re-lationships will be dependent upon a rigorousphylogenetic analysis.

Although we cannot reject the putativemonophyly of the subgenus Aquixalus (in-cluding the type species A. odontotarsus, aswell as A. ananjevae, A. baliogaster, A. bis-acculus, A. carinensis, and A. naso; modifiedfrom Delorme et al., 2005), we do not seeany reason to recognize it, either, until therelevant phylogenetic data are published bythe original authors. According to Delormeet al. (2005), the morphological diagnosis ofAquixalus (webbing on feet not extending totoes, rictal gland not connected to mouth,foot very thick, one outer palmar tubercle,concavity on tadpole snout in lateral view,four pairs of prelingual papillae in tadpole,median crest in tadpole triangular shaped,180–240 eggs per clutch) also applies to Ku-

rixalus verrucosus, so this diagnosis must belargely or entirely based on plesiomorphies,with the nominal subgenus Aquixalus beingthose members of Aquixalus that do not sharethe apomorphies of Gracixalus. Detailedanalysis of disclosed evidence is necessary.

[269] SUPERFAMILY: RANOIDEA RAFINESQUE,1814

IMMEDIATELY MORE INCLUSIVE TAXON:[244] Aglaioanura new taxon.

SISTER TAXON: [245] RhacophoroideaHoffman, 1932 (1858).

RANGE: Worldwide temperate and tropicalenvironments, except for southern Australia,New Zealand, Seychelles, and southernSouth America.

CONTENT: [270] Nyctibatrachidae Blom-mers-Schlosser, 1993, and [272] Ranidae Raf-inesque, 1814.

CHARACTERIZATION AND DIAGNOSIS: Mor-phological synapomorphies for Ranidae (seebelow) may actually optimize at this level.Regardless, the molecular data are decisivein support of this taxon (appendix 5).

[270] FAMILY: NYCTIBATRACHIDAEBLOMMERS-SCHLOSSER, 1993

Nyctibatrachinae Blommers-Schlosser, 1993: 211.Type genus: Nyctibatrachus Boulenger, 1882.

Lankanectinae Dubois and Ohler, 2001: 82. Typegenus: Lankanectes Dubois and Ohler, 2001.New synonym.

IMMEDIATELY MORE INCLUSIVE TAXON:[269] Ranoidea Rafinesque, 1814.

SISTER TAXON: [272] Ranidae Rafinesque,1814.

RANGE: Sri Lanka and India.CONTENT: Nyctibatrachus Boulenger,

1882; Lankanectes Dubois and Ohler, 2001.CHARACTERIZATION AND DIAGNOSIS: None

of our analyzed morphology optimizes onthis branch, although the molecular data aredecisive. See appendix 5 for list of unambig-uous molecular synapomorphies.

SYSTEMATIC COMMENTS: Nyctibatrachidaein our sense brings two genera together, Nyc-tibatrachus, with a median lingual process(unknown polarity), digital discs present(plesiomorphic), femoral glands present (un-known polarity), and lateral line system notpersisting into adulthood (plesiomorphic),


and Lankanectes, with no median lingualprocess, digital discs absent, femoral glandsabsent, and lateral line system persisting intoadulthood (Dubois et al., 2001). They are ar-ranged in a single family to avoid the taxo-nomic redundancy of having monotypic (andtherefore uninformative) family-groupnames.

[272] FAMILY: RANIDAE RAFINESQUE, 1814

Ranaridia Rafinesque, 1814: 102. Type genus:Ranaridia Rafinesque, 1814

Limnodytae Fitzinger, 1843: 31. Type genus: Lim-nodytes Dumeril and Bibron, 1841.

Amolopsinae Yang, 1991a: 172. Type genus:Amolops Cope, 1865.

IMMEDIATELY MORE INCLUSIVE TAXON:[269] Ranoidea Rafinesque, 1814.

SISTER TAXON: [270] NyctibatrachidaeBlommers-Schlosser, 1993.

RANGE: Temperate and tropical Africa andEurasia through Indonesia to northern Aus-tralia, North America, Central America, andnorthern South America.

CONTENT: Amolops Cope, 1865 (includingAmo Dubois, 1992); Babina Thompson,1912 (including Nidirana Dubois, 1992);Clinotarsus Mivart, 1869; Glandirana Fei,Ye, and Huang, 1991 ‘‘1990’’32 (includingRugosa Fei, Ye, and Huang, 1991 ‘‘1990’’);Hydrophylax Fitzinger, 1843 (including Am-nirana Dubois, 1992, and Chalcorana Du-bois, 1992); Hylarana Tschudi, 1838; HuiaYang, 1991 (including Eburana Dubois,1992; Bamburana Fei, Ye, Jiang, Xie, andHuang, 2005; Odorrana Fei, Ye, and Huang,1991 ‘‘1990’’); Humerana Dubois, 1992;Lithobates Fitzinger, 1843 (including Aquar-ana Dubois, 1992; Pantherana Dubois,1992; Sierrana Dubois, 1992; TrypheropsisCope, 1868; Zweifelia Dubois, 1992); Mer-istogenys Yang, 1991; Nasirana Dubois,1992; Pelophylax Fitzinger, 1843; PteroranaKiyasetuo and Khare, 1986; Pulchrana Du-bois, 1992; Rana Linnaeus, 1758 (including

32 Dubois (1999a: 91) considered Glandirana Fei, Ye,and Huang, 1991, to have priority over Rugosa Fei, Ye,and Huang, 1991, and Sylvirana Dubois, 1992, to havepriority over Papurana Dubois, 1992, and Tylerana Du-bois, 1992, under the provisions of Article 24.2 (‘‘Prin-ciple of First Revisor’’) of the International Code ofZoological Nomenclature (ICZN, 1999).

Amerana Dubois, 1992; Aurorana Dubois,1992; Pseudoamolops Jiang, Fei, Ye, Zeng,Zhen, Xie, and Chen, 1997; and PseudoranaDubois, 1992); Sanguirana Dubois, 1992;Staurois Cope, 1865; Sylvirana Dubois,1992 (including Papurana Dubois, 1992,and Tylerana Dubois, 199232). (See System-atic Comments.)

CHARACTERIZATION AND DIAGNOSIS: Al-though Haas (2003) included only two ranidsin his study, Sylvirana nigrovittata and Ranatemporaria, characters that optimize on theirsubtending branch are candidates as syna-pomorphies for Ranidae: (1) posterolateralprojections of the crista parotica absent (Haas67.0); and (2) processus branchialis closed(Haas 114.1). Denser sampling should testthis proposition. These characters may actu-ally optimize on Ranoides. Regardless, themolecular data are decisive (see appendix 5).

SYSTEMATIC COMMENTS: As noted in ‘‘Re-sults’’, Batrachylodes is transferred defini-tively to Ceratobatrachidae and Amietia (in-cluding Afrana) and Strongylopus are trans-ferred to Pyxicephalidae. For discussion ofthese taxa see those familial accounts.

As noted in the ‘‘Review of Current Tax-onomy’’, the sections and subsections of‘‘Rana’’ (sensu lato) provided by Dubois(1992) do not inform about evolutionary re-lationships, so for this discussion and the tax-onomic remedies we suggest, we will focuson genera and subgenera. The discussion thatfollows addresses the generic taxonomy thatwe recommend (moving from top to bottomof Ranidae [new taxonomy] in figure 71, al-though addressing other genera and problemsin passing).

Staurois Cope, 1865: We accept Stauroisas a genus, although we note that evidencefor this taxon’s monophyly is equivocal andrequires testing. The traditional diagnosis ofStaurois—digital discs broader than long; T-shaped terminal phalanges with horizontalarm longer than longitudinal arm; outermetatarsals separated to base but webbed;nasals small separated from each other andfrontoparietal; omosternal style not forked(Boulenger, 1918); and lacking a raised ab-dominal sucker disc on larva (Inger, 1966)—are plesiomorphic for Ranidae. Althoughsome larval characters are thought to becommon among species of Staurois (tadpole


Fig. 71. Generic changes suggested for ranid taxa that we studied. This is not exhaustive and theSystematic Comments under Ranidae in ‘‘A Taxonomy of Living Amphibians’’ should be consulted foradditional taxonomic changes.

with deep, cup-like labial parts; upper lip oforal disc with two continuous rows of papil-lae; lower lip with one broad continuousband of papillae; Inger, 1966), the diagnosticvalue of these characters is unknown due to

the large number of ranid species whoseadults are morphologically similar to those ofStaurois, but whose larvae remain unde-scribed.

[274] Hylarana Tschudi, 1838: We asso-


ciate our exemplars of Hylarana Tschudi,1838 (H. erythraea, the type species, and H.taipehensis), as well as of ‘‘Sylvirana’’guentheri, with the generic name Hylarana.Although these two units were assigned, re-spectively, to the no-humeral-gland (Hylar-ana) and humeral-gland subsections (Hydro-phylax) of Dubois (1992), our data suggeststrongly that the humeral gland is convergentin ‘‘S.’’ guentheri and Sylvirana (sensu stri-co) or that the presence of the structure hasbeen missed in a widespread way because ofthe lack of detailed morphological study (in-cluding dissections). Hylarana (including‘‘Sylvirana’’ guentheri and H. macrodactyla,the third species of Hylarana sensu Dubois,1992) lacks dermal glands in the larvae, acharacter that appears to optimize on the sis-ter branch of Hylarana. The vocal sac con-dition is variable among species of Hylarana,with ‘‘S.’’ guentheri possessing gular pouch-es and H. taipehensis and H. erythraea lack-ing gular pouches. This character is highlyhomoplastic throughout the ranid portion ofour tree. We take the molecular apomorphiesfor branch 274 (appendix 5) to be synapo-morphies of Hylarana.

We are unable to diagnose Hylarana onthe basis of morphology. We did not study,and so cannot document, the phylogeneticposition of H. macrodactyla. Thus, our as-sociation of this species with Hylarana re-quires testing. Similarly, we do not knowwhich other species may be included in thishistorically ambiguously diagnosed genus.

[278] Hydrophylax Fitzinger, 1843 (in-cluding Amnirana Dubois, 1992, and Chal-corana Dubois, 1992): We associate our ex-emplars of humeral-gland-bearing genera(Hydrophylax and Amnirana), as well as theimbedded Chalcorana, with the genericname Hydrophylax Fitzinger, 1843. Chan-ning (2001) had already considered the Af-rican member of Hydrophylax (H. galamen-sis) to be in Amnirana, along with other Af-rican Hylarana-like frogs. Our association ofthe type species of Hydrophylax, H. mala-barica (unstudied by us), with the clade ofstudied terminals requires testing, of course,as does the association of the unstudiedmembers of these nominal taxa. The associ-ation of unstudied members of Amnirana,Hydrophylax, and Chalcorana (some of

which are reported to not bear humeralglands33) is done on the assumption thatsome of the molecular apomorphies of thistaxon are synapomorphies of Hydrophylax inthe sense of including the species that we didnot study. On the basis of evidence presentedby Matsui et al. (2005), we place Chalcoranahosii in our Huia. Chalcorana is likelybroadly polyphyletic, but without evidenceof the remainder’s placement we provision-ally regard them as close to Chalcoranachalconota, the type-species of Chalcorana.We could have retained Chalcorana as a ge-nus, but it is clear that, as data emerge, thespecies in this nominal taxon will be as-signed to Hydrophylax, Sylvirana, and likelyothers as well. This is not a satisfactory so-lution to the problem of trying to sortthrough this morass, but it is the only prac-tical solution available to us at present.

We retain Humerana Dubois, 1992, andPulchrana Dubois, 1992, as nominal generaonly because we did not study these humeral-gland-bearing genera. Future work shouldtest the hypothesis that the remaining speciesof the ‘‘humeral-gland group’’ constitute amonophyletic unit. The results of Matsui etal. (2005; fig. 46) suggest that Humerana ul-timately will be assigned to Hylarana.

[280] Sylvirana Dubois, 1992: Our resultsdemonstrate the polyphyly of nominal Syl-virana (see discussion of ‘‘S.’’ guentheri un-der discussion of Hylarana) and the para-phyly of the major group of nominal Sylvir-ana (including its type species, S. nigrovit-tata). To remedy the demonstrated polyphylyof Sylvirana, we transfer ‘‘S.’’ guentheri intoHylarana Tschudi, 1838 (see above). To re-lieve the paraphyly of remaining Sylvirana,we place Papurana Dubois, 1992, and Ty-lerana Dubois, 1992, into the synonymy ofSylvirana Dubois, 1992. Although it is clearon the basis of molecular data that ‘‘S.’’guentheri is not in the clade containing S.nigrovittata (the type species of Sylvirana),it is also not clear how many species of nom-

33 Possession of humeral glands can be a difficultcharacteristic to assess due to level of development, andtheir presence may be apparent only on dissection.Therefore, any statement that humeral glands are absentreally requires that a dissection has been made. Dubois(1992) did not mention whether he had made such dis-sections.


inal Sylvirana are associated with ‘‘S.’’guentheri. We take the most falsifiable po-sition—that only ‘‘S.’’ guentheri is far fromSylvirana nigrovittata—and suggest thatcareful study is needed.

Meristogenys Yang, 1991, Clinotarsus Mi-vart, 1869, and Nasirana Dubois, 1992: Ourresults place Meristogenys as the sister taxonof Clinotarsus (as found by Roelants et al.,2004; fig. 35), and far from both Amolopsand Huia, to which it was considered to beclosely related by Yang (1991b) and Dubois(1992). Besides the molecular evidence, Cli-notarsus shares several larval characters withMeristogenys: (1) dermal glands on the flank;(2) increased numbers of rows of labial ker-atodonts (5–9/5–10 in Meristogenys and 6–8/6–8 in Clinotarsus; over 1–5/2–8 in Amo-lops and Huia; Boulenger, 1920: 132–133;Chari, 1962; Yang, 1991b; Hiragond et al.,2001); and (3) upper labial keratodont rowswith a medial gap. Unlike Clinotarsus, butlike Amolops, Huia, and (superficially) Pseu-doamolops, Meristogenys have a raised ab-dominal sucker in the larvae (Kuramoto etal., 1984; Yang, 1991b; Jiang et al., 1997).

Clinotarsus lacks the obvious synapomor-phies associated with Meristogenys (a raised,sharply defined abdominal sucker in the lar-vae, ribbed jaw sheaths, and upper or bothjaw sheaths divided (Yang, 1991b). Becausemost of the species of Meristogenys, likemost Hylarana-like species (sensu lato),have not been sampled and may be involvedwith this group, we retain both Clinotarsusand Meristogenys as genera.

Nasirana alticola (not studied by us) maybe allied with Clinotarsus, as their larvaeshare two possible synapomorphies: (1) largesize; and (2) supracaudal glands (Grosjean etal., 2003). Furthermore, Nasirana shareswith Meristogenys and Clinotarsus other lar-val characters of uncertain polarity: multiple(3–7) medially divided upper labial kerato-dont rows; high numbers of labial keratodontrows (7–8: 7–8); and presence of dermalglands on the flanks of the body (Yang,1991b; Hiragond et al., 2001; Grosjean et al.,2003). Nasirana can be distinguished fromall other frogs by a fleshy prominence on thesnout of the male. As with Clinotarsus, weprovisionally retain Nasirana as a genus.

Sanguirana Dubois, 1992, and Pterorana

Kiyasetuo and Khare, 1986: We provision-ally retain Sanguirana Dubois, 1992, andPterorana Kiyasetuo and Khare, 1986 (bothunstudied by us) as genera, owing to the am-biguous nature of their putative synapomor-phies (both genera are Hylarana-like forms).Sanguirana sanguinea (type species of San-guirana) has a tadpole with characters sharedwith Meristogenys, Clinotarsus, and Altir-ana: a moderate to high number of labial ker-atodont rows (4–6/4–5); upper lip with di-vided keratodont rows; and dermal glands onthe head and body; and ventral portions ofthe body and tail fins (Alcala and Brown,1982). Pterorana khare (tadpole unknown) isdistinguished from other ranid frogs by thelarge, fleshy folds on the flanks and thighsand over the vent that extend away from thebody when the frog is under water (Kiyase-tuo and Khare, 1986).

Amolops Cope, 1865, and Amo Dubois,1992: The phylogenetic association of Amo-lops, Meristogenys, and Huia (Yang, 1991b;Dubois, 1992), as noted in ‘‘Results’’ and inthe discussion above of Meristogenys, wasrejected. Further, the association of Pseu-doamolops Jiang et al., 1997, suggested byKuramoto et al. (1984) and Fei et al. (2000)is also rejected, suggesting that in each casethe ventral sucker on the larvae is nonho-mologous and should be considered indepen-dently apomorphic in each lineage. Kura-moto et al. (1984) provided morphologicalevidence that the ventral sucker disc on thelarvae of Amolops is not homologous withthat of ‘‘Pseudorana’’ sauteri: the edge ofthe disc is sharply defined in Amolops (notso in sauteri); the m. diaphragmatobranchial-is medialis engages the floor of the sucker togenerate negative pressure in Amolops (mus-cle does not communicate with sucker insauteri); and inframarginal U-shaped band ofkeratinized material on the sucker in Amo-lops (absent in sauteri). Regardless, Kura-moto et al. (1984) suggested a close relation-ship of sauteri to Amolops.

The status of Amo Dubois, 1992 (not stud-ied by us), is arguable. Dubois (1992) sug-gested that Amo is unique among Amolops inhaving axillary glands in both sexes and anouter metatarsal tubercle (a character ple-siomorphic at the base of the ranids), but theouter metatarsal tubercle is nevertheless pre-


sent in Amolops nepalicus34 and A. torrentis(after Yang, 1991b). Amo lacks the charac-teristics of both Huia and Meristogenys (tibiaelongate; having lateral dermal glands on thelarvae; high number of larval keratodontrows on the lower lip) but otherwise sharesone apomorphy with Amolops (sensu stricto)in our topology: first metacarpal greater thanhalf the length of the second. So, rather thansuggest that a sucker developed on the venterof the larvae five times in ranids (rather thanthe four events currently required by our to-pology) we regard Amo as a synonym ofAmolops.

We found nominal Amolops to be poly-phyletic (figs. 50, 65). In this case, the larvaof Amolops chapaensis is unknown (Yang,1991b), and that species had been assignedto Amolops on the basis of having an adultmorphology more similar to Amolops than toHylarana (i.e., no humeral glands and pres-ence of gular pouches in males; after Inger,1966: 257), rather than its having the larvalsynapomorphies of Amolops. We transfer thisspecies out of Amolops and into another ge-nus below. (See discussion of Huia, Odor-rana, and Eburana). Although we obtainAmolops as the sister taxon of Pelophylax,we are unaware of any morphological syna-pomorphy uniting these groups (see appen-dix 5, branch 287).

[288] Pelophylax Fitzinger, 1843: We re-strict the generic name Pelophylax to thesubgenus Pelophylax of Dubois (1992). Weare unaware of any morphological synapo-morphy for this group, although the molec-ular data are seemingly decisive (see appen-dix 5, branch 288).

Glandirana Fei, Ye, and Huang, 1991‘‘1990’’, and Rugosa Fei, Ye, and Huang,1991 ‘‘1990’’: Glandirana minima is the solespecies in its nominal genus (formerly a sub-genus of the section Hylarana, subsectionHylarana: Dubois, 1992). It is diagnosed byhaving skin densely covered in granular yel-

34 Dubois (2000: 331; 2004a: 176) suggested, on thebasis of examination of the holotype, this taxon is syn-onymous with Amolops formosus but did not provideany discussion regarding the differences itemized in theoriginal description or the diagnostic differences notedby Yang (1991b). Dubois (2004a: 176) subsequentlycriticized Anders (2002) for retaining Amolops nepalicuswithout providing a detailed discussion of the issue.

low glands; axillary glands and distal femo-ral glands densely packed, forming a roll;and intermittent longitudinal ridges, denselycovered with small tubercles on the dorsum(Fei et al., 1991 ‘‘1990’’). It shares with Pe-lophylax a very low number of labial kera-todont rows in larvae (likely plesiomorphicon our topology). Jiang and Zhou (2005;their fig. 1), with different taxon sampling,found Glandirana to be the sister taxon ofRugosa (not studied by us, but placed by Du-bois, 1992, in his section Pelophylax), andphylogenetically distant from their samplesof Pelophylax (P. hubeiensis and P. nigro-maculata).

Glandirana and Rugosa share the follow-ing characteristics that appear to be synapo-morphic (on our tree and on that of Jiang andZhou, 2005): entire body of tadpole coveredin glands; digital discs absent in adults; anddorsum densely covered with longitudinal,tubercular skin ridges in adults (Stejneger,1907: 123–126; Okada, 1966; Ting and T’sai,1979; Fei et al., 1991 ‘‘1990’’; Fei et al.,2005: 132–138). There are morphologicaldifferences between the two genera (Okada,1966; Fei et al., 1991 ‘‘1990’’; Fei et al.,2005: 132–138; Stejneger, 1907: 123–126;Ting and T’sai, 1979): sternal cartilageforked posteriorly in Glandirana [deeplynotched in Rugosa]; toes half-webbed, reach-ing the second subarticular tubercle on toeIV in Glandirana [fully webbed to beyondsecond subarticular tubercle on toe IV in Ru-gosa]; skin densely covered in granular yel-low glands, as well as axillary and distalfemoral glands densely packed, forming aroll in Glandirana [prominent glands onlybehind tympanum in Rugosa]). However,none of these characters is obviously in con-flict with Glandirana 1 Rugosa forming amonophyletic group. In light of this evi-dence, we recognize this clade as one genus,Glandirana, placing Rugosa into synonomy.Rugosa rugosa, the type species of Rugosa,should be included in subsequent phyloge-netic analysis to test this hypothesis.

[291] Babina Thompson, 1912, and Nidi-rana Dubois, 1992: Nidirana Dubois, 1992,has been associated with Babina Thompson,1912 (unstudied by us) on the basis of twocharacters: presence of a large suprabrachialgland in breeding-condition males, and egg


deposition in water-filled nests of terrestrialburrows or open puddles (Pope, 1931: 536–538; C.-C. Liu, 1950: 258–260; Kuramoto,1985; Dubois, 1992: 154–156; Chou, 1999:398–399). Babina is further diagnosablefrom Nidirana on the basis of the male hav-ing a spine on the prepollex (absent in Ni-dirana; Okada, 1966; Kuramoto, 1985;Chou, 1999). Nidirana, however, has nocharacters that suggest that it is monophylet-ic with respect to Babina (Dubois, 1992;Chou, 1999). For this reason, although a sub-genus Babina (the group with the large pre-pollical spine) could be employed, the nameNidirana applies to no monophyletic groupthat can be identified at this time. We there-fore transfer all members of Dubois’ subge-nus Nidirana to the genus Babina.

[292] Huia Yang, 1992, Odorrana Fei, Ye,and Huang, 1991 ‘‘1990’’, Bamburana Fei etal., 2005, ‘‘Amolops’’ chapaensis, and Ebur-ana Dubois, 1992: Although our molecularevidence capturing this clade of Himalayanand Southeast Asian cascade-dwelling spe-cies is unambiguous (see appendix 5, branch292), insufficient sampling, the lack of mor-phological data, and the concomitant taxo-nomic confusion surrounding these taxa pre-sented us with a significant taxonomic chal-lenge. ‘‘Amolops’’ chapaensis is embeddedin our Huia–Eburana–Odorrana clade, butits assignment to Amolops was done on thebasis of overall similarity (see discussion inAmolops section), and it is clearly not part ofthat genus. There is no known morphologicalsynapomorphy linking species of Odorrana,as its purported synapomorphy, colorlessspines on chest of the male, is also known inHuia nasica (B.L. Stuart and Chan-ard,2005) and species of at least two other gen-era (i.e., some Chalcorana and at least Ba-bina caldwelli [R. Bain, personal obs.]), andis absent in many species of Odorrana sensuFei et al. (1991 ‘‘1990’’; see discussion in‘‘Review of Current Taxonomy’’). Similarly,there is no evidence suggesting that Eburanais monophyletic, because its putative syna-pomorphy, unpigmented eggs, is shared byat least some species of three other genera(e.g., Chalcorana, Odorrana, Amolops; seediscussion in ‘‘Review of Current Taxono-my’’). Huia (sensu stricto) represents a thirdexample in our tree of convergence of a

raised, sharply defined abdominal sucker inthe tadpole (Yang, 1991b; see discussion ofMeristogenys and Amolops above). Beyondthis structure, the only characters unitingHuia with Amolops and Meristogenys areventral and postorbital glands of the larvae.None of these characters is present in Odor-rana grahami, the only other member of thisclade whose tadpole is known.

We know of no morphological synapo-morphy that unites this clade (branch 292),but our molecular data are decisive for itsbeing a monophyletic group (see appendix5). We therefore apply a single generic name.The oldest available name from this group ofspecies is Huia Yang, 1991b (published 18February, 1991; the publication containingOdorrana did not appear until at least Marchof 1991; Fei et al., 1991 ‘‘1990’’). We there-fore place ‘‘Amolops’’ chapaensis; EburanaDubois, 1992; and Odorrana Fei, Ye, andHuang, 1991 ‘‘1990’’, into the synonymy ofHuia Yang, 1991.

We recognize that this taxonomy is prob-lematic for two reasons. First, we did not in-clude any of the types of the nominal generain this study. Thus, the assigned name maybe inappropriate. Indeed, Huia nasica maynot be closely related to Huia cavitympanumBoulenger, 1893 (the type species of Huiaand not studied by us). The association withHuia nasica of a tadpole with a raised, sharp-ly defined abdominal sucker and ventral andpostorbital glands of the larvae was based onone specimen (C.-C. Liu and Hu, 1961).Yang (1991b) cast doubt on this assignmentwhen he reported that a ‘‘tadpole from Men-yang assigned to H. nasica by Liu and Hu(1961), is certainly Huia even if not larvalH. nasica’’. Our grouping of H. nasica with-in a clade of Odorrana and Eburana mightbe evidence that nasica is not a member ofHuia. And second, our small sample size (4species, only 2 of which have known tad-poles) from this large, undiagnosed group ofspecies (minimum 36 species; Frost, 2004)may speak to an oversimplification of the re-lationships among these taxa.

Whereas both of these problems are realconcerns, this decision, as with all of our tax-onomic decisions, is a hypothesis based onthe preponderance of the available evidence,which we prefer to taxonomic decisions


based on similarity groupings. As this entiresection of former Rana seems to have avoid-ed detailed study, we suggest that a concertedeffort to amass the necessary comparativemorphological and molecular data is needed,and we interpret our results as identifyingkey areas for further study and not as a de-cisive resolution of these problems.

[296] Rana Linnaeus, 1758 (including Au-rorana Dubois, 1992, Amerana Dubois,1992, Pseudoamolops Jiang, Fei, Ye, Zeng,Zhen, Xie, and Chen, 1997, and PseudoranaFei, Ye, and Huang, 1991 ‘‘1990’’): To ren-der a monophyletic grouping, we place Pseu-dorana and Pseudoamolops as junior syno-nyms of Rana, because they are both embed-ded within the same clade as Rana tempor-aria (the type species of Rana). Theabdominal sucker disc of the tadpole ofPseudoamolops is not homologous withthose of Amolops, Huia, and Meristogenys,all of which are distant from each other inour tree.

Because Amerana 1 Aurorana form thesister taxon of our exemplars of a clade withRana temporaria, we also place both of thesegenera as junior synonyms of Rana (sensustricto) to render a monophyletic group.These frogs are unusual among American‘‘Rana’’, but otherwise similar to membersof Rana (sensu stricto) in retaining an outermetatarsal tubercle.

Dubois (1992) recognized Pseudorana asincluding Rana sangzhiensis, Rana sauteri,and R. weiningensis, characterized as lackingdermal glands in the larvae (likely a syna-pomorphy at this level of universality) andhaving a labial keratodont row formula of 4–7/5–8, an abdominal sucker in the larvae (al-though not as well-developed as in Amo-lops), digit I longer than digit II (likely ple-siomorphy), toe pads present on digit I andtoe IV; metatarsal tubercle present (plesiom-orphy), dorsolateral folds present; no gularpouches in males; and a chevron-shapedmark on the anterior dorsum. Subsequently,Jiang et al. (1997) partitioned Pseudorana,with P. weiningensis staying in Pseudoranaalong with johnsi and sangzhiensis, but sau-teri being transferred to Pseudoamolops onthe basis of several features. The most dis-tinctive feature is that Pseudorana (contrathe diagnosis of Dubois, 1992) actually lacks

the abdominal suction cup on the larvae.This structure is found in sauteri alone, al-though in a less-developed form than inAmolops, Meristogenys, and Huia (sensustricto; Jiang et al., 1997). Tanaka-Ueno etal. (1998a) suggested on the basis of 587 bpof mtDNA that sauteri is imbedded withinthe brown frog clade (Dubois’ subgenusRana). Our results corroborate this. UnlikeAmolops, Meristogenys, and Huia, bothPseudorana and Pseudoamolops lack dermalglands on the larvae, which might be a syn-apomorphy, although we do not know thecondition of this feature in the Rana tempor-aria group. For our taxonomy, we relegatePseudoamolops and Pseudorana to the syn-onymy of Rana, which is decisively diag-nosable on the basis of molecular data (ap-pendix 5, branch 296).

[301] Lithobates Fitzinger, 1843 (includ-ing Aquarana Dubois, 1992, Pantherana Du-bois, 1992, Sierrana Dubois, 1992, Trypher-opsis Cope, 1868, and ‘‘Rana’’ sylvatica):Because of the phylogenetic propinquity ofAquarana Dubois, 1992, Lithobates Fitzin-ger, 1843, Pantherana Dubois, 1992, Sier-rana Dubois, 1992, Trypheropsis Cope,1868, ‘‘Rana’’ sylvatica, and Zweifelia Du-bois, 1992 (the latter not studied by us, butplaced phylogenetically in this group by Hil-lis and Wilcox, 2005; fig. 44), we place thesetaxa into their own genus, for which the old-est available name is Lithobates Fitzinger,1843. Therefore, we consider Lithobates tobe a genus, within which we place Aquar-ana, Trypheropsis, Sierrana, Zweifelia, andPantherana as junior synonyms. Absence ofan outer metatarsal tubercle is a morpholog-ical synapomorphy. (For species affected bythis nomenclatural change see Frost, 2004,and appendix 7).

We considered recognizing Aquarana forthe former R. clamitans/R. catesbeianagroup; Lithobates for the former R. palmipesgroup; Pantherana for the R. pipiens group;and Zweifelia for the former R. pustulosa/R.tarahumarae group. However, this wouldhave necessitated naming a new monotypicgenus for Rana sylvatica. Hillis and Wilcox(2005) also suggested, on the basis of a gen-erally more limited study, but much moredensely sampled within ‘‘Rana’’ than ours,that ‘‘Rana’’ sylvatica is the sister taxon of


Aquarana. We found it to be the sister taxonof the (old) Pantherana–Sierrana–Lithoba-tes–Typheropsis clade. However, this resultis weakly corroborated (due to the variableplacement of ‘‘R.’’ sylvatica; this branch hasa Bremer value of 1 and jackknife frequencyof 52%), and the results of Hillis and Wilcox(2005) therefore deserve further careful con-sideration. What does seem to be highly cor-roborated by both our data and those of Hillisand Wilcox (2005) is that, excluding the spe-cies formerly assigned to Amerana and Au-rorana, all North American species currentlyassigned to Rana form a clade. To recognizethis and to underscore the fact that the spe-cies on the West Coast are more closely re-lated to Eurasian species than to other NorthAmerican species, we recognize the com-pletely American group as Lithobates. (Seeappendix 7 for new combinations and con-tent.) Hillis and Wilcox (2005) provided sev-eral new names for various clades withinLithobates, but inasmuch as these were notassociated with organismal characteristicsthat purport to delimit them, they are nominanuda.

ACKNOWLEDGMENTS

We thank the National Aeronautic andSpace Administration (NASA) for significantsupport of computational and molecular bi-ology at the American Museum of NaturalHistory. This support (NASA grants NAG5-12333 and NAG5-8443 to Frost and NAG5-13028 to Wheeler) allowed the continued de-velopment of necessary algorithms, the soft-and hardware for massively parallel compu-tation of large phylogenetic trees, thelarge-scale acquisition of molecular data thatelucidate our understanding of the evolutionand distribution of life on planet Earth, aswell as the student involvement so necessaryto the success of this venture. This supportwent far to assuring the success of this in-ternational community project and we aredeeply grateful. Regardless, any opinions,findings, and conclusions or recommenda-tions expressed in this material are those ofthe authors and do not necessarily reflect theviews of the National Aeronautics and SpaceAdministration.

Many people in the AMNH deserve

thanks: Lisa Gugenheim and Merrily Sterns(Office of Government Relations) and DianeBynum and Barbara Green (Office of Grantsand Fellowships) were unstinting in theirsupport. Eleanor Sterling (Center for Biodi-versity and Conservation), initiated and pro-moted fieldwork in Vietnam and Bolivia thatresulted in the acquisition of many of thevaluable tissue samples used in this study.Angelique Corthals and Julie Feinstein(AMNH Monell Cryo-Collection) cooperat-ed in last-minute tissue requests and acces-sions. Leo Smith provided advice and sup-port regarding the vagaries of POY. Ho LingPoon (Center for Biodiversity and Conser-vation) provided timely assistance with trans-lations of Chinese literature. Mary DeJongwas invaluable in providing library assis-tance. In the AMNH Herpetology Depart-ment, Iris Calderon and Dawn Skala dealtskillfully with the large demands placed onthem by this and related projects. Denny Di-veley provided extensive editorial and librarysupport.

Enormous assistance and encouragementwas also provided from formal and informalreviewers. Maureen Donnelly, David Gower,Robert F. Inger, Roy W. McDiarmid, JosephMendelson III, Jay M. Savage, and Tom A.Titus read the entire manuscript, caughtmany errors, and provided invaluable insightand suggestions; their efforts are deeply ap-preciated. Paul Chippindale read the sala-mander sections, caught errors, and providedtimely advice. Jeffery A. Wilkinson, provid-ed welcome advice and comments on thevarious sections relevant to rhacophorid sys-tematics. Richard Mayden was a great sourceof counsel and encouragement during the de-velopment of this study.

Grant and Frost acknowledge NSF grantDEB-0309226, which allowed developmentof many of the primers used in this study andmany of the sequences used both in the sup-ported dendrobatid research as well as in thisstudy. During the course of this study Grantwas supported by an AMNH Graduate Stu-dent Fellowship, a Columbia University Cen-ter for Environmental Research and Conser-vation Faculty Fellowship, and NASA grantNAG5-13028.

Faivovich and Frost acknowledge NSFgrant DEB-0407632 which supported devel-


opment of primers and sequences used in thisstudy as well as the supported hylid research.Faivovich acknowledges the timely supportof a Theodore Roosevelt Memorial grant.During the course of this study Faivovichwas supported by an AMNH Graduate Stu-dent Fellowship and NASA grant NAG5-13028. Faivovich and Blotto thank SantiagoNenda, Guido Corallo, Andres Sehinkman,and Diego Baldo for field assistance.

Bain acknowledges NSF grant DEB-9870232 to the Center for Biodiversity andConservation (CBC/AMNH) for financialsupport as well as the generous support ofThe John D. and Catherine T. MacArthurFoundation. Collecting and export permitsfor Vietnam amphibians were granted by theForestry Protection Department, Ministry ofAgriculture and Rural Development, Viet-nam (export permit numbers 31–98, 102–98,340–99, 341–99, and 174–00). Thanks arealso due to Le Xuan Canh, Nguyen QuangTruong, Ho Thu Cuc, and Khuat Dang Longof the Institute of Ecology and BiologicalResources, Hanoi, and Melina Laverty, CBC/AMNH, for cooperation and assistance in allaspects of Vietnam fieldwork. Tissues of Bo-livian amphibians were collected on expedi-tions supported by the CBC/AMNH and theCenter for Environmental Research and Con-servation at Columbia University, New York,in collaboration with the Museo de HistoriaNatural Noel-Kempff Mercado, Santa Cruz,Bolivia, and Coleccion Boliviana de la Fau-na, La Paz. Collection permits for Bolivianmaterial were granted by el Ministerio deDesarrollo Sostenible y Planificacion de Bo-livia.

Haddad gratefully acknowledges Biota-FAPESP (01/13341-3) and CNPq for finan-cial support. Exportation permits of Braziliansamples were issued by CITES Lic. 081968BR; Autorizacoes de Acesso e de Remessade Amostras de Componentes do PatrimonioGenetico numbers 02001002851/2004;02001.002669/2004; permits for collectionwere issued by IBAMA/RAN, licencas 057/03 and 054/05. Haddad thanks the followingfor field support in the acquisition of relevanttissues: Antonio P. Almeida, Joao L. Gapar-ini, Jose P. Pombal, Jr., Luis O.M. Giasson,Marılia T.A. Hartmann, and Paulo C.A.Garcia.

Haas acknowledges support by the Deut-sche Forschungsgemeinschaft Grant Ha2323/2-1.

De Sa acknowledges NSF grants DEB-0342918 and 9815787 which provided sup-port for field work and Leptodactylus re-search that concomitantly furthered the de-velopment of this study.

Campbell gratefully acknowledges thesupport of NSF grants DEB-0102383 and9705277, which allowed the acquisition ofmany of the Middle American and tissuesamples used in this paper, as well as fieldand collection assistance by Dwight Law-son, Brice Noonan, Eric Smith, and Paul Us-tach.

Channing acknowledges the TanzaniaCommission for Science and Technology Re-search Permit 2002-319-ER-99-40, whichprovided field support for the collection ofgenetic samples in Tanzania.

Donnellan thanks Michael Mahony (Uni-versity of Newcastle), Steve Richards (SouthAustralian Museum), Allen Allison (BerniceP. Bishop Museum), Dale Roberts (Univer-sity of Western Australia), Michael Tyler(University of Adelaide), and Ken Aplin(Western Australian Museum) for access tocritical tissues, field support, and courtesiesextended to him that furthered this study.

Raxworthy acknowledges NSF grantDEB-9984496, National Geographic Societygrant 5396-94, and grants from Earthwatchwhich provided field support for acquisitionof important genetic samples from Madagas-car.

Nussbaum and Raxworthy gratefully ac-knowledge support from NSF grants DEB-9024505, 9322600, and 9625873, which pro-vided funds for field research and acquisitionof tissues.

Nussbaum acknowledges NSF grantsDEB-0070485, 9625873, and 9917453,which provided funds for the acquisition ofgenetic samples from Madagascar and theSeychelles. Nussbaum also thanks GregSchneider for efforts in developing andmaintaining the tissue collections at UMMZ;and Ronn Altig, Michael J. Pfrender, and Ed-mund D. Brodie II, Jr. for help with fieldwork in China, Madagascar, Sao Tome, andSeychelles.


Moler thanks Barry Mansell for field as-sistance.

Drewes thanks the NSF for grant DBI-9876766, that helped support the CAS frozentissue collection, which proved to be an in-valuable resource for this study.

Green thanks for funding the National Sci-ences and Engineering Research Council(NSERC) of Canada.

For access to critical tissues and othercourtesies with respect to this study andclosely related ones we thank Stevan J. Ar-nold (Oregon State University, Corvallis),J.W. Arntzen (National Museum of NaturalHistory, Leiden), Christopher Austin, RobbT. Brumfield, Donna Dittman, and FrederickSheldon (Louisiana State University Muse-um of Zoology, Baton Rouge), Boris Blotto(Museo Argentino de Ciencias Naturales‘‘Bernardino Rivadavia’’, Buenos Aires, Ar-gentina), Rafe Brown, William E. Duellman,and John Simmons (University of KansasMuseum of Natural History and BiodiversityCenter, Lawrence), Marius Burger (Univer-sity of the Western Cape, Bellville, South Af-rica), Janalee Caldwell (Sam NobleOklahoma Museum of Natural History, Nor-man), Paul Chippindale, Paul Franklin, EricSmith, and Paul Ustach (University of Texasat Arlington), Bruce L. Chrisman (Albuquer-que), Maureen Donnelly (Florida Interna-tional University, Miami), Robert N. Fisherand Brian Yang (U.S. Fish & Wildlife Ser-vice, San Diego), Ron Gagliardo (AtlantaBotanical Garden), Frank Glaw (ZoologischeStaatssammlung Munchen), Martin Henzl(Wien, Austria), Caren Goldberg (Universityof Idaho, Moscow), Andrew Holycross (Ar-izona State University, Tempe), Robert Inger,Alan Resetar, and Harold Voris (Field Mu-seum, Chicago), Cornelya Klutsch (Zoolo-gisches Forschungsinstitut und Museum Al-exander Koenig, Bonn, Germany), DwightLawson (Zoo Atlanta), Karen Lips (SouthernIllinois University, Carbondale), Steve Gotte,W. Ronald Heyer, Roy W. McDiarmid, Rob-ert Reynolds, and Addison Wynn (NationalMuseum of Natural History, Washington,D.C.), Robert W. Murphy (Royal OntarioMuseum, Toronto, Canada), Brice Noonan(Brigham Young University, Provo), PauloNuın (Museu de Zoologia, Universidade de

Sao Paulo, Brazil), Jose Nunez N. (Institutode Zoologıa, Universidad Austral de Chile,Valdivia, Chile), Wade Ryberg (WashingtonUniversity, St. Louis), Elizabeth Scott(Transvaal Museum, Pretoria, South Africa),Tom A. Titus (University of Oregon, Eu-gene), Jens V. Vindum (California Academyof Sciences, San Francisco), David B. Wake(Museum of Vertebrate Zoology, Universityof California, Berkeley), and Jorge Williams(Museo de la Plata, Buenos Aires, Argenti-na).

REFERENCES

Abel, O. 1919. Die Stamme der Wirbeltiere. Klas-se Amphibia. Berlin and Leipzig: Walter deGruyter.

Abourachid, A., and D.M. Green. 1999. Originsof the frog kick? Alternate-leg swimming inprimitive frogs, families Leiopelmatidae andAscaphidae. Journal of Herpetology 33: 657–663.

Adler, K.A. 1989. Herpetologists of the past. InK.A. Adler (editor), Contributions to the his-tory of herpetology. Contributions to Herpetol-ogy, no. 5. Ithaca, NY: Society for the Study ofAmphibians and Reptiles: 5–143.

Ahl, E. 1930. Neuere Erkenntnisse uber die sys-tematische Einteilung der Amphibian. Sitzungs-berichte der Gesellschaft NaturforschenderFreunde zu Berlin 1930: 78–85.

Alcala, A.C., and W.C. Brown. 1982. Reproduc-tive biology of some species of Philautus (Rha-cophoridae) and other Philippine anurans. Phil-ippine Journal of Biology 11: 203–226.

Alford, R.A., and S.J. Richards. 1999. Global am-phibian declines: a problem in applied ecology.Annual Review of Ecology and Systematics 30:133–165.

Allard, M.W., M.M. Miyamoto, L. Jarecki, F.Kraus, and M.R. Tennant. 1992. DNA system-atics and evolution of the artiodactyl familyBovidae. Proceedings of the National Academyof Sciences of the United States of America 89:3972–3976.

Altig, R.I., and G.F. Johnston. 1989. Guilds of an-uran larvae: relationships among developmen-tal modes, morphologies, and habitats. Herpe-tological Monographs 3: 81–109.

Altig, R.I., and R.W. McDiarmid. 1999. Diversity:familial and generic characterizations. In R.W.McDiarmid and R. Altig (editors), Tadpoles:the biology of anuran larvae: 295–337. Chica-go: University of Chicago Press.

Amiet, J.-L. 1970. Morphologie et developpementde la larve de Leptodactylodon ventrimarmor-


atus (Boulenger) (amphibien, anoure). Annalesde la Faculte des Sciences du Cameroun. Ya-ounde 4: 53–71.

Amiet, J.-L. 1971 ‘‘1970’’. Les batraciens oro-philes du Cameroun. Annales de la Faculte desSciences du Cameroun. Yaounde 5: 83–102.

Amiet, J.-L. 1973 ‘‘1972’’. Compte rendu d’unemission batachologique dans le Nord-Came-roun. Annales de la Faculte des Sciences duCameroun. Yaounde 12: 63–78.

Amiet, J.-L. 1973. Caracteres diagnostiques dePetropedetes perreti, nov. sp. et notes sur lesautres especes camerounaises du genre (amphi-biens anoures). Bulletin de l’Institut Fondamen-tal d’Afrique Noire, Serie A, Sciences Naturel-les 35: 462–474.

Amiet, J.-L. 1981. Ecologie, ethologie et devel-oppement de Phrynodon sandersoni Parker,1939 (Amphibia, Anura, Ranidae). Amphibia-Reptilia 2: 1–13.

Amiet, J.-L. 1983. Une espece meconnue de Pe-tropedetes du Cameroun: Petropedetes parkerin. sp. (Amphibia, Anura, Ranidae, Phrynoba-trachinae). Revue Suisse de Zoologie 90: 457–468.

Amiet, J.-L. 1989. Quelques aspects de la biologiedes amphibiens anoures du Cameroun. AnneeBiologique. Paris 28: 73–116.

Amiet, J.-L., and J.-L. Perret. 1969. Contributionsa la faune de la region de Yaounde (CamerounII. Amphibiens anoures. Annales de la Facultedes Sciences du Cameroun. Yaounde 1969:117–137.

Anders, C.C. 2002. Class Amphibia (amphibians).In H.H. Schleich and W. Kastle (editors), Am-phibians and reptiles of Nepal: biology, system-atics, field guide: 133–340. Ruggell: A.R.G.Gantner.

Anderson, J. 1871. A list of the reptilian accessionto the Indian Museum, Calcutta from 1865 to1870, with a description of some new species.Journal of the Asiatic Society of Bengal 40:12–39.

Anderson, J.S. 2001. The phylogenetic trunk:maximal inclusion of taxa with missing data inan analysis of the Lepospondyli (Vertebrata,Tetrapoda). Systematic Biology 50: 170–193.

Andreone, F., M. Vences, D.R. Vieites, F. Glaw,and A. Meyer. 2004 ‘‘2005’’. Recurrent ecolog-ical adaptations revealed through a molecularanalysis of the secretive cophyline frogs ofMadagascar. Molecular Phylogenetics and Evo-lution 34: 315–322.

Annandale, N. 1918. Some undescribed tadpolesfrom the hills of southern India. Records of theIndian Museum 15: 17–23.

Annandale, N., and C.R.N. Rao. 1918. The tad-poles of the families Ranidae and Bufonidae

found in the plains of India. Records of the In-dian Museum 15: 24–40.

Anonymous. 1956. Opinion 417. Rejection fornomenclatorial purposes of volume 3 (Zoolo-gie) of the work by Lorenz Oken entitled‘‘Okens Lehrbuch der Naturgeschichte’’ pub-lished in 1815–1816. Opinions and Declara-tions Rendered by the International Commis-sion on Zoological Nomenclature 14: 1–42.

Anonymous. 1977. Opinion 1071. Emendationunder the plenary powers of Liopelmatina toLeiopelmatidae (Amphibia, Salientia). Bulletinof Zoological Nomenclature 33: 167–169.

Anonymous. 1990. Opinion 1604. IchthyophiidaeTaylor, 1968 (Amphibia, Gymnophiona): con-served. Bulletin of Zoological Nomenclature47: 166–167.

Anonymous. 1996. Opinion 1830. CaeciliidaeKolbe, 1880 (Insecta, Psocoptera): spellingemended to Caeciliusidae, so removing thehomonymy with Caeciliidae Rafinesque, 1814(Amphibia, Gymnophiona). Bulletin of Zoolog-ical Nomenclature 53: 68–69.

Aplin, K.P., and M. Archer. 1987. Recent advanc-es in marsupial systematics with a new syn-cretic classification. In M. Archer (editor), vol.1. Possums and opossums: studies in evolution:xv–lxxii. Chipping Norton, Australia: SurreyBeatty.

Archey, G. 1922. The habitat and life history ofLiopelma hochstetteri. Records of the Canter-bury Museum 2: 59–71.

Archibald, J.D. 1994. Metataxon concepts and as-sessing possible ancestry using phylogeneticsystematics. Systematic Biology 43: 27–40.

Ardila-Robayo, M.C. 1979. Status sistematico delgenero Geobatrachus Ruthven, 1915 (Amphib-ia: Anura). Caldasia 12: 383–495.

Austin, J.D., S.C. Lougheed, K. Tanner, A.A.Chek, J.P. Bogart, and P.T. Boag. 2002. A mo-lecular perspective on the evolutionary affini-ties of an enigmatic Neotropical frog, Allophry-ne ruthveni. Zoological Journal of the LinneanSociety. London 134: 335–346.

Baez, A.M., and N.G. Basso. 1996. The earliestknown frogs of the Jurassic of South America:review and cladistic appraisal of their relation-ships. Munchner Geowissenschaftliche Abhan-dlungen. Reihe A. Geologie und Palaontologie30: 131–158.

Baez, A.M., and L.A. Pugener. 2003. Ontogenyof a new Paleogene pipid frog from southernSouth America and xenopodinomorph evolu-tion. Zoological Journal of the Linnean Society.London 139: 439–476.

Baez, A.M., and L. Trueb. 1997. Redescription ofthe Paleogene Shelania pascuali from Patagon-ia and its bearing on the relationships of fossil


and Recent pipoid frogs. Scientific Papers. Nat-ural History Museum, University of Kansas 4:1–41.

Bain, R.H., A. Lathrop, R.W. Murphy, N.L. Orlov,and T.C. Ho. 2003. Cryptic species of a cascadefrog from Southeast Asia: taxonomic revisionsand descriptions of six new species. AmericanMuseum Novitates 3417: 1–60.

Bain, R.H., and Q.T. Nguyen. 2004. Herpetofaunadiversity of Ha Giang Province in northeasternVietnam, with descriptions of two new species.American Museum Novitates 3453: 1–42.

Baldauf, R.J. 1959. Morphological criteria andtheir use in showing bufonid phylogeny. Jour-nal of Morphology 104: 527–560.

Baldissera, F.A., Jr., R.F. Batistic, and C.F.B. Had-dad. 1999. Cytotaxonomic considerations withthe description of two new NOR locations forSouth American toads, genus Bufo (Anura: Bu-fonidae). Amphibia-Reptilia 20: 413–420.

Barbour, T., and A. Loveridge. 1928. A compar-ative study of the herpetological faunae of theUluguru and Usambara Mountains, TanganyikaTerritory, with descriptions of new species. Me-moires of the Museum of Comparative Zoology50: 85–265.

Barrio, A. 1954. Sistematica, morfologıa y re-produccion de Physalaemus henselii (Peters) yPseudopaludicola falcipes (Hensel). Physis.Buenos Aires 20: 379–389.

Barrio, A. 1963. Consideraciones sobre compor-tamiento y ‘‘grito agresivo’’ propio de algunasespecies de Ceratophrynidae (Anura). Physis.Buenos Aires 24: 143–148.

Barrio, A. 1968. Revision del genero Lepidoba-trachus Budgett (Anura, Ceratophrynidae).Physis. Buenos Aires 27: 445–454.

Barrio, A. 1977. Aportes para la elucidacion del‘‘status’’ taxonomico de Pleurodema bibroniTschudi y Pleurodema kriegi (Muller) (Am-phibia, Anura, Leptodactylidae). Physis. Buen-os Aires 37: 311–331.

Barrio, A., and P. Rinaldi de Chieri. 1971. Con-tribucion al esclarecimiento de la posicion tax-ofiletica de algunos batracios argentinos me-diante el analisis cariotıpico. Physis. BuenosAires 30: 673–685.

Barrio-Amoros, C.L. 2004. Amphibians of Vene-zuela. Systematic list, distribution and referenc-es. Revista de Ecologıa Latino-Americana 9: 1–48.

Bauer, L. 1986. A new genus and a new specificname in the dart poison frog family (Dendro-batidae, Anura, Amphibia). Ripa. Netherlands1986(November): 1–12.

Beddard, F.E. 1908 ‘‘1907’’. Contributions to theknowledge of the anatomy of the batrachian

family Pelobatidae. Proceedings of the Zoolog-ical Society of London 1907: 871–911.

Beddard, F.E. 1911. Contributions to the anatomyof the Anura. Proceedings of the Zoological So-ciety of London 1911: 393–412.

Bell, B.D., and R.J. Wassersug. 2003. Anatomicalfeatures of Leiopelma embryos and larvae: im-plication for anuran evolution. Journal of Mor-phology 256: 160–170.

Benton, M.J. 2000. Stems, nodes, crown clades,and rank-free lists: is Linnaeus dead? Biologi-cal Reviews of the Cambridge PhilosophicalSociety 75: 633–648.

Berthold, A.A. 1827. Latreille’s naturliche Fami-lien der Thierreichs aus dem Franzosischen mitAnmerkungen und Zusatzen von Dr. ArnoldAdoph Berthold. Weimar: Landes-IndustrieComptoir.

Biju, S.D., and F. Bossuyt. 2003. New frog familyfrom India reveals an ancient biogeographicallink with the Seychelles. Nature. London 425:711–714.

Bishop, S.C. 1943. Handbook of salamanders. Ith-aca: Comstock Publishing Company.

Blair, W.F. (editor), 1972a. Evolution in the genusBufo. Austin: University of Texas Press.

Blair, W.F. 1972b. Bufo of North and CentralAmerica. In W.F. Blair (editor), Evolution in thegenus Bufo: 93–101. Austin: University of Tex-as Press.

Blair, W.F. 1972c. Evidence from hybridization. InW.F. Blair (editor), Evolution in the genus Bufo:196–243. Austin: University of Texas Press.

Blair, W.F. 1972d. Characteristics of the testes. InW.F. Blair (editor), Evolution in the genus Bufo:324–328. Austin: University of Texas Press.

Blaustein, A.R., and J.M. Kiesecker. 2002. Com-plexity in conservation: lessons from the globaldecline of amphibian populatons. Ecology Let-ters 5: 597–608.

Blommers-Schlosser, R.M.A. 1975. Observationson the larval development of some Malagasyfrogs, with notes on their ecology and biology(Anura: Dyscophinae, Scaphiophryninae andCophylinae). Beaufortia 24: 7–26.

Blommers-Schlosser, R.M.A. 1976. Chromosomalanalysis of twelve species of Microhylidae (An-ura) from Madagascar. Genetica 46: 199–210.

Blommers-Schlosser, R.M.A. 1993. Systematicrelationships of the Mantellinae Laurent 1946(Anura Ranoidea). Ethology Ecology & Evo-lution 5: 199–218.

Blommers-Schlosser, R.M.A., and C.P. Blanc.1991. Amphibiens (premiere partie). Faune deMadagascar 75: 1–379.

Blommers-Schlosser, R.M.A., and C.P. Blanc.1993. Amphibiens (deuxieme partie). Faune deMadagascar 75: 385–530.


Bogart, J.P. 1968. Chromosome number differ-ence in the amphibian genus Bufo: the Bufo re-gularis group. Evolution 22: 42–45.

Bogart, J.P. 2003. Genetics and systematics of hy-brid species. In D.M. Sever (editor), Reproduc-tive biology and phylogeny of Urodela (Am-phibia): 109–134. Enfield, New Hampshire:Science Publishers, Inc.

Bogart, J.P., and M. Tandy. 1981. Chromosomelineages in African ranoid frogs. MonitoreZoologico Italiano. Nuova Serie, Supplemento15: 55–91.

Boie, H. 1828. Bemerfungen uber die Ubtheilun-gen im naturlichen Systeme und deren Char-acteristit. Isis von Oken 21: 351–363.

Bokermann, W.C.A. 1965. Notas sobre as espe-cies de Thoropa Fitzinger (Amphibia, Lepto-dactylidae). Anais da Academia Brasileira deCiencias. Rio de Janeiro 37: 525–537.

Bolıvar-G., W., T. Grant, and L.A. Osorio. 1999.Combat behavior in Centrolene buckleyi andother centrolenid frogs. Alytes 16: 77–83.

Bolkay, S.J. 1919. Osnove uporedne osteologijeanurskih batrahija [Elements of the comparativeosteology of the tailless batrachians]. GlasnikaZemaljskog Muzeja u Bosni i Hercegovini. Sa-rejevo 31: 275–357.

Bonacum, J., J. Stark, and E. Bonwich. 2001.PCR methods and approaches. In R. DeSalle,G. Giribet, and W.C. Wheeler (editors), Tech-niques in molecular systematics and evolution:302–328. Boston: Birkhauser.

Bonaparte, C.L.J.L. 1839. Iconographia della fau-na italica per le quattro classi degli animali ver-tebrati. Tomo II. Amphibi. Fascicolo 26. Roma:Salviucci.

Bonaparte, C.L.J.L. 1840. Prodromus systematisherpetologiae. Nuovi Annali delle Scienze Na-turali. Bologna 4: 90–101.

Bonaparte, C.L.J.L. 1845. Specchio generale deisistemi erpetologico, anfibiologico ed ittiologi-co. Milano: Coi Tipi di Luigi di Giacomo Pi-rola.

Bonaparte, C.L.J.L. 1850. Conspectus systema-tum. Herpetologiae et amphibiologiae. Editioaltera reformata. Leiden: Brill.

Bonett, R.M., and P.T. Chippindale. 2004. Speci-ation, phylogeography and evolution of life his-tory and morphology in plethodontid salaman-ders of the Eurycea multiplicata complex. Mo-lecular Ecology 13: 1189–1203.

Bossuyt, F., and M.C. Milinkovitch. 2000. Con-vergent adaptive radiations in Madagascan andAsian ranid frogs reveal covariation betweenlarval and adult traits. Proceedings of the Na-tional Academy of Sciences of the UnitedStates of America 97: 6585–6590.

Bossuyt, F., and M.C. Milinkovitch. 2001. Am-

phibians as indicators of early Tertiary ‘‘out-of-India’’ dispersal of vertebrates. Science 292:93–95.

Boulenger, G.A. 1882. Catalogue of the BatrachiaSalientia s. Ecaudata in the collection of theBritish Museum, 2nd ed. London: Taylor andFrancis.

Boulenger, G.A. 1884. Diagnoses of new reptilesand batrachians from the Solomon Islands, col-lected and presented to the British Museum byH.B. Guppy, Esq., M.B., H.M.S. ‘‘Lark’’. Pro-ceedings of the Zoological Society of London1884: 210–213.

Boulenger, G.A. 1890. Second report on additionsto the batrachian collection in the Natural-His-tory Museum. Proceedings of the ZoologicalSociety of London 1890: 323–328.

Boulenger, G.A. 1892 ‘‘1891’’. A synopsis of thetadpoles of the European batrachians. Proceed-ings of the Zoological Society of London 1891:593–627.

Boulenger, G.A. 1906 ‘‘1905’’. Report on the ba-trachians collected by the late L. Fea in WestAfrica. Annali del Museo Civico di Storia Na-turale di Genova. Serie 3, 2: 157–172.

Boulenger, G.A. 1918. Remarks on the batrachiangenera Cornufer, Tschudi, Platymantis, Gthr.,Simomantis, g.n., and Staurois, Cope. Annalsand Magazine of Natural History, Series 9, 1:372–375.

Boulenger, G.A. 1920. A monograph of the SouthAsian, Papuan, Melanesian and Australianfrogs of the genus Rana. Records of the IndianMuseum 20: 1–226.

Boycott, R.C. 1982. On the taxonomic status ofHeleophryne regis Hewitt, 1909 (Anura: Lep-todactylidae). Annals of the Cape ProvincialMuseums. Natural History 14: 89–108.

Bremer, K. 1994. Branch support and tree stabil-ity. Cladistics 10: 295–304.

Brongniart, A.T. 1800a. Essai d’une classificationnaturelle des reptiles. Iere Partie. Bulletin desSciences, par La Societe Philomathique 2: 81–82.

Brongniart, A.T. 1800b. Essai d’une classificationnaturelle des reptiles. II Partie. Bulletin des Sci-ences, par La Societe Philomathique 2: 89–91.

Brown, W.C. 1952. The amphibians of the Solo-mon Islands. Bulletin of the Museum of Com-parative Zoology 107: 3–64.

Brummitt, R.K. 2002. How to chop up a tree. Tax-on 51: 31–41.

Burton, T.C. 1986. A reassessment of the Papuansubfamily Asterophryninae (Anura: Microhyli-dae). Records of the South Australian Museum19: 405–450.

Burton, T.C. 1998a. Pointing the way: the distri-bution and evolution of some characters of the


finger muscles of frogs. American MuseumNovitates 3229: 1–13.

Burton, T.C. 1998b. Variation in the hand and su-perficial throat musculature of Neotropical lep-todactylid frogs. Herpetologica 54: 53–72.

Burton, T.C. 2004. Muscles and pes of hylid frogs.Journal of Morphology 260: 209–233.

Caccone, A., M.C. Milinkovitch, V. Sbordoni, andJ.R. Powell. 1994. Molecular biogeography: us-ing the Corsica-Sardinia microplate disjunctionto calibrate mitochondrial rDNA evolutionaryrates in mountain newts (Euproctus). Journal ofEvolutionary Biology 7: 227–245.

Caldwell, J.P., and C.W. Myers. 1990. A new poi-son frog from Amazonian Brazil, with furtherrevision of the quinquevittatus group of Den-drobates. American Museum Novitates 2988:1–21.

Cannatella, D.C. 1985. A phylogeny of primitivefrogs (Archeobatrachia). Ph.D. dissertation. De-partment of Systematics and Ecology, Univer-sity of Kansas, Lawrence.

Cannatella, D.C. 1989. On the monophyly of dis-coglossoid frogs. Fortschritte der Zoologie/Pro-gress in Zoology 35: 230–231.

Cannatella, D.C., and D.M. Hillis. 1993. Amphib-ian relationships: phylogenetic analysis of mor-phology and molecules. Herpetological Mono-graphs 7: 1–7.

Cannatella, D.C., and D.M. Hillis. 2004. Amphib-ians: leading a life of slime. In J. Cracraft andM.J. Donoghue (editors), Assembling the treeof life: 430–450. Oxford, U.K.: Oxford Uni-versity Press.

Cannatella, D.C., D.M. Hillis, P.T. Chippindale,L.A. Weigt, A.S. Rand, and M.J. Ryan. 1998.Phylogeny of frogs of the Physalaemus pustu-losus species group, with an examination ofdata incongruence. Systematic Biology 47:311–335.

Cannatella, D.C., and L. Trueb. 1988. Evolutionof pipoid frogs: intergeneric relationships of theaquatic frog family Pipidae (Anura). ZoologicalJournal of the Linnean Society. London 94: 1–38.

Cantino, P.D., H.N. Bryant, K. de Queiroz, M.J.Donoghue, T. Eriksson, D.M. Hillis, and M.S.Y.Lee. 1999. Species names in phylogenetic no-menclature. Systematic Biology 48: 790–807.

Cantino, P.D., R.G. Olmstead, and S.J. Wagstaff.1997. A comparison of phylogenetic nomencla-ture with the current system: a botanical casestudy. Systematic Biology 46: 313–331.

Caramaschi, U., and J.P. Pombal, Jr. 2001. Bary-cholos savagei: a junior synonym of Paludicolaternetzi, with notes on development. Journal ofHerpetology 35: 357–360.

Carpenter, J.M. 2003. Critique of pure folly. Bo-tanical Review 69: 79–92.

Carroll, R.L. 2000a. The lissamphibian enigma. InH. Heatwole and R.L. Carroll (editors), Am-phibian biology, vol. 4. Paleontology, the evo-lutionary history of amphibians: 1270–1273.Chipping Norton, Australia: Surrey Beatty.

Carroll, R.L. 2000b. Eocaecilia and the origin ofcaecilians. In H. Heatwole and R.L. Carroll (ed-itors), Amphibian biology, vol. 4. Paleontology,the evolutionary history of amphibians: 1402–1411. Chipping Norton, Australia: Surrey Beat-ty & Sons.

Carroll, R.L., and P.J. Currie. 1975. Microsaurs aspossible apodan ancestors. Zoological Journalof the Linnean Society. London 57: 229–247.

Carroll, R.L., A. Kunst, and K. Albright. 1999.Vertebral development and amphibian evolu-tion. Evolution and Development 1: 36–48.

Case, S.M. 1978. Biochemical systematics ofmembers of the genus Rana native to westernNorth America. Systematic Zoology 27: 299–311.

Cei, J.M. 1970. La posicion filetica de Telmato-biinae, su discusion reciente y significado cri-tico de algunos imunotests. Acta Zoologica Lil-loana 27: 181–192.

Cei, J.M. 1972. Bufo of South America. In W.F.Blair (editor), Evolution in the genus Bufo: 82–92. Austin: University of Texas Press.

Cei, J.M. 1980. Amphibians of Argentina. Moni-tore Zoologico Italiano. Nuova Serie, Monogra-phia 2: 1–609.

Channing, A. 1989. A re-evaluation of the phy-logeny of Old World treefrogs. South AfricanJournal of Zoology 24: 116–131.

Channing, A. 1995. The relationship betweenBreviceps (Anura: Microhylidae) and Hemisus(Hemisotidae) remains equivocal. Journal ofthe Herpetological Association of Africa 44:55–57.

Channing, A. 2001. Amphibians of central andsouthern Africa. Ithaca, NY: Cornell UniversityPress.

Channing, A. 2003. Ghost frogs (Heleophryni-dae). In W.E. Duellman (editor), Grzimek’s an-imal life encyclopedia, 2nd ed. Vol. 6. Am-phibians: 131–134. Detroit: Gale Group.

Channing, A., D. Moyer, and M. Burger. 2002.Cryptic species of sharp-nosed reed frogs in theHyperolius nasutus complex: advertisementcall differences. African Zoology 36: 91–99.

Channing, A., D.C. Moyer, and K.M. Howell.2002. Description of a new torrent frog in thegenus Arthroleptides from Tanzania (Amphibia,Anura, Ranidae). Alytes 20: 13–27.

Chari, V.K. 1962. A description of the hithertoundescribed tadpole of, and some field notes on


the fungoid frog Rana malabarica (Bibr.). Jour-nal of the Bombay Natural History Society 59:71–76.

Chen, L.Q., R.W. Murphy, A. Lathrop, A. Ngo,N.L. Orlov, T.C. Ho, and I.L.M. Somorjai.2005. Taxonomic chaos in Asian ranid frogs:an initial phylogenetic resolution. Herpetologi-cal Journal 15: 231–243. [Not seen prior to De-cember, 2005.]

Chen, N., J.X. Ma, D.W. Corson, E.S. Hazard, andR.K. Crouch. 1996. Molecular cloning of a rho-dopsin gene from salamander rods. Investiga-tions in Ophthalmology and Vision Science 37:1907–1913.

Chippindale, P.T., R.M. Bonett, A.S. Baldwin, andJ.J. Wiens. 2004. Phylogenetic evidence for amajor reversal of life-history evolution in pleth-odontid salamanders. Evolution 58: 2809–2822.

Chou, W.-H. 1999. A new frog of the genus Rana(Anura: Ranidae) from China. Herpetologica55: 389–400.

Clarke, B.T. 1981. Comparative osteology andevolutionary relationships in the African Rani-nae (Anura: Ranidae). Monitore Zoologico It-aliano. Nuova Serie, Supplemento 15: 285–331.

Clough, M.E., and K. Summers. 2000. Phyloge-netic systematics and biogeography of the poi-son frogs: evidence from mitochondrial DNAsequences. Biological Journal of the LinneanSociety 70: 515–540.

Cogger, H.G., E.E. Cameron, and H.M. Cogger.1983. Zoological catalogue of Australia, vol. 1.Amphibia and Reptilia. Canberra: AustralianGovernment Publishing Service.

Colgan, D.J., A. McLauchlan, G.D.F. Wilson, S.P.Livingston, G.D. Edgecombe, J. Macaranas,and G. Cassis. 1999. Histone H3 and U2 sn-RNA DNA sequences and arthropod molecularevolution. Australian Journal of Zoology 46:419–437.

Collins, J.P., and A. Storfer. 2003. Global am-phibian declines: sorting the hypotheses. Di-versity and Distributions 9: 89–98.

Coloma, L.A. 1995. Ecuadorian frogs of the ge-nus Colostethus (Anura: Dendrobatidae). Uni-versity of Kansas Museum of Natural History,Miscellaneous Publications 87: 1–72.

Cope, E.D. 1859. On the primary divisions of theSalamandridae, with descriptions of two newspecies. Proceedings of the Academy of Natu-ral Sciences of Philadelphia 11: 122–128.

Cope, E.D. 1861 ‘‘1860’’. Descriptions of reptilesfrom tropical America and Asia. Proceedings ofthe Academy of Natural Sciences of Philadel-phia 12: 368–374.

Cope, E.D. 1862. Catalogues of the reptiles ob-tained during the explorations of the Parana,

Paraguay, Vermejo and Uraguay [sic] Rivers,by Capt. Thos. J. Page, U.S.N.; and of thoseprocured by Lieut. N. Michler, U.S. Top. Eng.,Commander of the expedition conducting thesurvey of the Atrato River. Proceedings of theAcademy of Natural Sciences of Philadelphia14: 346–359.

Cope, E.D. 1863. On Trachycephalus, Scaphiopusand other Batrachia. Proceedings of the Acad-emy of Natural Sciences of Philadelphia 15:43–54.

Cope, E.D. 1865. Sketch of primary groups ofBatrachia s. Salientia. Natural History Review.New Series 5: 97–120.

Cope, E.D. 1866. On the structure and distributionof the genera of the arciferous Anura. Journalof the Academy of Natural Sciences of Phila-delphia. Series 2, 6: 67–112.

Cope, E.D. 1867. On the families of the raniformAnura. Journal of the Academy of Natural Sci-ences of Philadelphia. Series 3, 6: 189–206.

Cope, E.D. 1869. A review of the species ofPlethodontidae and Desmognathidae. Proceed-ings of the Academy of Natural Sciences ofPhiladelphia 21: 93–118.

Cope, E.D. 1875. Check-list of North AmericanBatrachia and Reptilia; with a systematic list ofthe higher groups, and an essay on geographicaldistribution based on specimens contained inthe U.S. National Museum. Bulletin of theUnited States National Museum 1: 1–104.

Cope, E.D. 1880. Geology and paleontology.American Naturalist 14: 609–610.

Cope, E.D. 1887. The hyoid structure in the am-blystomid salamanders. American Naturalist21: 88.

Cope, E.D. 1889. Batrachia of North America.Bulletin of the United States National Museum34: 5–525.

Couper, P. 1992. Hope for our missing frogs.Wildlife Australia. Brisbane 1992: 10–11.

Crawford, A.J. 2003. Huge populations and oldspecies of Costa Rican and Panamanian dirtfrogs inferred from mitochondrial and nucleargene sequences. Molecular Ecology 12: 2525–2540.

Crawford, A.J., and E.N. Smith. 2005. Cenozoicbiogeography and evolution in direct-develop-ing frogs of Central America (Leptodactylidae:Eleutherodactylus) as inferred from a phylo-genetic analysis of nuclear and mitochondrialgenes. Molecular Phylogenetics and Evolution35: 536–555.

Cunningham, M., and M.I. Cherry. 2000. Mito-chondrial DNA divergence in southern Africanbufonids: are species equivalent entities? Afri-can Journal of Herpetology 49: 9–22.

Cunningham, M., and M.I. Cherry. 2004. Molec-


ular systematics of African 20-chromosometoads (Anura: Bufonidae). Molecular Phyloge-netics and Evolution 32: 671–685.

Cuvier, G.L.C.F.D. 1829. Le regne animal distri-bue d’apres son organisation, pour servir debase a l’histoire naturelle des animaux etd’introduction a l’anatomie comparee. Nou-velle ed., revue et augmentee par P.A. Latreille,vol. 2. Paris: Deterville.

Daltry, J.C., and G.N. Martin. 1997. Rediscoveryof the black narrow mouthed frog, Melanoba-trachus indicus Beddome, 1878. Hamadryad22: 57–58.

Darst, C.R., and D.C. Cannatella. 2004. Novel re-lationships among hyloid frogs inferred from12S and 16S mitochondrial DNA sequences.Molecular Phylogenetics and Evolution 31:462–475.

da Silva, H.R. 1998. Phylogenetic relationships ofthe family Hylidae with emphasis on the rela-tionships within the subfamily Hylinae (Am-phibia: Anura). Ph.D. dissertation. Departmentof Sytematics and Ecology, University of Kan-sas, Lawrence.

da Silva, H.R., and J.R. Mendelson, III. 1999. Anew organ and sternal morphology in toads(Anura: Bufonidae): descriptions, taxonomicdistribution, and evolution. Herpetologica 55:114–126.

Davies, M.M. 2003a. Australian ground frogs(Limnodynastidae). In W.E. Duellman (editor),Grzimek’s animal life encyclopedia, 2nd ed.Vol. 6. Amphibians: 139–146. Detroit: GaleGroup.

Davies, M.M. 2003b. Australian toadlets and wa-ter frogs (Myobatrachidae). In W.E. Duellman(editor), Grzimek’s animal life encyclopedia,2nd ed. Vol. 6. Amphibians: 147–154. Detroit:Gale Group.

Dawood, A., A. Channing, and J.P. Bogart. 2002.A molecular phylogeny of the frog genus To-mopterna in southern Africa: examining spe-cies boundaries with mitochondrial 12S rRNAsequence data. Molecular Phylogenetics andEvolution 22: 407–413.

De Bavay, J.M. 1993. The developmental stagesof the sphagnum frog, Kyarranus sphagnicol-ous Moore (Anura, Myobatrachidae). Austra-lian Journal of Zoology 41: 151–201.

de Blainville, H.M.D. 1816. Prodrome d’une nou-velle distribution systematique du regne animal.Bulletin de la Societe Philomathique de Paris.Series 3, 3: 113–124.

de Blainville, H.M.D. 1835. Description de quel-ques especes de reptiles de la Californie, pre-cedee de l’analyse d’un systeme generald’erpetologie et d’amphibiologie. Nouvelles

Annales du Museum d’Histoire Naturelle. Paris4: 233–296, 4 pl.

de Carvalho, M.R., F.A. Bockman, D.S. Amorim,M. de Vivo, M. de Toledo-Piza, N.A. Menezes,J.L. De Figueiredo, R.M.C. Castro, A.C. Gill,J.D. McEachran, L.J.V. Compagno, R.C. Schel-ly, R. Britz, J.C. Lundberg, R.P. Vari, and G.Nelson. 2005. Revisiting the taxonomic imped-iment. Science 307: 353.

De la Riva, I., and J.D. Lynch. 1997. New speciesof Eleutherodactylus from Bolivia (Amphibia:Leptodactylidae). Copeia 1997: 151–157.

Delorme, M., and A. Dubois. 2001. Une nouvelleespece de Scutiger du Bhutan, et quelques re-marques sur la classification subgenerique dugenre Scutiger (Megophryidae, Leptobrachi-inae). Alytes 19: 141–153.

Delorme, M., A. Dubois, S. Grosjean, and A. Ohl-er. 2005. Une nouvelle classification generiqueet subgenerique de la tribu des Philautini (Am-phibia, Anura, Ranidae, Rhacophorinae). Bul-letin Mensuel de la Societe Linneenne de Lyon74: 165–171.

Delorme, M., A. Dubois, J. Kosuch, and M.Vences. 2004. Molecular phylogenetic relation-ships of Lankanectes corrugatus from Sri Lan-ka: endemism of South Asian frogs and theconcept of monophyly in phylogenetic studies.Alytes 22: 53–64.

del Pino, E.M., and B. Escobar. 1981. Embryonicstages of Gastrotheca riobambae (Fowler) dur-ing maternal incubation and comparison withdevelopment with other marsupial frogs. Jour-nal of Morphology 167: 277–295.

de Queiroz, K. 1988. Systematics and the Dar-winian Revolution. Philosophy of Science 55:238–259.

de Queiroz, K., and J.A. Gauthier. 1992. Phylo-genetic taxonomy. Annual Review of Ecologyand Systematics 23: 449–480.

de Queiroz, K., and J.A. Gauthier. 1994. Towarda phylogenetic system of biological nomencla-ture. Trends in Ecology and Evolution 9: 27–31.

de Sa, R.O., W.R. Heyer, and A. Camargo. 2005.A phylogenetic analysis of Vanzolinius (Am-phibia, Anura, Leptodactylidae): taxonomic andlife history implications. Arquivos do MuseuNacional do Rio de Janeiro, In press.

de Sa, R.O., and D.M. Hillis. 1990. Phylogeneticrelationships of the pipid frogs Xenopus andSilurana: an integration of ribosomal DNA andmorphology. Molecular Biology and Evolution7: 365–376.

de Sa, R.O., and C.C. Swart. 1999. Developmentof the suprarostral plate of pipoid frogs. Journalof Morphology 240: 143–153.

De Villiers, C.G.S. 1929. The development of a


species of Arthroleptella from Jonkershoek,Stellenbosch. South African Journal of Science26: 481–510.

De Villiers, C.G.S. 1931. Uber den Schadelbaudes Breviceps fuscus. Anatomischer Anzeiger72: 164–178.

D’Haese, C.A. 2003. Morphological appraisal ofCollembola phylogeny with special emphasison Poduromorpha and a test of the aquatic or-igin hypothesis. Zoologica Scripta 32: 563–586.

Diaz, N.F., J. Valencia, and M. Sallaberry. 1983.Life history and phylogenetic relationships ofInsuetophrynus acarpicus (Anura: Leptodactyl-idae). Copeia 1983: 30–37.

Donnelly, M.A., and M.L. Crump. 1998. Potentialeffects of climate change on two Neotropicalamphibian assemblages. Climatic Change 39:541–561.

Donnelly, M.A., R.O. de Sa, and C. Guyer. 1990.Description of the tadpoles of Gastrophrynepictiventris and Nelsonophryne aterrima (An-ura: Microhylidae), with a review of morpho-logical variation in free-swimming microhylidlarvae. American Museum Novitates 2796: 1–19.

Donoghue, M.J. 1985. A critique of the biologicalspecies concept and recommendations for aphylogenetic alternative. Bryologist 88: 172–181.

Drewery, G.E., and K.L. Jones. 1976. A new ovo-viviparous frog, Eleutherodactylus jasperi(Amphibia, Anura, Leptodactylidae) fromPuerto Rico. Journal of Herpetology 10: 161–165.

Drewes, R.C. 1984. A phylogenetic analysis ofthe Hyperoliidae (Anura): treefrogs of Africa,Madagascar, and the Seychelles Islands. Occa-sional Papers of the California Academy of Sci-ences 139: 1–70.

Drewes, R.C., R.I. Altig, and K.M. Howell. 1989.Tadpoles of three frog species endemic to theforest of the Eastern Arc Mountains, Tanzania.Amphibia-Reptilia 10: 435–443.

Drewes, R.C., and J.A. Wilkinson. 2004. The Cal-ifornia Academy of Sciences Gulf of GuineaExpedition (2001) I. The taxonomic status ofthe genus Nesionixalus Perret, 1976 (Anura:Hyperoliidae), treefrogs of Sao Tome and Prın-cipe, with comments on the genus Hyperolius.Proceedings of the California Academy of Sci-ences 55: 395–407.

Dubois, A. 1980. Notes sur la systematique et larepartition des amphibiens anoures de Chine etdes regions avoisinantes IV. Classification ge-nerique et subgenerique des Pelobatidae Me-gophryinae. Bulletin Mensuel de la SocieteLinneenne de Lyon 49: 469–482.

Dubois, A. 1981. Liste des genres et sous-genresnominaux de Ranoidea (amphibiens anoures)du monde, avec identification de leurs especestypes; consequences nomenclaturales. MonitoreZoologico Italiano. Nuova Serie, Supplemento15: 225–284.

Dubois, A. 1982. Les notions de genre, sous-genre et groupe d’especes en zoologie a la lu-miere de la systematique evolutive. MonitoreZoologico Italiano. Nuova Serie, Supplemento16: 9–65.

Dubois, A. 1983. Classification et nomenclaturesupragenerique des amphibiens anoures. Bul-letin Mensuel de la Societe Linneenne de Lyon52: 270–276.

Dubois, A. 1984a. Miscellanea nomenclatoricabatrachologica (V). Alytes 3: 111–116.

Dubois, A. 1984b. La nomenclature supragene-rique des amphibiens anoures. Memoires duMuseum National d’Histoire Naturelle. Paris.Serie A, Zoologie 131: 1–64.

Dubois, A. 1985. Miscellanea nomenclatorica ba-trachologica (VII). Alytes 4: 61–78.

Dubois, A. 1986 ‘‘1985’’. Diagnose preliminaired’un nouveau genre de Ranoidea (amphibiens,anoures) du sud de l’Inde. Alytes 4: 113–118.

Dubois, A. 1987 ‘‘1985’’. Miscellanea taxinomicabatrachologica (I). Alytes 5: 7–95.

Dubois, A. 1987 ‘‘1986’’. Living amphibians ofthe world: a first step towards a comprehensivechecklist. Alytes 5: 99–149.

Dubois, A. 1987. Discoglossidae Gunther, 1858(Amphibia, Anura): proposed conservation. Al-ytes 6: 56–68.

Dubois, A. 1988a. Miscellanea nomenclatoricabatrachologica (XVII). Alytes 7: 1–5.

Dubois, A. 1988b. The genus in zoology: a con-tribution to the theory of evolutionary system-atics. Memoires du Museum Nationald’Histoire Naturelle. Paris. Serie A, Zoologie140: 1–122.

Dubois, A. 1992. Notes sur la classification desRanidae (amphibiens anoures). Bulletin Men-suel de la Societe Linneenne de Lyon 61: 305–352.

Dubois, A. 1995. Keratodont formulae in anurantadpoles: proposals for a standardization. Jour-nal of Zoological Systematics and EvolutionaryResearch 33: 1–15.

Dubois, A. 1999a. Miscellanea nomenclatoricabatrachologica. 19. Notes on the nomenclatureof Ranidae and related groups. Alytes 17: 81–100.

Dubois, A. 1999b. South Asian Amphibia: a newfrontier for taxonomists. Journal of South AsianNatural History 4: 1–11.

Dubois, A. 2000. The influence of man on thedistribution of amphibians in the Himalayas of


Nepal: an example of critical evaluation of bio-geographical data. In G. Miehe and Y. Zhang(editors), Environmental changes in High Asia.Proceedings of an international symposium atthe University of Marburg, Faculty of Geogra-phy, 29 May to 1 June 1997, under the auspicesof the Unesco. Marburger GeographischeSchriften 135: 326–345.

Dubois, A. 2003. True frogs (Ranidae). In W.E.Duellman (editor), Grzimek’s animal life en-cyclopedia, 2nd ed. Vol. 6. Amphibians: 245–264. Detroit: Gale Group.

Dubois, A. 2004a. Amphibians of Nepal: a fewwords of caution. Alytes 21: 174–180.

Dubois, A. 2004b. The higher nomenclature ofrecent amphibians. Alytes 22: 1–14.

Dubois, A. 2005. Amphibia Mundi. 1.1. An er-gotaxonomy of Recent amphibians. Alytes 23:1–24.

Dubois, A., and R. Gunther. 1982. Klepton andsynklepton: two new evolutionary systematicscategories in zoology. Zoologische Jahrbucher.Abteilung fur Systematik, Okologie und Geo-graphie. Jena 109: 290–305.

Dubois, A., and A. Ohler. 1998. A new species ofLeptobrachium (Vibrissaphora) from northernVietnam, with a review of the taxonomy of thegenus Leptobrachium (Pelobatidae, Megophyi-nae). Dumerilia 4: 1–32.

Dubois, A., and A. Ohler. 1999. Asian and Ori-ental toads of the Bufo melanostictus, Bufo sca-ber and Bufo stejnegeri groups (Amphibia, An-ura): a list of available and valid names andredescription of some name-bearing types.Journal of South Asian Natural History 4: 133–180.

Dubois, A., and A. Ohler. 2000. Systematics ofFejervarya limnocharis (Gravenhorst, 1829)(Amphibia, Anura, Ranidae) and related spe-cies. 1. Nomenclatural status and type-speci-mens of the nominal species Rana limnocharisGravenhorst, 1829. Alytes 18: 15–50.

Dubois, A., and A. Ohler. 2001. A new genus foran aquatic ranid (Amphibia, Anura) from SriLanka. Alytes 19: 81–106.

Dubois, A., A. Ohler, and S.D. Biju. 2001. A newgenus and species of Ranidae (Amphibia, An-ura) from south-western India. Alytes 19: 53–79.

Duellman, W.E. 1975. On the classification offrogs. Occasional Papers of the Museum ofNatural History, University of Kansas 42: 1–14.

Duellman, W.E. 2001. Hylid frogs of MiddleAmerica, 2nd ed. 2 vol. Contributions to Her-petology, no. 18. Ithaca, NY: Society for theStudy of Amphibians and Reptiles.

Duellman, W.E. 2003. Leptodactylid frogs (Lep-

todactylidae). In W.E. Duellman (editor), Grzi-mek’s animal life encyclopedia, 2nd ed. Vol. 6.Amphibians: 155–171. Detroit: Gale Group.

Duellman, W.E., and P. Gray. 1983. Developmen-tal biology and systematics of the egg-broodinghylid frogs, genera Flectonotus and Fritziana.Herpetologica 39: 333–359.

Duellman, W.E., and M.S. Hoogmoed. 1984. Thetaxonomy and phylogenetic relationships of thehylid frog genus Stefania. University of KansasMuseum of Natural History, MiscellaneousPublications 75: 1–39.

Duellman, W.E., and R. Schulte. 1992. Descrip-tion of a new species of Bufo from northernPeru with comments on phenetic groups ofSouth American toads (Anura: Bufonidae).Copeia 1992: 162–172.

Duellman, W.E., and L. Trueb. 1986. Biology ofamphibians. New York: McGraw-Hill.

Duellman, W.E., and A. Veloso M. 1977. Phylog-eny of Pleurodema (Anura: Leptodactylidae): abiogeographic model. Occasional Papers of theMuseum of Natural History, University of Kan-sas 64: 1–46.

Dumeril, A.H.A. 1863. Catalogue methodique dela collection des batraciens du Museumd’Histoire Naturelle de Paris. Memoires de laSociete Imperiale des Sciences Naturelles deCherbourg 9: 295–321.

Dumeril, A.M.C. 1806. Zoologie analytique, oumethode naturelle de classification des ani-maux, rendue plus facile a l’dide de tableauxsynoptiques. Paris: Allais.

Dunn, E.R. 1920. Notes on two Pacific coast Am-bystomidae. Proceedings of the New EnglandZoological Club 7: 55–59.

Dunn, E.R. 1922. The sound-transmitting appa-ratus of salamanders and the phylogeny of theCaudata. American Naturalist 56: 418–487.

Dunn, E.R. 1939. Bathysiredon, a new genus ofsalamanders, from Mexico. Notulae Naturae ofthe Academy of Natural Sciences of Philadel-phia 36: 1.

Dutta, S.K., K. Vasudevan, M.S. Chaitra, K.Shanker, and R.-K. Aggarwal. 2004. Jurassicfrogs and the evolution of amphibian endemismin the western Ghats. Current Science. Banga-lore 86: 211–216.

Echeverria, D.D. 1998. Aspectos de la reproduc-cion in-vitro del desarrollo larval de Melano-phryniscus stelzneri (Weyenbergh, 1875) (An-ura, Bufonidae), con comentarios acerca del or-gano de Bidder. Alytes 15: 158–170.

Edwards, J.L. 1976. Spinal nerves and their bear-ing on salamander phylogeny. Journal of Mor-phology 148: 305–328.

Elias, P., and D.B. Wake. 1983. Nyctanolis pernix,a new genus and species of plethodontid sala-


mander from northwestern Guatemala andChiapas, Mexico. In A. Rhodin and K. Miyata(editors), Advances in herpetology and evolu-tionary biology. Essays in honor of Ernest E.Williams: 1–12. Cambridge, MA: Museum ofComparative Zoology, Harvard University.

Emerson, S.B., and D. Berrigan. 1993. System-atics of Southeast Asian ranids: multiple originsof voicelessness in the subgenus Limnonectes(Fitzinger). Herpetologica 49: 22–31.

Emerson, S.B., R.F. Inger, and D.T. Iskandar.2000a. Molecular systematics and biogeogra-phy of the fanged frogs of Southeast Asia. Mo-lecular Phylogenetics and Evolution 16: 131–142.

Emerson, S.B., C.M. Richards, R.C. Drewes, andK.M. Kjer. 2000b. On the relationships amongranoid frogs: a review of the evidence. Herpe-tologica 56: 209–230.

Estes, R. 1965. Fossil salamanders and salaman-der origins. American Zoologist 5: 319–334.

Estes, R. 1970. New fossil pelobatid frogs and areview of the genus Eopelobates. Bulletin ofthe Museum of Comparative Zoology 139:239–340.

Estes, R. 1981. Handbuch der Palaoherpetologie/Encyclopedia of paleoherpetology. Part 2.Gymnophiona, Caudata. Stuttgart: Gustav Fi-scher.

Estes, R., K. de Queiroz, and J.A. Gauthier. 1988.Phylogenetic relationships within Squamata. InR. Estes and G.K. Pregill (editors), Phyloge-netic relationships of the lizard families, essayscommemorating Charles L. Camp: 119–281.Stanford, CA: Stanford University Press.

Estes, R., and O.A. Reig. 1973. The early fossilrecord of frogs: a review of the evidence. In J.Vial (editor), Evolutionary biology of the an-urans: contemporary research on major prob-lems: 11–63. Columbia: University of MissouriPress.

Evans, B.J., R.M. Brown, J.A. McGuire, J. Su-priatna, N. Andayani, A.C. Diesmos, D.T. Is-kandar, D.J. Melnick, and D.C. Cannatella.2004. Phylogenetics of fanged frogs: testingbiogeographical hypotheses at the interface ofthe Asian and Australian fauna zones. System-atic Biology 52: 794–819.

Evans, B.J., D.J. Melnick, D.C. Cannatella, J. Su-priatna, N. Andayani, and M.I. Setiadi. 2003.Monkeys and toads define areas of endemismon Sulawesi. Evolution 57: 1436–1443.

Evans, S.E., and D. Sigogneau-Russell. 2001. Astem-group caecilian (Lissamphibia: Gymno-phiona) from the Lower Cretaceous of NorthAfrica. Palaeontology 44: 259–274

Fabrezi, M., and J.A. Langone. 2000. Los carac-teres morfologicos del controvertido Neobatra-

chia arborıcola Allophryne ruthveni Gaige,1926. Cuadernos de Herpetologıa 14: 47–59.

Faivovich, J. 2002. A cladistic analysis of Scinax(Anura: Hylidae). Cladistics 18: 367–393.

Faivovich, J., C.F.B. Haddad, P.C.A. Garcia, D.R.Frost, J.A. Campbell, and W.C. Wheeler. 2005.Systematic review of the frog family Hylidae,with special reference to Hylinae: a phyloge-netic analysis and taxonomic revision. Bulletinof the American Museum of Natural History294: 1–240.

Farris, J.S. 1973. On comparing the shapes of tax-onomic trees. Systematic Zoology 22: 50–54.

Farris, J.S., A.G. Kluge, and M.F. Mickevich.1979. Paraphyly of the Rana boylii speciesgroup. Systematic Zoology 28: 627–634.

Farris, J.S., A.G. Kluge, and M.F. Mickevich.1982a. Phylogenetic analysis, the monotheticgroup method, and myobatrachid frogs. Sys-tematic Zoology 31: 317–327.

Farris, J.S., A.G. Kluge, and M.F. Mickevich.1982b. Immunological distance and the phylo-genetic relationships of the Rana boylii speciesgroup. Systematic Zoology 31: 479–491.

Fatio, V. 1872. Faune des vertebres de la Suisse,vol. III. Histoire naturelle des reptiles et desbatraciens. Paris: J.-P. Bailliere.

Fei, L. 1999. [Atlas of amphibians of China.]Zhengzhou: Henan Press of Science and Tech-nology. [In Chinese.]

Fei, L., and C. Ye. 2000. A new hynobiid subfam-ily with a new genus and new species of Hy-nobiidae from West China. Cultum Herpetolo-gica Sinica 8: 64–70. [In Chinese with Englishabstract.]

Fei, L., and C. Ye. 2001. [The color handbook ofthe amphibians of Sichuan.] Chengdu, China:Sichuan Forestry Department, Sichuan Associ-ation of Wildlife Conservation, and ChengduInstitute of Biology. [In Chinese.]

Fei, L., C. Ye, and Y. Huang. 1991 ‘‘1990’’. [Keyto Chinese amphibians.] Chongqing, China:Publishing House for Scientific and Technolog-ical Literature. [In Chinese.]

Fei, L., C. Ye, and Y. Huang. 1997. Taxonomicstudies of the genus Liurana of China includingdescriptions of a new species (Amphibia: Ran-idae). Cultum Herpetologica Sinica 6–7: 75–80.

Fei, L., C. Ye, and J. Jiang. 2000. A new genusof the subfamily Amolopinae—Pseudoamo-lops, and its relationship to related genera. ActaZoologica Sinica 46: 19–26.

Fei, L., C. Ye, J. Jiang, X. Feng, and Y. Huang.2005. [An illustrated key to Chinese amphibi-ans.] Chongqing: Sichuan Publishing House ofScience and Technology. [In Chinese.]

Fei, L., C. Ye, and C. Li. 2001. Descriptions of


two new species of the genus Odorrana in Chi-na. Acta Zootaxonomica Sinica 26: 108–114.

Fejervary, G.J. 1917. Anoures fossiles des couch-es preglaciares de Puspokfurdo en Hongrie.Foldtani Kozlony 47: 141–172.

Fejervary, G.J. 1920. Remarques sur la positionsystematique des genres Bufavus et Ranavus.Annales Historico-Naturales Musei NationalisHungarici 18: 28–30.

Fejervary, G.J. 1921. Kritische Bemerkungen zurOsteologie, Phylogenie und Systematik der An-uren. Archiv fur Naturgeschichte. Abteilung A87: 1–30.

Fejervary, G.J. 1923. Ascaphidae, a new familyof the tailless batrachians. Annales Historico-Naturales Musei Nationalis Hungarici 20: 178–181.

Feller, A.E., and S.B. Hedges. 1998. Molecularevidence for the early history of living amphib-ians. Molecular Phylogenetics and Evolution 9:509–516.

Fink, W.L. 1990. Review of: The genus in zool-ogy: a contribution to the theory of evolution-ary systematics, by Alain Dubois. Mem. duMuseum national d’Histoire Naturelle, Serie A,Zoology, Tome 140. 1988. Quarterly Review ofBiology 65: 79–80.

Fischer von Waldheim, G. 1813. Zoognosia tabulissynopticis illustrata, in usum prælectionum Aca-demiæ Imperialis Medico-Chirurgicæ Mosquen-sis edita. 3rd ed. Vol. 1. Moscow: Nicolai Ser-geidis Vsevolozsky.

Fitzinger, L.J.F.J. 1826. Neue Classification derReptilien nach ihren naturlichen Verwandt-schaften nebst einer Verwandtschafts-Tafel undeinem Verzeichnisse der Reptilien-Sammlungdes k.k. zoologisch Museum’s zu Wien. Wien:J.G. Heubner.

Fitzinger, L.J.F.J. 1835. Entwurf einer systema-tischen Anordnung der Schildkroten nach denGrandsatzen der naturlichen Methode. Annalendes Naturhistorischen Museums in Wien 1:105–128.

Fitzinger, L.J.F.J. 1843. Systema reptilium. Fas-ciculus primus. Wien: Braumuller et Seidel.

Ford, L.S. 1990. The phylogenetic position of poi-son-dart frogs (Dendrobatidae): reassessment ofthe neobatrachian phylogeny with commentaryon complex character systems. Ph.D. disserta-tion. Department of Systematics and Ecology,University of Kansas, Lawrence.

Ford, L.S. 1993. The phylogenetic position of thedart-poison frogs (Dendrobatidae) among an-urans: an examination of the competing hy-potheses and their characters. Ethology Ecolo-gy & Evolution 5: 219–231.

Ford, L.S., and D.C. Cannatella. 1993. The major

clades of frogs. Herpetological Monographs 7:94–117.

Formas, J.R., and N.D. Espinoza. 1975. Karyo-logical relatonships of frogs of the genus Tel-matobufo (Anura: Leptodactylidae). Herpeto-logica 31: 429–432.

Formas, J.R., E. Pugin, and B. Jorquera. 1975. Laidentidad del batracio chileno Heminectes rufusPhilippi, 1902. Physis. Buenos Aires 34: 147–157.

Frost, D.R. (editor), 1985. Amphibian species ofthe world. A taxonomic and geographical ref-erence. Lawrence, KS: Association of System-atics Collections and Allen Press.

Frost, D.R. 2004. Amphibian species of the world:an online reference. Version 3.0. New York:American Museum of Natural History. [Elec-tronic database available at http://re-search.amnh.org/herpetology/amphibia/in-dex.html.]

Frost, D.R., and A.G. Kluge. 1994. A consider-ation of epistemology in systematic biology,with special reference to species. Cladistics 10:259–294.

Frost, D.R., M.T. Rodrigues, T. Grant, and T.A.Titus. 2001. Phylogenetics of the lizard genusTropidurus (Squamata: Tropiduridae: Tropidur-inae): direct optimization, descriptive efficien-cy, and sensitivity analysis of congruence be-tween molecular data and morphology. Molec-ular Phylogenetics and Evolution 21: 352–371.

Gadow, H. 1901. The Cambridge natural history,vol. 8. Amphibia and reptiles. London: Mac-millan and Co.

Gallardo, J.M. 1965. A proposito de los Lepto-dactylidae (Amphibia, Anura). Papeis Avulsosde Zoologia. Sao Paulo 17: 77–87.

Gao, K., and N.H. Shubin. 2001. Late Jurassicsalamanders from northern China. Nature. Lon-don 410: 574–577.

Gao, K., and N.H. Shubin. 2003. Earliest knowncrown group salamanders. Nature. London 422:424–429.

Gao, K., and Y. Wang. 2001. Mesozoic anuransfrom Liaoning Province, China, and phyloge-netic relationships of archaeobatrachian anuranclades. Journal of Vertebrate Paleontology 21:460–476.

Garcıa-Parıs, M., D.R. Buchholz, and G. Parra-Olea. 2003. Phylogenetic relationships of Pe-lobatoidea re-examined using mtDNA. Molec-ular Phylogenetics and Evolution 28: 12–23.

Garcıa-Parıs, M., A. Monton, and M.A. Alonso-Zarazaga. 2004a. Apendice 1. Nomenclatura:lista de sinonimos y combinaciones. In M.Garcıa-Parıs, A. Montori, and P. Herrero (edi-tors), Fauna Iberica, vol. 24. Amphibia. Lis-samphibia: 589–602. Madrid: Museo Nacional


de Ciencias Naturales and Consejo Superior deInvestigaciones Cientıfica.

Garcıa-Parıs, M., A. Montori, and P. Herrero.2004b. Fauna Iberica, vol. 24. Amphibia. Lis-samphibia. Madrid: Museo Nacional de Cien-cias Naturales and Consejo Superior de Inves-tigaciones Cientıfica.

Garcıa-Parıs, M., and D.B. Wake. 2000. Molecu-lar phylogenetic analysis of relationships of thetropical salamander genera Oedipina and No-totriton, with descriptions of a new genus andthree new species. Copeia 2000: 42–70.

Gardiner, B.G. 1982. Tetrapod classification. Zoo-logical Journal of the Linnean Society. London74: 207–232.

Gardner, J.D. 2001. Monophyly and affinities ofalbanerpetontid amphibians (Temnospondyli;Lissamphibia). Zoological Journal of the Lin-nean Society. London 131: 309–352.

Gardner, J.D. 2002. Monophyly and intra-genericrelationships of Albanerpeton (Lissamphibia;Albanerpetontidae). Journal of Vertebrate Pa-leontology 22: 12–22.

Gauthier, J.A., D.C. Cannatella, K. de Queiroz,A.G. Kluge, and T. Rowe. 1989. Tetrapod phy-logeny. In B. Fernholm, K. Bremer, and H.Jornvall (editors), The hierarchy of life: 337–353. New York: Elsevier.

Gauthier, J.A., A.G. Kluge, and T. Rowe. 1988a.Amniote phylogeny and the importance of fos-sils. Cladistics 4: 105–209.

Gauthier, J.A., A.G. Kluge, and T. Rowe. 1988b.The early evolution of the Amniota. In M.J.Benton (editor), The phylogeny and classifica-tion of the tetrapods, vol. 1. Amphibians, rep-tiles, birds: 103–155. Systematics AssociationSpecial vol. 23. New York: Academic Press.

Ghiselin, M.T. 1966. On psychologism in the log-ic of taxonomic controversies. Systematic Zo-ology 15: 207–215.

Giaretta, A.A., and R.J. Sawaya. 1998. Secondspecies of Psyllophryne (Anura: Brachycephal-idae). Copeia 1998: 985–987.

Glaw, F., and M. Vences. 1994. A fieldguide tothe amphibians and reptiles of Madagascar, 2nded., including mammals and freshwater fish.Koln: Moos Druck.

Glaw, F., and M. Vences. 2002. A new siblingspecies of the anuran subgenus Blommersiafrom Madagascar (Amphibia: Mantellidae:Mantidactylus) and its molecular phylogeneticrelationships. Herpetological Journal. London12: 11–20.

Goebel, A.M., J.M. Donnelly, and M.E. Atz.1999. PCR primers and amplification methodsfor 12S ribosomal DNA, the control region, cy-tochrome oxidase I, and cytochrome b in bu-fonids and other frogs, and an overview of PCR

primers which have amplified DNA in amphib-ians successfully. Molecular Phylogenetics andEvolution 11: 163–199.

Goin, C.J., O.B. Goin, and G.R. Zug. 1978. Intro-duction to herpetology, 3rd ed. San Francisco:W.H. Freeman and Co.

Goldfuss, G.A. 1820. Handbuch der Zoologie.Zweite Abtheilung. Nurnburg: Johann Leon-hard Schrag.

Goloboff, P.A. 1993–1999. NONA. Version 2.9.Tucuman, Argentina: Computer software dis-tributed by the author.

Goloboff, P.A. 1999. Analyzing large data sets inreasonable times: solutions for composite opti-ma. Cladistics 15: 415–428.

Goloboff, P.A., and J.S. Farris. 2001. Methods ofquick consensus estimation. Cladistics 17: S26–S34.

Goloboff, P.A., J.S. Farris, and K.C. Nixon. 2003.T.N.T.: Tree analysis using new technology,version 1.0. Program and documentation avail-able from the authors and at www.zmuc.dk/public/phylogeny.

Good, D.A., and D.B. Wake. 1992. Geographicvariation and speciation in the torrent salaman-ders of the genus Rhyacotriton (Caudata: Rhy-acotritonidae). University of California Publi-cations in Zoology 126: 1–91.

Gower, D.J., A. Kupfer, O.V. Oommen, W. Him-stedt, R.A. Nussbaum, S.P. Loader, B. Pres-swell, H. Muller, S.B. Krishna, R. Boistel, andM. Wilkinson. 2002. A molecular phylogeny ofichthyophiid caecilians (Amphibia: Gymno-phiona: Ichthyophiidae): out of India or out ofSouth East Asia? Proceedings of the Royal So-ciety of London. Series B, Biological Sciences269: 1563–1569.

Gower, D.J., and M. Wilkinson. 2002. Phallusmorphology in caecilians (Amphibia, Gymno-phiona) and its systematic utility. Bulletin ofthe Natural History Museum. London. ZoologySeries 68: 143–154.

Grandison, A.G.C. 1981. Morphology and phy-logenetic position of the West African Didyn-amipus sjoestedti Andersson, 1903 (Anura, Bu-fonidae). Monitore Zoologico Italiano. NuovaSerie, Supplemento 15: 187–215.

Grant, T. 1998. Una nueva especie de Colostethusdel grupo edwardsi de Colombia. Revista de laAcademia Colombiana de Ciencias Exactas,Fisicas y Naturales 22: 423–428.

Grant, T. 2002. Testing methods: the evaluation ofdiscovery operations in evolutionary biology.Cladistics 18: 94–111.

Grant, T. 2004. On the identities of Colostethusinguinalis (Cope, 1868) and C. panamensis(Dunn, 1933), with comments on C. latinasus


(Cope, 1863) (Anura: Dendrobatidae). Ameri-can Museum Novitates 3444: 1–24.

Grant, T., and F. Castro-Herrera. 1998. The cloudforest Colostethus (Anura, Dendrobatidae) of aregion of the Cordillera Occidental of Colom-bia. Journal of Herpetology 32: 378–392.

Grant, T., E.C. Humphrey, and C.W. Myers. 1997.The median lingual process of frogs: a bizarrecharacter of Old World ranoids discovered inSouth American dendrobatids. American Mu-seum Novitates 3212: 1–40.

Grant, T., and A.G. Kluge. 2004. Transformationseries as an ideographic character concept. Cla-distics 20: 23–31.

Grant, T., and L.O. Rodriguez. 2001. Two newspecies of frogs of the genus Colostethus (Den-drobatidae) from Peru and a redescription of C.trilineatus (Boulenger, 1883). American Mu-seum Novitates 3355: 1–24.

Gray, J.E. 1825. A synopsis of the genera of rep-tiles and Amphibia, with a description of somenew species. Annals of Philosophy. Series 2, 10193–217.

Gray, J.E. 1850a. Catalogue of the specimens ofAmphibia in the collection of the British Mu-seum. Part. II. Batrachia Gradientia, etc. Lon-don: Spottiswoodes and Shaw.

Gray, J.E. 1850b. Description of a new genus ofbatrachians from Swan River. By Dr. H. Schle-gel, Curator of the Royal Zoological Museum,Leyden. (Extracted from a letter to J.E. Gray,Esq.). Proceedings of the Zoological Society ofLondon 1850: 9–10.

Graybeal, A. 1995. Phylogenetic relationships andevolution of bufonid frogs based on molecularand morphological characters. Ph.D. disserta-tion. Department of Integrative Biology, Uni-versity of California, Berkeley.

Graybeal, A. 1997. Phylogenetic relationships ofbufonid frogs and tests of alternate macroevo-lutionary hypotheses characterizing their radi-ation. Zoological Journal of the Linnean Soci-ety. London 119: 297–338.

Graybeal, A., and D.C. Cannatella. 1995. A newtaxon of Bufonidae from Peru, with descrip-tions of two new species and a review of thephylogenetic status of supraspecific bufonidtaxa. Herpetologica 51: 105–131.

Green, D.M. 2005. The ecology of extinction:population fluctuation and decline in amphibi-ans. Biological Conservation 111: 331–343.

Green, D.M., and D.C. Cannatella. 1993. Phylo-genetic significance of the amphicoelous frogs,Ascaphidae and Leiopelmatidae. EthologyEcology & Evolution 5: 233–245.

Green, D.M., R.A. Nussbaum, and D. Yang. 1988.Genetic divergence and heterozygosity among

frogs of the family Sooglossidae. Herpetologica44: 113–119.

Green, D.M., T.F. Sharbel, R.A. Hitchmough, andC.H. Daugherty. 1989. Genetic variation in thegenus Leiopelma and relationships to otherprimitive frogs. Zeitschrift fur ZoologischeSystematik und Evolutionsforschung 27: 65–79.

Griffiths, I. 1954. On the ‘‘otic element’’ in Am-phibia Salientia. Proceedings of the ZoologicalSociety of London 124: 3–50.

Griffiths, I. 1959a. The phylogenetic status of theSooglossinae. Annals and Magazine of NaturalHistory, Series 13, 2: 626–640.

Griffiths, I. 1959b. The phylogeny of Sminthilluslimbatus and the status of the Brachycephalidae(Amphibia Salientia). Proceedings of the Zoo-logical Society of London 132: 457–487.

Griffiths, I. 1963. The phylogeny of the Salientia.Biological Reviews of the Cambridge Philo-sophical Society 38: 241–292.

Grosjean, S., M. Perez, and A. Ohler. 2003. Mor-phology and buccopharyngeal anatomy of thetadpole of Rana (Nasirana) alticola (Anura:Ranidae). Raffles Bulletin of Zoology 51: 101–107.

Grosjean, S., M. Vences, and A. Dubois. 2004.Evolutionary significance of oral morphologyin the carnivorous tadpoles of tiger frogs, genusHoplobatrachus (Ranidae). Biological Journalof the Linnean Society 81: 171–181.

Gunther, A. 1858a. Neue Batrachier in der Samm-lung des britischen Museums. Archiv fur Na-turgeschichte 24: 319–328.

Gunther, A. 1858b. On the systematic arrange-ment of the tailless batrachians and the struc-ture of Rhinophrynus dorsalis. Proceedings ofthe Zoological Society of London 1858: 339–352.

Gunther, A. 1859 ‘‘1858’’. Catalogue of the Ba-trachia Salientia in the collection of the BritishMuseum. London: Taylor and Francis.

Gunther, A. 1870. Reptilia (1869). Zoological Re-cord 6: 105–122.

Haas, A. 1995. Cranial features of dendrobatidlarvae (Amphibia: Anura: Dendrobatidae).Journal of Morphology 224: 241–264.

Haas, A. 2003. Phylogeny of frogs as inferredfrom primarily larval characters (Amphibia:Anura). Cladistics 19: 23–90.

Haas, A., and S.J. Richards. 1998. Correlations ofcranial morphology, ecology, and evolution inAustralian suctorial tadpoles of the genera Li-toria and Nyctimystes (Amphibia: Anura: Hy-lidae: Pelodryadinae. Journal of Morphology238: 109–141.

Haddad, C.F.B., and C.P.A. Prado. 2005. Repro-ductive modes in frogs and their unexpected di-


versity in the Atlantic Forest of Brazil. Bio-Science 55: 207–217.

Haeckel, E.H.P.A. 1866. Generelle Morphologieder Organismen, vol. 2. Berlin: Georg Reimer.

Hall, J.A., and J.H. Larsen, Jr. 1998. Postembry-onic ontogeny of the spadefoot toad, Scaphio-pus intermontanus (Anura: Pelobatidae): skel-etal morphology. Journal of Morphology 238:179–244.

Halliday, T. 2005. Diverse factors influencing am-phibian population declines. In M.J. Lannoo(editor), Amphibian declines: the conservationstatus of United States species: 3–9. Berkeley:University of California Press.

Hallowell, E. 1856. Description of several speciesof Urodela, with remarks on the geographicaldistribution of the Caducibranchiata division ofthese animals and their classification. Proceed-ings of the Academy of Natural Sciences ofPhiladelphia 8: 6–11.

Hanken, J., and D.B. Wake. 1982. Genetic differ-entiation among plethodontid salamanders (ge-nus Bolitoglossa) in Central and South Ameri-ca: implications for the South American inva-sion. Herpetologica 38: 272–287.

Harris, D.J. 2001. Reevaluation of 16S ribosomalRNA variation in Bufo (Anura: Amphibia). Mo-lecular Phylogenetics and Evolution 19: 326–329.

Hass, C.A., J.F. Dunski, L.R. Maxson, and M.S.Hoogmoed. 1995. Divergent lineages withinthe Bufo margaritifera complex (Amphibia:Anura; Bufonidae) revealed by albumin im-munology. Biotropica 27: 238–249.

Hay, J.M., I. Ruvinsky, S.B. Hedges, and L.R.Maxson. 1995. Phylogenetic relationships ofamphibian families inferred from DNA se-quences of mitochondrial 12S and 16S ribo-somal RNA genes. Molecular Biology andEvolution 12: 928–937.

Hayes, M.P., and P.H. Starrett. 1981 ‘‘1980’’.Notes on a collection of centrolenid frogs fromthe Colombia Choco. Bulletin of the SouthernCalifornia Academy of Science 79: 89–96.

Hedges, S.B. 1989. Evolution and biogeographyof West Indian frogs of the genus Eleuthero-dactylus: slow-evolving loci and the majorgroups. In C.A. Woods (editor), Biogeographyof the West Indies: past, present, and future:305–370. Gainesville, FL: Sandhill CranePress.

Hedges, S.B. 1994. Molecular evidence for theorigin of birds. Proceedings of the NationalAcademy of Science of the United States ofAmerica 91: 2621–2624.

Hedges, S.B., and L.R. Maxson. 1993. A molec-ular perspective on lissamphibian phylogeny.Herpetological Monographs 7: 27–42.

Hedges, S.B., R.A. Nussbaum, and L.R. Maxson.1993. Caecilian phylogeny and biogeographyinferred from mitochondrial DNA sequences ofthe 12S rRNA and 16S rRNA genes (Amphib-ia: Gymnophiona). Herpetological Monographs7: 64–76.

Hedges, S.B., and L.L. Poling. 1999. A molecularphylogeny of reptiles. Science 283: 998–1001.

Hennig, W. 1966. Phylogenetic systematics. Chi-cago: University of Illinois Press.

Henrici, A.C. 1991. Chelomophrynus bayi (Am-phibia, Anura, Rhinophrynidae), a new genusand species from the Middle Eocene of Wyo-ming: ontogeny and relationships. Annals ofthe Carnegie Museum 60: 97–144.

Hertwig, S., R.O. de Sa, and A. Haas. 2004. Phy-logenetic signal and the utility of 12S and 16SmtDNA in frog phylogeny. Journal of Zoolog-ical Systematics and Evolutionary Research 42:2–18.

Hewitt, J. 1919. Anhydrophryne rattrayi, a re-markable new frog from Cape Colony. Recordof the Albany Museum. Grahamstown 3: 182–189.

Heyer, W.R. 1970. Studies on the frogs of the ge-nus Leptodactylus (Amphibia: Leptodactyli-dae). VI. Biosystematics of the melanonotusgroup. Natural History Museum of Los AngelesCounty Contributions in Science 191: 1–48.

Heyer, W.R. 1975. A preliminary analysis of theintergeneric relationships of the frog familyLeptodactylidae. Smithsonian Contributions inZoology 199: 1–55.

Heyer, W.R. 1998. The relationships of Leptodac-tylus diedrus (Anura, Leptodactylidae). Alytes16: 1–24.

Heyer, W.R. 1999. A new genus and species offrog from Bahia, Brazil (Amphibia: Anura:Leptodactylidae) with comments on the zoo-geography of the Brazilian campos rupestres.Proceedings of the Biological Society of Wash-ington 112: 19–30.

Heyer, W.R. 2003. Viewpoint: ultraviolet-B andAmphibia. BioScience 53: 540–541.

Heyer, W.R., and R.I. Crombie. 1979. Natural his-tory notes on Craspedoglossa stejnegeri andThoropa petropolitana (Amphibia: Salientia,Leptdactylidae). Journal of the WashingtonAcademy of Sciences 69: 17–20.

Heyer, W.R., and D.S.S. Liem. 1976. Analysis ofthe intergeneric relationships of the Australianfrog family Myobatrachidae. Smithsonian Con-tributions in Zoology 233: 1–29.

Highton, R. 1997. Geographic protein variationand speciation in the Plethodon dorsalis com-plex. Herpetologica 53: 345–356.

Highton, R. 1998. Is Ensatina eschscholtzii a ringspecies? Herpetologica 54: 254–278.


Highton, R. 1999. Geographic protein variationand speciation in the salamanders of the Pleth-odon cinereus group with the description oftwo new species. Herpetologica 55: 43–90.

Highton, R., and R.B. Peabody. 2000. Geographicprotein variation and speciation in salamandersof the Plethodon jordani and Plethodon gluti-nosus complexes in the southern AppalachianMountains with the description of four newspecies. In R.C. Bruce, R.G. Jaeger, and L.D.Houck (editors), The biology of plethodontidsalamanders: 31–93. New York: Kluwer Aca-demic/Plenum Publishers.

Hillis, D.M., and S.K. Davis. 1986. Evolution ofribosomal DNA: fifty million years of recordedhistory in the frog genus Rana. Evolution 40:1275–1288.

Hillis, D.M., and M.T. Dixon. 1991. RibosomalDNA: molecular evolution and phylogenetic in-ference. Quarterly Review of Biology 66: 411–453.

Hillis, D.M., and T.P. Wilcox. 2005. Phylogeny ofthe New World true frogs (Rana). MolecularPhylogenetics and Evolution 34: 299–314.

Hiragond, N.C., B.A. Shanbhag, and S.K. Saida-pur. 2001. Description of the tadpole of astream breeding frog, Rana curtipes. Journal ofHerpetology 35 166–168.

Hoffman, A.C. 1932. Researches relating to thevalidity of the South African Polypedatidae(Rhacophoridae) as an autonomous family ofthe Anura. South African Journal of Science29: 562–583.

Hoffman, A.C. 1935. Die sistematiese posiesievan Heleophryne. Soologiese Navorsing vandie Nasionale Museum. Bloemfontein 1: 1–2.

Hoffmann, C.K. 1878. Die Klassen und Ordnun-gen des Thier-Reichs wissenschaftlich darges-telldt in Wort und Bild, vol. 6 (part 2). Klassenund Ordnungen der Amphibien wissenschaf-tlich dargestelldt in Wort un Bild. Leipzig andHeidelberg: C.F. Winter.

Hogg, J. 1838. On the classification of the Am-phibia. Annals of Natural History 1: 152.

Hogg, J. 1839a. On the classification of the Am-phibia. Magazine of Natural History, New Se-ries 3: 265–274.

Hogg, J. 1839b. On the classification of the Am-phibia (continued from page 274). Magazine ofNatural History, New Series 3: 367–378.

Hoogmoed, M.S. 1989a. South American bufon-ids (Amphibia: Anura: Bufonidae), an enigmafor taxonomists. Treballs d’Ictiologia i Herpe-tologia 2: 167–180.

Hoogmoed, M.S. 1989b. On the identity of sometoads of the genus Bufo from Ecuador, with ad-ditional remarks on Andinophryne colomaiHoogmoed, 1985 (Amphibia: Anura: Bufoni-

dae). Zoologische Verhandelingen. Leiden 250:1–32.

Hoogmoed, M.S., and J. Lescure. 1984. A newgenus and two new species of minute leptodac-tylid frogs from northern South America, withcomments upon Phyzelaphryne (Amphibia: An-ura: Leptodactylidae). Zoologische Mededelin-gen. Leiden 58: 85–115.

Houlahan, J.E., C.S. Findlay, B.R. Schmidt, A.H.Meyer, and S.L. Kuzmin. 2000. Quantitativeevidence for global amphibian population de-clines. Nature. London 404: 752–755.

Hu, S., E. Zhao, and C.-C. Liu. 1966. A herpe-tological survey of the Tsinling and Ta-Pa Shanregion. Acta Zoologica Sinica 18: 57–89. [InChinese with English abstract.]

Hu, S., E. Zhao, and C.-C. Liu. 1973. A surveyof amphibians and reptiles in Kweichow prov-ince, including a herpetofaunal analysis. ActaZoologica Sinica 19: 149–181.

Hull, D.L. 1988. Science as a process: an evolu-tionary account of the social and conceptual de-velopment of science. Chicago: University ofChicago Press.

Hutchinson, M.N., and L.R. Maxson. 1987. Phy-logenetic relationships among Australian treefrogs (Anura: Hylidae: Pelodryadinae): an im-munological approach. Australian Journal ofZoology 35: 61–74.

Huxley, T.H. 1863. Description of Anthracosau-rus russelli, a new labyrinthodont from theLanarkshire coal field. Quarterly Journal of theGeological Society of London 19: 56–68.

Inger, R.F. 1954. Systematics and zoogeographyof Philippine Amphibia. Fieldiana. Zoology 33:183–531.

Inger, R.F. 1966. The systematics and zoogeog-raphy of the Amphibia of Borneo. Fieldiana.Zoology 52: 1–402.

Inger, R.F. 1967. The development of a phylogenyof frogs. Evolution 21: 369–384.

Inger, R.F. 1972. Bufo of Eurasia. In W.F. Blair(editor), Evolution in the genus Bufo: 102–118.Austin: University of Texas Press.

Inger, R.F. 1996. Commentary on a proposed clas-sification of the family Ranidae. Herpetologica52: 241–246.

Inger, R.F., H.B. Shaffer, M. Koshy, and R. Bakde.1984. A report on a collection of amphibiansand reptiles from the Ponmudi, Kerala, SouthIndia. Journal of the Bombay Natural HistorySociety 81: 406–427.

International Commission of Zoological Nomen-clature. 1999. International code of zoologicalnomenclature, 4th ed. London: InternationalTrust for Zoological Nomenclature.

Iordansky, N.N. 1996. Evolution of the muscula-ture of the jaw apparatus in the Amphibia. Ad-


vances in Amphibian Research in the FormerSoviet Union 1: 3–26.

Iwabe, N., Y. Hara, Y. Kumazawa, K. Shibamoto,Y. Saito, T. Miyata, and K. Kazutaka. 2005. Sis-ter-group relationship of turtles to the bird-croc-odilian clade revealed by nuclear DNA-codedproteins. Molecular Biology and Evolution 22:810–813.

Izecksohn, E. 1971. Novo genero e nova especiede Brachycephalidae do Estado do Rio de Ja-neiro, Brasil (Amphibia, Anura). Boletim doMuseu Nacional, Rio de Janeiro. Nova Serie,Zoologia 280: 1–12.

Izecksohn, E. 1988. Algumas consideracoes sobreo genero Euparkerella, coma descricao de tresnovas especies (Amphibia, Anura, Leptodactyl-idae). Revista Brasileira de Biologia 48: 59–74.

Izecksohn, E., J.J. Jim, S.T. de Albuquerque, andW.F. de Mendonca. 1971. Observacoes sobre odesenvolvimento e os habitos de Myersiellasubnigra (Miranda-Ribeiro). Arquivos do Mu-seu Nacional. Rio de Janeiro 43: 69–73.

Jackman, T.R., G. Applebaum, and D.B. Wake.1997. Phylogenetic relationships of bolitoglos-sine salamanders: a demonstration of the effectsof combining morphological and moleculardata sets. Molecular Biology and Evolution 14:883–891.

Janies, D., and W.C. Wheeler. 2001. Efficiency ofparallel direct optimization. Cladistics 17: S71–S82.

Janke, A., D. Erpenbeck, M. Nilsson, and U. Ar-nason. 2001. The mitochondrial genomes of theiguana (Iguana iguana) and the caiman (Cai-man crocodylus): implications for amniote phy-logeny. Proceedings of the Royal Society ofLondon. Series B, Biological Sciences 268:623–631.

Jenkins, F.A., and D.M. Walsh. 1993. An earlyJurassic caecilian with limbs. Nature. London365: 246–250.

Jiang, J., A. Dubois, A. Ohler, A. Tillier, X. Chen,F. Xie, and M. Stock. 2005. Phylogenetic rela-tionships of the tribe Paini (Amphibia, Anura,Ranidae) based on partial sequences of mito-chondrial 12S and 16S rRNA genes. ZoologicalScience. Tokyo 22: 353–362.

Jiang, J., L. Fei, C. Ye, X. Zeng, M. Zhen, F. Xie,and Y. Chen. 1997. Studies on the taxonomicsof species of Pseudorana and discussions of thephylogenetical relationships with its relativegenera. Cultum Herpetologica Sinica 6–7: 67–74.

Jiang, J., and K. Zhou. 2001. Evolutionary rela-tionships among Chinese ranid frogs inferredfrom mitochondrial DNA sequences of 12SrRNA gene. Acta Zoologica Sinica 47: 38–44.

Jiang, J., and K. Zhou. 2005. Phylogenetic rela-

tionships among Chinese ranids inferred fromsequence data set of 12S and 16S rDNA. Her-petological Journal. London 15: 1–8.

Jimenez de la Espada, M. 1871 ‘‘1870’’. Faunaneotropicalis species quaedam nondum cogni-tae. Jornal de Sciencias, Mathematicas, Physi-cas e Naturaes. Lisboa 3: 57–65.

Jockusch, E.L., and D.B. Wake. 2002. Fallingapart and merging: diversification of slendersalamanders (Plethodontidae: Batrachoseps) inthe American West. Biological Journal of theLinnean Society 76: 361–391.

Jockusch, E.L., K.P. Yanev, and D.B. Wake. 2001.Molecular phylogenetic analysis of slender sal-amanders, genus Batrachoseps (Amphibia:Plethodontidae), from central coastal Californiawith descriptions of four new species. Herpe-tological Monographs 15: 54–99.

Jungfer, K.-H., H. Birkhahn, V. Kulpmann, and K.Wassmann. 1996. Haltung und Fortpflanzungvon Dendrobates fulguritus Silverstone, 1975,mit Anmerkungen zur Gattung Minyobates My-ers, 1987. Herpetofauna. Weinstadt 15: 19–27.

Jungfer, K.-H., S. Lotters, and D. Jorgens. 2000.Der kleinste Pfeilgiftfrosche—eine neue Den-drobates-Art aus West-Panama. Herpetofauna.Weinstadt 22: 11–18.

Jurgens, J.D. 1971. The morphology of the nasalregion of the Amphibia and its bearing on thephylogeny of the group. Annals of the Univer-sity of Stellenbosch 46: 1–146.

Kaiser, H., L.A. Coloma, and H.M. Gray. 1994.A new species of Colostethus (Anura: Dendro-batidae) from Martinique, French Antilles. Her-petologica 50: 23–32.

Kaplan, M. 1994. Analysis of some long-standingcontroversies concerning the pectoral girdle ofAtelopus (Bufonidae) using ontogenetic studies.Journal of Herpetology 28: 128–131.

Kaplan, M. 1995. On the presence of overlap dur-ing the development of the pectoral girdle ofColostethus subpunctatus (Amphibia: Anura)and its relevance in the classification of Den-drobatidae. Journal of Herpetology 29: 300–304.

Kaplan, M. 1997. A new species of Colostethusfrom the Sierra Nevada de Santa Marta (Co-lombia) with comments on intergeneric rela-tionships within the Dendrobatidae. Journal ofHerpetology 31: 369–375.

Kaplan, M. 2000. The pectoral girdles of Ranarugulosa (Ranidae) and Nesomantis thomasseti(Sooglossidae). Herpetologica 56: 188–195.

Kaplan, M. 2001. On the relevance of the char-acter ‘‘absence of epicoracoid horns’’ in thesystematics of anurans. Alytes 19: 196–204.

Kaplan, M. 2002. Histology of the anteroventralpart of the breast-shoulder apparatus of Bra-


chycephalus ephippium (Brachycephalidae)with comments on the validity of the genusPsyllophryne (Brachycephalidae). Amphibia-Reptilia 23: 225–227.

Kaplan, M. 2004. Evaluation and redefinition ofthe states of anuran pectoral girdle architecture.Herpetologica 60: 84–97.

Keller, R.A., R.N. Boyd, and Q.D. Wheeler. 2003.The illogical basis of Phylogenetic Nomencla-ture. Botanical Review 69: 93–110.

King, M., M.J. Tyler, M.M. Davies, and D. King.1979. Karyotypic studies on Cyclorana and as-sociated genera of Australian frogs. AustralianJournal of Zoology 27: 699–708.

Kirsch, J.A., A.W. Dickerman, O.A. Reig, andM.S. Springer. 1991. DNA hybridization evi-dence for the Australasian affinity of the Amer-ican marsupial Dromiciops australis. Proceed-ings of the National Academy of Sciences ofthe United States of America 88: 10465–10469.

Kirtisinghe, P. 1958. Some hitherto undescribedanuran tadpoles. Ceylon Journal of Science 1:171–176.

Kiyasetuo and M.K. Khare. 1986. A new genusof frog (Anura: Ranidae) from Nagaland at thenortheastern hills of India. Asian Journal of Ex-ploration and Science 1: 12.

Kjer, K.M. 1995. Use of rRNA secondary struc-ture in phylogenetic studies to identify homol-ogous positions: an example of alignment anddata presentation from frogs. Molecular Phy-logenetics and Evolution 4: 314–330.

Klein, S.L., R.L. Strausberg, L. Wagner, J. Pon-tius, S.W. Clifton, and P. Richardson. 2002. Ge-netic and genomic tools for Xenopus research:the NIH Xenopus initiative. Developmental Dy-namics 225: 384–391.

Klemens, M.W. 1998. The male nuptial charac-teristics of Arthroleptides martiensseni Nieden,an endemic torrent frog from Tanzania’s East-ern Arc Mountains. Herpetological Journal.London 8: 35–40.

Kluge, A.G. 1966. A new pelobatine frog fromthe lower Miocene of South Dakota with a dis-cussion of the evolution of the Scaphiopus-Spea complex. Natural History Museum of LosAngeles County Contributions in Science 113:1–26.

Kluge, A.G. 2005. Taxonomy in theory and prac-tice, with arguments for a new phylogeneticsystem of taxonomy. In M.A. Donnelly, B.I.Crother, C. Guyer, M.H. Wake, and M.E. White(editors), Ecology and evolution in the tropics:a herpetological perspective: 7–47. Chicago:University of Chicago Press.

Kluge, A.G., and J.S. Farris. 1969. Quantitativephyletics and the evolution of anurans. System-atic Zoology 18: 1–32.

Knauer, F.K. 1883. Naturgeschichte der Lurche.(Amphibiologie.) Eine umfassendere Darle-gung unserer Kenntnisse von dem anatomisch-en Bau, der Entwicklung und systematischenEintheilung der Amphibien, & c. Zweite Aus-gabe. Wien and Leipzig: A. Pilchler’s Witwe &Sohn.

Kohler, J. 2000. New species of Eleutherodactylus(Anura: Leptodactylidae) from cloud forest ofBolivia. Copeia 2000: 516–520.

Kojima, J.-I. 2003. Apomorphy-based definitionalso pinpoints a node, and PhyloCode namesprevent effective communication. BotanicalReview 69: 44–58.

Kokubum, M.N., de Carvalho, and A.A. Giaretta.2005. Reproductive ecology and behaviour ofa species of Adenomera (Anura, Leptodactyli-nae) with endotrophic tadpoles: systematic im-plications. Journal of Natural History. London39: 1745–1758.

Kosuch, J., M. Vences, A. Dubois, A. Ohler, andW. Bohme. 2001. Out of Asia: mitochondrialDNA evidence for an oriental origin of tigerfrogs, genus Hoplobatrachus. Molecular Phy-logenetics and Evolution 21: 398–407.

Kress, W.J., and P. DePriest. 2001. What’s in aPhylocode name? Science 292: 6.

Kuramoto, M. 1985. A new frog (genus Rana)from the Yaeyama Group of the Ryukyu Is-lands. Herpetologica 41: 150–158.

Kuramoto, M. 1990. A list of chromosome num-bers of anuran amphibians. Bulletin of FukuokaUniversity of Education 39: 83–127.

Kuramoto, M., and C.-S. Wang. 1987. A new rha-cophorid treefrog from Taiwan, with compari-sons to Chirixalus eiffingeri (Anura, Rhaco-phoridae). Copeia 1987: 931–942.

Kuramoto, M., C.-S. Wang, and H.-T. Yu. 1984.Breeding, larval morphology and experimentalhybridization of Taiwanese brown frogs, Ranalongicrus and R. sauteri. Journal of Herpetol-ogy 18: 387–395.

Kwon, A.S., and Y.H. Lee. 1995. Comparativespermatology of anurans with special referenc-es to phylogeny. In B.G.M. Jamieson, J. Ausio,and J.-L. Justine (editors), Advances in sper-matozoal phylogeny and taxonomy. Memoiresdu Museum National d’Histoire Naturelle. Par-is. Serie A, Zoologie 166: 321–332.

La Marca, E., M. Vences, and S. Lotters. 2002.Rediscovery and mitochondrial relationships ofthe dendrobatid frog Colostethus humilis sug-gest parallel colonization of the VenezuelanAndes by poison frogs. Studies on NeotropicalFauna and Environment 37: 233–240.

Lamotte, M. 1961. Contribution a l’etude des ba-traciens de l’ouest africain XII. Les formes lar-vaires de Cardioglossa leucomystax Blgr. Bul-


letin de l’Institut Fondamental d’Afrique Noire23: 211–216.

Lamotte, M., and J. Lescure. 1989. Les tetardsrheophiles et hygropetriques de l’Ancien et duNoveau Monde. Annales des Sciences Naturel-les. Zoologie. Paris. Serie 13, 10: 111–122.

Lamotte, M., J.-L. Perret, and S. Dzieduszycka.1959. Contribution a l’etude des batraciens del’ouest africain. IX. Les formes larvaires de Pe-tropedetes palmipes, Conraua goliath et Acan-thixalus spinosus. Bulletin de l’Institut Fran-caise d’Afrique Noire. Serie A, Sciences Na-turelles 21: 762–776.

Lamotte, M., and F. Xavier. 1972. Les amphibiensanoures a developpement direct d’Afrique. Ob-servations sur la biologie de Nectophrynoidestornieri (Roux). Bulletin de la Societe Zoolo-gique de France 97: 413–428.

Lamotte, M., and M. Zuber-Vogeli. 1954. Contri-bution a l’etude des batraciens de l’ouest afri-cain. III. Les formes larvaires de Astylosternusdiadematus et Petropedetes natator. Bulletin del’Institut Francaise d’Afrique Noire. Serie A,Sciences Naturelles 16: 1222–1233.

Langone, J.A. 1994. Ranas y sapos del Uruguay(reconocimientos y aspectos biologicos). Mu-seo Damaso Antonio Larranaga, Serie de Di-vulgacion 5: 1–123.

Largen, M.J. 1991. A new genus and species ofpetropedetine frog (Amphibia, Anura, Ranidae)from high altitude in the mountains of Ethiopia.Tropical Zoology. Firenze 4: 139–152.

Largen, M.J., and R.C. Drewes. 1989. A new ge-nus and species of brevicipitine frog (Amphib-ia, Anura, Microhylidae) from high altitude inthe mountains of Ethiopia. Tropical Zoology.Firenze 2: 13–30.

Larson, A. 1991. A molecular perspective on theevolutionary relationship of the salamanderfamilies. In M.K. Hecht, B. Wallace, and R.J.MacIntyre (editors), Evolutionary biology, vol.25: 211–277. New York: Plenum PublishingCorporation.

Larson, A., and W. Dimmick. 1993. Phylogeneticrelationships of the salamander families: ananalysis of congruence among morphologicaland molecular characters. HerpetologicalMonographs 7: 77–93.

Larson, A., D.B. Wake, L.R. Maxson, and R.Highton. 1981. A molecular phylogenetic per-spective on the origins of morphological nov-elties in the salamanders of the tribe Pletho-dontini (Amphibia, Plethodontidae). Evolution35: 405–422.

Larson, A., D.W. Weisrock, and K.H. Kozak.2003. Phylogenetic systematics of salamanders(Amphibia: Urodela), a review. In D.M. Sever(editor), Reproductive biology and phylogeny

of Urodela (Amphibia): 31–108. Enfield, NH:Science Publishers.

Lataste, F. 1879. Etude sur le Discoglossus pictusOtth. Actes de la Societe Linneenne de Bor-deaux, Serie 4, 3: 275–342.

Lathrop, A. 1997. Taxonomic review of the me-gophryid frogs (Anura: Pelobatoidea). AsiaticHerpetological Research 7: 68–79.

Lathrop, A. 2003. Asian toadfrogs (Megophryi-dae). In W.E. Duellman (editor), Grzimek’s an-imal life encyclopedia, 2nd ed. Vol. 6. Am-phibians: 109–117. Detroit: Gale Group.

Latreille, P.A. 1800. Histoire naturelle des sala-mandres de France, precedee d’un tableaumethodique des autres reptiles indigenes. Paris:Imprimerie de Crapelet.

Latreille, P.A. 1825. Familles naturelles du regneanimal, exposees succinctement et dans un or-dre analytique, avec l’indication de leursgenres. Paris: J.B. Bailliere.

Laurent, R.F. 1941 ‘‘1940’’. Contribution al’osteologie et a la systematique des ranides af-ricains. Premiere note. Revue de Zoologie et deBotanique Africaines 34: 74–96.

Laurent, R.F. 1941. Contribution a l’osteologie eta la systematique des ranides africains. Deux-ieme note. Revue de Zoologie et de BotaniqueAfricaines 34: 192–234.

Laurent, R.F. 1942. Note sur les procoeliens fir-misternes (Batrachia Anura). Bulletin du MuseeRoyal d’Histoire Naturelle de Belgique 18: 1–20.

Laurent, R.F. 1943. Contribution a l’osteologie eta la systematique des rhacophorides non afri-caines. Bulletin du Musee Royal d’Histoire Na-turelle de Belgique 19: 1–16.

Laurent, R.F. 1946. Mises au point dans la tax-onomie des ranides. Revue de Zoologie et deBotanique Africaines 39: 336–338.

Laurent, R.F. 1951. Sur la necessite de supprimerla famille des Rhacophoridae mais de creer cel-le des Hyperoliidae. Revue de Zoologie et deBotanique Africaines 45: 116–122.

Laurent, R.F. 1954. Remarques sur le genreSchoutedenella. Annales du Musee Royal duCongo Belge. Nouvelle Serie in Quarto. Sci-ences Zoologiques. Tervuren 1: 34–40.

Laurent, R.F. 1961. Notes on some South Africanamphibians. Publications de l’Universite del’Etat a Elisabethville. Lubumbashi 1: 197–209.

Laurent, R.F. 1972. The morphology, systematics,and evolution of the Old World treefrogs (Rha-cophoridae and Hyperoliidae) [Review]. Cop-eia 1972: 198–201.

Laurent, R.F. 1973. The natural classification ofthe Arthroleptinae (Amphibia, Hyperoliidae).Revue de Zoologie et de Botanique Africaines87: 666–678.


Laurent, R.F. 1975. Biogeographie et liaisons in-tercontinentales au course du Mesozoıque. Me-moires du Museum National d’Histoire Natu-relle. Paris. Serie A, Zoologie 88: 176–191.

Laurent, R.F. 1978. L’appareil hyoidien des As-tylosterninae et des Arthroleptinae (Amphibia).Revue Zoologique Africaine 92: 233–240.

Laurent, R.F. 1980 ‘‘1979’’. Esquisse d’une phy-logenese des anoures. Bulletin de la SocieteZoologique de France 104: 397–422.

Laurent, R.F. 1983. Heterogeneidad del generoBatrachophrynus Peters (Leptodactylidae).Acta Zoologica Lilloana 37: 107–113.

Laurent, R.F. 1984a. Heterogeneidad de la familiaCaeciliidae (Amphibia-Apoda). Acta ZoologicaLilloana 37: 199–200.

Laurent, R.F. 1984b. La phylogenese des Rano-idea et le cladisme. Alytes 3: 97–111.

Laurent, R.F. 1986. Sous classe des lissamphi-biens (Lissamphibia). In P. Grasse and M. Del-sol (editors), Traite de zoologie. Anatomie, sys-tematique, biologie, vol. 14. Batraciens, fasc. 1-B: 594–797. Paris: Masson.

Laurent, R.F. 1986 ‘‘1985’’. Sur la classificationet la nomenclature des amphibiens. Alytes 4:119–120.

Laurent, R.F., and M. Fabrezi. 1986 ‘‘1985’’. Lecarpe des Arthroleptinae. Alytes 4: 85–93.

Laurenti, J.N. 1768. Specimen medicum, exhibenssynopsin reptilium emendatum cum experimen-tis circa venena et antidota Reptilium Austria-corum. Wien.

Laurin, M. 1998a. The importance of global par-simony and historical bias in understanding tet-rapod evolution. Part I. Systematics, middle earevolution and jaw suspension. Annales des Sci-ences Naturelles. Zoologie et Biologie Anima-le. Paris. Serie 13, 1998: 1–42.

Laurin, M. 1998b. The importance of global par-simony and historical bias in understanding tet-rapod evolution. Part II. Vertebral centrum, cos-tal ventilation, and paedomorphosis. Annalesdes Sciences Naturelles. Zoologie et BiologieAnimale. Paris. Serie 13, 1998: 99–114.

Laurin, M. 1998c. A reevaluation of the origin ofpentadactyly. Evolution 52: 1476–1482.

Laurin, M. 2002. Tetrapod phylogeny, amphibianorigins, and the definition of the name Tetra-poda. Systematic Biology 51: 364–369.

Laurin, M., and R.R. Reisz. 1997. A new per-spective on tetrapod phylogeny. In S.S. Sumidaand K.L.M. Martin (editors), Amniote origins:completing the transition to land: 9–59. San Di-ego: Academic Press.

Laurin, M., R.R. Reisz, and M. Girondot. 2000.Caecilian viviparity and amniote origins: a re-ply to Wilkinson and Nussbaum. Journal ofNatural History. London 34: 311–315.

Lavilla, E.O., and J.M. Cei. 2001. Amphibians ofArgentina. A second update, 1987–2000. Mu-seo Regionale di Scienze Naturali Monografie.Torino 28: 1–177.

Lawson, D.P. 1993. The reptiles and amphibiansof Korup National Park Project, Cameroon.Herpetological Natural History 1: 27–90.

Lebedkina, N.S. 2004. Evolution of the amphibianskull. Advances in Amphibian Research in theFormer Soviet Union 9: 1–265.

Lescure, J., V. Marty, C. Marty, F. Starace, M.A.Thomay, and F. Letellier. 1995. Contribution al’etude des amphibiens de Guyane francaise. X.Les Phyllomedusa (Anura, Hylidae). RevueFrancaise d’Aquariologie, Herpetologie 22 35–50.

Lescure, J., S. Renous, and J.-P. Gasc. 1986. Prop-osition d’une nouvelle classification des am-phibiens gymnophiones. Memoires de la Socie-te Zoologique de France 43: 145–177.

Leuckart, F.S. 1821. Einiges uber die fischartigenAmphibien. Isis von Oken 9: 257–265.

Li, W.-H., and Z.-Y. Wang. 1985. Karyotype ofRana livida. Acta Herpetologica Sinica 4: 56.[In Chinese with English abstract.]

Licht, L.E. 2003. Shedding light on ultraviolet ra-diation and amphibian embryos. BioScience53: 551–561.

Liem, D.S.S. 1970. The morphology, systematics,and evolution of the Old World treefrogs (Rha-cophoridae and Hyperoliidae). Fieldiana. Zo-ology 57: i–vii, 1–145.

Linnaeus, C. 1758. Systema naturae per regna trianaturae, secundum classes, ordines, genera,species, cum characteribus, differentiis, synon-ymis, locis, 10th ed. Stockholm.

Lips, K.R., P.A. Burrowes, J.R. Mendelson III,and G. Parra-Olea. 2005. Amphibian declinesin Latin America: a synthesis. Biotropica 37:222–228.

Littlejohn, M.J. 1963. The breeding biology of theBaw Baw frog Philoria frosti Spencer. Pro-ceedings of the Linnaean Society of New SouthWales 88: 273–276.

Liu, C.-C. 1950. Amphibians of western China.Fieldiana. Zoology Memoires 2: 1–397 1 10pl.

Liu, C.-C., and S. Hu. 1961. [Tailless amphibiansof China.] Shanghai: Science Press. [In Chi-nese.]

Liu, C.-C., and S. Hu. 1962. A herpetological re-port of Kwangsi. Acta Zoologica Sinica 14: 73–104. [In Chinese with English abstract andtranslations of descriptions.]

Liu, W., A. Lathrop, J. Fu, D. Yang, and R.W.Murphy. 2000. Phylogeny of East Asian bufon-ids inferred from mitochondrial DNA sequenc-


es (Anura: Amphibia). Molecular Phylogeneticsand Evolution 14: 423–435.

Loader, S.P., D.J. Gower, K.M. Howell, N. Dog-gart, M.-O. Rodel, R.O. de Sa, B.L. Cohen, andM. Wilkinson. 2004. Phylogenetic relationshipsof African microhylid frogs inferred from DNAsequences of mitochondrial 12S and 16S rRNAgenes. Organisms, Diversity & Evolution 4:227–235.

Lombard, R.E., and S.S. Sumida. 1992. Recentprogress in understanding early tetrapods.American Zoologist 32: 609–622.

Lombard, R.E., and D.B. Wake. 1986. Tongueevolution in the lungless salamanders, familyPlethodontidae IV. Phylogeny of plethodontidsalamanders and the evolution of feeding dy-namics. Systematic Biology 35: 532–551.

Loveridge, A. 1957. Check list of the reptiles andamphibians of East Africa (Uganda; Kenya;Tanganyika; Zanzibar). Bulletin of the Museumof Comparative Zoology 117: 153–362.

Loytynoja, A., and M.C. Milinkovitch. 2000.SOAP, cleaning multiple alignments from un-stable blocks, version 1.0. Bioinformatics 17:573–574.

Loytynoja, A., and M.C. Milinkovitch. 2003. Ahidden Markov model for progressive multiplealignments. Bioinformatics 19: 1505–1513.

Lutz, B. 1954. Anfıbios anuros do Distrito Fed-eral/The frogs of the Federal District of Brazil.Memorias do Instituto Oswaldo Cruz. Rio deJaneiro 52: 155–197 (Portuguese), 219–238(English).

Lutz, B. 1968. Taxonomy of the Neotropical Hy-lidae. Pearce-Sellards Series. Texas MemorialMuseum 11: 3–26.

Lutz, B. 1969. Adaptacoes, especializacoes e lin-hagens nos anuros neotropicais. Acta ZoologicaLilloana 24: 267–292.

Lynch, J.D. 1969. Program. Final Ph.D. exami-nation. Department of Zoology, University ofKansas, Lawrence.

Lynch, J.D. 1971. Evolutionary relationships, os-teology, and zoogeography of leptodactyloidfrogs. University of Kansas Museum of NaturalHistory, Miscellaneous Publications 53: 1–238.

Lynch, J.D. 1972a. Generic partitioning of theSouth American leptodactyloid frog genus Eup-sophus Fitzinger, 1843 (sensu lato). Bulletin ofthe Southern California Academy of Science71: 2–11.

Lynch, J.D. 1972b. Two new species of frogs(Eleutherodactylus: Leptodactylidae) from theparamos of northern Ecuador. Herpetologica28: 141–147.

Lynch, J.D. 1973. The transition from archaic toadvanced frogs. In J.L. Vial (editor), Evolution-ary biology of the anurans: contemporary re-

search on major problems: 133–182. Columbia:University of Missouri Press.

Lynch, J.D. 1975. A review of the Andean lep-todactylid frog genus Phrynopus. OccasionalPapers of the Museum of Natural History, Uni-versity of Kansas 35: 1–51.

Lynch, J.D. 1976. The species groups of the SouthAmerican frogs of the genus Eleutherodactylus(Leptodactylidae). Occasional Papers of theMuseum of Natural History, University of Kan-sas 61: 1–24.

Lynch, J.D. 1978a. A new eleutherodactyline frogfrom the Andes of northern Colombia. Copeia1978: 17–21.

Lynch, J.D. 1978b. A re-assessment of the tel-matobiine leptodactylid frogs of Patagonia. Oc-casional Papers of the Museum of Natural His-tory, University of Kansas 72: 1–57.

Lynch, J.D. 1980. A new species of Barycholosfrom Estado Goias, Brasil (Amphibia, Anura,Leptodactylidae) with remarks on related gen-era. Bulletin du Museum National d’HistoireNaturelle. Paris. Section A, Zoologie, Biologieet Ecologie Animales 2: 289–302.

Lynch, J.D. 1982a. Two new species of poison-dart frogs (Colostethus) from Colombia. Her-petologica 38: 366–374.

Lynch, J.D. 1982b. Relationships of the frogs ofthe genus Ceratophrys (Leptodactylidae) andtheir bearing on hypotheses of Pleistocene for-est refugia in South America and punctuatedequilibrium. Systematic Zoology 31: 166–179.

Lynch, J.D. 1986. The definition of the MiddleAmerican clade of Eleutherodactylus based onjaw musculature (Amphibia: Leptodactylidae).Herpetologica 42: 248–258.

Lynch, J.D. 1989. Intrageneric relationships ofmainland Eleutherodactylus (Leptodactylidae).I. A review of the frogs assigned to the Eleuth-erodactylus discoidalis species group. Milwau-kee Public Museum Contributions in Biologyand Geology 79: 1–25.

Lynch, J.D. 1994. A new species of high-altitudefrog (Eleutherodactylus: Leptodactylidae) fromthe Cordillera Oriental of Colombia. Revista dela Academia Colombiana de Ciencias Exactas,Fısicas y Naturales 19: 195–203.

Lynch, J.D. 1996. The relationships of the His-paniolan frogs of the subgenus Pelorius(Eleutherodactylus: Leptodactylidae). In R.Powell and R.W. Henderson (editors), Contri-butions to West Indian herpetology: a tribute toAlbert Schwartz: 141–155. Contribution toHerpetology, no. 12. Ithaca, NY: Society for theStudy of Amphibians and Reptiles.

Lynch, J.D. 2000. The relationships of an ensem-ble of Guatemalan and Mexican frogs (Eleuth-erodactylus: Leptodactylidae: Amphibia). Re-


vista de la Academia Colombiana de CienciasExactas, Fısicas y Naturales 24: 129–156.

Lynch, J.D., and W.E. Duellman. 1997. Frogs ofthe genus Eleutherodactylus in western Ecua-dor. Systematics, ecology, and biogeography.University of Kansas Natural History Museum,Special Publication 23: 1–236.

Lynch, J.D., and H.L. Freeman. 1966. Systematicstatus of a South American frog, Allophryneruthveni Gaige. University of Kansas Publica-tions, Museum of Natural History 17: 493–502.

Lynch, J.D., and R.W. McDiarmid. 1987. Twonew species of Eleutherodactylus (Amphibia:Anura: Leptodactylidae) from Bolivia. Proceed-ings of the Biological Society of Washington100: 337–346.

Lynch, J.D., and P.M. Ruiz-Carranza. 1982. Anew genus and species of poison-dart frog(Amphibia: Dendrobatidae) from the Andes ofnorthern Colombia. Proceedings of the Biolog-ical Society of Washington 95: 557–562.

Lynch, J.D., and P.M. Ruiz-Carranza. 1997‘‘1996’’. A remarkable new centrolenid frogfrom Colombia with a review of nuptial ex-crescences in the family. Herpetologica 52:525–535.

Lynch, J.F., and D.B. Wake. 1978. A new speciesof Chiropterotriton (Amphibia: Caudata) fromBaja Verapaz, Guatemala, with comments onrelationships among Central American mem-bers of the genus. Natural History Museum ofLos Angeles County Contributions in Science294: 1–22.

Lynch, J.F., D.B. Wake, and S.-Y. Yang. 1983.Genic and morphological differentiation inMexican Pseudoeurycea (Caudata: Plethodon-tidae). Copeia 1983: 884–894.

Macey, J.R., J.L. Strasburg, J.A. Brisson, V.T.Vredenburg, M. Jennings, and A. Larson. 2001.Molecular phylogenetics of western NorthAmerican frogs of the Rana boylii speciesgroup. Molecular Phylogenetics and Evolution19: 131–143.

Macey, J.R. 2005. Plethodontid salamander mi-tochondrial genomics: a parsimony evaluationof character conflict and implications for his-torical biogeography. Cladistics 21: 194–202.

Maglia, A.M. 1998. Phylogenetic relationships ofextant pelobatoid frogs (Anura: Pelobatoidea):evidence from adult morphology. Scientific Pa-pers. Natural History Museum, University ofKansas 10: 1–19.

Maglia, A.M., L.A. Pugener, and L. Trueb. 2001.Comparative development of anurans: usingphylogeny to understand ontogeny. AmericanZoologist 41: 538–551.

Mahoney, M.J. 2001. Molecular systematics ofPlethodon and Aneides (Caudata: Plethodonti-

dae: Plethodontini): phylogenetic analysis of anold and rapid radiation. Molecular Phylogenet-ics and Evolution 18: 174–188.

Maienschein, J. 1994. Cutting edges cut bothways. Biology and Philosophy 9: 1–24.

Mannen, H., and S.S.-L. Li. 1999. Molecular ev-idence for a clade of turtles. Molecular Phylo-genetics and Evolution 13: 144–148.

Manzano, A.S., and E.O. Lavilla. 1995. Myolog-ical peculiarities in Rhinoderma darwini (An-ura: Rhinodermatidae). Journal of Morphology224: 125–129.

Manzano, A.S., S.A. Moro, and V. Abdala. 2003.The depressor mandibulae muscle in Anura.Alytes 20: 93–131.

Marmayou, J., A. Dubois, A. Ohler, E. Pasquet,and A. Tillier. 2000. Phylogenetic relationshipsin the Ranidae (Amphibia, Anura). Independentorigin of direct development in the genera Phi-lautus and Taylorana. Comptes Rendus del’Academie des Sciences. Series 3, Life Scienc-es Paris 323: 287–297.

Martin, A.A. 1967. Australian anuran life histo-ries: some evolutionary and ecological aspects.In A.H. Weatherly (editor), Australian inlandwaters and their fauna: eleven studies: 175–191. Canberra: Australian National UniversityPress.

Martin, R.F. 1972. Evidence from osteology. InW.F. Blair (editor), Evolution in the genus Bufo:37–70. Austin: University of Texas Press.

Martin, W.F. 1972. Evolution of vocalization inthe genus Bufo. In W.F. Blair (editor), Evolutionin the genus Bufo: 279–309. Austin: Universityof Texas Press.

Matsui, M. 1994. A taxonomic study of the Rananarina complex, with description of three newspecies (Amphibia: Ranidae). Zoological Jour-nal of the Linnean Society. London 111: 385–415.

Matsui, M., and N.L. Orlov. 2004. A new speciesof Chirixalus from Vietnam (Anura: Rhaco-phoridae). Zoological Science. Tokyo 21: 671–676.

Matsui, M., H. Ota, M.W.-N. Lau, and A. Boga-dek. 1995. Cytotaxonomic studies of three ra-nid species (Amphibia: Anura) from HongKong. Japanese Journal of Herpetology/ Ha-chu-Ryoseiruigaku Zasshi 16: 12–17.

Matsui, M., T. Shimada, H. Ota, and T. Tanaka-Ueno. 2005. Multiple invasions of the RyukyuArchipelago by Oriental frogs of the subgenusOdorrana with phylogenetic reassessment ofthe related subgenera of the genus Rana. Mo-lecular Phylogenetics and Evolution 37: 733–742. [Seen as an electronic/pdf preprint avail-able from the publisher.]

Maxson, L.R., R. Highton, and D.B. Wake. 1979.


Albumin evolution and its phylogenetic impli-cations in the plethodontid salamander generaPlethodon and Ensatina. Copeia 1979: 502–508.

Maxson, L.R., D.P. Ondrula, and M.J. Tyler. 1985.An immunological perspective on evolutionaryrelationships in Australian frogs of the hylidgenus Cyclorana. Australian Journal of Zoolo-gy 33: 17–22.

Maxson, L.R., and D.B. Wake. 1981. Albuminevolution and its phylogenetic implications inthe plethodontid salamander genera Pseudoeu-rycea and Chiropterotriton. Herpetologica 37:109–117.

Mayer, A.F.J.K. 1849. System des Thier-Reichesoder Eintheilung der Thiere nach einem Prin-cip, entworfen. Verhandlungen des Naturhisto-rischen Vereines der Preussischen Rheinlande6: 177–210.

McDiarmid, R.W., and R.I. Altig. 1999. Researchmaterials and techniques. In R.W. McDiarmidand R. Altig (editors), Tadpoles: the biology ofanuran larvae: 7–23. Chicago: University ofChicago Press.

McDiarmid, R.W., and S.J. Gorzula. 1989. As-pects of the reproductive ecology and behaviorof the tepui toads, genus Oreophrynella (Anura,Bufonidae). Copeia 1989: 445–451.

McGowan, G.J., and S.E. Evans. 1995. Albaner-petontid amphibians from the Cretaceous ofSpain. Nature. London 373: 143–145.

Meegaskumbura, M., F. Bossuyt, R. Pethiyagoda,K. Manamendra-Arachchi, M. Bahir, M.C. Mil-inkovitch, and C.J. Schneider. 2002. Sri Lanka:an amphibian hot spot. Science 298: 379.

Meinhardt, D.J., and J.R. Parmalee. 1996. A newspecies of Colostethus (Anura: Dendrobatidae)from Venezuela. Herpetologica 52: 70–77.

Mendelson, J.R., III, H.R. da Silva, and A.M.Maglia. 2000. Phylogenetic relationshipsamong marsupial frog genera (Anura: Hylidae:Hemiphractinae) based on evidence from mor-phology and natural history. Zoological Journalof the Linnean Society. London 128: 125–148.

Merrem, B. 1820. Versuch eines Systems der Am-phibien/ Tentamen systematis amphibiorum.Marburg: Johann Christian Krieger.

Milner, A.R. 1988. The relationships and originof the living amphibians. In M.J. Benton (edi-tor), The phylogeny and classification of thetetrapods, vol. 1. Amphibians, reptiles, birds:59–102. Systematics Association Special Vol-ume 23. New York: Academic Press.

Milner, A.R. 1993. The Paleozoic relatives of lis-samphibians. Herpetological Monographs 7: 8–27.

Milner, A.R. 1994. Late Triassic and Jurassic am-phibians: fossil record and phylogeny. In N.C.

Fraser and H.-D. Sues (editors), In the shadowof the dinosaurs: 5–23. New York: CambridgeUniversity Press.

Milner, A.R. 2000. Mesozoic and Tertiary Cau-data and Albanerpetontidae. In H. Heatwoleand R.L. Carroll (editors), Amphibian biology,vol. 4. Paleontology, the evolutionary historyof amphibians: 1412–1444. Chipping Norton,Australia: Surrey Beatty.

Min, M.-S., S.-Y. Yang, R.M. Bonett, D.R. Viei-tes, R.A. Brandon, and D.B. Wake. 2005. Dis-covery of the first Asian plethodontid salaman-der. Nature. London 435: 87–90.

Miranda-Ribeiro, A., de. 1923. Os hylodideos doMuseu Paulista. Revista do Museu Paulista.Sao Paulo 13: 825–846 (reprint pages 3–24).

Miranda-Ribeiro, A., de. 1926. Notas para servi-rem ao estudo dos Gymnobatrachios (Anura)brasileiros. Arquivos do Museu Nacional doRio de Janeiro 27: 1–227.

Mivart, S.G. 1869. On the classification of theanurous batrachians. Proceedings of the Zoo-logical Society of London 1869: 280–295.

Mookerjee, H.K. 1931. On the development of thevertebral column of Anura. PhilosophicalTransactions of the Royal Society of London219: 165–196.

Morrison, D.A., and J.T. Ellis. 1997. Effects ofnucleotide sequence alignment on phylogenyestimation: a case study of 18S rDNAs of Ap-icomplexa. Molecular Biology and Evolution14: 428–441.

Mueller, R.L., J.R. Macey, M. Jaekel, D.B. Wake,and J.L. Boore. 2004. Morphological homopla-sy, life history evolution, and historical bioge-ography of plethodontid salamanders inferredfrom complete mitochondrial genomes. Pro-ceedings of the National Academy of Sciencesof the United States of America 101: 13820–13825.

Muller, H., G.J. Measey, and P.K. Malonza. 2005.Tadpole of Bufo taitanus (Anura: Bufonidae)with notes on its systematic significance andlife history. Journal of Herpetology 39: 138–141.

Muller, J. 1831. An einer jungen Coecilia hypo-cyanea im Museum der Naturgeschichte. Isisvon Oken 1831: 710–711.

Muller, J. 1832. Beitrage zur Anatomie und Na-turgeschichte der Amphibien. I. Ueber die na-turliche Eintheilung der Amphibien. Zeitschriftfur Physiologie 4: 190–275, pl. 18–22.

Muller, K. 2004. PRAP—computation of Bremersupport for large data sets. Molecular Phylo-genetics and Evolution 31: 780–782.

Myers, C.W. 1982. Spotted poison frogs: descrip-tions of three new Dendrobates from westernAmazonia, and resurrection of a lost species


from ‘‘Chiriqui’’. American Museum Novitates2721: 1–23.

Myers, C.W. 1987. New generic names for someNeotropical poison frogs (Dendrobatidae). Pa-peis Avulsos de Zoologia. Sao Paulo 36: 301–306.

Myers, C.W., and P.A. Burrowes. 1987. A newpoison frog (Dendrobates) from Andean Co-lombia, with notes on a lowland relative. Amer-ican Museum Novitates 2899: 1–17.

Myers, C.W., J.W. Daly, and B. Malkin. 1978. Adangerously toxic new frog (Phyllobates) usedby Embera indians of western Colombia, withdiscussion of blowgun fabrication and dart poi-soning. Bulletin of the American Museum ofNatural History 161: 307–366.

Myers, C.W., and L.S. Ford. 1986. On Atopo-phrynus, a recently described frog wrongly as-signed to the Dendrobatidae. American Muse-um Novitates 2843: 1–15.

Myers, C.W., A. Paolillo O., and J.W. Daly. 1991.Discovery of a defensively malodorous andnocturnal frog in the family Dendrobatidae:phylogenetic significance of a new genus andspecies from the Venezuelan Andes. AmericanMuseum Novitates 3002: 1–33.

Nascimento, L.B., U. Caramaschi, and C.A.G.Cruz. 2005. Taxonomic review of the speciesgroup of the genus Physalameus Fitzinger,1826 with revalidation of the genera Engysto-mops Jimenez de la Espada, 1872 and Eupem-phix Steindachner, 1836 (Amphibia, Anura,Leptodactylidae). Arquivos do Museu Nacionaldo Rio de Janeiro 63: 297–320.

Nicholls, G.E. 1916. The structure of the vertebralcolumn in the Anura Phaneroglossa and its im-portance as a basis of classification. Proceed-ings of the Linnaean Society of London 128:80–92.

Niklas, K.J. 2001. Taxing debate for taxonomists.Science 292: 2249–2250.

Nixon, K.C. 1999. The parsimony ratchet, a newmethod for rapid parsimony analysis. Cladistics15: 407–414.

Nixon, K.C. 1999–2002. WinClada. Version 1.0.Ithaca, New York: Computer software distrib-uted by the author.

Nixon, K.C., and J.M. Carpenter. 2000. On theother ‘‘phylogenetic systematics’’. Cladistics16: 298–318.

Nixon, K.C., J.M. Carpenter, and D.W. Stevenson.2003. The PhyloCode is fatally flawed and the‘‘Linnaean’’ system can be easily fixed. Botan-ical Review 69: 111–120.

Noble, G.K. 1924. A new spadefoot toad from theOligocene of Mongolia with a summary of theevolution of the Pelobatidae. American Muse-um Novitates 132: 1–15.

Noble, G.K. 1926. The pectoral girdle of the bra-chycephalid frogs. American Museum Novita-tes 230: 1–14.

Noble, G.K. 1927. The value of life history datain the study of the evolution of the Amphibia.Annals of the New York Academy of Sciences30: 31–128.

Noble, G.K. 1929. The adaptive modifications ofthe arboreal tadpoles of Hoplophryne and thetorrent tadpoles of Staurois. Bulletin of theAmerican Museum of Natural History 58: 291–334.

Noble, G.K. 1931. The biology of the Amphibia.New York: McGraw-Hill.

Noble, G.K., and P.G. Putnam. 1931. Observa-tions on the life history of Ascaphus truei Ste-jneger. Copeia 1931: 97–101.

Nussbaum, R.A. 1976. Geographic variation andsystematics of salamanders of the genus Di-camptodon Strauch (Ambystomatidae). Miscel-laneous Publications. Museum of Zoology,University of Michigan 149: 1–94.

Nussbaum, R.A. 1977. Rhinatrematidae: a newfamily of caecilians (Amphibia: Gymno-phiona). Occasional Papers of the Museum ofZoology, University of Michigan 682: 1–30.

Nussbaum, R.A. 1979. The taxonomic status ofthe caecilian genus Uraeotyphlus Peters. Oc-casional Papers of the Museum of Zoology,University of Michigan 687: 1–20.

Nussbaum, R.A. 1980. Phylogenetic implicationsof amplectic behavior in sooglossid frogs. Her-petologica 36: 1–5.

Nussbaum, R.A. 1982. Heterotopic bones in thehindlimbs of frogs of the families Pipidae, Ran-idae and Sooglossidae. Herpetologica 38: 312–320.

Nussbaum, R.A., A.P. Jaslow, and J. Watson.1982. Vocalization in frogs of the family Soog-lossidae. Journal of Herpetology 16: 198–203.

Nussbaum, R.A., and M. Wilkinson. 1989. On theclassification and phylogeny of caecilians (Am-phibia: Gymnophiona), a critical review. Her-petological Monographs 3: 1–42.

Nussbaum, R.A., and M. Wilkinson. 1995. A newgenus of lungless tetrapod: a radically divergentcaecilian (Amphibia: Gymnophiona). Proceed-ings of the Royal Society of London. Series B,Biological Sciences 261: 331–335.

Ohler, A., S.R. Swan, and J.C. Daltry. 2002. Arecent survey of the amphibian fauna of theCardamom Mountains, Southwest Cambodiawith descriptions of three new species. RafflesBulletin of Zoology. Singapore 50: 465–481.

Okada, Y. 1966. Fauna Japonica. Anura (Amphib-ia). Tokyo: Biogeographical Society of Japan.

Olsson, L., and J. Hanken. 1996. Cranial neural-crest migration and chondrogenic fate in the


oriental fire-bellied toad Bombina orientalis:defining the ancestral pattern of head develop-ment in anuran amphibians. Journal of Mor-phology 299: 105–120.

Oppel, M. 1810. Second memoire sur las classi-fication des reptiles. Annales du Museumd’Histoire Naturelle 16: 394–418.

Orlov, N.L., L.N. Ngat, and T.C. Ho. 2003. A newspecies of cascade frog from North Vietnam(Ranidae, Anura). Russian Journal of Herpetol-ogy 10: 123–134.

Orton, G.L. 1949. Larval development of Necto-phrynoides tornieri (Roux), with comments ondirect development in frogs. Annals of the Car-negie Museum 31: 257–274.

Orton, G.L. 1953. The systematics of vertebratelarvae. Systematic Zoology 2: 63–75.

Orton, G.L. 1957. The bearing of larval evolutionon some problems in frog classification. Sys-tematic Zoology 6: 79–86.

Page, L.M, H.L. Bart, Jr., R. Beaman, L. Bohs,L.T. Deck, V.A. Funk, D. Lipscomb, M.A. Ma-res, L.A. Prather, J. Stevenson, Q.D. Wheeler,J.B. Wooley, and D.W. Stevenson. 2005. LIN-NE: legacy infrastructure network for naturalenvironments. Champaign, IL: Illinois NaturalHistory Survey.

Palma, R.E., and A.E. Spotorno. 1999. Molecularsystematics of marsupials based on the rRNA12S mitochondrial gene: the phylogeny of di-delphimorphia and the living fossil microbioth-eriid Dromiciops gliroides Thomas. MolecularPhylogenetics and Evolution 13: 525–535.

Palumbi, S.R., A. Martin, S. Romano, W.O. Mc-Millan, L. Stice, and G. Grabawski. 1991. Thesimple fool’s guide to PCR, version 2.0. Uni-versity of Hawaii, Honolulu: Privately pub-lished, compiled by S. Palumbi.

Papavero, N., J. Llorente-Bousquets, and J.M.Abe. 2001. Proposal of a new system of no-menclature for phylogenetic systematics. Ar-quivos de Zoologia. Sao Paulo 36: 1–145.

Parker, H.W. 1934. A monograph of the frogs ofthe family Microhylidae. London: Trustees ofthe British Museum.

Parker, H.W. 1940. The Australasian frogs of thefamily Leptodactylidae. Novitates Zoologicae.Tring 42: 1–106.

Parra-Olea, G. 2002. Molecular phylogenetic re-lationships of Neotropical salamanders of thegenus Pseudoeurycea. Molecular Phylogeneticsand Evolution 22: 234–246.

Parra-Olea, G., M. Garcıa-Parıs, and D.B. Wake.2002. Phylogenetic relationships among the sal-amanders of the Bolitoglossa macrinii speciesgroup (Amphibia: Plethodontidae), with de-scriptions of two new species from Oaxaca(Mexico). Journal of Herpetology 36: 356–366.

Parra-Olea, G., M. Garcıa-Parıs, and D.B. Wake.2004. Molecular diversification of salamandersof the tropical American genus Bolitoglossa(Caudata: Plethodontidae) and its evolutionaryand biogeographical implications. BiologicalJournal of the Linnean Society 81: 325–346.

Parra-Olea, G., and D.B. Wake. 2001. Extrememorphological and ecological homoplasy intropical salamanders. Proceedings of the Na-tional Academy of Sciences of the UnitedStates of America 98: 7888–7891.

Parsons, T.S., and E.E. Williams. 1963. The rela-tionships of the modern Amphibia: a re–ex-amination. Quarterly Review of Biology 38:26–53.

Passmore, N.I., and V.C. Carruthers. 1979. SouthAfrican frogs. Johannesburg: WitwatersrandUniversity Press.

Patterson, C., and D.E. Rosen. 1977. Review ofthe ichthyodectiform and other Mesozoic tele-ost fishes and the theory and practice of clas-sifying fossils. Bulletin of the American Mu-seum of Natural History 158: 85–172.

Pauly, G.B., D.M. Hillis, and D.C. Cannatella.2004. The history of Nearctic colonization: mo-lecular phylogenetics and biogeography of theNearctic toads (Bufo). Evolution 58: 2517–2535.

Peixoto, O.L. 1995. Associacao de anuros a bro-meliaceas na mata Atlantica. Revista de Univ-ersidade Federal Rural do Rio de Janeiro. SerieCiencias da Vida 17: 75–83.

Pennisi, E. 2001. Linnaeus’s last stand? Science291: 2304–2307.

Perret, J.-L. 1966. Les amphibiens du Cameroun.Zoologische Jahrbucher. Abteilung fur Syste-matik, Okologie und Geographie. Jena 93:289–464.

Perret, J.-L. 1977. Les Hylarana (amphibiens,ranides) du Cameroun. Revue Suisse de Zool-ogie 84: 841–868.

Perret, J.-L. 1984. Identification des syntypes dePetropedetes obscurus Ahl, 1924 (Amphibia,Phrynobatrachinae), conserves au museum deBerlin. Bulletin de la Societe Neuchateloise desSciences Naturelles 107: 167–170.

Peters, W.C.H. 1862. Uber die Batrachier-GattungHemiphractus. Monatsberichte der KoniglichenPreussische Akademie des Wissenschaften zuBerlin 1862: 144–152.

Philippe, H. 1993. MUST: management utilitiesfor sequences and trees. Nucleic Acids Re-search 21: 5264–5272.

Phillips, A., D. Janies, and W.C. Wheeler. 2000.Multiple sequence alignment in phylogeneticanalysis. Molecular Phylogenetics and Evolu-tion 16: 317–330.

Pickett, K.M. 2005. The new and improved


PhyloCode, now with types, ranks, and evenpolyphyly: a conference report from the FirstInternational Phylogenetic Nomenclature Meet-ing. Cladistics 21: 79–82.

Platnick, N.I. 1977. Cladograms, phylogenetictrees, and hypothesis testing. Systematic Zool-ogy 26: 438–443.

Pombal, J.P., Jr. 1999. Oviposicao e desenvolvi-mento de Brachycephalus ephippium (Spix)(Anura, Brachycephalidae). Revista Brasileirade Zoologia 16: 967–976.

Pombal, J.P., Jr., and C.F.B. Haddad. 1999. Frogsof the genus Paratelmatobius (Anura: Lepto-dactylidae) with descriptions of two new spe-cies. Copeia 1999: 1014–1026.

Pope, C.H. 1931. Notes on amphibians from Fu-kien, Hainan and other parts of China. Bulletinof the American Museum of Natural History61: 397–611.

Posada, D., and K.A. Crandall. 1998. Modeltest:testing the model of DNA substitution. Bioin-formatics 14: 817–818.

Post, T.J., and T. Uzzell. 1981. The relationshipsof Rana sylvatica and the monophyly of theRana boylii group. Systematic Zoology 30:170–180.

Poynton, J.C. 1964a. Amphibia of southern Afri-ca: a faunal study. Annals of the Natal Museum17: 1–334.

Poynton, J.C. 1964b. Amphibia of the Nyasa-Lu-angwa region of Africa. Senckenbergiana Biol-ogica 45: 193–225.

Poynton, J.C. 1976. Classification and the Arthro-leptinae. Revue Zoologique Africaine 90: 215–220.

Poynton, J.C. 2003. Arthroleptis troglodytes andthe content of Schoutedenella (Amphibia: An-ura: Arthroleptidae). African Journal of Her-petology 52: 49–51.

Poynton, J.C., and D.G. Broadley. 1967. A newspecies of Probreviceps (Amphibia) from Rho-desia. Arnoldia. Zimbabwe 3: 1–3.

Poynton, J.C., and D.G. Broadley. 1985. Amphib-ia Zambesiaca 2. Ranidae. Annals of the NatalMuseum 27: 115–181.

Poynton, J.C., and D.G. Broadley. 1988. Amphib-ia Zambesiaca, 4. Bufonidae. Annals of the Na-tal Museum 29: 447–490.

Pramuk, J.B. 2000. Prenasal bones and snout mor-phology in West Indian bufonids and the Bufogranulosus species group. Journal of Herpetol-ogy 34: 334–340.

Pramuk, J.B. 2002. Combined evidence and cla-distic relationships of West Indian toads (Anu-ra: Bufonidae). Herpetological Monographs 16:121–151.

Pramuk, J.B., C.A. Hass, and S.B. Hedges. 2001.Molecular phylogeny and biogeography of

West Indian toads (Anura: Bufonidae). Molec-ular Phylogenetics and Evolution 20: 294–301.

Pramuk, J.B., and J.R. Mendelson, III. 2003. An-axyrus melanocholicus Tschudi: synonym ofthe Mexican taxon Bufo compactilis Wiegmann(Anura: Bufonidae). Southwestern Naturalist48: 676–680.

Pregill, G.K. 1981. Cranial morphology and theevolution of West Indian toads: resurrection ofthe genus Peltophryne (Fitzinger). Copeia1981: 273–285.

Procter, J.B. 1925. Notes on the nests of someAfrican frogs. Proceedings of the ZoologicalSociety of London 1925: 909–910.

Pugener, L.A., A.M. Maglia, and L. Trueb. 2003.Revisiting the contribution of larval charactersto an analysis of phylogenetic relationships ofbasal anurans. Zoological Journal of the Lin-nean Society. London 139: 129–155.

Pusey, H.K. 1943. On the head of the liopelmidfrog, Ascaphus truei I. The chondrocranium,jaws, arches, and muscles of a partly grown lar-va. Quarterly Journal of Microscopical Science84: 106–185.

Pyburn, W.F. 1970. Breeding behavior of the leaf-frogs Phyllomedusa callidryas and Phyllome-dusa dacnicolor in Mexico. Copeia 1970: 209–218.

Pytel, B.A. 1986. Biochemical systematics of theeastern North American frogs of the genusRana. Herpetologica 42: 273–282.

Rabb, G.B. 1960. On the unique sound productionof the Surinam toad, Pipa pipa. Copeia 1960:368–369.

Rafinesque, C.S. 1814. Fine del prodromod’erpetologia siciliana. Specchio delle Scienze,o, Giornale Enciclopedico di Sicilia 2: 102–104.

Rafinesque, C.S. 1815. Analyse de nature, ou tab-leau de l’universe et des corps organises. Pa-lermo: Jean Barravecchia.

Rambaut, A. 1995. Se-Al. Sequence alignmenteditor, version 1.d1. University of Oxford,U.K.: Computer software distributed by the au-thor.

Rao, C.R.N. 1920. Some South Indian batrachi-ans. Journal of the Bombay Natural History So-ciety 27: 119–127.

Read, K., J.S. Keogh, I.A. Scott, J.D. Roberts, andP. Doughty. 2001. Molecular phylogeny of theAustralian frog genera Crinia, Geocrinia, andallied taxa (Anura: Myobatrachidae). MolecularPhylogenetics and Evolution 21: 294–308.

Regal, P.J. 1966. Feeding specializations and theclassification of terrestrial salamanders. Evolu-tion 20: 392–407.

Reig, O.A. 1958. Proposiciones para una nueva


macrosistematica de los anuros (nota prelimi-nar). Physis. Buenos Aires 21: 109–118.

Reig, O.A. 1960. Las relaciones genericas del an-uro chileno Calyptocephalella gayi (Dum. &Bibr.). In Actas y trabajos del Primer CongresoSudamericano de Zoologıa (La Plata, 12–24Octubre 1959), vol. 4: 113–147. La Plata: Com-ision de Investigacion Cientıfica de la Provinciade Buenos Aires y Consejo Nacional de Inves-tigaciones Cientıficas y Tecnicas.

Reig, O.A. 1972. Macrogenioglottus and theSouth American bufonid toads. In W.F. Blair(editor), Evolution in the genus Bufo: 14–36.Austin: University of Texas Press.

Richards, C.M., and W.S. Moore. 1996. A phy-logeny for the African treefrog family Hyper-oliidae based on mitochondrial rDNA. Molec-ular Phylogenetics and Evolution 5: 522–532.

Richards, C.M., and W.S. Moore. 1998. A molec-ular phylogenetic study of the Old World tree-frog family Rhacophoridae. HerpetologicalJournal. London 8: 41–46.

Richards, C.M., R.A. Nussbaum, and C.J. Rax-worthy. 2000. Phylogenetic relationships withinthe Madagascan boophids and mantellids aselucidated by mitochondrial ribosomal genes.African Journal of Herpetology 49: 23–32.

Rieppel, O., and M. de Braga. 1996. Turtles asdiapsid reptiles. Nature. London 384: 453–455.

Risch, J.-P. 1985. The Himalayan salamander andits relatives: a short review of the Pleurodelinae(Amphibia, Caudata, Salamandridae). Journalof the Bengal Natural History Society. New Se-ries 4: 139–143.

Ritgen, F.A. 1828. Versuch einer naturlichenEintheilung der Amphibien. Nova Acta Physi-co-medica Academiae Caesareae Leopoldino-Carolinae Naturae Curiosorum. Halle 14: 277,278.

Ritland, R.M. 1955. Studies on the post-cranialmorphology of Ascaphus truei. II. Journal ofMorphology 97: 215–282.

Rocek, Z. 1981 ‘‘1980’’. Cranial anatomy of frogsof the family Pelobatidae Stannius, 1856, withoutlines of their phylogeny and systematics.Acta Universitatis Carolinae. Biologica. Prague1980: 1–160.

Rocek, Z. 1989. Developmental pattern of the eth-moidal region of the anuran skull. In H.Splechtna (editor), Trends in vertebrate mor-phology: 412–515. Stuttgart: G. Fischer.

Rocek, Z. 1990. Ethmoidal endocranial structuresin primitive tetrapods: their bearing on thesearch for anuran ancestry. Zoological Journalof the Linnean Society. London 99: 389–407.

Rocek, Z., and M. Vesely. 1989. Development ofthe ethmoidal structures of the endocranum in

the anuran Pipa pipa. Journal of Morphology200: 300–319.

Rodel, M.-O., J. Kosuch, M. Veith, and R. Ernst.2003. First record of the genus AcanthixalusLaurent, 1944 from the upper Guinean rain for-est, West Africa, with the description of a newspecies. Journal of Herpetology 37: 43–52.

Rodman, J.E., and J.H. Cody. 2003. The taxonom-ic impediment overcome: NSF’s Partnershipsfor Enhancing Expertise in Taxonomy (PEET)as a model. Systematic Biology 52: 428–435.

Roelants, K., and F. Bossuyt. 2005. Archaeobatra-chian paraphyly and Pangaean diversificationof crown-group frogs. Systematic Biology 54:111–126.

Roelants, K., J. Jiang, and F. Bossuyt. 2004. En-demic ranid (Amphibia: Anura) genera insouthern mountain ranges of the Indian subcon-tinent represent ancient frog lineages: evidencefrom the molecular data. Molecular Phyloge-netics and Evolution 31: 730–740.

Romer, A.S. 1933. Vertebrate paleontology. Chi-cago: University of Chicago Press.

Romer, A.S. 1945. Vertebrate paleontology, 2nded. Chicago: University of Chicago Press.

Ruiz-Carranza, P.M., and J.D. Lynch. 1991a. Ran-as Centrolenidae de Colombia I. Propuesta deuna nueva clasificacion generica. Lozania 57:1–30.

Ruiz-Carranza, P.M., and J.D. Lynch. 1991b. Ran-as Centrolenidae de Colombia II. Nuevas es-pecies de Centrolene de la Cordillera Orientaly Sierra Nevada de Santa Marta. Lozania 58:1–26.

Ruiz-Carranza, P.M., and J.D. Lynch. 1998. RanasCentrolenidae de Colombia XI. Nuevas espe-cies de ranas cristal del genero Hyalinobatrach-ium. Revista de la Academia Colombiana deCiencias Exactas, Fısicas y Naturales 22: 571–586.

Ruta, M., M.I. Coates, and D.L.J. Quicke. 2003.Early tetrapod relationships revisited. Biologi-cal Reviews of the Cambridge PhilosophicalSociety 78: 251–345.

Ruvinsky, I., and L.R. Maxson. 1996. Phyloge-netic relationships among bufonoid frogs (An-ura: Neobatrachia) inferred from mitochondrialDNA sequences. Molecular Phylogenetics andEvolution 5: 533–547.

Saint-Aubain, M.L., de. 1981. Amphibian limbontogeny and its bearing on the phylogeny ofthe group. Zeitschrift fur Zoologische Syste-matik und Evolutionsforschung 19: 175–194.

Salthe, S.N. 1967. The courtship patterns and thephylogeny of the urodeles. Copeia 1967: 100–117.

Sanchız, F.B. 1984. Analisis filogenetico de la tri-bu Alytini (Anura, Discoglossidae) mediante el


estudio de su morfoestructura osea. In H. Hem-mer and J.A. Alcover (editors), Historia bioog-ica del ferreret (Life history of the Mallorcanmidwife toad): 61–108. Mallorca, Spain: Edi-torial Moll.

Sanchız, F.B. 1998. Encyclopedia of paleoherpe-tology, vol. 4. Salientia. Munchen: Dr. Fried-rich Pfeil.

Sanchız, F.B., and I. de la Riva. 1993. Remarkson the tarsus of centrolenid frogs (Amphibia,Anura). Graellsia 49: 115–117.

Sankoff, D. 1975. Minimal mutation trees of se-quences. SIAM Journal on Applied Mathemat-ics 28: 35–42.

Sankoff, D., R.J. Cedergren, and G. Lapalme.1976. Frequency of insertion-deletion, transver-sion, and transition in evolution of 5S ribosom-al RNA. Journal of Molecular Evolution 7:133–149.

San Mauro, D., D.J. Gower, O.V. Oommen, M.Wilkinson, and R. Zardoya. 2004. Phylogeny ofcaecilian amphibians (Gymnophiona) based oncomplete mitochondrial genomes and nuclearRAG1. Molecular Phylogenetics and Evolution33: 413–427.

San Mauro, D., M. Vences, M. Alcobendas, R.Zardoya, and A. Meyer. 2005. Initial diversifi-cation of living amphibians predated the break-up of Pangaea. American Naturalist 165: 590–599.

Santos, J.C., L.A. Coloma, and D.C. Cannatella.2003. Multiple, recurring origins of aposema-tism and diet specialization in poison frogs.Proceedings of the National Academy of Sci-ences of the United States of America 100:12792–12797.

Sarasin, P., and F. Sarasin. 1890. Zur Entiwick-lungsgeschichte und Anatomie der ceylonisch-en Blindwuehle, Ichthyophis glutinosus (Epi-crium glutinosum Aut.). Ergebnisse naturwis-senschaftlicher Forschungen auf Ceylon in denJahren 1884–86. Vol. II. Heft 4. Wiesbaden:C.W. Kreidel.

Savage, J.M. 1973. The geographic distribution offrogs: patterns and predictions. In J.L. Vial (ed-itor), Evolutionary biology of the anurans: con-temporary research on major problems: 351–445. Columbia: University of Missouri Press.

Savage, J.M. 1987. Systematics and distributionof the Mexican and Central American rainfrogsof the Eleutherodactylus gollmeri group (Am-phibia: Leptodactylidae). Fieldiana. Zoology.New Series 33: 1–57.

Savage, J.M., and C.W. Myers. 2002. Frogs of theEleutherodactylus biporcatus group (Leptodac-tylidae) of Central America and northern SouthAmerica, including rediscovered, resurrected,

and new taxa. American Museum Novitates3357: 1–48.

Schauble, C.S., C. Moritz, and R.W. Slade. 2000.A molecular phylogeny for the frog genus Lim-nodynastes (Anura: Myobatrachidae). Molecu-lar Phylogenetics and Evolution 16: 379–391.

Scheel, J.J. 1970. Notes on the biology of the Af-rican tree-toad, Nectophryne afra Buchholz &Peters, 1875 (Bufonidae, Anura) from Fernan-do Poo. Revue de Zoologie et de Botanique Af-ricaines 81: 225–236.

Scheltinga, D.M., B.G.M. Jamieson, D.P. Bick-ford, A.A. Garda, S.N. Bao, and K.R. Mc-Donald. 2002. Morphology of the spermatozoaof the Microhylidae (Anura, Amphibia). ActaZoologica. Stockholm 83: 263–275.

Schmidt, K.P., and R.F. Inger. 1959. Amphibiansexclusive of the genera Afrixalus and Hypero-lius. Exploration du Parc National del’Upemba. Mission G.F. de Witte, en Collabo-ration avec W. Adam, A. Janssens, L. van Meelet R. Verheyen (1946–1949) 56: 1–264.

Schoch, R.R., and A.R. Milner. 2004. Structureand implications of theories on the origins oflissamphibians. In G. Arratia, M.V. Wilson, andR. Cloutier (editors), Recent advances in theorigin and early radiation of vertebrates: 345–377. Munchen: Pfeil.

Scholz, K.P. 1995. Zur Stammesgeschichte derSalamandridae Gray, 1825. eine kladistischeAnalyse anhand von Merkmalen aus Morphol-ogie und Balzverhalten. Acta Biologica Ben-rodis 7: 25–75.

Schuh, R.T. 2003. The Linnaean system and its250-year persistence. Botanical Review 69: 59–79.

Schulte, R. 1989. Nueva especie de rana venenosadel genero Epipedobates registrada en la Cor-dillera Oriental, Departamento de San Martin.Boletın de Lima 11: 41–46.

Schwenk, K., and D.B. Wake. 1993. Prey pro-cessing in Leurognathus marmoratus and theevolution of form and function in desmogna-thine salamanders (Plethodontidae). BiologicalJournal of the Linnean Society 49: 141–162.

Scopoli, G.A. 1777. Introductio ad historiam na-turalem, sistens genera lapidium, planatarum, etanimalium hactenus detecta, caracteribus essen-tialibus donata, in tribus divisa, subinde ad le-ges naturae. Prague: Gerle.

Scott, E. 2002. Phylogenetic relationships of thesubfamily Petropedetinae Noble, 1931 (Anura:Ranidae): a simultaneous analysis of morpho-logical and molecular data. Ph.D. dissertation.Department of Zoology, University of theWestern Cape, Bellville, South Africa.

Sever, D.M. 1990. Cloacal anatomy of female sal-amanders of the plethodontid subfamily Des-


mognathinae (Amphibia: Urodela). Transac-tions of the American Microscopical Society109: 193–204.

Sever, D.M. 1991a. Comparative anatomy andphylogeny of the cloacae of salamanders (Am-phibia: Caudata). 1. Evolution at the family lev-el. Herpetologica 47: 165–193.

Sever, D.M. 1991b. Comparative anatomy andphylogeny of the cloacae of salamanders (Am-phibia: Caudata). 2. Cryptobranchidae, Hyno-biidae, and Sirenidae. Journal of Morphology207: 283–301.

Sever, D.M. 1992. Comparative anatomy and phy-logeny of the cloacae of salamanders (Amphib-ia: Caudata). VI. Ambystomatidae and Dicamp-todontidae. Journal of Morphology 212: 305–322.

Sever, D.M. 1994. Comparative anatomy and phy-logeny of the cloacae of salamanders (Amphib-ia: Caudata). VII. Plethodontidae. Herpetologi-cal Monographs 7: 276–337.

Sever, D.M., E.A. Heinz, P.A. Lempart, and M.S.Taghon. 1990. Phylogenetic significance of thecloacal anatomy of female bolitoglossine sala-manders (Plethodontidae: tribe Bolitoglossini).Herpetologica 46: 431–446.

Shaffer, H.B., J.M. Clark, and F. Kraus. 1991.When molecules and morphology clash: a phy-logenetic analysis of the North American am-bystomatid salamanders (Caudata: Ambysto-matidae). Systematic Zoology 40: 284–303.

Sharrock, G., and J. Felsenstein. 1975. Finding allmonothetic subsets of a taxonomic group. Sys-tematic Zoology 24: 373–377. [Cited as ‘‘1969.manuscript in preparation’’ by Liem, 1970.]

Sheil, C.A., J.R. Mendelson, III, and H.R. da Sil-va. 2001. Phylogenetic relationships of the spe-cies of Neotropical horned frogs, genus Hemi-phractus (Anura: Hylidae: Hemiphractinae),based on evidence from morphology. Herpeto-logica 57: 203–214.

Shubin, N.H., and F.A. Jenkins. 1995. An earlyJurassic jumping frog. Nature. London 377:49–52.

Silva, A.P.Z., C.F.B. Haddad, and S. Kasahara.2003. Chromosome banding in Macrogenioglot-tus alipioi Carvalho, 1946 (Amphibia, Anura,Leptodactylidae), with comments on its taxo-nomic position. Boletim do Museu Nacional,Rio de Janeiro. Nova Serie, Zoologia. 499: 1–9.

Silverstone, P.A. 1975. A revision of the poison-arrow frogs of the genus Dendrobates Wagler.Natural History Museum of Los Angeles Coun-ty Science Bulletin 21: 1–55.

Simmons, M.P. 2004. Independence of alignmentand tree search. Molecular Phylogenetics andEvolution 31: 874–879.

Simmons, M.P., and H. Ochoterena. 2000. Gapsas characters in sequence-based phylogeneticanalyses. Systematic Biology 49: 369–381.

Sinsch, U., and N. Juraske. 1995. Reassessmentof central Peruvian Telmatobiinae (genera Ba-trachophrynus and Telmatobius) II. Allozymesand phylogenetic relationships. Alytes 13: 52–66.

Sinsch, U., A.W. Salas, and V. Canales. 1995. Re-assessment of central Peruvian Telmatobiinae(genera Batrachophrynus and Telmatobius) I.Morphometry and classification. Alytes 13: 14–44.

Sites, J.W., Jr., M. Morando, R. Highton, F. Huber,and R.E. Jung. 2004. Phylogenetic relationshipsof the endangered Shenandoah Salamander(Plethodon shenandoah) and other salamandersof the Plethodon cinereus group (Caudata:Plethodontidae). Journal of Herpetology 38:96–105.

Slabbert, G.K., and W.A. Maree. 1945. The cra-nial morphology of the Discoglossidae and itsbearing upon the phylogeny of the primitiveAnura. Annals of the University of Stellen-bosch 23A: 91–97.

Slowinski, J.B. 1998. The number of multiplealignments. Molecular Phylogenetics and Evo-lution 10: 264–266.

Smith, M.A. 1930. The Reptilia and Amphibia ofthe Malay Peninsula. A supplement to G.A.Boulenger’s Reptilia and Batrachia, 1912. Bul-letin of the Raffles Museum 3: i–xviii, 1–149.

Sokol, O. 1975. The phylogeny of anuran larvae:a new look. Copeia 1975: 1–23.

Sokol, O. 1977. A subordinal classification offrogs (Amphibia: Anura). Journal of Zoology.London 182: 505–508.

Sokol, O. 1981. The larval chondrocranium of Pe-lodytes punctatus, with a review of tadpolechondrocrania. Journal of Morphology 169:161–183.

Starrett, P.H. 1973. Evolutionary patterns in larvalmorphology. In J.L. Vial (editor), Evolutionarybiology of the anurans: contemporary researchon major problems: 251–271. Columbia: Uni-versity of Missouri Press.

Steindachner, F. 1867. Amphibien. In Reise derosterreichischen Fregatte Novara um die Erdein den Jahren 1857, 1858, 1859 unter den Ba-fehlen des Commodore B. von Wullerstorf-Ur-bair, Zoologischer Theil. 1: 1–98. Wien: Kais-erlich-Konigliche Hof- und Staatsdruckerei; inCommission bei K. Gerold’s Sohn.

Steinfartz, S., U.W. Hwang, D. Tautz, M. Oz, andM. Veith. 2002. Molecular phylogeny of thesalamandrid genus Neurergus: evidence for an


intrageneric switch of reproductive biology.Amphibia-Reptilia 23: 419–431.

Stejneger, L. 1907. Herpetology of Japan and ad-jacent territory. Bulletin of the United StatesNational Museum 58: i–xx, 1–577.

Stejneger, L., and T. Barbour. 1917. A check listof North American amphibians and reptiles.Cambridge, MA: Harvard University Press.

Stephenson, E.M., E.S. Robinson, and N.G. Ste-phenson. 1974. Inter-specific relationships ofLeiopelma (Amphibia: Anura): further karyo-logical evidence. Experientia 30: 1248–1250.

Stephenson, N.G. 1951. Observations on the de-velopment of the amphicoelous frogs, Leiopel-ma and Ascaphus. Journal of the Linnean So-ciety of London. Zoology 42: 18–28.

Stoll, N. 1961. Introduction. In InternationalCommission of Zoological Nomenclature (edi-tors), International code of zoological nomen-clature adopted by the XV International Con-gress of Zoology: vii–xvii. London: Interna-tional Trust for Zoological Nomenclature.

Stuart, B.L., and T. Chan-ard. 2005. Two newHuia (Amphibia: Ranidae) from Laos and Thai-land. Copeia 2005: 279–289.

Stuart, S.N., J.S. Chanson, N.A. Cox, B.E. Young,A.S.L. Rodrigues, D.L. Fischman, and R.W.Waller. 2004. Status and trends of amphibiandeclines and extinctions worldwide. Science306: 1783–1786.

Sumida, M., A. Allison, and M. Nishioka. 2000a.Evolutionary relationships among 12 speciesbelonging to three genera of the family Micro-hylidae in Papua New Guinea revealed by al-lozyme analysis. Biochemical Systematics andEcology 28: 721–736.

Sumida, M., Y. Kondo, Y. Kanamori, and M. Ni-shioka. 2002. Inter- and intraspecific evolution-ary relationships of the rice frog Rana limno-charis and the allied species R. cancrivora in-ferred from crossing experiements and mito-chondrial DNA sequences of the 12S and 16SrRNA genes. Molecular Phylogenetics andEvolution 25: 293–305.

Sumida, M., M. Ogata, and M. Nishioka. 2000b.Molecular phylogenetic relationships of pondfrogs distributed in the Palearctic Region in-ferred from DNA sequences of mitochondrial12S ribosomal RNA and cytochrome b genes.Molecular Phylogenetics and Evolution 16:278–285.

Swofford, D.L. 2002. PAUP*. Phylogenetic anal-ysis using parsimony (*and other methods),version 4.0 beta. Sunderland, MA: Sinauer As-sociates.

Swofford, D.L., G.J. Olsen, P.J. Waddell, andD.M. Hillis. 1996. Phylogenetic inference. In

D.M. Hillis, C. Moritz, and B.K. Mable (edi-tors), Molecular systematics: 407–514. Sunder-land, MA: Sinauer Associates.

Tamarunov, L.P. 1964a. Salientia. In Y.A. Orlov(editor), Osnovy paleontologii: spravochnikdlia paleontologov i geologov SSSR, vol. 12.Amphibia–Aves: 125–133. Moscow: Nauka.

Tamarunov, L.P. 1964b. Lepospondyli. In Y.A.Orlov (editor), Osnovy paleontologii: spravo-chnik dlia paleontologov i geologov SSSR, vol.12. Amphibia–Aves: 144–164. Moscow: Nau-ka.

Tanaka-Ueno, T., M. Matsui, S.-L. Chen, O. Tak-enaka, and H. Ota. 1998a. Phylogenetic rela-tionships of brown frogs from Taiwan and Ja-pan assessed by mitochondrial cytochrome bgene sequences (Rana: Ranidae). ZoologicalScience. Tokyo 15: 283–288.

Tanaka-Ueno, T., M. Matsui, T. Sato, S. Takenaka,and O. Takenaka. 1998b. Phylogenetic relation-ships of brown frogs with 24 chromosomesfrom Far East Russia and Hokkaido assessedby mitochondrial cytochrome b gene sequences(Rana: Ranidae). Zoological Science. Tokyo15: 289–294.

Tandy, M., and R. Keith. 1972. Bufo of Africa. InW.F. Blair (editor), Evolution in the genus Bufo:119–170. Austin: University of Texas Press.

Taylor, E.H. 1951. Two new genera and a newfamily of tropical American frogs. Proceedingsof the Biological Society of Washington 64:33–40.

Taylor, E.H. 1968. The caecilians of the world: ataxonomic review. Lawrence: University ofKansas Press.

Taylor, E.H. 1969a. A new family of AfricanGymnophiona. University of Kansas ScienceBulletin 48: 297–305.

Taylor, E.H. 1969b. Skulls of Gymnophiona andtheir significance in the taxonomy of the group.University of Kansas Science Bulletin 48: 585–687.

Thibaudeau, G., and R.I. Altig. 1999. Endotrophicanurans. Development and evolution. In R.W.McDiarmid and R. Altig (editors), Tadpoles:the biology of anuran larvae: 170–188. Chica-go: University of Chicago Press.

Thompson, J.D., T.J. Gibson, F.J. Plewniak, F., andD.G. Higgins. 1997. The ClustalX windows in-terface: flexible strategies for multiple sequencealignment aided by quality analysis tools. Nu-cleic Acids Research 24 4876–4882.

Thompson, J.D., D.G. Higgins, and T.J. Gibson.1994. CLUSTAL W: improving the sensitivityof progressive multiple sequence alignmentsthrough sequence weighting, position specific


gap penalties and weight matrix choice. Nu-cleic Acids Research 22: 4673–4680.

Tian, W., and Q. Hu. 1985. Taxonomical studieson the primitive anurans of the HengduanMountains, with descriptions of a new subfam-ily and subdivision of Bombina. Acta Herpe-tologica Sinica, New Series 4: 219–224.

Tihen, J.A. 1958. Comments on the osteology andphylogeny of ambystomatid salamanders. Bul-letin of the Florida Museum of Natural History.Biological Sciences 3: 1–50.

Tihen, J.A. 1960. Two new genera of African bu-fonids, with remarks on the phylogeny of re-lated genera. Copeia 1960: 225–233.

Tihen, J.A. 1965. Evolutionary trends in frogs.American Zoologist 5: 309–318.

Tilley, S.G., and J. Bernardo. 1993. Life historyevolution in plethodontid salamanders. Herpe-tologica 49: 154–163.

Ting, H.-P., and M.-C. T’sai. 1979. A new speciesof frog (Rana minimus) from Fujian Province.Acta Zootaxonomica Sinica 4: 297–300. [InChinese with English abstract.]

Titus, T.A., and A. Larson. 1995. A molecularphylogenetic perspective on the evolutionaryradiation of the salamander family Salamandri-dae. Systematic Biology 44: 125–151.

Titus, T.A., and A. Larson. 1996. Molecular phy-logenetics of desmognathine salamanders (Cau-data: Plethodontidae): a reevaluation of evolu-tion in ecology, life history, and morphology.Systematic Biology 45: 451–472.

Trewevas, E. 1933. The hyoid and larynx of theAnura. Philosophical Transactions of the RoyalSociety of London, B, Biological Sciences 222:401–527.

Trontelj, P., and S. Goricki. 2003. Monophyly ofthe family Proteidae (Amphibia: Caudata) test-ed by phylogenetic analysis of mitochondrial12S rDNA sequences. Natura Croatica. Zagreb12: 113–120.

Trueb, L. 1993. Patterns of cranial diversityamong the Lissamphibia (Amphibia, Temnos-pondyli). In J. Hanken and B.K. Hall (editors),The skull: 255–343. Chicago: University ofChicago Press.

Trueb, L., and D.C. Cannatella. 1986. Systemat-ics, morphology, and phylogeny of genus Pipa(Anura: Pipidae). Herpetologica 42: 412–449.

Trueb, L., and R. Cloutier. 1991. A phylogeneticinvestigation of the inter- and intrarelationshipsof the Lissamphibia (Amphibia: Temnospon-dyli). In H.P. Schultze and L. Trueb (editors),Origins of the higher groups of tetrapods: con-troversy and consensus: 223–313. Ithaca, NY:Cornell University Press.

Tschudi, J.J., von. 1838. Classification der Batra-chier mit Berucksichtigung der fossilen Thieredieser Abtheilung der Reptilien. Neuchatel: Pe-titpierre.

Tschudi, J.J., von. 1845. Reptilium conspectusquae in Republica Peruana reperiuntur et ple-raquae observata vel collecta sunt in itinere aDr. J.J. de Tschudi. Archiv fur Naturgeschichte11: 150–170.

Tyler, M.J. 1971a. The occurrence of the muscu-lus cutaneous pectoris in the Anura. Herpeto-logica 27: 150–152.

Tyler, M.J. 1971b. Observations on anuran myo-integumental attachments associated with thevocal sac apparatus. Journal of Natural History5: 225–231.

Tyler, M.J. 1971c. The phylogenetic significanceof vocal sac structure in hylid frogs. Universityof Kansas Publications. Museum of NaturalHistory 19: 319–360.

Tyler, M.J. 1972. Superficial mandibular muscu-lature, vocal sacs and the phylogeny of Austra-lo-Papuan leptodactylid frogs. Records of theSouth Australian Museum 16: 1–20.

Tyler, M.J. 1979. Herpetofauna relationships ofSouth America with Australia. In W.E. Duell-man (editor), The South American herpetofau-na: its origin, evolution, and dispersal. Univer-sity of Kansas Museum of Natural History,Monograph 7: 73–106.

Tyler, M.J. 1982. Frogs, 2nd ed. Sydney: Collins.Tyler, M.J. 1985. Reproductive modes in Austra-

lian Amphibia. In G. Grigg, R. Shine, and H.Ehman (editors), Biology of Australasian frogsand reptiles: 265–267. Sydney: Royal Zoolog-ical Society of New South Wales.

Tyler, M.J. 1989. Australian frogs. Ringwood,Victoria, Australia: Viking O’Neil.

Tyler, M.J., and M.M. Davies. 1978. Species-groups within the Australopapuan hylid froggenus Litoria Tschudi. Australian Journal ofZoology, Supplementary Series 63: 1–47.

Tyler, M.J., and W.E. Duellman. 1995. Superficialmandibular musculature and vocal sac structurein hemiphractine hylid frogs. Journal of Mor-phology 224: 65–71.

Uzzell, T., and T.J. Post. 1986. Rana temporariais not a member of the Rana boylii group. Sys-tematic Zoology 35: 414–421.

Vallan, D., M. Vences, and F. Glaw. 2003. Twonew species of the Boophis mandraka complex(Anura, Mantellidae) from the Andasibe regionin eastern Madagascar. Amphibia-Reptilia 24:305–319.

Van der Hoeven, J. 1833. Handboek der dierkun-de, grondbeginsels der natuurlijke geschiedenis


van het dierenrijk, tweeden deels, tweede stuk.Amsterdam: C.G. Sulpke.

Van der Meijden, A., M. Vences, S. Hoegg, andA. Meyer. 2005. A previously unrecognized ra-diation of ranid frogs in southern Africa re-vealed by nuclear and mitochondrial DNA se-quences. Molecular Phylogenetics and Evolu-tion 37: 674–685. [Seen as an electronic/pdfpreprint available from the publisher.]

Van der Meijden, A., M. Vences, and A. Meyer.2004. Novel phylogenetic relationships of theenigmatic brevicipitine and scaphiophryninetoads as revealed by sequences from the nucle-ar Rag-1 gene. Proceedings of the Royal Soci-ety of London. B (Supplement—Biology Let-ters) 271: S378–S381.

Van Dijk, D.E. 2001. Osteology of the ranoid bur-rowing African anurans Breviceps and Hemi-sus. African Zoology. Pretoria 36: 137–141.

Van Gelder, R.G. 1977. Mammalian hybrids andgeneric limits. American Museum Novitates2635: 1–25.

Veith, M., and S. Steinfartz. 2004. When non-monophyly results in taxonomic consequenc-es—the case of Mertensiella within the Sala-mandridae (Amphibia: Urodela). Salamandra40: 67–80.

Vences, M., F. Andreone, F. Glaw, and J.E. Ran-drianirina. 2003a. Molecular and bioacousticdivergence in Mantidactylus granulatus and M.zavona n. sp. (Anura: Mantellidae): bearingsfor the biogeography of northern Madagascar.African Zoology. Pretoria 38: 67–78.

Vences, M., and F. Glaw. 2001. When moleculesclaim for taxonomic changes: new proposals onthe classification of Old World treefrogs (Am-phibia, Anura, Ranoidea). Spixiana. Munchen24: 85–92.

Vences, M., and F. Glaw. 2004. Revision of thesubgenus Chonomantis (Anura: Mantellidae:Mantidactylus) from Madagascar, with descrip-tion of two new species. Journal of Natural His-tory. London 38: 77–118.

Vences, M., F. Glaw, F. Andreone, R. Jesu, and G.Schimmenti. 2002. Systematic revision of theenigmatic Malagasy broad-headed frogs (Lau-rentomantis Dubois, 1980) and their phyloge-netic position within the endemic mantellid ra-diation of Madagascar. Bijdragen tot de Dier-kunde 70: 191–212.

Vences, M., F. Glaw, J. Kosuch, I. Das, and M.Veith. 2000a. Polyphyly of Tomopterna (Am-phibia: Ranidae) based on sequences of the mi-tochondrial 16S and 12S rRNA genes, and eco-logical biogeography of Malagasy relict am-phibian groups. In W.R. Lourenco and S.M.Goodman (editors), Diversite et endeemisme a

Madagascar/Diversity and endemism in Mada-gascar: 229–242. Memoires de la Societe deBiogeographie. Paris.

Vences, M., J. Kosuch, R. Boistel, C.F.B. Haddad,E. La Marca, and S. Lotters. 2003b. Convergentevolution of aposematic coloration in Neotrop-ical poison frogs: a molecular phylogenetic per-spective. Organisms, Diversity & Evolution 3:215–226.

Vences, M., J. Kosuch, F. Glaw, W. Bohme, andM. Veith. 2003c. Molecular phylogeny of hy-peroliid treefrogs: biogeographic origin of Mal-agasy and Seychellean taxa and re-analysis offamilial paraphyly. Journal of Zoological Sys-tematics and Evolutionary Research 41: 205–213.

Vences, M., J. Kosuch, S. Lotters, A. Widmer,K.H. Jungfer, J. Kohler, and M. Veith. 2000b.Phylogeny and classification of poison frogs(Amphibia: Dendrobatidae), based on mito-chondrial 16S and 12S ribosomal RNA genesequences. Molecular Phylogenetics and Evo-lution 15: 34–40.

Vences, M., D.R. Vieites, F. Glaw, H. Brinkmann,J. Kosuch, M. Veith, and A. Meyer. 2003d.Multiple overseas dispersal in amphibians. Pro-ceedings of the Royal Society of London. Se-ries B, Biological Sciences 270: 2435–2442.

Vences, M., S. Wanke, G. Odierna, J. Kosuch, andM. Veith. 2000c. Molecular and karyologicaldata on the south Asian ranid genera Indirana,Nyctibatrachus and Nannophrys (Anura: Rani-dae). Hamadryad 25: 75–82.

Wagler, J.G. 1828. Vorlaufige Uebersicht des Ger-uftes, sowie Untungigung feines Systema am-phibiorum. Isis von Oken 21: 859–861.

Wagler, J.G. 1830. Naturliches System der Am-phibien, mit vorangehender Classification derSaugthiere und Vogel. Ein Beitrag zur verglei-chenden Zoologie. Munchen, Stuttgart and Tu-bingen: J.G. Cotta.

Wake, D.B. 1966. Comparative osteology andevolution of the lungless salamanders, familyPlethodontidae. Memoires of the Southern Cal-ifornia Academy of Sciences 4: 1–111.

Wake, D.B. 1993. Phylogenetic and taxonomic is-sues relating to salamanders of the familyPlethodontidae. Herpetologica 49: 229–237.

Wake, D.B., and P. Elias. 1983. New genera andnew species of Central American salamanders,with a review of the tropical genera (Amphibia,Caudata, Plethodontidae). Natural History Mu-seum of Los Angeles County Contributions inScience. 345: 1–19.

Wake, D.B., and J.F. Lynch. 1976. The distribu-tion, ecology and evolutionary history of pleth-


odontid salamanders in tropical America. Nat-ural History Museum of Los Angeles CountyScience Bulletin 175: 1–65.

Wake, D.B., L.R. Maxson, and G.Z. Wurst. 1978.Genetic differentiation, albumin evolution, andtheir biogeographic implications in plethodon-tid salamanders of California and southern Eu-rope. Evolution 32: 529–539.

Wake, M.H. 1977. Fetal maintenance and its evo-lutionary significance in the Amphibia: Gym-nophiona. Journal of Herpetology 11: 379–386.

Wake, M.H. 1980. The reproductive biology ofNectophrynoides malcolmi (Amphibia: Bufon-idae), with comments on the evolution of re-productive modes in the genus Nectophryno-ides. Copeia 1980: 193–209.

Wake, M.H. 1993. Non-traditional characters inthe assessment of caecilian phylogenetic rela-tionships. Herpetological Monographs 7: 42–55.

Wake, M.H., G. Parra-Olea, and J.P.-Y. Shee.2005. Biogeography and molecular phylogenyof certain New World caecilians. In M.A. Don-nelly, B.I. Crother, C. Guyer, M.H. Wake, andM.E. White (editors), Ecology and evolution inthe tropics: a herpetological perspective: 48–64. Chicago: University of Chicago Press.

Walls, J.G. 1994. Jewels of the rainforest—poisonfrogs of the family Dendrobatidae. NeptuneCity, New Jersey: T.F.H. Publications.

Wang, L., and T. Jiang. 1994. On the complexityof multiple sequence alignment. Journal ofComputational Biology 1: 337–348.

Wassersug, R.J. 1984. The Pseudohemisus tad-pole: a morphological link between microhylid(Orton Type 2) and ranoid (Orton Type 4) lar-vae. Herpetologica 40: 138–148.

Wassersug, R.J., and W.R. Heyer. 1983. Morpho-logical correlates of subaerial existence in lep-todactylid tadpoles associated with flowing wa-ter. Canadian Journal of Zoology 61: 761–769.

Wassersug, R.J., and W.F. Pyburn. 1987. The bi-ology of the Pe-ret toad, Otophryne robusta(Microhylidae), with special consideration ofits fossorial larva and systematic relationships.Zoological Journal of the Linnean Society.London 91: 137–169.

Wei, G., N. Xu, D. Li, G. Wu, and X. Song. 1993.Karyotype C-band and Ag-NORs study of threestink frogs. Asiatic Herpetological Research 5:45–50.

Werner, F. 1896. Beitrage zur Kenntniss der Rep-tilien und Batrachier von Centralamerika undChile, sowie einiger seltenerer Schlangenarten.Verhandlungen des Zoologisch-BotanischenVereins in Wien 46: 344–365.

Wheeler, Q.D., P.H. Raven, and E.O. Wilson.2004. Taxonomy: impediment or expedient?Science 303: 285.

Wheeler, W.C. 1992. Extinction, sampling, andmolecular phylogenetics. In M.J. Novacek andQ.D. Wheeler (editors), Extinction and phylog-eny: 205–215. New York: Columbia UniversityPress.

Wheeler, W.C. 1994. Sources of ambiguity in nu-cleic acid sequence alignment. In B. Schier-water, B. Streit, G.P. Wagner, and R. DeSalle(editors), Molecular ecology and evolution: ap-proaches and applications: 323–352. Basel,Switzerland: Birkhauser.

Wheeler, W.C. 1995. Sequence alignment, param-eter sensitivity, and the phylogenetic analysis ofmolecular data. Systematic Biology 44: 321–331.

Wheeler, W.C. 1996. Optimization alignment: theend of multiple sequence alignment in phylo-genetics? Cladistics 12: 1–9.

Wheeler, W.C. 1998. Alignment characters, dy-namic programing and heuristic solutions. In R.DeSalle and B. Schierwater (editors), Molecu-lar approaches to ecology and evolution, 2nded.: 243–251. Basel, Switzerland: Birkhauser.

Wheeler, W.C. 1999. Fixed character states andthe optimization of molecular sequence data.Cladistics 15: 379–385.

Wheeler, W.C. 2000. Heuristic reconstruction ofhypothetical-ancestral DNA sequences: se-quence alignment vs optimization. In R.W.Scotland and R.T. Pennington (editors), Ho-mology and systematics: 106–113. New York:Taylor and Francis.

Wheeler, W.C. 2001. Homology and the optimi-zation of DNA sequence data. Cladistics 17:S3–S11.

Wheeler, W.C. 2002. Optimization alignment:down, up, error, and improvements. In R.DeSalle, G. Giribet, and W.C. Wheeler (edi-tors), Techniques in molecular systematics andevolution: 55–69. Basel, Switzerland: Birkhau-ser.

Wheeler, W.C. 2003a. Iterative pass optimizationof sequence data. Cladistics 19: 254–260.

Wheeler, W.C. 2003b. Implied alignment: a syn-apomorphy-based multiple sequence alignmentmethod. Cladistics 19: 261–268.

Wheeler, W.C. 2003c. Search-based optimization.Cladistics 19: 348–355.

Wheeler, W.C., and D.S. Gladstein. 1992. Malign,version 1.2. New York: Computer software dis-tributed by the authors.

Wheeler, W.C., D.S. Gladstein, and J. De Laet.1996–2003. POY: Phylogeny reconstruction viaoptimization of DNA data. New York: Com-


puter software distributed by the authors andfrom the American Museum of Natural Histo-ry: ftp://ftp.amnh.org/pub/molecular/poy.

Widmer, A., S. Lotters, and K.-H. Jungfer. 2000.A molecular phylogenetic analysis of the Neo-tropical dart-poison frog genus Phyllobates(Amphibia: Dendrobatidae). Naturwissenschaf-ten. Berlin 87: 559–562.

Wieczorek, A.M., A. Channing, and R.C. Drewes.1998. A review of the taxonomy of the Hyper-olius viridiflavus complex. Herpetological Jour-nal. London 8: 29–34.

Wieczorek, A.M., R.C. Drewes, and A. Channing.2000. Biogeography and evolutionary historyof Hyperolius species: application of molecularphylogeny. Journal of Biogeography. Oxford27: 1231–1243.

Wieczorek, A.M., R.C. Drewes, and A. Channing.2001. Phylogenetic relationships within the Hy-perolius viridiflavus complex (Anura: Hypero-liidae), and comments on taxonomic status.Amphibia-Reptilia 22: 155–166.

Wied-Neuwied, M.A.P., Prinz zu. 1825. Beitragezur Naturgeschichte von Brasilien, vol. 1 (Ver-zeichniss der Amphibien). Weimar, Germany:Gr. H.S. priv. Landes-Industrie-Comptoir.

Wiedersheim, R. 1877. Das Kopfskelet der Uro-delen (Fortsetzung). Morphologisches Jahr-buch. Leipzig 3: 459–548.

Wiens, J.J. 1989. Ontogeny of the skeleton ofSpea bombifrons (Anura: Pelobatidae). Journalof Morphology 202: 29–51.

Wiens, J.J., R.M. Bonett, and P.T. Chippindale.2005. Ontogeny discombobulates phylogeny:paedomorphosis and higher-level salamanderrelationships. Systematic Biology 54: 91–110.

Wild, E.R. 1995. New genus and species of Am-azonian microhylid frog with a phylogeneticanalysis of New World genera. Copeia 1995:837–849.

Wild, E.R. 1997. Description of the adult skeletonand developmental osteology of the hyperossi-fied horned frog, Ceratophrys cornuta (Anura:Leptodactylidae). Journal of Morphology 232:169–206.

Wild, E.R. 1999. Description of the chondrocra-nium and osteogenesis of the chacoan burrow-ing frog, Chacophrys pierotti (Anura: Lepto-dactylidae). Journal of Morphology 242: 229–249.

Wiley, E.O. 1981. Phylogenetics. The theory andpractice of phylogenetic systematics. NewYork: Wiley Interscience.

Wilkinson, J.A., and R.C. Drewes. 2000. Char-acter assessment, genus level boundaries, andphylogenetic analysis of the family Rhacophor-idae: a review and present day status. Contem-

porary Herpetology 2000: 1–14. [Electronicjournal available at http://www.nhm.ac.uk/hostedpsites/ch/ch/index.htm.]

Wilkinson, J.A., R.C. Drewes, and O.L. Tatum.2002. A molecular phylogenetic analysis of thefamily Rhacophoridae with an emphasis on theAsian and African genera. Molecular Phyloge-netics and Evolution 24: 265–273.

Wilkinson, J.A., M. Matsui, and T. Terachi. 1996.Geographic variation in a Japanese tree frog(Rhacophorus arboreus) revealed by PCR-aid-ed restriction site analysis of mtDNA. Journalof Herpetology 30: 418–423.

Wilkinson, M. 1991. Adult tooth crown morphol-ogy in the Typhlonectidae (Amphibia: Gym-nophiona): a reinterpretation of variation and itssignificance. Zeitschrift fur Zoologische Syste-matik und Evolutionsforschung 29: 304–311.

Wilkinson, M. 1997. Characters, congruence andquality: a study of neuroanatomical and tradi-tional data in caecilian phylogeny. BiologicalReviews of the Cambridge Philosophical Soci-ety 72: 423–470.

Wilkinson, M., S.P. Loader, D.J. Gower, J.A.Sheps, and B.L. Cohen. 2003. Phylogenetic re-lationships of African caecilians (Amphibia:Gymnophiona): insights from mitochondrialrRNA gene sequences. African Journal of Her-petology 52: 83–92.

Wilkinson, M., and R.A. Nussbaum. 1996. On thephylogenetic position of the Uraeotyphlidae(Amphibia: Gymnophiona). Copeia 1996: 550–562.

Wilkinson, M., and R.A. Nussbaum. 1999. Evo-lutionary relationships of the lungless caecilianAtretochoana eiselti (Amphibia: Gymnophiona:Typhlonectidae). Zoological Journal of the Lin-nean Society. London 126: 191–223.

Wilkinson, M., J.A. Sheps, O.V. Oommen, andB.L. Cohen. 2002. Phylogenetic relationshipsof Indian caecilians (Amphibia: Gymnophiona)inferred from mitochondrial rRNA gene se-quences. Molecular Phylogenetics and Evolu-tion 23: 401–407.

Wilkinson, M., J. Thorley, and M.J. Benton. 1997.Uncertain turtle relationships. Nature. London387: 466.

Withgott, J. 2000. Is it ‘‘So long, Linnaeus’’?BioScience 50: 646–651.

Wogel, H., P.A. Abrunhosa, and J.P. Pombal, Jr.2004. Vocalizations and aggressive behavior ofPhyllomedusa rohdei (Anura: Hylidae). Her-petological Review 35: 239–243.

Wu, L., R. Xu, Q. Dong, D. Li, and J. Liu. 1983.A new species of Rana and records of amphib-ians from Guizhou Province. Acta Zoologica


Sinica 29: 66–70. [In Chinese, with Englishsummary.]

Wu, S.-H. 1994. Phylogenetic relationships, high-er classification and historical biogeography ofthe microhyloid frogs (Lissampibia: Anura:Brevicipitidae and Microhylidae). Ph.D. disser-tation. Department of Zoology, University ofMichigan, Ann Arbor.

Xie, F., and Z. Wang. 2000. [Review of the sys-tematics of pelobatids.] Cultum HerpetologicaSinica 8: 356–370. [In Chinese.]

Yang, D. (editor), 1991a. [The Amphibia-fauna ofYunnan.] Beijing, China: China Forestry Pub-lishing House. [In Chinese.]

Yang, D. 1991b. Phylogenetic systematics of theAmolops group of ranid frogs of southeasternAsia and the Greater Sunda Islands. Fieldiana.Zoology. New Series 63: 1–42.

Yang, D., and S. Li. 1980. A new species of thegenus Rana from Yunnan. Zoological Research.Kunming 1: 261–264.

Yokoyama, S., H. Zhang, F.B. Radlwimmer, andN.S. Blow. 1999. Adaptive evolution of colorvision of the Comoran coelacanth (Latimeriachalumnae). Proceedings of the National Acad-emy of Sciences of the United States of Amer-ica 96: 6279–6284.

Young, B.E., K.R. Lips, J.K. Reaser, R. Ibanez D.,A.W. Salas, J.R. Cedeno, L.A. Coloma, S.R.Ron, E. La Marca, J.R. Meyer, A. Munoz, F.Bolanos, G. Chaves, and D. Romo. 2001. Pop-ulation declines and priorities for amphibianconservation in Latin America. ConservationBiology 15: 1213–1223.

Zacj, I., and J.W. Arntzen. 1999. Phylogenetic re-lationships of the European newts (genus Tri-turus) tested with mitochondrial DNA sequencedata. Contributions to Zoology. Amsterdam 68:78–81.

Zaldıvar-Riveron, A., V. Leon-Regagnon, and A.Nieto-Montes de Oca. 2004. Phylogeny of theMexican coastal leopard frogs of the Rana ber-landieri group based on mtDNA sequences.Molecular Phylogenetics and Evolution 30: 38–49.

Zardoya, R., and A. Meyer. 1996. Evolutionaryrelationships of the coelacanth, lungfishes, andtetrapods based on the 28S ribosomal RNAgene. Proceedings of the National Academy ofSciences United States of America 93: 5449–5454.

Zardoya, R., and A. Meyer. 1998. Complete mi-tochondrial genome suggests diapsid affinitiesof turtles. Proceedings of the National Acade-my of Sciences of the United States of America95: 14226–14231.

Zardoya, R., and A. Meyer. 2000. Mitochondrialevidence on the phylogenetic position of

caecilians (Amphibia: Gymnophiona). Genetics155: 765–775.

Zardoya, R., and A. Meyer. 2001. On the originof and phylogenetic relationships among livingamphibians. Proceedings of the National Acad-emy of Sciences of the United States of Amer-ica 98: 7380–7383.

Zhang, P., Y.Q. Chen, Y.F. Liu, H.-Y. Zhou, andL.H. Qu. 2003a. The complete mitochondrialgenome of the Chinese giant salamander, An-drias davidianus (Amphibia: Caudata). Gene311: 93–98.

Zhang, P., Y.Q. Chen, H.-Y. Zhou, X.L. Wang, andL.H. Qu. 2003b. The complete mitochondrialgenome of a relic salamander, Ranodon sibiri-cus (Amphibia: Caudata) and implications foramphibian phylogeny. Molecular Phylogeneticsand Evolution 28: 620–626.

Zhao, E. 1994. A study on vomerine teeth patternof the genus Liua, with revised diagnoses ofLiua and Ranodon (Caudata: Hynobiidae).Sichuan Journal of Zoology 13: 162–166.

Zhao, E., and S.-Q. Li. 1984. A new species ofthe genus Platymantis (Amphibia: Ranidae)from Xizang. Acta Herpetologica Sinica, NewSeries 3: 55–57. [In Chinese with English sum-mary.]

Ziegler, M., and M. Vences. 2002. The tadpole ofRhacophorus verrucosus Boulenger, 1893,from Vietnam (Amphibia: Anura: Rhacophori-dae). Faunistische Abhandlungen. StaatlichesMuseum fur Tierkunde in Dresden 22: 319–327.

Zug, G.R., L.J. Vitt, and J.P. Caldwell. 2001. Her-petology: an introductory biology of amphibi-ans and reptiles. New York: Academic Press.

Zweifel, R.G. 1955. Ecology, distribution, andsystematics of frogs of the Rana boylei group.University of California Publications in Zool-ogy 54: 207–292.

Zweifel, R.G. 1956. Two pelobatid frogs from theTertiary of North America and their relation-ships to fossil and recent forms. American Mu-seum Novitates 1762: 1–45.

Zweifel, R.G. 1971. Results of the Archbold Ex-peditions. No. 96. Relationships and distribu-tion of Genyophryne thomsoni, a microhylidfrog of New Guinea. American Museum Nov-itates 2469: 1–13.

Zweifel, R.G. 1972. Results of the Archbold Ex-peditions. No. 97. A revision of the frogs of thesubfamily Asterophryinae, family Microhyli-dae. Bulletin of the American Museum of Nat-ural History 148: 411–546.

Zweifel, R.G. 1986. A new genus and species ofmicrohylid frog from the Cerro de la Neblinaregion of Venezuela and a discussion of rela-


tionships among New World microhylid gen-era. American Museum Novitates 2863: 1–24.

Zweifel, R.G. 2000. Partition of the Australopa-puan microhylid frog genus Sphenophryne withdescriptions of new species. Bulletin of the

American Museum of Natural History 253: 1–130.

Zwickl, D.J., and D.M. Hillis. 2002. Increasedtaxon sampling greatly reduces phylogeneticerror. Systematic Biology 51: 588–598.


APPENDIX 1

VOUCHER AND DNA LOCUS INFORMATION

Below we provide the specimen or tissue identification (ID) numbers (or source, if ID number unavail-able), localities, GenBank numbers, and total number of base pairs (bp) analyzed for each terminal inthe analysis. The locus mtDNA refers to 12S, tRNAVal, and 16S sequences, and SIA refers to the geneSeven in Absentia. Asterisks (*) mark the 85 species for which all sequence data were obtained fromGenBank and not generated by us. Species for which morphological data were included from Haas(2003) are in boldface. Sequences obtained from or previously deposited in GenBank are given in bold(see appendix 2 for references); all other sequences are new. ID numbers and localities are given onlyfor sequences generated by us. Localities for conspecific tissues are separated by a semicolon. Abbre-viations are: ABTC (Australian Biological Tissue Collection, South Australian Museum, Adelaide), AC(Alan Channing field series), ACD (Arvin C. Deismos field series), AH (Alexander Haas), AMCC(Ambrose Monell Cryo-Collection, American Museum of Natural History, New York); AMNH (Amer-ican Museum of Natural History, New York), AMS (Australian Museum, Sydney), ARBT (Adam Back-lin field series, via Robert Fisher), ASU (Arizona State University, Tempe), ATH (Andrew T. Holycrossfield series), BB (Boris Blotto field series), BLC (Bruce L. Christman), BMNH (The Natural HistoryMuseum, London), BPN (Brice P. Noonan field series), BY (Brian Yang), CAR (Channing CentralAfrican Republic collection, deposited at SAM), CAS (California Academy of Sciences, San Francisco),CFBH (Celio F.B. Haddad specimen collection), CFBH-T (Celio F.B. Haddad tissue collection), CG(Caren Goldberg), DMG (David M. Green field series), DPL (Dwight P. Lawson field series), ENS(Eric N. Smith field series), FMNH (Field Museum, Chicago), IWK (Iwokrama collection field series,Maureen Donnelly), IZUA (Instituto de Zoologıa, Universidad Austral de Chile, Valdivia), JAC (Jon-athan A. Campbell field series), JF (Julian Faivovich field series), JLG (Joao Luiz Gasparini field series),KRL (Karen R. Lips field series), KU (Natural History Museum, University of Kansas, Lawrence),LSUMZ (Louisiana State University Museum of Zoology, Baton Rouge), MACN (Museo Argentinode Ciencias Naturales Bernardino Rivadavia, Buenos Aires), MAD (Maureen A. Donnelly field series),MB (Marius Burger field series), MHNSM (Museo de Historia Natural San Marcos, Lima, Peru), MJH(Martin J. Henzl field series), MLPA (Museo de la Plata, Buenos Aires, Argentina), MVZ (Museumof Vertebrate Zoology, University of California at Berkeley), MW (Mark Wilkinson field series), NK(Museo de Historia Natural Noel Kempff Mercado, Santa Cruz, Bolivia), NTM (Museum and ArtGalleries of the Northern Territory, Darwin, Australia), QMJ (Queensland Museum, Brisbane), RABI(Marius Burger, Rabi oilfield, Gabon, field series), RAN (Ronald A. Nussbaum field series), RAX(Christopher Raxworthy field series), RdS (Rafael de Sa collection), RG (Ron Gagliardo), RNF (RobertN. Fisher field series), RWM (Roy W. McDiarmid field series), SAM (South African Museum, CapeTown), SAMA (South Australian Museum, Adelaide), SIUC (Southern Illinois University at Carbon-dale), TAT (Tom A. Titus field series), TMSA (Transvaal Museum, Pretoria, South Africa), UAZ(Herpetology Collection, University of Arizona, Tucson), USNM (National Museum of Natural History,Smithsonian Institution, Washington, D.C.), UMFS (University of Michigan Museum of Zoology, AnnArbor, field series), UMMZ (University of Michigan Museum of Zoology, Ann Arbor), UTA (Universityof Texas at Arlington), WAM (Western Australia Museum, Perth), WCS (Wildlife Conservation Society,New York), WR (Wade Ryberg), ZFMK (Zoologisches Forschungsinstitut und Museum AlexanderKoenig, Bonn, Germany), and ZSM (Zoologisches Museum, Munchen, Germany).

Species ID number Locality

Locus/partition

mtDNA Histone H3 Rhodopsin SIA Tyrosinase 28STotal

bp

Acanthixalusspinosus*

AJ437002AF215214AF465438

1283

Acris crepitans LSUMZH-2164

USA, Alabama, DeKalb Co, powerlineaccess, 0.1 mi WLookout Mt BoysCamp Rd

AY843559 DQ284107 AY844533 AY844762 AY844019 3952

Adelotus brevis SAMAR39251

Australia, Queensland,Nambour

DQ283298 DQ284307 DQ283948 DQ282800 DQ283638 3731

Adenomerahylaedactyla

MJH 3669 Peru, Huanuco, RıoLlullapichis, Panguana

DQ283063 DQ284093 DQ283790 3063



Locus/partition


bp

Afrana angolensis CAS 202040 Uganda, RukungiriDist, BwindiImpenetrable NationalPark, Munyaga Fallstrail

DQ284258 DQ284258 DQ283597 1600

Afrana fuscigula AMNHA144976

South Africa, WesternCape Prov,Bainskloof, in streamat settlement at crestof pass

DQ283069 DQ284105 DQ283794 DQ282909 DQ283476 4162

Afrixalus fornasinii AMNHA153277

Tanzania, Morogoro,Udzungwa MtsNational Park,Man’gula camp site 3on Mwaya River, 350m, 78509510S,36853900E

U22071DQ283401

DQ284382 DQ284013 DQ282859 DQ283003 DQ283713 4289

Afrixalus pygmaeus CAS 214836 Kenya, Kilifi Dist,Kararacha Pond I,038249540S,39852919.80E

DQ283234 DQ284263 DQ283908 DQ282765 DQ282955 DQ283602 4265

Agalychniscallidryas

RdS 537 Belize, Stann CreekDist, CockscombBasin WildlifeSanctuary

AY843563 DQ284401 AY844537 AY844765 DQ283018 4017

Aglyptodactylusmadagascariensis

UMMZ198472

Madagascar,Toamasina,Moramanga, MantadyPark, 48.4583338S,18.858E

DQ283056 DQ283785 DQ282906 DQ283469 3927

Alexteroonobstetricans

MB 5515(SAM)

Gabon, Rabi (ShellGabon), at Rabi 059,at trap lines 1–3,018569330S,098519090E

DQ283171 DQ284209 DQ283864 DQ282723 DQ282969 DQ283561 2311

Alexteroonobstetricans

UTAA44465

Cameroon,Southwestern Prov,vicinity Ediensoa

DQ283344 DQ282820 DQ283666 3135

Alligator sinensis WCS 850352 No data (WCS) NC004448 DQ283961 DQ282809 DQ283650 3848

Allobates femoralis LSUMZ17552

Brazil, Rondonia, RioFormoso, ParqueEstadual Guajira-Mirim, ca. 90 km NNova Mamore,108199S, 648339W

DQ283045 DQ284074 DQ283774 DQ282657 DQ283465 4226

Allophryneruthveni

MAD 1512 Guyana, Kabocalicamp, 101 m,4817.109N,58830.569W

AF364511AF364512AY843564

AY844538 AY844766 3134

Alsodes gargola MACN37942

Argentina, Neuquen,Alumine, stream 10km W Primeros Pinos

AY843565 DQ284118 AY844539 AY844767 AY844197 4211

Alytes obstetricans AH Germany, Thuringen,Schnellbach, 725 m

DQ283112 DQ284158 AY364385 DQ282683 DQ283510 4155

Ambystomacingulatum

AMCC125631

USA, Florida,Wakulla Co,30808.969N,84809.239W

DQ283184 DQ284218 2697

Ambystomamexicanum

AMCC105479

No data DQ283213 DQ284244 DQ283893 3025

Ambystomatigrinum

AMNHA164658

USA, Arizona,Cochise Co, Hwy 80,0.5 mi N PriceCanyon Rd, ca. 50 mW Hwy 80, ca. 1401m, 318389150N,1098119270W

DQ283407 DQ284388 U36574 DQ282864 3422



Locus/partition


bp

Amerana muscosa BY USA, California, LosAngeles Co, tributaryof South Fork BigRock Creek,34.37758N,117.828248W

DQ283190 DQ284224 DQ283877 DQ282735 DQ282945 DQ283575 4686

Amietia vertebralis AMNHA144977

Lesotho, Katse DQ283402 DQ284383 DQ282860 DQ283004 DQ283714 4382

Amniranaalbilabris

UTAA44423

Cameroon,Southwestern Prov,Kumba–Mamfe rd,6.4 km S Nguti

DQ283368 DQ284354 DQ283989 DQ283687 3273

Amniranagalamensis

KU 290412 Ghana, Muni Lagoon,Winneba, 58219140N,08429120W

DQ283058 AY341808 AY341749 3250

Amolopschapaensis

AMNHA161439

Vietnam, Lai ChauProv, Mt Fansipan,1600 m

DQ283372 DQ284358 DQ283992 DQ282837 DQ282984 DQ283690 4695

Amolopshongkongensis*

AF206072AF206453AF206117

1939

Amphiumatridactylum

UMFS10349

No data DQ283372 DQ284358 DQ283690 3410

Andriasdavidianus*

AJ492192 2390

Andrias japonicus UMFS11734

No data (Detroit Zoo;living animal)

DQ283274 DQ284358 2714

Aneides hardii* AY728226 2342

Anhydrophrynerattrayi*

AF215504 500

Anodonthylamontana*

AJ314812 493

Anotheca spinosa ENS 10039 Mexico, Oaxaca,Ixtlan de Juarez,Santiago Comaltepec,Vista Hermosa

AY843566 DQ284101 AY844540 AY844768 AY844022 AY844198 4730

Ansonialongidigitata

FMNH242550

Malaysia, Sabah,Sipitang Dist, 3.3 kmW Mendolong camp

DQ283341 DQ283968 DQ282817 3136

Ansonia muelleri* U52740U52784

1200

Aphantophrynepansa

ABTC 49605 Papua New Guinea,Bolulo

DQ283195 DQ284228 DQ283879 DQ282739 DQ283578 4171

Aplastodiscusperviridis

MACN37791

Argentina, Misiones,Guaranı, San Vicente,Campo Anexo INTA‘‘Cuartel RıoVictoria’’

AY843569 DQ284044 AY844543 AY844771 AY844025 AY844201 4746

Aquaranacatesbeiana

BLC USA, New Mexico,Sierra Co, LasAnimas Creek, LadderRanch

DQ283257 DQ283926 DQ282778 DQ282959 DQ283618 4363

Aquaranaclamitans

AMCC125633

USA, Florida, WaltonCo, Eglin Air ForceBase, Range Rd 211,ca. 1.2 mi E IndigoPond, 30853.289N,86853.269W

DQ283185 DQ284219 DQ283872 DQ282730 DQ283570 4160

Aquarana grylio AMCC125634

USA, Florida, WaltonCo, Eglin Air ForceBase, Range Rd 211,ca. 1.2 mi E IndigoPond, 30853.289N,86853.269W

DQ283186 DQ284220 DQ283873 DQ282731 DQ283571 4160

Aquaranaheckscheri

AMCC125635

USA, Florida,Wakulla Co, SmithCreek at County Rd375

DQ283191 DQ284225 DQ283878 DQ282736 DQ282946 DQ283576 4693



Locus/partition


bp

Aquixalusgracilipes

AMNHA163897

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, Mt TayConn Linh II, aboveTham Ve Village,small forest pools ca.1 km SW high camp,1700 m, 228459270N,1048499350E

DQ283051 DQ283780 2712

Arenophrynerotunda

WAMR146480

Australia, WesternAustralia, FalseEntrance Well

DQ283326 DQ284322 DQ283965 DQ283656 2268

Argenteohylasiemersi pederseni

MACN38644

Argentina, Corrientes,Bella Vista, junctionR.N. 12 at Rıo SantaLucıa

AY843570 DQ284064 AY844544 AY844772 AY844026 AY844202 4734

Arthroleptellabicolor

AMNHA144967

South Africa, WesternCape Prov,Landdroskop (nrpeak), ca. 15 km SWStellenbosch (by air),ca. 1450 m

DQ283070 DQ284106 DQ283795 DQ282662 DQ282910 DQ283477 4701

Arthroleptidesyakusini

RdS 862 Tanzania, UluguruMts, Tegetero Village,68569300S, 378439100E

DQ283415 DQ284396 DQ284020 DQ282872 DQ283010 DQ283725 4729

Arthroleptistanneri

RdS 929 Tanzania, WestUsambara Mts,Mazumbai,04848946.50S,38830912.00E

DQ283427 DQ284405 DQ284028 DQ283020 DQ283736 3844

Arthroleptisvariabilis

UTAA44448

Cameroon,Southwestern Prov,vicinity Babong

DQ283081 DQ284133 DQ283803 DQ282914 DQ283483 4263

Ascaphus truei UMFS10198

USA, Washington,Skamania Co,McCloskey Creek atMaybee Mines Rd

AJ440760 DQ284162 DQ283514 2905

Assa darlingtoni SAMAR39233

Australia, New SouthWales, Wiangaree

DQ283284 DQ284300 DQ283943 2128

Astylosternusschioetzi

UTA 52398 Cameroon, SouthProv

DQ283349 DQ284340 DQ283976 DQ282826 DQ282974 DQ283674 4699

Atelognathuspatagonicus

MACN37905

Argentina, Neuquen,Catan Lil, Laguna delBurro

AY843571 AY844545 AY844773 AY844027 AY844203 4408

Atelopus flavescens BPN 726(UTA)

French Guiana, N sideof mt just S Kaw

DQ283259 DQ284282 DQ283928 DQ282780 3462

Atelopus spumarius BPN 754(UTA)

French Guiana, GrandBoe of Mort (circuittrail) just SSW Saul

DQ283260 DQ284283 DQ283929 DQ282781 DQ283619 4229

Atelopus zeteki UMFS11492

Captive raised, DetroitZoo (parental stockfrom Panama, LasFilipinas near Sora,8839.999N,8080.2499W)

DQ283252 1518

Aubria subsigillata MB 5855(SAM)

Gabon, at foreststream in Gambaregion, 028469300S,108009590E

DQ283172DQ283173

DQ284210 DQ283865 DQ282724 DQ283562 3689

Aubria subsigillata DPL 4936(UTA)

Cameroon,Southwestern Prov,Nguti–Bayenti rd

DQ283350DQ283351DQ283352

DQ284341 DQ283977 DQ282827 DQ282975 DQ283675 3880

Aurorana aurora ARBT 018 USA, California, LosAngeles, SanFrancisquito Canyon,plunge pool,34.5457678N,118.516538W

DQ283189 DQ284223 DQ283876 DQ282734 DQ282944 DQ283574 4683

Barycholos ternetzi CFBH-T 306 Brazil, Minas Gerais,Gurinhata

DQ283094 DQ284144 DQ283810 DQ284144 DQ283496 2938



Locus/partition


bp

Batrachosepsattenuatus*

AY728228 2327

Batrachosepswrightorum*

AY728221 2335

Batrachuperuspinchoni

FMNH232841

China, Sichuan,Hongya Xian, 15 kmSW Bin Ling, top ofWa Shan

DQ283339 DQ284330 DQ283664 3017

Batrachylaleptopus

MACN38008

Argentina, Chubut,Cushamen, LagoPuelo

AY843572 DQ284119 AY844546 AY844774 AY844028 AY844204 4726

Batrachylodesvertebralis

AMSR134887

Solomon Islands, NewGeorgia, Patutiva

DQ283210 DQ284242 DQ283891 DQ282753 DQ283586 4124

Bolitoglossarufescens

JAC 21178 Mexico, Oaxaca,Coconales–ZacatepecHwy, 1625 m

DQ283210 DQ284242 DQ282753 DQ283586 2890

Bombina bombina AH No data DQ283250 DQ284275 DQ283920 3067

Bombinamicrodeladigitora

AMNHA163789

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, Mt TayConn Linh II, aboveTham Ve Village,1900 m

DQ283408 DQ284389 DQ284017 DQ282865 DQ283718 4171

Bombina orientalis RdS No data DQ283432 DQ284032 DQ283741 3474

Bombina variegata ZSM 724/2000

No data DQ283249 DQ284274 DQ283919 DQ283612 3779

Boophis albilabris RAX 2714 Madagascar,Antsiranana,Ambanja, AntsahateloCamp, TsaratananaReserve, 138519350S,488519590E

DQ283033 DQ284054 DQ283762 3050

Boophistephraeomystax

AMNHA168144

Madagascar,Antsiranana,Ambanja,MandrizavonaVillage, RamenaValley, 13848930S,488449470E

DQ283032 DQ284053 DQ283761 AF249168 3590

Boulengerulauluguruensis

MW 3268(BMNH)

Tanzania DQ283087 DQ284138 DQ282670 DQ283488 3810

Brachycephalusephippium

CFBH 2466,CFBH 2468

Brazil, Sao Paulo,Campinas, JoaquimEgydio

DQ283091 DQ283808DQ283806

DQ282672DQ282673

DQ282919DQ282917

DQ283494DQ283492

4263

Brachytarsophrysfeae*

AY236799 555

Brevicepsmossambicus

RdS 903 Tanzania, Morogoro DQ283155 DQ284397 DQ284023 DQ283013 DQ283546 4292

Buergeria japonica UMMZ190051

China, Taiwan, I-Lan,near Ran-Jeh spring

DQ283055 DQ283784 2710

Bufo alvarius ATH 499 USA, Arizona SantaCruz Co, 0.5 mi (byair) SW junction ofI-19 and Ruby Rd

DQ283269 DQ284289 DQ283933 DQ282785 DQ283625 4221

Bufo amboroensis NK A5302 Bolivia, Dept SantaCruz, Prov Caballero,San Juan Canton,Amboro, NationalPark, near San Juandel Portrero, on RıoCerro Bravo, near178509080S,648239230W, 1800–2100 m

DQ283386 DQ284003 DQ282848 DQ283701 3894



Locus/partition


bp

Bufo andrewsi CAS 214911 China, Yunnan, NuJiang Pref, smallvillage S Gongshan,27842913.70N,98842910.20E, ca.4760 ft

DQ283230 DQ284260 DQ283905 DQ282763 DQ283599 4216

Bufo angusticeps* AF220852AF220899

850

Bufo arenarum MACN38639

Argentina, San Luıs,Rte 20 betweenBardas Blancas andkm 330

AY843573 DQ284103 AY844547 AY844775 AY844205 4217

Bufo asper FMNH248147

Brunei, Dutong Dist,Tasek Merimbun, SgMerimbun

DQ283148 DQ284188 DQ283848 DQ282704 DQ282939 DQ283539 4748

Bufo biporcatus* AY325987 2350

Bufo boreas RNF 2416 USA, California, SanDiego Co, MarronValley Rd, 0.25 mi EMine Canyon

DQ283180 DQ284215 DQ283871 DQ283567 3821

Bufo brauni RdS 952 Tanzania, EastUsambara Mts,adjacent to AmanaiNature Reserve,05807938.00S,38837922.60E

DQ283416 DQ284021 DQ282873 DQ283011 DQ283726 4420

Bufo bufo* AY325988 U59921 2672

Bufo camerunensis UTAA44478

Cameroon, East Prov,ca. 35 km E LipondjiVillage

DQ283358 DQ284345 DQ283979 DQ282830 DQ283678 4211

Bufo celebensis* AF375513AY180245

1209

Bufo cf. arunco AMNHA168401

No data (pet trade) DQ283162 DQ284200 DQ283857 DQ282715 DQ283553 4219

Bufo cognatus AMNHA168396

No data (pet trade) DQ283159 DQ284197 DQ282713 DQ283550 3902

Bufo coniferus SIUC 6913 Panama, Cocle Prov,Parque Nacional ElCope

DQ283166 DQ284204 DQ283860 DQ282719 DQ283556 4216

Bufo divergens FMNH242591

Malaysia, Sabah,Sipitang Dist,Mendelong camp,watershed

DQ283149 DQ284189 DQ283849 DQ282705 DQ283540 4210

Bufo galeatus AMNHA163648

Vietnam, Quang NamProv, Tra My, TraTap commune, streamnear Thon 2 village,920–1060 m,15809.6229N,108802.4279E

DQ283376 DQ284362 DQ283995 DQ282839 DQ282987 3994

Bufo granulosus AMNHA139020

Guyana, southernRupununi Savanna,Aishalton (onKubabawau Creek),150 m, 28289310N,598199160W

DQ283332 DQ284323 DQ283966 DQ283657 3808

Bufo guttatus AMNHA141058

Guyana, DubulayRanch on BerbiceRiver, 200 ft,58409550N,578519320W

DQ283375 DQ284361 DQ283994 DQ283693 3823

Bufo gutturalis RdS 873 Tanzania, MumbaVillage, 08810944.90S,31851947.80E

DQ283436 DQ284035 DQ282890 DQ283745 3863

Bufo haematiticus SIUC 7059 Panama, Cocle Prov,Parque Nacional ElCope

DQ283167 DQ284205 DQ283861 DQ282720 DQ283557 4217



Locus/partition


bp

Bufo latifrons UTAA44695

Cameroon, SouthwestProv, ManyuDivision, ca. 9.0 kmW Bakumba Village,between Mpi Riverand primary forest

DQ283343 DQ284332 DQ283970 DQ282819 DQ283665 3310

Bufo lemur UMFS11733

No data (Detroit Zoo) DQ283273 2424

Bufo maculatus AMNHA163573

Mali, 128369450N,78599210W

DQ283388 DQ284374 DQ284005 DQ282850 DQ283703 4213

Bufo margaritifer* AF375514AF375489

1101

Bufo marinus MJH 3678 Peru, Huanuco, RıoPachitea, Puerto Inca

DQ283062 DQ284092 DQ283789 DQ283472 3820

Bufomazatlanensis*

U52755U52723

1343

Bufomelanostictus

AMNHA161135

Vietnam, Ha TinhProv, Huang SonReserve, Rao Anregion, 200 m,18822900N,1058139130E

DQ283333 DQ284324 DQ283967 DQ282815 DQ283658 4237

Bufo nebulifer* AY325985 2426

Bufo punctatus AMNHA168398


Bufo quercicus AMNHA168432

USA, Florida, WaltonCo, Eglin Air ForceBase, Range Rd 211,ca. 1.2 mi E IndigoPond, 30842900N,86819900W

DQ283153 DQ284192 DQ282708 DQ283544 3900

Bufo regularis FMNH251386

Tanzania, KilimanjaroRegion, South PareMts, Chome ForestReserve, 7 km SBombo (by air),48209S, 388009E,1100 m

DQ283163 DQ284201 DQ283858 DQ282716 DQ283554 4191

Bufo schneideri BB 1224 Argentina, Santiagodel Estero, Guasayan,Dona Luisa

DQ283065 DQ284102 DQ283791 3068

Bufo spinulosus BB 1032 Argentina, Rıo Negro,Bariloche, PampaLinda

DQ283046 DQ284077 DQ283775 DQ282658 3469

Bufo terrestris AMNHA168433

USA, Florida, MarionCo, 4 mi WSWMicanopy,29838.569N,82820.309W

DQ283158 DQ284196 DQ283854 DQ282712 DQ283549 4214

Bufo tuberosus UTAA52375

Cameroon, CenterProv, east bank ofNyong River, vicinity0742952, 0382754(UTM 32N)

DQ283362 DQ283984 DQ282832 DQ283683 3856

Bufo viridis AMNHA168402


Bufo woodhousii RNF 2417 USA, California,Imperial Co,Winterhaven, 1.5 mi(by air) N Hwy 8 onPicacho Rd,32.751008N,114.615968W

DQ283188 DQ284222 DQ283875 DQ282733 DQ283573 4217

Cacosternumplatys

AC South Africa, WesternCape Prov, CapeTown

DQ283258 DQ284281 DQ283927 DQ282779 DQ282960 3968



Locus/partition


bp

Caeciliatentaculata

AMNHA145174

Guyana, DubulayRanch on BerbiceRiver, 200 ft.,58409550N,578519320W

DQ283406 DQ284387 DQ282863 DQ283717 2936

Calluella guttulata FMNH252955

Vietnam, Gia-LaiProv, Ankhe Dist,Kannack town, BuonLuoi village, 20 kmNW Kannack, Annammts, 700–750 m,148209N, 1068369E

DQ283144 DQ284184 DQ283845 DQ282700 DQ282937 DQ283536 4714

Callulinakisiwamsitu

RdS 936 Tanzania, WestUsambara Mts,Mazumbai,04848946.50S,38830912.00E

DQ283429 DQ284406 DQ282884 DQ283021 DQ283737 4333

Callulina kreffti* AY326068 2363

Callulops slateri* AF095339 541

Capensibufo rosei* AF220864AF220911

841

Capensibufotradouwi*

AF220865AF220912

842

Cardioglossagratiosa

RABI 141(SAM)

Gabon, Rabi (ShellGabon), Toucan WellHead, funnel trap line1.8, 01.47508S,09.53358E

DQ283176 DQ284213 DQ283868 DQ282726 DQ283565 3699

Cardioglossaleucomystax

UTAA44591;UTAA44585

Cameroon, SouthwestProv, vicinityEdiensoa

DQ283080DQ283079

DQ284348DQ284132

DQ283802DQ283982

DQ282978DQ282913

DQ283681 4266

Caudiverberacaudiverbera

AMNHA168414


Centrolenegeckoideum*

X86230X86264X86298

1146

Centroleneprosoblepon

SIUC 7053 Panama, Cocle Prov,El Cope, ParqueNacional ‘‘OmarTorrijos’’

AY364358AY364379AY843574

AY364404 AY844776 AY844206 3871

Ceratobatrachusguentheri

AMSR137134;AMNHA161634

Solomon Islands,Malaita, Su’u Bay;Solomon Islands

DQ283197DQ283198

DQ284230DQ284409

DQ283881DQ284031

DQ282741DQ282886

DQ283024 DQ283579DQ283740

4675

Ceratophryscranwelli

JF 929 Argentina, Santa Fe,Vera, ‘‘Las Gamas’’

AY843575 AY843797 AY844207 3469

Chacophryspierottii

AMNHA168435

No data (pet trade) DQ283328 2421

Chalcoranachalconota

FMNH248327

Brunei, Belait Dist,Labi, Sg Mendaram

DQ283139 DQ284179 DQ283840 DQ282695 DQ282933 DQ283531 4687

Chaperina fusca FMNH231111

Malaysia, Sabah,Lahad Datu Dist,Danum ValleyResearch Center

DQ283145 DQ284185 DQ282701 DQ282938 2307

Charadrahylanephila

UTAA54772

Mexico, Oaxaca,Colonia RodulfoFigueroa, El Carrizal,1475 m

AY843649 DQ284100 AY844635 AY844853 AY844094 AY844272 4730

Chelydraserpentina

AMCC101071

USA, New York,Cornwall Co, BlackRock Forest, ArthursPond

DQ283320 DQ282810 DQ283651 3108



Locus/partition


bp

Chirixalus doriae FMNH255213

Laos, Huaphahn Prov,Vieng Tong Dist,Phou Louey NationalBiodiversityConservation Area,near Nam PuongRiver, 985 m,208149N, 1038169E

DQ283135 DQ284176 DQ283836 DQ282691 DQ283528 4139

Chirixalus vittatus FMNH254444

Vietnam, Gia-LaiProv, Ankhe Dist,Kannack town, BuonLuoi village, 20 kmNW Kannack, Annammts, 700–750 m,148209N, 1068369E

DQ283134 DQ284175 DQ283835 DQ282690 DQ283527 4140

Chiromantisxerampelina

AMNHA153250

Tanzania, Morogoro,Udzungwa MtsNational Park,Njokamoni Riverdrainage, 1100–1200 m

AF215348AF458132

DQ284380 DQ284012 2656

Choerophryne sp. ABTC 47720 Papua New Guinea,Mt Menawa

DQ283207 DQ284239 DQ283889 DQ282750 DQ283583 4156

Clinotarsuscurtipes*

AF249058AF249021

AF249117 AF249180 2110

Cochranellabejaranoi

NK A 5292 Bolivia, Dept SantaCruz, Prov Caballero,San Juan Canton,Amboro, NationalPark, near San Juandel Portrero, on theRıo Cerro Bravo, near178509080S,648239230W, 1800–2100 m

AY843576 DQ284066 AY844372 AY844777 AY844029 AY844208 4730

Colostethusundulatus

AMNHA159139

Venezuela, Amazonas,Cerro Yutaje, 1700 m,58469N, 66889W

DQ283044 DQ284073 DQ283773 DQ282656 DQ283464 4223

Conraua goliath FMNH262216

Cameroon, Ebowalaarea

DQ283132 DQ284173 DQ283833 DQ282688 DQ283525 4158

Conraua robusta UTAA44401

Cameroon, SouthwestProv, plateau NW ofNtale village, ca.700 m

DQ283347 DQ284337 DQ283973 DQ282823 DQ282972 DQ283671 4688

Cophixalussphagnicola

ABTC 47881 Papua New Guinea,Wau

DQ283206 DQ284238 DQ282749 DQ283582 4032

Copiula sp. AMSR124417

Papua New Guinea,Sinyarge

DQ283208 DQ284240 DQ282751 DQ283584 3415

Crinia nimbus ABTC 25300 Australia, Tasmania,Haast Mts

DQ283299 DQ283949 DQ282801 DQ283639 3351

Crinia signifera SAMAR40274

Australia, New SouthWales, Watagan S.F.

DQ283192DQ283193

DQ284226 DQ282737 2695

Crossodactylusschmidti

MLPA 1414 Argentina, Misiones,Aristobulo del Valle,Balneario Cunapiru

AY843579 DQ284050 AY844552 AY844780 AY844031 3989

Crotaphatrematchabalmbaboensis

UTAA51667

Cameroon, Adamoua,N face of Mt TchabalMbabo, 1950 m

DQ283353DQ283354

DQ284342 DQ283676 2430

Cruziohylacalcarifer

KRL 800 Panama, Cocle Prov,El Cope, ParqueNacional ‘‘OmarTorrijos’’

AY843562 AY844536 DQ282950 AY844196 4061

Cryptobatrachussp.*

AY326050 2329

Cryptobranchusalleganiensis

TAT USA, Arkansas, NorthFork White River

DQ283263 DQ284286 DQ283621 2998



Locus/partition


bp

Cryptothylaxgresshoffi

CAR 381(SAM)

Central AfricanRepublic, PrefSangha-Mbaere, ParkNational de Dzanga-Ndoki, 38.6 km 1738SLidjombo, Camp 3,02.21368S, 16.03128E

DQ283170 DQ284208 DQ283863 DQ282722 DQ283560 4184

Cryptotritonalvarezdeltoroi*

AF199196 507

Ctenophrynegeayei

AMNHA166444

Guyana, BerbiceRiver camp at ca. 18mi (linear) SWKwakwani (ca. 2 midownriver fromKurundi Riverconfluence), 200 ft,585960N, 588149140W

DQ283383 DQ28436 DQ282846 DQ282993 DQ283698 4392

Cycloramphusboraceiensis

CFBH 5757 Brazil, Sao Paulo,Picinguaba, Ubatuba

DQ283097 DQ284147 DQ283813 DQ282675 DQ282924 DQ283498 4740

Cycloranaaustralis

SAMAR16906

Australia, no otherdata

DQ284124 DQ284124 AY844553 3062

Dasypops schirchi CFBH-T 71 Brazil, Espırito Santo,Linhares, Reserva daVale

DQ283095 DQ284145 DQ283811 DQ282922 DQ283497 4302

Dendrobatesauratus

USNM313818

Panama, Bocas delToro

AY843581 DQ284072 AY844554 AY844781 AY844032 AY844211 4758

Dendrophryniscusminutus


AY843582 DQ284096 AY844555 3056

Dendropsophusmarmoratus


AY843640 DQ284085 DQ283782 3071

Dendropsophusminutus

MACN33799

Argentina, Misiones,Guaranı, San Vicente,Campo Anexo INTA‘‘Cuartel RıoVictoria’’

AY549345 DQ284096 DQ283758 AY844089 DQ283456 4309

Dendropsophusnanus

MACN37785

Argentina, Entre Rıos,Dept Islas del Ibicuy

AY549346 DQ284051 AY844634 AY844852 AY844271 4200

Dendropsophusparviceps

AMNHA139315

Brazil, Acre, CentroExperimental daUniversidade do Acreat km 23 on RioBranco–PortoVelho Rd

AY843652 AY844638 AY844856 AY844097 AY844274 4410

Dendrotritonrabbi*

AF199232 516

Dermatonotusmuelleri

AMNHA168436

No data (pet trade) DQ283329DQ283330

2069

Dermophisoaxacae

UTA 56550 Mexico, Guerrero,Tierra Colorada–Ayutla Hwy, 424 m

DQ283455 DQ284428 DQ282897 2710

Desmognathusquadramaculatus

UMMZ221202

USA, North Carolina,Macon Co, BlueRidge Parkway

DQ283253 DQ284278 DQ283923 DQ282775 DQ283614 3628

Desmognathuswrighti*

AY728225 2320

Dicamptodonaterrimus

RAN 31288 USA, Idaho, BenewehCo, Mannering Creek

DQ283118 DQ284164 DQ283516 3394

Dicamptodontenebrosus

TAT 1043 USA, Oregon, LaneCo, Thompson Creek

DQ283261 DQ284284 2705

Didelphismarsupialis

AMNHA272836

Peru, Loreto, RıoGalvez, Nuevo SanJuan

DQ283321 DQ282811 1897

Didynamipussjostedti*

AY325991 2289



Locus/partition


bp

Dimorphognathusafricanus

SAM 51540 Gabon, LoangoNational Park, nearpitfall trap line #3,028209270S,098359500E

DQ283175 DQ284212 DQ283867 DQ282725 DQ282943 DQ283564 4240

Discodeles guppyi AMSR137175

Solomon Islands,Malaita, Su’u Bay

DQ283200 DQ284232 DQ283883 DQ282743 DQ282947 3521

Discoglossusgalganoi

ZSM 725/2000

Portugal, AlamadaCity

DQ283243 DQ284270 DQ283915 DQ282770 DQ283609 3774

Discoglossuspictus

AH Spain, Barcelona DQ283435 DQ284412 DQ284034 DQ282889 DQ283744 3796

Duellmanohylarufioculis

MVZ207193

Costa Rica,Guanacaste Prov,Volcan Cacao

AY549315 DQ284059 AY844556 AY844033 AY844212 4295

Dyscophus guineti RdS No data (pet trade) DQ283434 DQ284411 DQ282888 DQ283025 DQ283743 4419

Eburanachloronota

AMNHA163935

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, Mt TayConn Linh II, BacTrao River, nearcamp, just upstream,600 m, 228459390N,1048529230E

DQ283394 DQ284008 DQ282854 DQ282999 DQ283707 4359

Ecnomiohylamiliaria


AY843776AY843777

DQ284115 AY844629 AY844847 AY844088 AY844268 3846

Edalorhina perezi MJH 7082 Peru, Huanuco, RıoLlullapichis, Panguana

AY843585 DQ284095 AY844558 AY844764 DQ283474 4200

Elachistocleisovalis

AMNHA141136


DQ283405 DQ284386 2728

Eleutherodactylusalfredi

JAC 21987 Mexico, Veracruz,Municipio Cordoba,Cruz de los Naranjos,1100 m

DQ283318 DQ284318 DQ283649 3483

Eleutherodactylusaugusti

CG (nowUAZunnumbered)

Mexico, Sonora,Alamos

DQ283271 DQ284291 DQ283935 DQ282786 DQ282963 DQ283627 4738

Eleutherodactylusbinotatus

CFBH 5813 Brazil, Sao Paulo,Parque Estadual daSerra do Mar, NucleoSanta Virgınia, SaoLuiz do Paraitinga

DQ283092 DQ284142 DQ283807 DQ282918 DQ283493 4288

Eleutherodactylusbufoniformis

SIUC 7062 Panama, Cocle Prov,Parque Nacional ElCope

DQ283165 DQ284203 DQ282718 DQ282942 DQ283555 4404

Eleutherodactylusjuipoca

CFBH 4450 Brazil, Minas Gerais,Pocos de Caldas

DQ283093 DQ284143 DQ283809 DQ282920 DQ283495 4271

Eleutherodactylusmarnockii

USNM331345

USA, Texas, TravisCo, Austin, Univ ofTexas Campus, nearfootball stadium

DQ283101DQ283102

DQ284151 DQ283817 DQ282677 DQ283502 3324

Eleutherodactylusnitidus

UTAA54771

Mexico, Oaxaca,Municipio Cuicatlan,Tutepetongo, 1619 m

DQ283316 DQ284316 DQ283959 DQ282807 DQ283647 2855

Eleutherodactylusplanirostris

USNM547959;P. Moler,unnumbered

USA, Florida, Collier,Naples, Parkshoresubdivision, ParkviewWay, 268119240N,818489160W; USA,Florida, Duval Co,2826 Rosselle St

DQ283107DQ283108

DQ284155DQ284294

DQ283821DQ283937

DQ282680DQ282788

DQ282929DQ282964

DQ283506DQ283629

4740



Locus/partition


bp

Eleutherodactyluspluvicanorus

AMNHA165195

Bolivia, Santa Cruz,Caballero, San JuanCanton, AmboroNational Park, 2050m, 178509170S,648239300W

AY843586 DQ284372 AY844559 AY844785 AY844035 AY844213 4790

Eleutherodactyluspunctariolus

SIUC 7066 Panama, Cocle,Parque Nacional ElCope

DQ283168 DQ284206 DQ283862 DQ283558 3804

Eleutherodactylusranoides

USNM-FS195393

Panama, Bocas delToro, Isla Escudo deVeraguas, West Point

DQ283105DQ283106

DQ284154 DQ283820 DQ282928 DQ283505 4004

Eleutherodactylusrhodopis

JAC 22721 Mexico, Oaxaca, ElMirador, MunicipioSanta MarıaChilchotla

DQ283317 DQ284317 DQ283960 DQ282808 DQ282968 DQ283648 4702

Ensatinaeschscholtzii*

AY728216 2311

Epicrionops sp. UMMZ185825

Ecuador, Cotopaxi,San Francisco de LasPampas

DQ283130 DQ284171 DQ283523 3074

Epipedobatesboulengeri

UMMZ227952

Pet trade, importedfrom Ecuador

DQ283037 DQ284063 DQ283768 DQ282653 DQ282902 DQ283461 4761

Euphlyctiscyanophlyctis*

AF249053AF249015

AF249111 AF249174 2069

Euproctus asper* U04694U04695

840

Eupsophuscalcaratus

MACN37980

Argentina, Neuquen,Huiliches, Termas deEpulafquen

AY843587 DQ284120 AY844560 AY844786 AY844036 AY844214 4749

Eurycea wilderae UMMZ221205

USA, North Carolina,Macon Co, Deep Gap

DQ283254 DQ283615 3040

Exerodontachimalapa

JAC 21736 Mexico, Chiapas,Colonia RodulfoFigueroa, El Carrizal,1475 m

AY843619 DQ284099 AY844596 AY844815 AY844062 AY844240 4738

Fejervaryacancrivorus*

AB070731AF206473AF206092AF206137

2391

Fejervaryakirtisinghei*

AY014380 502

Fejervaryalimnocharis

AMNHA161230

Vietnam, Nghe AnProv, Con CuongDist, Bong KheCommune, 19829240N,1048549240E

AY843588 DQ284356 AY844561 AY844787 AY844037 3991

Fejervaryasyhadrensis*

AY141843AF249011

AF249107 AF249170 2484

Flectonotus sp. CFBH 5720 Brazil, Santa Catarina,Santo Amaro daImperatriz

AY843589 AY844562 AY844788 AY844038 AY844215 4004

Gastrophryneelegans

RdS 726 Belize, Stann CreekDist, CockscombBasin WildlifeSanctuary

DQ283426 DQ284404 DQ282883 DQ283019 DQ283735 4387

Gastrophryneolivacea

ATH 476 USA, Arizona, SantaCruz Co, Ruby Rd,vicinity CalabasasCanyon

DQ283268 DQ284288 DQ283932 DQ282784 DQ282961 DQ283624 4703



Locus/partition


bp

Gastrothecacf. marsupiata

NK A5286 Bolivia, Dept SantaCruz, Prov Caballero,San Juan Canton,Amboro, NationalPark, near San Juandel Potrero, on RıoCerro Bravo, near178509080S,648239230W, 1800–2100 m

AY843590 DQ284069 AY844563 AY844789 AY844039 3995

Gastrothecafissipes

JLG 09 Brazil, Espırito Santo,Setiba, Guarapari

AY843592 AY844564 AY844790 3130

Gazella thomsoni WCS 851199 No data M86501 DQ282812 DQ283652 3556

Gegeneophisramaswamii*

AF461136AF461137

972

Genyophrynethomsoni

ABTC 49624 Papua New Guinea,Bolulo

DQ283209 DQ284241 DQ283890 DQ282752 DQ283585 4171

Geocriniavictoriana

ABTC 7145 Australia, Victoria,Tanjil Bren

DQ283294DQ283295DQ283296

DQ284306 DQ283947 DQ282799 DQ282965 DQ283637 3858

Geotrypetesseraphini

FMNH256782

Gabon, Prov deWoleu-Ntem, 31 kmESE Minvoul, alongIOBT trail (PK 29),600 m, 284.89N,12824.49E

DQ283337 DQ284328 DQ283662 2816

Glandiranaminima*

AF315127AF315153

882

Gyrinophilusporphyriticus

UMMZ221207

USA, North Carolina,Macon Co, Deep Gap

DQ283255 DQ284279 DQ283924 DQ282776 DQ283616 3630

Hamptophryneboliviana

RdS Peru (no other data) DQ283438 DQ284414 DQ282892 DQ283747 3891

Heleioporusaustraliacus

ABTC 76692 Australia, New SouthWales, Mona Vale

DQ283306DQ283307

DQ284311 DQ283953 DQ282804 DQ283642 3694

Heleophrynepurcelli

TMSA84157

South Africa, WesternCape Prov, CedarbergRange, head of KromRiver

AY843593 DQ284113 AY844565 AY844791 3458

Heleophryne regis AC 2544 South Africa, WesternCape Prov, MontaguePass

DQ283115 DQ284161 DQ283828 DQ282684 DQ283513 3758

Hemidactyliumscutatum

UMFS11564

USA, Michigan, SaintClair Co, Woodlotjust S Marysvillealong Hwy 29/BushaHwy, about 1 km NWjct Davis Rd,42853.39N, 82829.39W

DQ283120DQ283121

1587

Hemiphractushelioi

MJH 3689 Peru, Ucayali, 3 kmS, km 65 on HwyFederico Basadre atIvita

AY843594 DQ284084 AY844566 AY844792 3431

Hemisusmarmoratus

RdS 916 Tanzania, Arusha,Masai Camp

AY326070 DQ284407 DQ284029 DQ282885 DQ283022 DQ283738 4619

Herpelesqualostoma

UTAA52349

Cameroon,Southwestern Prov,Nguti

DQ283359 DQ284346 DQ283980 DQ283679 3746

Heterixalus sp. UMMZ219330

Madagascar,Mahajanga,Antsalova, BemarahaReserveAntranopasasy,44.716358N,18.7080168E

DQ283448 DQ284422 DQ283027 DQ283752 4004

Heterixalustricolor*

AY341630AY341697AY341725

AY341759 2392



Locus/partition


bp

Hoplobatrachusoccipitalis

KU 290425 Ghana, Muni Lagoon,Winneba, 58219140N,08429120W

DQ283059 DQ284090 DQ283787 DQ282907 DQ283471 4303

Hoplobatrachusrugulosus

FMNH255191

Laos, ChampasakProv, MounlapamokDist, DongKhanthung NationalBiodiversityConservation Area,near Houay Khiemstream, 60 m,148089N, 1058229E

DQ283141 DQ284181 DQ283842 DQ282697 DQ282934 DQ283533 4696

Hoplophrynerogersi

RdS 949 Tanzania, EastUsambara Mts,adjacent to AmanaiNature Reserve,05807938.00S,38837922.60E

DQ283419 DQ284398 DQ282876 DQ283015 DQ283730 3946

Huia nasica AMNHA161169

Vietnam, Ha TinhProv, Huang SonReserve, Rao Anregion, top of PomuMt, 900–1200 m,188209530N,1058149380E

DQ283345 DQ284333 DQ283971 DQ282821 DQ282970 DQ283667 4694

Hyalinobatrachiumfleischmanni

JAC 21365 Mexico, Oaxaca, SanJose Pacıfico–Candelaria LoxichaHwy, 480 m

DQ283453 DQ284 DQ284043 DQ283756 3800

Hydromantesplatycephalus

CAS 206495 USA, California, InyoCo, ElderberryCanyon, 37.377498N,118.638518W

DQ283227 DQ28425 2248

Hyla arborea* ZFMK Germany (livespecimen)

AY843601 AY843822 AY844046 3270

Hyla cinerea MVZ145385

USA, Texas, TravisCo, Austin, municipalgolf course

AY549327 DQ284057 AY844597 AY844816 AY844063 AY844241 4736

Hylaranaerythraea

FMNH257285

Cambodia, Siem ReapProv, Siem Reap Dist,Siem Reap town, ,10m, 138229290N,1038509440E

DQ283138 DQ283839 DQ282694 3121

Hylaranataipehensis

AMNHA163972

Vietnam, Ha GiangProv, Yen Minh, DuGia Commune, KhauRia Village, ricepaddy on edge oflimestone forest Svillage, 934 m,228539490N,1058149480E

DQ283396 DQ284010 DQ282856 DQ283000 DQ283710 4358

Hylodes phyllodes CFBH-T 249 Brazil, Sao Paulo,Picinguaba, Ubatuba

DQ283096 DQ284146 DQ283812 DQ282674 DQ282923 3989

Hylorina sylvatica* AY389153 718

Hyloscirtusarmatus

AMNHA165163

Bolivia, Dept SantaCruz, Caballero, SanJuan Canton, AmboroNational Park, nearbase camp on RıoCerro Bravo,178509170S,648239300W

AY549321 DQ284070 AY844579 AY844050 AY844224 4367

Hyloscirtuspalmeri


AY843650 DQ284088 AY844636 AY844095 AY844273 4354

Hymenochirusboettgeri*

AY341634AY341700AY341726

AY341763 2339



Locus/partition


bp

Hyperolius alticola CAS 202047 Uganda, RukungiriDist, BwindiImpenetrable NationalPark, Munyaga River,ca. 100 mdownstream fromMunyaga Falls

DQ283225 DQ284255 DQ283902 DQ282762 DQ282952 DQ283595 3781

Hyperoliuspunticulatus

AMNHA153299

Tanzania, Morogoro,Udzungwa MtsNational Park,Njokamoni Riverdrainage, 1100–1200 m

DQ283389 DQ284375 DQ282851 DQ282997 DQ283704 3963

Hyperoliustuberilinguis

AMNHA153257

Tanzania, Morogoro,Udzungwa MtsNational Park,Man’gula Camp Site3 on Mwaya River,350 m, 78509510S,36853900E

DQ283399DQ283400

DQ284381 DQ282858 DQ283002 DQ283712 3492

Hypogeophisrostratus

UMMZ181332

Seychelles, SilhouetteIsland, Trail from LaPasse to JardinMarron

DQ283131 DQ284172 DQ282687 DQ283524 3890

Hypsiboasalbomarginatus

USNM284519

Brazil, Pernambuco,near Caraurucu, onway to Serra dosCavalos

AY549316 AY549369 AY844794 AY844218 3901

Hypsiboas boans RWM 17746 Venezuela, Amazonas,Cano Agua Blanca,3.5 km SE Neblinabase camp on RıoBaria

AY843610 DQ284086 AY844588 AY844809 AY844055 AY844231 4746

Hypsiboascinerascens

MAD 085 Guyana, Iwokrama,Muri Scrub camp,80 m

AY549336 DQ284076 AY844610 AY844828 DQ283466 4218

Hypsiboasmultifasciatus

AMNHA141040

Guyana, Demerara,Ceiba Station,Madewini River, ca. 3mi (linear) E Timehriairport

AY843648 AY844633 AY844851 AY844093 AY844270 4437

Ichthyophiscf. peninsularis

MW 375(Univ ofKerala)

India DQ283086 DQ284137 DQ282669 DQ283487 3847

Ichthyophis sp. FMNH256425

Laos, KhammouanNakai Dist, NakaiNam Theun NationalBiodiversityConservation Area,Annamite Mts,disturbed evergreenforest along HouayTing Tou stream, 700m, 178589N, 1058349E

DQ283336 DQ284327 DQ283661 2988

Iguana iguana WCS No data NC002793 DQ284249 DQ283590 3416

Indirana sp.* AF249051 AF249122 AF249185 1399

Indirana sp.* AF249064 AF249123 AF249186 1406

Ingerana baluensis FMNH231085


DQ283142 DQ284182 DQ283843 DQ282698 DQ282935 DQ283534 4636

Ischnocnemaquixensis

MJH 7057 Peru, Huanuco,Panguana, RıoLlullapichis

DQ283061DQ283060

DQ284091 DQ283788 DQ282661 2950

Isthmohylarivularis

MVZ149750

Costa Rica, HerediaProv, ‘‘Chompipe’’,vicinity Volcan Barba

AY843659 DQ284058 AY844649 AY844117 3598

Ixalotriton niger* AF451248 518



Locus/partition


bp

Kalophrynuspleurostigma

FMNH230844


DQ283146 DQ284186 DQ283846 DQ282702 DQ283537 4168

Kaloula pulchra AMCC106697; RdS02

Vietnam, Ha TinhProv, Huong SonDist, Huong SonReserve, Ngai Doiregion, headquartersof Huong SonReserve, 100 m,188279080N,1058179430E; No data(pet trade)

DQ283397DQ283398

DQ284379 DQ284011 DQ282857DQ282874

DQ283001DQ283012

DQ283711DQ283727

4745

Kassinasenegalensis

RdS 803 Tanzania, Iringa,Kibebe Farm,07848912.40S,35845924.20E

DQ283437 DQ284413 DQ282891 DQ283026 DQ283746 4401

Kurixalus eiffingeri UMFS 5969 China, Taiwan, Nan-Tou, Lu-Gu Chi-Tou,900–1100 m

DQ283122 DQ284166 DQ283830 DQ282931 DQ283518 4272

Kurixalusidiootocus

UMFS 5702 China, Taiwan, Nan-Tou, Tung Fu, 750 m

DQ283054 DQ284087 DQ283783 DQ282905 DQ283468 4287

Kyarranussphagnicolus

ABTC 25186 Australia, New SouthWales, DorrigoMountain

DQ283313 DQ283957 DQ283646 3442

Laliostomalabrosum

UMMZ213554

Madagascar, Toliara,Sakaraha, ZombitsyForest, 44.7116668S,22.8433338E

DQ283057 DQ284089 DQ283786 AF249169 DQ283470 4295

Lankanectescorrugatus*

AF215393AF249019AF249043

AF249115 AF249178 2102

Latimeriachalumnae

AMNHA59196

Comoros, GrandeComore

NCp001804 DQ284319 AF131253 DQ283653 3865

Lechriodusfletcheri

ABTC 24921 Australia, New SouthWales, Border RangesNational Park

DQ283282DQ283283

DQ284299 DQ283942 DQ282793 DQ283632 3753

Leiopelma archeyi DMG 5123 New Zealand, NorthIsland, CoromandelPeninsula, TapuSummit

DQ283216DQ283215

DQ284246 DQ283895 DQ283588 3395

Leiopelmahochstetteri

DMG 5135 New Zealand,Waitakere Mts,Cowan Stream

DQ283217 DQ284247 DQ282755 DQ283589 3894

Lepidobatrachuslaevis

AMNHA168407


Leptobrachiumchapaense

AMNHA163791

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, MountTay Conn Linh II,above Tham VeVillage, spring camp,1420 m, 228459590N,1048499560E

DQ283052 DQ284081 DQ283467 3053

Leptobrachiumhasselti

CAS 222293 Myanmar, RakhineState, Gwa Township,Rakhine YomaElephant Sanctuary,Kyat stream camp,17842914.00N,94838954.30E

DQ283239 DQ284265 DQ283911 DQ282767 DQ283605 4176

Leptodactylodonbicolor

UTAA44492

Cameroon, SouthwestProv, plateau NWNtale Village

DQ283364 DQ284351 DQ283986 DQ282980 3587



Locus/partition


bp

Leptodactylusfuscus

AMNHA139088

Guyana, SouthernRupununi savanna,Aishalton (onKubabawau Creek),150 m, 28289310N,598199160W

DQ283404 DQ284385 DQ284015 DQ282862 AY341760 DQ283716 4744

Leptodactylusocellatus

MACN38648

Argentina, BuenosAires, Escobar, LomaVerde,Establecimiento ‘‘LosCipreses’’

AY843688 DQ284104 AY844681 AY844302 3809

Leptolalaxbourretti

AMNHA163810

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, MountTay Conn Linh II,above Tham Vevillage, stream 2 kmSW base camp, 1420m, 22846980N,1048499510E

DQ283381 DQ284367 DQ284000 DQ282844 DQ283696 3246

Leptopelisargenteus

CAS 169938 Kenya, Kilifi Dist,14.4 km W Kakayuni,towards Lake Jilore,on Kakayuni Rdroadside pond

DQ283226 DQ284256 DQ283903 DQ283596 3760

Leptopelis bocagei RdS 802 Tanzania, Iringa,Kibebe Farm,07848912.40S,35845924.20E

DQ283418 DQ283014 DQ283729 3639

Leptopelis sp. AMNHA168408


Leptopelisvermiculatus

CAS 168661 Tanzania, TangaRegion, Muheza Dist,East Usambara Mts,Amani-Muheza Rd 3–5 km SE Amani

DQ283242 DQ284268 DQ283608 3450

Limnodynastesdepressus

NTMR26241

Australia, NorthernTerritory, ElizabethDowns, Daly Riverregion

DQ283308 DQ284312 DQ283954 DQ282805 DQ283643 4174

Limnodynastesdumerilli

SAMAR34734

Australia, New SouthWales, Langothlin

DQ283285DQ283286

DQ284301 DQ283944 DQ282794 DQ283633 3743

Limnodynastesornatus

QMJ 57109 Australia, Queensland,Heathlands

DQ283280DQ283281

DQ284298 DQ283941 DQ282792 DQ283631 3756

Limnodynastesperonii

AH No data DQ283245DQ283246

DQ284272 DQ283917 DQ282772 2962

Limnodynastessalmini*

AY326071 2408

Limnomedusamacroglossa

MACN38641

Argentina, Misiones,Aristobulo del Valle,Balneario Cunapiru

AY843689 DQ284127 AY844682 AY844128 3594

Limnonectesacanthi*

AY313724 2399

Limnonectesgrunniens

ABTC 47812 Papua New Guinea,Utai

DQ283202 DQ284234 DQ283885 DQ282745 3443

Limnonectesheinrichi*

AY313749 2402

Limnonectes kuhlii AMNHA161202

Vietnam, Quang BinhProv, Minh Hoa, ChaLo

AY313686 DQ284234 DQ283885 DQ282745 DQ282982 DQ283688 4686

Limnonectespoilani

AMNHA163717

Vietnam, Quang NamProv, Tra My, TraTap Commune,stream near Thon 2Village, 920–1060 m,15899370N, 108829260E

DQ283378 DQ284364 DQ283997 DQ282841 DQ282989 3981

Limnonectesvisayanus*

AY313719 2358



Locus/partition


bp

Lineatritonlineolus*

AF380808 516

Liophrynerhododactyla

ABTC 49566 Papua New Guinea,Bulolo

DQ283199 DQ284231 DQ283882 DQ282742 DQ283580 4171

Lithobatespalmipes

AMNHA166454

Guyana, Magdalen’sCreek camp, 6300 ydNW bank ofKonawaruk River ca.25 mi (linear) WSWMabura Hill, 400 ft,5813970N, 59829430W

DQ283384 DQ284369 DQ284001 DQ282847 DQ282994 DQ283699 4686

Lithodytes lineatus AMNHA166426

Guyana, BerebiceRiver camp at ca. 18mi (linear) SWKwakwani (ca. 2 midownriver fromKurundi Riverconfluence), 200 ft,585960N, 588149140W

AY843690 DQ284112 AY844683 AY844129 AY844303 4345

Litoria aurea AMS 52744 New Caledonia, ProvNord, Valle Phaaye,Nomac River, 8 km EPoum

AY843691 DQ284098 AY844684 AY844130 AY844892 3989

Litoria freycineti SAMAR12260

Australia, New SouthWales, 16 km ERetreat

AY843693 DQ284122 AY844686 AY844894 3460

Litoriagenimaculata

SAMAR41068

Australia, NorthernTerritory, Mt Lewis

DQ283222 DQ284252 DQ283899 DQ282759 DQ283592 4144

Litoria inermis SAMAR53945

Australia, WesternAustralia, 24 km NTunnel Creek Gorge

DQ283211DQ283212

DQ284243 DQ283892 2718

Litoria lesueurii SAMAR35012

Australia, New SouthWales, MurrumbidgeeRiver

DQ283204 DQ284236 DQ283887 DQ282747 3456

Litoria meiriana SAMAR17215

Australia, WesternAustralia, BlackRock, near Kununurra

AY843695 DQ284125 AY844688 AY844895 AY844132 3988

Litoria nannotis SAMAR40266

Australia, Queensland,Paluma

DQ283218 DQ284248 DQ283896 DQ282756 3459

Lysapsus laevis AMCC10720

Guyana, SouthernRupununi Savannah,Aishalton (onKubanawan Creek)

AY843696 DQ284110 AY844689 AY844896 AY844133 AY844305 4746

Mannophrynetrinitatis

MVZ199838

Trinidad and Tobago,Nariva Parish,Tamana Cave,Charuma Ward

DQ283071 DQ284108 DQ283796 3052

Mantellaaurantiaca

UMMZ201411

Madagascar,Toamasina,Moramanga, AndasibeRegion

DQ283035 DQ284061 DQ283766 DQ282651 DQ282901 DQ283460 4666

Mantella nigricans AMNHA167477

Madagascar,Antsiranana,Ambanja, AntsaravyRidge, TsaratananaReserve, 138559340S,488549210E

DQ283034 DQ284056 DQ283764 DQ283458 3730

Mantidactyluscf. femoralis

AMNHA167581

Madagascar,Antsiranana,Ambanja, RamenaRiver Camp,Tsaratanana Reserve,13855940S, 488539160E

AY843698 DQ284055 DQ283763 AY844898 DQ282900 3978

Mantidactylusperaccae

UMMZ213278

Madagascar,Fianarantsoa, Ivohibe,AndringitraVolotsangana River(Camp 3),47.0166668S,22.2777778E

DQ283036 DQ284062 DQ283767 DQ282652 3445



Locus/partition


bp

Megaelosia goeldii MZUSP95879

Brazil, Rio de Janeiro,Teresopolis, Rio BeijaFlor, 910 m, 228249S,428699W

DQ283072 DQ284109 DQ283797 DQ282911 3590

Megistolotislignarius

SAMAR37834

Australia, WesternAustralia, Kununurra

DQ283289 DQ284303 DQ282796 DQ283634 3846

Megophrys nasuta FMNH236525

Malaysia, Sabah,Tenom Dist, CrockerRange National Park,Purulon camp, SungaiKilampun

DQ283342 DQ284331 DQ283969 DQ282818 3437

Melanophryniscusklappenbachi

MACN38531

Argentina, Chaco,vicinity Resistencia

AY843699 DQ284060 DQ283765 AY844899 AY844306 4207

Meristogenysorphnocnemis

FMNH230531

Malaysia, Sabah,Lahad Datu Dist,Danum ValleyResearch Center,Sungai PalumTambun

DQ283147 DQ284187 DQ283847 DQ282703 DQ283538 4176

Metacrinianichollsi

WAMR106065

Australia, WesternAustralia, 9.5 kmENE Mt Frankland

DQ283292DQ283293

DQ284305 DQ283946 DQ282798 DQ283636 3077

Micrixalus borealis CAS 205064 Myanmar, RakhineState, Gwa Township,ca. 0.5 mi S PleasantBeach Resort,1784393.70N,94831955.60E

DQ283235DQ283236

DQ283909 DQ282766 DQ283603 2517

Micrixalus fuscus* AF249024AF249056

AF249120 AF249183 2105

Micrixaluskottigeharensis*

AF249025AF249041

AF249121 AF249184 2103

Microhylaheymonsi

AMNHA163850

Vietnam, Ha GiangProv, Yen Minh, DuGia Commune, KhauRia Village, stream 1,below cascade,228549270N,1058139520E

DQ283382 DQ282845 DQ282992 DQ283697 4052

Microhyla sp. RdS 05 No data (pet trade) DQ283422 DQ284400 DQ284025 DQ282879 DQ283017 DQ283732 4678

Micrylettainornata*

AF285207 502

Minyobatesclaudiae

USNM-FS59980

Panama, Bocas delToro, S end of IslaPopa, 1 km ESumwood Channel

DQ283042 DQ284071 DQ283772 DQ282654 DQ283462 4224

Mixophyescarbinensis

ABTC 25115 Australia, Queensland,Mt Lewis area

DQ283314DQ283315

DQ284315 DQ283958 2148

Myobatachusgouldii

WAMR116075

Australia, WesternAustralia, SpaldingPark Geraldton

DQ283309DQ283310

DQ284313 DQ283955 DQ283644 3337

Nannophrysceylonensis*

AF249016AF249047

AF249112 AF249175 2112

Nanorana pleskei* AF206111AF206156AF206492

1979

Nasikabatrachidaesp.*

AY425725AY425726

902

Nasikabatrachussahyadrensis*

AY364360AY364381

AY364406 1532

Natalobatrachusbonebergi*

AF215396AF215198

784

Nectophryne afra UTAA44673

Cameroon, SouthwestProv, vicinityEdienosa

DQ283360 DQ284347 DQ283981 DQ282831 DQ282977 DQ283680 4705



Locus/partition


bp

Nectophryne batesi RABI 031 Gabon, Rabi (ShellGabon), near ToucanWell Head, 01.478S,09.538E

DQ283169 DQ284207 DQ282721 DQ283559 3863

Nectophrynoidestornieri


DQ283413 DQ284394 DQ284018 DQ282870 DQ283723 3774

Necturus cf. beyeri AMCC125608

USA, Florida, JacksonCo, Econfina Creek,30834.179N,85821.729W

DQ283151 DQ284190 DQ283542 2952

Necturusmaculosus

AMCC105652

USA, New York,Suffolk Co, ColdSpring Harbor, ColdSpring Harbor FishHatchery

DQ283412 DQ283722 2622

Nelsonophryneaequatorialis*

AY326067 2414

Neobatrachuspictus

SAMAR50636

Australia, SouthAustralia, 10 km SRobe

DQ283290DQ283291

DQ284304 DQ282797 DQ283635 3430

Neobatrachussudelli

SAMAR12391

Australia, New SouthWales, 30 km NKenmore

AY843700 DQ284123 AY844691 AY844307 3779

Nesionixalusthomensis

CAS 218925 Sao Tome andPrincipe, Sao Tome I,forest at radio tower SBom Sucesso,00816964.00N,06836920.00E

DQ284123 DQ284261 DQ283906 DQ282764 DQ282953 DQ283600 4213

Nesomantisthomasseti

RAN 25162 Seychelles, Mahe,junction of Foret NoirRd with Grand BoisRiver and CongoRouge Trail

DQ283452 DQ284425 DQ284042 AY341761 DQ283755 3776

Neurerguscrocatus*

AY147246AY147247

719

Nidiranaadenopleura

UMMZ189963

China, Taiwan, Taipei,Wu-Lai, Shao-Yi, trailalong Tung-Ho Creek

DQ283117 DQ284163 DQ283829 DQ282685 DQ282930 DQ283515 4684

Nidiranachapaensis

AMNHA161183

Vietnam, Ha TinhProv, Huang SonReserve, Rao Anregion, top of PomuMountain, 900–1200m, 188209530N,1058149380E

DQ283365DQ283366

DQ284352 DQ283987 DQ282833 DQ282981 DQ283685 3791

Notadenmelanoscaphus

QMJ 57130 Australia, Queensland,Hervey Range

DQ283287DQ283288

DQ284302 DQ283945 DQ282795 3026

Notophthalmusviridiscens

AMCC106084

No data DQ283421 DQ284399 DQ284024 DQ282878 3001

Nototritonabscondens*

AF199199 514

Nyctibatescorrugatus

UTAA44461

Cameroon,Southwestern Prov,vicinity Ediensoa

DQ283361 DQ284349 DQ283983 DQ282979 DQ283682 3876

Nyctibatrachuscf. aliciae*

AF249018AF249063

AF249114 1578

Nyctibatrachusmajor*

AF249017AF249052AY341687

AF249113 AF249176 2688

Nyctimistespulchra

SAMAR45336

Papua New Guinea,Magidobo, SHP

AY843701 DQ284126 AY844692 AY844134 3588



Locus/partition


bp

Nyctimystes dayi SAMAR41010;ZSM 748/2000

Australia, Queensland,Pilgrim Sands;Australia, Queensland,Tully River tributary,100 m, 50 km (by rd)NW Tully

DQ283220 DQ284250DQ284276

DQ283921DQ283897

DQ282757 DQ283591 4145

Nyctixalus pictus FMNH231095


DQ283133 DQ284174 DQ283834 DQ282689 DQ283526 4150

Nyctixalus spinosus ACD 1043 Philippines, Mindanao DQ283114 DQ284160 DQ283827 DQ283512 3768

Occidozygabaluensis

FMNH242747

Malaysia, Sabah,Sipitang Dist,Mendolong camp,km 6.8

DQ283143 DQ284183 DQ283844 DQ282699 DQ282936 DQ283535 4262

Occidozyga lima CAS 213254 Myanmar, YangonDivision, Hlaw GaPark, MingalardonTownship,17802936.50N,96806941.50E

AF161027 DQ284254 DQ283901 DQ282761 DQ282951 DQ283594 4143

Occidozygamartensii

AMNHA161171

Vietnam, Ha TinhProv, Huang SonReserve, Rao Anregion, 160 m,188299540N,1058139510E

DQ283357 DQ284344 DQ283978 DQ282829 DQ282976 3560

Odontophrynusachalensis

ZSM 733/2000; BB1324

Argentina, ProvCordoba, Pampa deAchala; Argentina,Prov Cordoba,proximity ofPampilla, nearParador El Condor

DQ283247DQ283248

DQ284273 DQ283918 DQ282773 DQ283611 4243

Odontophrynusamericanus

JF 1946 Argentina, BuenosAires, Escobar, LomaVerde, Ea. ‘‘LosCipreses’’

AY843704 AY844695 AY844901 AY844309 3913

Odorrana grahami CAS 207504 China, Yunnan,Baoshan Pref, Qushi,ca. 258179N, 988369E

DQ283241 DQ284267 DQ283913 DQ282769 DQ283607 4163

Oedipinauniformis*

AF199230 515

Ophryophrynehansi

AMNHA163669

Vietnam, Quang NamProv, Tra My, TraDon Commune, nearCamp 1, 980–1020m, 158119410N,108829250E

DQ283377 DQ284363 DQ283996 DQ282840 DQ282988 3995

Ophryophrynemicrostoma

AMNHA163859

Vietnam, Ha GiangProv, Yen Minh, DuGia Commune, KhauRia Village, stream 1,above cascade, 900m, 22854980N,1058139520E

DQ283391 DQ284376 DQ284006 DQ282852 DQ283705 4190

Opisthothylaximmaculatus

MB 5513(SAM); DPL3968

Gabon, Rabi (ShellGabon), at Rabi 059,trap lines 1–3,01.56338S, 09.51098E;Cameroon, SouthwestProv, Kumba–Mamferd, within 15 km Nand S of Nguti

DQ283174 DQ284211 DQ283866 DQ282971 DQ283563 4274

Oreophrynebrachypus

AMSR129618

Papua New Guinea, 8km NNE Amelei

DQ283194 DQ284227 DQ282738 DQ283577 3446

Osornophryneguacamayo*

AY326036 2412



Locus/partition


bp

Osteocephalustaurinus

AMNHA131254

Venezuela, Amazonas,Neblina base camp onRıo Mawarinuma(5Rıo Baria), 140 m

AY843709 DQ284075 AY844700 AY844905 AY844140 AY844313 4731

Osteopilusseptentrionalis

USNM317830

Cuba, Guantanamo,Guantanamo Bay

AY843712 DQ284049 AY844906 AY844316 3886

Pachytritonbrevipes

AMNHA168416

No data (pet trade) DQ283446DQ283447

DQ284421 1749

Pantheranaberlandieri*

AY115111 856

Pantherana capito AMCC125632

USA, Florida,Hernando Co, CroomWildlife ManagementArea, Seed Orchard

DQ283187 DQ284221 DQ283874 DQ282732 DQ283572 4158

Pantheranachiricahuensis

ASU 33310 USA, Arizona,Greenlee Co,Coleman Creek

DQ283270 DQ284290 DQ283934 DQ282962 DQ283626 4291

Pantherana forreri USNM534222

Honduras, El Paraiso,12 km NNW Ojo deAgua

DQ283103 DQ284152 DQ283818 DQ282678 DQ283503 4156

Pantherana pipiens UMMZ227023

USA, Michigan, KentCo, Grand RapidsAda Township Park

DQ283123 DQ284167 DQ283831 DQ282686 DQ283519 4161

Pantheranayavapaiensis

CG USA, Arizona, PimaCo, Cienega Creek

DQ283272 DQ284292 DQ283936 DQ282787 DQ283628 4158

Papurana daemeli SAMAR40355

Australia, NorthernTerritory, CapeTribulation

DQ283201 DQ284233 DQ283884 DQ282744 DQ282948 DQ283581 4682

Paracriniahaswelli

SAMAR40951

Australia, Victoria,near Marlo

DQ283304DQ283305

DQ284310 DQ283952 DQ283641 3327

Paramesotriton sp. RdS Vietnam (no otherdata)

DQ283428 1950

Paratelmatobiussp.

CFBH-T 240 Brazil, Parana,Piraquara

DQ283098 DQ284148 DQ283814 DQ282676 DQ282925 DQ283499 4726

Parvimolgetownsendi*

AF451247 512

Pedostibes hosei FMNH231190

Malaysia, Sabah,Lahad Datu Dist,Danum ValleyResearch Center,Sungai PalumTambun

DQ283164 DQ284202 DQ283859 DQ282717 3463

Pelobatescultripes*

AY236801AY364341AY364363

AY364386 1586

Pelobates fuscus AH Germany, Thuringen,Geroda (Triptis)

DQ283113 DQ284159 DQ283826 DQ283511 3788

Pelodytespunctatus

AH Spain, Barcelona DQ283111 DQ284157 DQ283824 DQ282682 DQ283509 4175

Pelomedusasubrufa

RAX 2055(now KU)

Ghana, Muni Lagoon,Winneba, 58219140N,08429120W

NC001947 DQ282782 DQ283622 3545

Pelophrynebrevipes*

AF375503AF375530

1093

Pelophylaxnigromaculata

FMNH232879

China, Sichuan,Hongya Xian, BinLing

DQ283137 DQ284178 DQ283838 DQ282693 DQ282932 DQ283530 4694

Pelophylaxridibunda*

AB023397AY147983

918

Petropedetescameronensis

UTAA44399

Cameroon, SouthwestProv, vicinityEdiensoa

DQ283075DQ283076

DQ284130 DQ283800 DQ282665 DQ283481 3671

Petropedetesnewtoni

RABI 033 Gabon, Rabi (ShellGabon), Toucan WellHead, 01.47508S,09.53358E

DQ283177DQ283178

DQ284214 DQ283869 DQ282727 3045



Locus/partition


bp

Petropedetespalmipes

UTAA52407

Cameroon, SouthProv, near Bipindi,vicinity 0658198,0342287 (UTM 32 N)

DQ283074 DQ284129 DQ283799 DQ282664 DQ283480 3747

Petropedetesparkeri*

AY341694AY364348AY364369

AY364394 AY341757 2830

Phaeognathushubrichti*

AY728233 2363

Phasmahylaguttata

CFBH 5756 Brazil, Sao Paulo,Ubatuba, Picinguaba

AY843716 AY844703 AY844909 AY844145 3661

Philautusrhododiscus

AMNHA163892

Vietnam, Ha GiangProv, Vi Xuyen, CaoBo Commune, MountTay Conn Linh II,above Tham VeVillage, base camp,1420 m, 22846980N,1048499510E

DQ283392DQ283393

DQ284007 DQ282853 DQ282998 DQ283706 3945

Phlyctimantisleonardi

DPL 4057 Cameroon,Southwestern Prov,Kumba–Mamfe

DQ283355DQ283356

DQ284343 DQ282828 DQ283677 3446

Phobobatessilverstonei

RG No data (AtlantaBotanical Garden,captive bred)

DQ283073 DQ284116 DQ283798 DQ282663 DQ283479 4223

Phrynobatrachusauritus

UTAA44704

Cameroon, SouthwestProv, vicinityEdienosa

DQ283084 DQ284135 DQ282668 DQ282916 DQ283485 3901

Phrynobatrachuscalcaratus

CAS 199268 Cameroon, East Prov,Dja Reserve, BoumirCamp, 38119260N,128489420E, 665 m

DQ283240 DQ28426 DQ283912 DQ282768 DQ283606 4157

Phrynobatrachusdendrobates

CAS 202048 Uganda, RukunguriProv Dist, BwindiImpenetrable NationalPark, Munyaga River,ca. 100 m downstreamMunyaga Falls

DQ283228DQ283229

DQ2842 DQ283904 DQ283598 3312

Phrynobatrachusdispar

CAS 218995 Sao Tome andPrincipe, Sao TomeId., Java,00815939.90N,06839903.20E

DQ283223 DQ284253 DQ283900 DQ282760 DQ283593 3742

Phrynobatrachusmababiensis

RdS 805 Tanzania, Iringa,Kibebe Farm, NettingPond, 07848912.40S,35845924.20E

DQ283424 DQ284402 DQ284026 DQ282881 DQ283733 4158

Phrynobatrachusnatalensis

RdS 881 Tanzania, TatandaVillage, 08829927.20S,31830918.30E

DQ283414 DQ284395 DQ284019 DQ282871 DQ283009 DQ283724 4628

Phrynodonsandersoni

UTAA44599;UTAA44600

Cameroon, SouthwestProv, plateau NWNtale Village. ca.567 m

DQ283082DQ283083

DQ284339DQ284134

DQ283804DQ283975

DQ282825DQ282667

DQ282915DQ282973

DQ283673DQ283484

4662

Phrynomantisbifasciatus

RdS No data (pet trade) DQ283154 DQ28419 DQ282709 DQ282940 DQ283545 3945

Phrynopus sp. AMNHA165108

Bolivia, La Paz,Bautista Saavedra,Canton Charazani, ca.4 km E Chullina,3590 m, 158109120S,688539120W

AY843720 DQ284371 DQ282995 AY844323 3901

Phrynopus sp.* KU 202652 AY326010 3446

Phyllobateslugubris

USNM-FS195116

Panama, Bocas delToro, S end of IslaPopa, 1 km ESumwood Channel

DQ283043 DQ282655 DQ283463 4157

Phyllodytesluteolus

JLG17 Brazil, Espırito Santo,Setiba, Guarapari

AY843721 AY844708 AY844913 AY844150 3312



Locus/partition


bp

Phyllomedusavaillanti

AMNHA166288

Guyana, BerbiceRiver camp at ca. 18mi (linear) SWKwakwani, ca. 2 midownriver fromKurundi Riverconfluence, 200 ft,585960N, 588149140W

AY549363 AY844716 AY844921 AY844158 AY844329 3742

Physalaemusgracilis

RdS 788 Uruguay, Flores DQ283417 DQ284022 DQ282875 DQ283728 3885

Pipa carvalhoi AH No data DQ283251 DQ284277 DQ283922 DQ282774 DQ283613 4009

Pipa pipa USNM562560

Venezuela, Amazonas,Dept Rıo Negro,Neblina Base Campon the Rıo Baria,008499500N,668099400W, 140 m

DQ283053 DQ283781 DQ282660 3168

Platymantispelewensis

USNM546385

Palau Islands,Ngerekebesang I,Echang village, rd toJapanese bunkers justN Image Restaurantand Palau SunriseHotel, 78219N,1348279E

DQ283104 DQ2841 DQ283819 DQ282679 DQ283504 4134

Platymantis weberi AMSR134894

Solomon Islands, NewGeorgia, Patutiva

DQ283196 DQ284229 DQ283880 DQ282740 3436

Platypelis grandis AMNHA167214

Madagascar,Antsiranana, Vohemar,Bezavona Mountain,138319580S,498519570E

DQ283410 DQ284392 DQ282868 DQ283007 DQ283721 4336

Plectrohylaguatemalensis

UTAA-55140

Guatemala,Guatemala, DonJusto, Santa Rosalia,km 12.5 on the hwyto El Salvador

AY843731 AY844719 AY844924 AY844160 3663

Plethodon dunni TAT 1040 USA, Oregon, LaneCo, RichardsonCreek Rd

DQ283262 DQ284285 DQ283930 DQ283620 3226

Plethodon jordani UMMZ210798

North Carolina,Macon Co, CoweetaMiddle Elevation

DQ283125DQ283126

DQ284169 DQ283521 2431

Plethodontohylasp.

AMNHA167315

Madagascar,Antsiranana, Vohemar,Camp 1, SorataMountain, 13841990S,498269310E

DQ283409 DQ284390 DQ282866 DQ283006 DQ283719 3914

Pleurodeles waltl AMNHA168418

No data (pet trade) DQ283445 DQ284420 DQ283751 3442

Pleurodemabrachyops

AMNHA139118

Guyana, SouthernRupununi Savanna,Aishalton (onKubabawau Creek),150 m, 28289310N,598199160W

AY843733 DQ28411 AY844721 AY844926 3466

Polypedatescruciger*

AF249028AY341685

AF249124 AF249187 2167

Polypedatesleucomystax

AMNHA161395

Vietnam, Ha Tinh,Huong Son, HuongSon Reserve, Rao Anregion, top of PomuMountain, 900–1200m, 188209530N,1058149380E

DQ283048 DQ284079 DQ283777 3040

Probrevicepsmacrodactylus


DQ283420 DQ282877 DQ283016 DQ283731 3149



Locus/partition


bp

Proceratophrysavelinoi

JF 1947 Argentina, Misiones,Guarani, San Vicente,Campo Anexo INTA‘‘Cuartel RıoVictoria’’

DQ283038DQ283039

DQ2840 DQ283769 DQ282903 3255

Pseudacris crucifer JF No data (pet trade) AY843735 DQ284114 AY844723 AY844927 AY844163 DQ283478 4695

Pseudacrisocularis

AMNHA168472

USA, Florida,Columbia Co, SR 2502 mi W I-10

AY843736 AY844724 AY844164 4416

Pseudis paradoxa MACN37786

Argentina, Corrientes,Dept Bellavista, SanRoque–Bellavista rd

AY843740 DQ284128 AY844727 AY844167 AY844337 4357

Pseudoamolopssauteri

UMMZ189938

China, Taiwan, Tai-Chung, Ha-Pin troutpond near Wu-Lin

DQ283124 DQ284168 DQ283832 DQ283520 3762

Pseudobranchusstriatus

AMCC125629

USA, Georgia, LongCo, 15.5 km EGlennville

DQ283182DQ283183

DQ284217 DQ283569 2935

Pseudoeuryceaconanti

JAC 21252 Mexico, Oaxaca,Sierra Madre del Sur,San Jose Pacıfico–Portillo del RayoHwy, 1850 m,1681.7019N,96831.1769W

DQ283454 DQ284427 DQ283757 2917

Pseudopaludicolafalcipes

MACN38647

Argentina, Corrientes,Yapeyu

AY843741 DQ284117 AY844728 AY844930 AY844168 3989

Pseudophrynebibroni

SAMAR73293

Australia, New SouthWales, S ParaReservoir Reserve

AY843988 AY844338 3118

Pseudophrynecoriacea

ABTC 25573 Australia, New SouthWales, SheepstationCreek, Border Ranges

DQ283311DQ283312

DQ284314 DQ283956 DQ282806 DQ283645 3276

Pseudorana johnsi AMNHA161191

Vietnam, Nghe AnProv, Con Cuong,Chau Khe Commune,Ngun Stream, 300 m,19829170N, 104842960E

DQ283214 DQ284245 DQ283894 DQ282754 DQ283587 4148

Ptychadenaanchietae*

AF261249AF261267

1650

Ptychadenacooperi

AMNHA158394

Ethiopia, Bale Prov,creek just E Dinsho

DQ283066DQ283067

DQ283792 DQ283475 2497

Ptychadenamascareniensis

AMNHA167415

Madagascar,Antsiranana,Ambanja,MandrizavonaVillage, RamenaValley, 13848930S,488449470E

DQ283031 DQ284052 DQ283760 DQ282899 3670

Ptychohylaleonhardlschultei

UTAA-54782

Mexico, Oaxaca,Sierra Madre del Sur,Pochutla Hwy, 681 m

AY843746 AY844733 AY844934 AY844171 3660

Pyxicephalusedulis

AMNHA168412

No data (pet trade) DQ283157 DQ284195 DQ283853 DQ282711 DQ282941 DQ283548 4685

Quasipaaverrucospinosa

AMNHA163740


DQ283379 DQ284365 DQ283998 DQ282842 DQ282990 DQ283694 4263

Quasipaaexilispinosa

ZSM 759/2000

China, Hong Kong,Lantau Island, SunsetPeak

DQ283244 DQ284271 DQ283916 DQ282771 DQ282957 DQ283610 4698

Ramanellaobscura*

AF215382 499

Rana japonica FMNH232896

China, Sichuan,Hongya Xian, BinLing

DQ283136 DQ284177 DQ283837 DQ282692 DQ283529 4153



Locus/partition


bp

Rana sylvatica AMCC108286

USA, New Jersey,Monmouth Co, 2 miN Manalapan,40.279108N,74.381368W

DQ283387 DQ284373 DQ284004 DQ282849 DQ282996 DQ283702 4687

Rana temporaria ZSM 762/2000; UMFS8005

Germany, Thuringia,Schnellbach, 725 melevation; Ireland,Kells, Meath

DQ283127DQ283128DQ283129

DQ284170DQ284269

DQ283914 DQ282956 DQ283522 4284

Ranodon sibiricus* NC004021 2428

Rhacophorusannamensis

AMNHA161414

Vietnam, Quang BinhProv, Minh Hoa,Cha Lo

DQ283047 DQ283776 2729

Rhacophorusbipunctatus

AMNHA161418

Vietnam, Ha TinhProv, Huong SonDist, Huon SonReserve, Rao Anregion, top of PomuMountain

AY843750 DQ284078 AY844737 3756

Rhacophoruscalcaneus

AMNHA163749


DQ283380 DQ284366 DQ283999 DQ282843 DQ282991 DQ283695 4692

Rhacophorusorlovi

AMNHA161405

Vietnam, Ha TinhProv, Huong SonDist, Huon SonReserve, Nga Doiregion, tributary ofNga Doi River, 240–350 m, 188299500N,1058139490E

DQ283049 DQ283778 2716

Rhamphophrynefestae*

AF375504AF375531

1583

Rheobatrachussilus

ABTC 7317 Australia, Queensland,Connondale Ranges

DQ283275DQ283276

DQ284295 DQ283938 DQ282789 3007

Rhinatremabivittatum

AMNHA166059

Guyana, Magdalen’sCreek camp, 6300 ydNW bank ofKonawaruk River ca.25 mi (linear) WSWMabura Hill, 400 ft,5813970N, 59829430W

DQ283385 DQ284370 DQ284002 DQ283700 2897

Rhinodermadarwinii

IZUA 3504 Chile, X Region,Valdivia, ReservaForestal de Oncol

DQ283324 DQ284320 DQ283963 DQ282813 DQ283654 4202

Rhinophrynusdorsalis

WR USA, Texas, Starr Co,near McAllen (livingspecimen)

DQ283109 DQ284156 DQ283822 DQ282681 DQ283507 4198

Rhyacotritoncascadae

UMFS11729

USA, Oregon,Multnomah Co,122.1148W, 45.5698N

DQ283110 DQ283823 DQ283508 2924

Salamandrasalamandra

AMNHA168419


Scaphiophrynemarmorata

AMNHA-167395

Madagascar,Antsiranana,Vohemnar, Sorata Mtn(1320 m)

AY843751 DQ284391 AY364390 DQ282867 AY844175 DQ283720 4706

Scaphiopus couchii AMNHA168413


Scaphiopusholbrooki

AMNHA168434

USA, Florida,Alachua Co, Rd 346,1.2 mi W jct FloridaHwy 121

DQ283156 DQ284194 DQ283852 DQ282710 DQ283547 4101

Scarthylagoinorum

KU 215427 Peru, Madre de Dios,Cusco Amazonico, 15km E PuertoMaldonado

AY843752 AY844738 AY844938 3124



Locus/partition


bp

Schismadermacarens

RdS 796 Tanzania, Iringa,Kibebe Farm,07848912.40S,35845924.20E

DQ283425 DQ284403 DQ284027 DQ282882 DQ283734 4218

Schistometopumgregorii

BMNH2002.98

Tanzania DQ283089 DQ284140 DQ283805 DQ283490 3749

Schoutedenellaschubotzi

CAS 201752 Uganda, RukungiriDist, BwindiImpenetrable NationalPark, Buhoma Rd (Eside), ca. 25 m SBizenga River,00859933.90S,29836956.60E

DQ283237DQ283238

DQ284264 DQ283910 DQ283604 2964

Schoutedenellasylvatica

UTAA44685

Cameroon, SouthwestProv, vicinity Babong

DQ283077DQ283078

DQ284131 DQ283801 DQ282666 DQ282912 DQ283482 4028

Schoutedenellataeniata

CAS 207926 Equatorial Guinea,Bioko I, vicinityMoka Malabo, alongroad cut of Moka Rd,03821939.50N,08840902.70E

DQ283232 DQ284262 DQ283907 DQ282954 DQ283601 3892

Schoutedenellaxenodactyloides

RdS 864 Tanzania, UluguruMts, Tegetero Village,68569300S, 378439100E

DQ283431 DQ284408 DQ284030 DQ283023 DQ283739 3911

Scinax garbei MHNSM7311

Peru, Madre de Dios,Prov Tambopata,Cusco Amazonico, ca.15 km E PuertoMaldonado, 200 m

DQ283030 DQ283759 DQ282650 DQ282898 DQ283457 4446

Scinax ruber IWK 109 Guyana, Iwokrama,Muri Scrub camp

AY549365 DQ284045 AY844746 AY844944 AY844181 3993

Scolecomorphusvittatus

FMNH251843

Tanzania, TangaRegion, Muheza Dist,western edgeKwangumi ForestReserve, 4.4 km WMt Mhinduro, 2 km SKwamtili Estateoffices, 230 m,48569300S, 388449E

DQ283338 DQ284329 DQ282816 DQ283663 3792

Scotoblepsgabonicus

UTAA44772

Cameroon, SW Prov,vicinity Ediensoa

DQ283367 DQ284353 DQ283988 DQ282834 DQ283686 3743

Scythrophryssawayae

CFBH 6072 Brazil, Parana,Piraquara

DQ283099 DQ284149 DQ283815 DQ282926 DQ283500 4334

Sierrana maculata USNM559483

Honduras, Atlantida,Parque Nacional PicoBonito, Quebrada deOro (tributary of RıoViejo), 158389N,868489W, 945 m

DQ283303 DQ284309 DQ283951 DQ282803 DQ282967 3975

Silurana tropicalis UTAA47158

Cameroon, East Prov,vicinity LipondjiVillage

DQ283363 DQ284350 DQ283985 DQ283684 3834

Siphonops hardyi MW 1032(BM)

Brazil DQ283088 DQ284139 DQ283489 2535

Siren intermedia* Y10946 2410

Siren lacertina AMCC125630

USA, Florida, PutnamCo, RodmanReservoir at FL Hwy310, 29832.59N,81850.29W

DQ283181 DQ284216 DQ282729 DQ283568 3825

Smilisca phaeota RdS 786 No data (BaltimoreNatl Aquarium;captive bred)

AY843764 DQ284083 AY844751 AY844948 AY844185 AY844351 4733

Sooglossussechellensis

UMMZ(#15)

No data DQ283449DQ283450

DQ284423 DQ284040 DQ282895 DQ283028 DQ283753 4337



Locus/partition


bp

Spea hammondii RNF 3221 USA, California, SanDiego Co, Del MarMesa,32.947383338N,117.156883338W

DQ283179 DQ283870 DQ282728 DQ283566 3857

Speleomantesitalicus*

AY728215 2069

Sphaenorhynchuslacteus

USNM152136

Peru, Madre de Dios,30 km (by air) SSWPuerto Maldonado,Tambopata Reserve

AY549367 DQ28404 AY844754 AY844188 AY844352 4344

Sphaerothecabreviceps

USNM524017

Myanmar, Sagaing,Kanbular Township,Chatthin, ca. 2 kmWNW ChatthinWildlife Sancturary,San Myaung Camp,238349460N,958449260E, 200 m

DQ283100 DQ28415 DQ283816 DQ282927 DQ283501 3883

Sphaerothecapluvialis*

AF249014AF249042

AF249110 AF249173 2110

Sphenophryne sp. AMSR122221

Papua New Guinea,Namosado

DQ283205 DQ284237 DQ282748 3134

Spicospinaflammocaerulea

WAMR119457

Australia, WesternAustralia, 30 km NEWalpole

DQ283301DQ283302

DQ284308 DQ283950 DQ282802 DQ282966 DQ283640 4267

Stauroistuberlinguis

FMNH243096

Malaysia, Sabah,Sipitang Dist,Mendolong camp,Sungai Mendolong

DQ283140 DQ284180 DQ283841 DQ282696 DQ283532 4150

Stefania evansi AMNHA164211

Guyana, Iwokrama,Pakatau Creek, 85 m,48459N, 598019W

AY843767 AY844755 AY844950 AY844189 AY844353 4032

Stephopaedesanotis*

AF220910 511

Strongylopus grayii AMNHA144979

South Africa, WesternCape Prov,Bainskloof, atsettlement at crest ofpass in stream

DQ283068 DQ283793 2719

Stumpffiacf. psologlossa

AMNHA167359

Madagascar,Antsiranana, Vohemar,Bezavona Mountain,138319580S,498519570E

DQ283411 DQ284393 DQ282869 DQ283008 3580

Sylvirana guentheri AMNHA161190;AMNHA163940

Vietnam, Ha TinhProv, Ke Go NaturalReserve, Rao Cai;Vietnam, Ha Tinh,Yen Minh, Du GiaCommune, Khau RiaVillage, rice paddy onedge of limestoneforest south ofvillage, 934 m,228539490N,1058149480E

DQ283265DQ283266DQ283267

DQ284287DQ284377

DQ283931DQ284009

DQ282783DQ282855

DQ283623DQ283708

4155

Sylviranamaosonensis

AMNHA161487

Vietnam, Vinh PhuProv, ca. 17 km NWTam Dao Hill Stationnear Buddhist temple(E Tinh Sinh)

DQ283373 DQ284359 DQ283993 DQ282838 DQ282985 DQ283691 4687

Sylvirananigrovittata

AMNHA161280

Vietnam, Ha TinhProv, Ke Go NaturalReserve, Rao Cai

DQ283371 DQ284357 DQ283991 DQ282836 DQ282983 DQ283689 4284

Sylviranatemporalis*

AF249022AF249054

AF249118 AF249181 2163

Synapturanusmirandaribeiroi

MJH 3986 No data DQ283064 DQ284094 DQ282908 DQ283473 2032



Locus/partition


bp

Tachycnemisseychellensis

UMMZ189382

Seychelles, Praslin,near entrance Valleede Mai

DQ283451 DQ284424 DQ284041 DQ282896 DQ283029 DQ283754 4719

Taricha sp. AMNHA168420


Taudactylusacutirostris

SAMAR41092

Australia, Queensland,Mt Lewis

DQ283277DQ283278

DQ284296 DQ283939 DQ282790 2987

Tayloranalimborgi*

AF261251 490

Telmatobiusjahuira

AMNHA165110

Bolivia, La Paz,Bautista Saavedra,Charazani Canton,stream 4, 15879490S,688539170W

DQ283040 DQ283770 2740

Telmatobiusmarmoratus

AMNHA165114

Bolivia, La Paz,Bautista Saavedra,Charazani Canton,stream, 2700–2750 m,15879490S,688539170W

AY843769 DQ284068 AY844757 AY844952 AY844355 4192

Telmatobius sp. AMNHA165130

Bolivia, La Paz,Bautista Saavedra,Charazani Canton,stream 4, 15879490S,688539170W

DQ283041 DQ284067 DQ283771 3066

Telmatobufovenustus

IZUA 3054 Chile, VII Region,Altos de Vilches, RıoLicay

DQ283325 DQ284321 DQ283964 DQ282814 DQ283655 3216

Thelodermacorticale

AMNHA161499

Vietnam, Vinh PhuProv, ca. 500 m WInstitute of Ecologyand BiologicalResources Station onSW outskirts of TamDao

DQ283050 DQ284080 DQ283779 DQ282659 DQ282904 3969

Thorius sp. JAC 21291 Mexico, Oaxaca,Sierra Miahuatlan,2943 m

DQ283334 DQ284325 DQ283659 2925

Thoropa miliaris CFBH 3239 Brazil, Sao Paulo,Picinguaba, Ubatuba

DQ283331 2752

Tlalocohyla picta RdS 606 Belize, Stann CreekDist, CockscombBasin WildlifeSanctuary

AY843654 DQ284121 AY844640 AY844858 AY844099 AY844276 4739

Tomopternadelalandii

AMNHA144981

South Africa, WesternCape Prov,Stellenbosch air field

DQ283403 DQ284384 DQ284014 DQ282861 DQ283005 DQ283715 4694

Torrentophryneaspinia*

AF160770AF160787

897

Trachycephalusjordani

UMMZ218914

No data AY843771 DQ284097 AY844758 AY844953 AY844190 AY844356 4735

Trachycephalusvenulosus

AMNHA141142


AY549362 AY844707 AY844912 AY844149 AY844322 4735

Trichobatrachusrobustus

DPL 3932 Cameroon, SouthwestProv, Kumba–Mamfe

AY843773 DQ284335 AY844760 AY844954 AY844192 DQ283669 4684

Triprion petasatus RdS Belize, HummingbirdHwy, 9.5 km fromWestern Hwyturnpoint

AY843774 DQ284082 AY844761 AY844955 AY844193 AY844357 4729

Triturus cristatus AMNHA168421


Trypheropsiswarszewitschii

KRL 823(voucher atUniv ofPanama)

Panama, Cocle Prov,Parque Nacional ElCope

DQ283256 DQ284280 DQ283925 DQ282777 DQ282958 DQ283617 4682



Locus/partition


bp

Tylerana arfaki AMSR114913

Papua New Guinea,near Haia

DQ283203 DQ284235 DQ283886 DQ282746 3982

Tylototritonshanjing

AMCC105494

No data DQ283395 DQ284378 DQ283709 3433

Typhlonectesnatans

BMNH2000.218

Venezuela (no otherdata)

DQ283085 DQ284136 DQ283486 2992

Uperoleialaevigata

SAMAR42629

Australia, New SouthWales, OurimbahState Forest

DQ283221 DQ284251 DQ283898 DQ282758 3445

Uraeotyphlusnarayani

MW 1418(Univ ofKerala)

India (no other data) DQ283090 DQ284141 DQ282671 DQ283491 3822

Vanzoliniusdiscodactylus

RdS Ecuador (no otherdata)

DQ283433 DQ284410 DQ284033 DQ282887 DQ283742 4204

Werneria mertensi DPL 5107 Cameroon (no otherdata)

DQ283348 DQ284338 DQ283974 DQ282824 DQ283672 4217

Wolterstorffinaparvipalmata

DPL 5101 Cameroon (no otherdata)

DQ283346 DQ284334 DQ283972 DQ282822 DQ283668 3778

Xenophryslateralis* (5X.major)

AY236800 553

Xenophrys major AMNHA161506

Vietnam, Vinh PhuProv, ca. 17 km NWTam Dao Hill Stationnear Buddhist temple(E Tinh Sinh)

DQ283374 DQ284360 DQ282986 DQ283692 3572

Xenopus gilli AMNHA153027

South Africa, WesternCape Prov, 5 km E ofBetty’s Bay, 348229S,19879E

DQ283442DQ283443

DQ284418 DQ283750 3161

Xenopus laevis* NC001573Y10943

BC054145 AY341764 X59734 4044


APPENDIX 2

ACCESSION NUMBERS AND PUBLICATION REFERENCES FOR GENBANK SEQUENCES USED

Accession numbers and publication references are provided for all 199 GenBank sequences includedin this study. The locus mtDNA refers to 12S, tRNAVal, and 16S sequences.

Species Locus GenBank accession number Reference

Acanthixalus spinosus mtDNA AJ437002, AF215214, AF465438 Vences, unpubl. data; Rodel et al., 2003;Vences et al., 2003c

Afrixalus fornasini mtDNA U22071 Richards and Moore, 1996Alligator sinensis mtDNA NC004448 Wu et al., unpubl. dataAllophryne ruthveni mtDNA AF364511, AF364512 Austin et al., 2002Alytes obstetricans Rhodopsin AY364385 Biju and Bossuyt, 2003Ambystoma tigrinum Rhodopsin U36574 N. Chen et al., 1996Amnirana galamensis Rhodopsin AY341808 Vences et al., 2003dAmolops hongkongensis mtDNA AF206072, AF206453, AF206117 L.Q. Chen et al., 2005Andrias davidianus mtDNA AJ492192 Zhang et al., 2003aAneides hardii mtDNA AY728226 Mueller et al., 2004Anhydrophryne rattrayi mtDNA AF215504 Vences, unpubl. dataAnodonthyla montana mtDNA AJ314812 Odierna et al., unpubl. dataAnsonia muelleri mtDNA U52740, U52784 Graybeal, 1997Ascaphus truei mtDNA AJ440760 Hertwig et al., 2004Batrachoseps attenuatus mtDNA AY728228 Mueller et al., 2004Batrachoseps wrightorum mtDNA AY728221 Mueller et al., 2004Boophis tephraeomystax Tyrosinase AF249168 Bossuyt and Milinkovitch, 2000Brachytarsophrys feae mtDNA AY236799 Garcıa-Parıs et al., 2003Bufo angusticeps mtDNA AF220852, AF220899 Cunningham and Cherry, 2000Bufo biporcatus mtDNA AY325987 Darst and Cannatella, 2004Bufo bufo mtDNA AY325988 Darst and Cannatella, 2004Bufo bufo Rhodopsin U59921 Fyhrquist et al., unpubl. dataBufo celebensis mtDNA AF375513, AY180245 Darst and Cannatella, 2004; B.J. Evans et al.,

2004Bufo margaritifer mtDNA AF375514, AF375489 A. Gluesenkamp, unpubl. dataBufo mazatlanensis mtDNA U52755, U52723 Graybeal, 1997Bufo nebulifer mtDNA AY325985 Darst and Cannatella, 2004Callulina kreffti mtDNA AY326068 Darst and Cannatella, 2004Callulops slateri mtDNA AF095339 Emerson et al., 2000bCapensibufo rosei mtDNA AF220864, AF220911 Cunningham and Cherry, 2000Capensibufo tradouwi mtDNA AF220865, AF220912 Cunningham and Cherry, 2000Centrolene geckoideum mtDNA X86230, X86264, X86298 Hay et al., 1995Centrolene prosoblepon mtDNA AY364358, AY364379 Biju and Bossuyt, 2003Centrolene prosoblepon Rhodopsin AY364404 Biju and Bossuyt, 2003Chiromantis xerampelina mtDNA AF215348, AF458132 Vences, unpubl. data; J.A. Wilkinson et al.,

2002Clinotarsus curtipes mtDNA AF249058, AF249021 Bossuyt and Milinkovitch, 2000Clinotarsus curtipes Rhodopsin AF249117 Bossuyt and Milinkovitch, 2000Clinotarsus curtipes Tyrosinase AF249180 Bossuyt and Milinkovitch, 2000Cryptobatrachus sp. mtDNA AY326050 Darst and Cannatella, 2004Cryptotriton alvarezdeltoroi mtDNA AF199196 Garcıa-Parıs and Wake, 2000Dendrotriton rabbi mtDNA AF199232 Garcıa-Parıs and Wake, 2000Desmognathus wrighti mtDNA AY728225 Mueller et al., 2004Didynamipus sjostedti mtDNA AY325991 Darst and Cannatella, 2004Ensatina eschscholtzii mtDNA AY728216 Mueller et al., 2004Euphlyctis cyanophlyctis mtDNA AF249053, AF249015 Bossuyt and Milinkovitch, 2000; Biju and

Bossuyt, 2003Euphlyctis cyanophlyctis Rhodopsin AF249111 Bossuyt and Milinkovitch, 2000Euphlyctis cyanophlyctis Tyrosinase AF249174 Bossuyt and Milinkovitch, 2000Euproctus asper mtDNA U04694, U04695 Caccone et al., 1994Fejervarya cancrivorus mtDNA AB070731, AF206473, AF206092, AF206137 Chen et al., unpubl. data; Sumida et al., 2002Fejervarya kirtisinghei mtDNA AY014380 Kosuch et al., 2001Fejervarya syhadrensis mtDNA AY141843, AF249011 Bossuyt and Milinkovitch, 2000; Meegaskum-

bura et al., 2002Fejervarya syhadrensis Rhodopsin AF249107 Bossuyt and Milinkovitch, 2000Fejervarya syhadrensis Tyrosinase AF249170 Bossuyt and Milinkovitch, 2000Gazella thomsoni mtDNA M86501 Allard et al., 1992Gegeneophis ramaswamii mtDNA AF461136, AF461137 M. Wilkinson et al., 2002Glandirana minima mtDNA AF315127, AF315153 Jiang and Zhou, 2001Hemisus marmoratus mtDNA AY326070 Darst and Cannatella, 2004Heterixalus tricolor mtDNA AY341630, AY341697, AY341725 Vences et al., 2003dHeterixalus tricolor Tyrosinase AY341759 Vences et al., 2003dHydrophylax galamensis Tyrosinase AY341749 Vences et al., 2003dHylorina sylvatica mtDNA AY389153 Nunez, unpubl. dataHymenochirus boettgeri mtDNA AY341634, AY341700, AY341726 Vences et al., 2003dHymenochirus boettgeri Tyrosinase AY341763 Vences et al., 2003dIguana iguana mtDNA NCp002793 Janke et al., 2001Indirana sp. 1 mtDNA AF249051 Bossuyt and Milinkovitch, 2000Indirana sp. 1 Rhodopsin AF249122 Bossuyt and Milinkovitch, 2000Indirana sp. 1 Tyrosinase AF249185 Bossuyt and Milinkovitch, 2000Indirana sp. 2 mtDNA AF249064 Bossuyt and Milinkovitch, 2000Indirana sp. 2 Rhodopsin AF249123 Bossuyt and Milinkovitch, 2000


Species Locus GenBank accession number Reference

Indirana sp. 2 Tyrosinase AF249186 Bossuyt and Milinkovitch, 2000Ixalotriton niger mtDNA AF451248 Parra-Olea, 2002Laliostoma labrosum Tyrosinase AF249169 Bossuyt and Milinkovitch, 2000Lankanectes corrugatus mtDNA AF215393, AF249019, AF249043 Vences, unpubl. data; Bossuyt and Milinkov-

itch, 2000Lankanectes corrugatus Rhodopsin AF249115 Bossuyt and Milinkovitch, 2000Lankanectes corrugatus Tyrosinase AF249178 Bossuyt and Milinkovitch, 2000Latimeria chalumnae mtDNA NCp001804 Zardoya and Meyer, 1996Latimeria chalumnae Rhodopsin AF131253 Yokoyama et al., 1999Leptodactylus fuscus Tyrosinase AY341760 Vences et al., 2003dLimnodynastes salmini mtDNA AY326071 Darst and Cannatella, 2004Limnonectes acanthi mtDNA AY313724 B.J. Evans et al., 2004Limnonectes heinrichi mtDNA AY313749 B.J. Evans et al., 2004Limnonectes kuhlii mtDNA AY313686 B.J. Evans et al., 2004Limnonectes visayanus mtDNA AY313719 B.J. Evans et al., 2004Lineatriton lineolus mtDNA AF380808 Parra-Olea and Wake, 2001Micrixalus fuscus mtDNA AF249024 Bossuyt and Milinkovitch, 2000Micrixalus fuscus mtDNA AF249056 Bossuyt and Milinkovitch, 2000Micrixalus fuscus Rhodopsin AF249120 Bossuyt and Milinkovitch, 2000Micrixalus fuscus Tyrosinase AF249183 Bossuyt and Milinkovitch, 2000Micrixalus kottigeharensis mtDNA AF249025, AF249041 Bossuyt and Milinkovitch, 2000Micrixalus kottigeharensis Rhodopsin AF249121 Bossuyt and Milinkovitch, 2000Micrixalus kottigeharensis Tyrosinase AF249184 Bossuyt and Milinkovitch, 2000Micryletta inornata mtDNA AF285207 Ziegler, unpubl. dataNannophrys ceylonensis mtDNA AF249016, AF249047 Bossuyt and Milinkovitch, 2000Nannophrys ceylonensis Rhodopsin AF249112 Bossuyt and Milinkovitch, 2000Nannophrys ceylonensis Tyrosinase AF249175 Bossuyt and Milinkovitch, 2000Nanorana pleskei mtDNA AF206111, AF206156, AF206492 L.Q. Chen et al., 2005Nasikabatrachus sahyadrensis mtDNA AY364360, AY364381 Biju and Bossuyt, 2003Nasikabatrachus sahyadrensis Rhodopsin AY364406 Biju and Bossuyt, 2003Nasikobatrachidae sp. mtDNA AY425725, AY425726 Dutta et al., 2004Natalobatrachus bonebergi mtDNA AF215396, AF215198 Vences, unpubl. dataNelsonophryne aequatorialis mtDNA AY326067 Darst and Cannatella, 2004Nesomantis thomasseti Tyrosinase AY341761 Vences et al., 2003dNeurergus crocatus mtDNA AY147246, AY147247 Steinfartz et al., 2002Nototriton abscondens mtDNA AF199199 Garcıa-Parıs and Wake, 2000Nyctibatrachus cf. aliciae mtDNA AF249018, AF249063 Bossuyt and Milinkovitch, 2000Nyctibatrachus cf. aliciae Rhodopsin AF249114 Bossuyt and Milinkovitch, 2000Nyctibatrachus major mtDNA AF249017, AF249052, AY341687 Bossuyt and Milinkovitch, 2000; Vences et

al., 2003dNyctibatrachus major Rhodopsin AF249113 Bossuyt and Milinkovitch, 2000Nyctibatrachus major Tyrosinase AF249176 Bossuyt and Milinkovitch, 2000Occidozyga lima mtDNA AF161027 Marmayou et al., 2000Oedipina uniformis mtDNA AF199230 Garcıa-Parıs and Wake, 2000Osornophryne guacamayo mtDNA AY326036 Darst and Cannatella, 2004Parvimolge townsendi mtDNA AF451247 Parra-Olea, 2002Pelobates cultripes mtDNA AY236801, AY364341, AY364363 Garcıa-Parıs et al., 2003; Biju and Bossuyt,

2003Pelobates cultripes Rhodopsin AY364386 Biju and Bossuyt, 2003Pelomedusa subrufa mtDNA NCp001947 Zardoya and Meyer, 1998Pelophryne brevipes mtDNA AF375503, AF375530 Gluesenkamp, unpubl. dataPelophylax ridibunda mtDNA AB023397, AY147983 Sumida et al., 2000bPetropedetes parkeri mtDNA AY341694, AY364348, AY364369 Biju and Bossuyt, 2003Petropedetes parkeri Rhodopsin AY364394 Biju and Bossuyt, 2003Petropedetes parkeri Tyrosinase AY341757 Vences et al., 2003dPhaeognathus hubrichti mtDNA AY728233 Mueller et al., 2004Phrynopus sp. KU 202652 mtDNA AY326010 Darst and Cannatella, 2004Polypedates cruciger mtDNA AF249028, AY341685 Bossuyt and Milinkovitch, 2000; Vences et

al., 2003dPolypedates cruciger Rhodopsin AF249124 Bossuyt and Milinkovitch, 2000Polypedates cruciger Tyrosinase AF249187 Bossuyt and Milinkovitch, 2000Ptychadena anchietae mtDNA AF261249, AF261267 Richards et al., 2000Ramanella obscura mtDNA AF215382 Vences, unpubl. dataRana berlandieri mtDNA AY115111 Zaldıvar-Riveron et al., 2004Ranodon sibiricus mtDNA NCp004021 Zhang et al., 2003bRhamphophryne festae mtDNA AF375504, AF375531 Gluesenkamp, unpubl. dataScaphiophryne marmorata Rhodopsin AY364390 Biju and Bossuyt, 2003Siren intermedia mtDNA Y10946 Feller and Hedges, 1998Speleomantes italicus mtDNA AY728215 Mueller et al., 2004Sphaerotheca pluvialis mtDNA AF249014, AF249042 Bossuyt and Milinkovitch, 2000Sphaerotheca pluvialis Rhodopsin AF249110 Bossuyt and Milinkovitch, 2000Sphaerotheca pluvialis Tyrosinase AF249173 Bossuyt and Milinkovitch, 2000Stephopaedes anotis mtDNA AF220910 Cunningham and Cherry, 2000Sylvirana temporalis mtDNA AF249022, AF249054 Bossuyt and Milinkovitch, 2000Sylvirana temporalis Rhodopsin AF249118 Bossuyt and Milinkovitch, 2000Sylvirana temporalis Tyrosinase AF249181 Bossuyt and Milinkovitch, 2000Taylorana limborgi mtDNA AF261251 Richards et al., 2000Torrentophryne aspinia mtDNA AF160770, AF160787 W. Liu et al., 2000Xenophrys major mtDNA AY236800 Garcıa-Parıs et al., 2003Xenopus laevis Rhodopsin BC054145 Klein et al., 2002Xenopus laevis Tyrosinase AY341764 Vences et al., 2003d


APPENDIX 3

BASE-PAIR LENGTH OF 28S FRAGMENT

Higher taxon and family SpeciesLength

(bp) Higher taxon and family SpeciesLength

(bp)

MarsupialiaDidelphidae Didelphis marsupialis 1092

DiapsidaAlligatoridae Alligator sinensis 696Iguanidae Iguana iguana 699

TestudinesChelydridae Chelydra serpentina 694Pelomedusidae Pelomedusa subrufa 694

CoelocanthaLatimeriidae Latimeria chalumnae 691

AnuraAlytidae Alytes obstetricans 706Alytidae Discoglossus galganoi 706Alytidae Discoglossus pictus 706Amphignathodontidae Flectonotus sp. 762Arthroleptidae Arthroleptis tanneri 721Arthroleptidae Arthroleptis variabilis 722Arthroleptidae Astylosternus schioetzi 716Arthroleptidae Cardioglossa gratiosa 717Arthroleptidae Cardioglossa leucomystax 719Arthroleptidae Leptopelis argenteus 717Arthroleptidae Leptopelis bocagei 717Arthroleptidae Leptopelis sp. 717Arthroleptidae Nyctibates corrugatus 717Arthroleptidae Schoutedenella schubotzi 744Arthroleptidae Schoutedenella xenodactyloides 762Arthroleptidae Scotobleps gabonicus 718Arthroleptidae Trichobatrachus robustus 714Batrachophrynidae Caudiverbera caudiverbera 709Batrachophrynidae Telmatobufo venustus 710Bombinatoridae Bombina microdeladigitora 710Bombinatoridae Bombina orientalis 710Bombinatoridae Bombina variegata 710Brachycephalidae Barycholos ternetzi 744Brachycephalidae Brachycephalus ephippium 740Brachycephalidae Craugastor alfredi 759Brachycephalidae Craugastor augusti 760Brachycephalidae Craugastor bufoniformis 744Brachycephalidae Craugastor pluvicanorus 830Brachycephalidae Craugastor punctariolus 756Brachycephalidae Craugastor rhodopis 756Brachycephalidae Eleutherodactylus binotatus 747Brachycephalidae Eleutherodactylus juipoca 738Brachycephalidae Eleutherodactylus rugulosus 757Brachycephalidae Euhyas planirostris 768Brachycephalidae Phrynopus sp. 743Brachycephalidae Syrrhophus marnockii 769Brachycephalidae Syrrhophus nitidus 769Brevicipitidae Breviceps mossambicus 712Brevicipitidae Callulina kisiwamsitu 710Brevicipitidae Probreviceps macrodactylus 710Bufonidae Atelopus spumarius 766Bufonidae Bufo alvarius 751Bufonidae Bufo amboroensis 751Bufonidae Bufo andrewsi 752Bufonidae Bufo arenarum 752Bufonidae Bufo asper 751Bufonidae Bufo boreas 751Bufonidae Bufo brauni 751Bufonidae Bufo camerunensis 732Bufonidae Bufo cf. chilensis 752Bufonidae Bufo cognatus 751Bufonidae Bufo divergens 750Bufonidae Bufo granulosus 742Bufonidae Bufo guttatus 752Bufonidae Bufo gutturalis 732Bufonidae Bufo haematiticus 752Bufonidae Bufo latifrons 751Bufonidae Bufo maculatus 751Bufonidae Bufo punctatus 700Bufonidae Bufo quercicus 751Bufonidae Bufo terrestris 751Bufonidae Bufo tuberosus 721

Anura (continued)Bufonidae Bufo viridis 751Bufonidae Bufo woodhousii 751Bufonidae Dendrophryniscus minutus 752Bufonidae Melanophryniscus klappenbachi 740Bufonidae Nectophryne afra 752Bufonidae Nectophryne batesi 752Bufonidae Nectophrynoides tornieri 753Bufonidae Schismaderma carens 754Bufonidae Werneria mertensi 751Bufonidae Wolterstorffina parvipalmata 750Centrolenidae Centrolene prosoblepon 732Centrolenidae Cochranella bejaranoi 732Centrolenidae Hyalinobatrachium fleischmanni 732Ceratobatrachidae Batrachylodes vertebralis 714Ceratobatrachidae Ceratobatrachus guentheri 720Ceratobatrachidae Playmantis pelewensis 713Ceratophryidae Atelognatus patagonicus 732Ceratophryidae Batrachyla leptopus 732Ceratophryidae Ceratophrys cranwelli 728Ceratophryidae Telmatobius sp. 728Cryptobatrachidae Stefania evansi 786Cycloramphidae Alsodes gargola 757Cycloramphidae Cycloramphus boraceiensis 742Cycloramphidae Eupsophus calcaratus 757Cycloramphidae Odontophrynus achalensis 780Cycloramphidae Odontophrynus americanus 778Cycloramphidae Rhinoderma darwinii 744Dendrobatidae Allobates boulengeri 774Dendrobatidae Ameerega femoralis 782Dendrobatidae Colostethus undulatus 775Dendrobatidae Dendrobates auratus 759Dendrobatidae Minyobates claudiae 760Dendrobatidae Phobobates silverstonei 771Dendrobatidae Phyllobates lugubris 769Dicroglossidae Hoplobatrachus occipitalis 708Dicroglossidae Hoplobatrachus rugulosus 708Dicroglossidae Limnonectes kuhlii 709Dicroglossidae Occidozyga lima 708Dicroglossidae Paa exilispinosa 714Dicroglossidae Quasipaa verrucospinosa 708Dicroglossidae Phrynoglossus baluensis 708Dicroglossidae Phrynoglossus borealis 708Dicroglossidae Sphaerotheca breviceps 709Heleophrynidae Heleophryne regis 719Hemisotidae Hemisus marmoratus 709Hylidae Anotheca spinosa 743Hylidae Hypsiboas albomarginatus 764Hylidae Aplastodiscus perviridis 757Hylidae Argenteohyla siemersi pederseni 740Hylidae Charadrahyla nephila 741Hylidae Cruziohyla calcarifer 789Hylidae Dendropsophus minutus 713Hylidae Dendropsophus nanus 745Hylidae Duellmanohyla rufioculis 738Hylidae Ecnomiohyla miliaria 744Hylidae Exerodonta chimalapa 743Hylidae Hyla cinerea 742Hylidae Hyloscirtus armatus 764Hylidae Hyloscirtus palmeri 767Hylidae Hypsiboas boans 757Hylidae Hypsiboas granosus 767Hylidae Hypsiboas multifasciatus 762Hylidae Litoria genimaculata 690Hylidae Lysapsus laevis 757Hylidae Nyctimistes dayi 694Hylidae Osteocephalus taurinus 740Hylidae Osteopilus septentrionalis 742Hylidae Phrynohyas venulosa 744Hylidae Phyllomedusa vaillanti 795Hylidae Plectrohyla guatemalensis 744Hylidae Pseudacris crucifer 743Hylidae Pseudacris triseriata 747Hylidae Pseudis paradoxa 758Hylidae Scinax garbei 778




(bp)

Anura (continued)Hylidae Smilisca phaeota 745Hylidae Sphaenorhynchus lacteus 753Hylidae Tlalacohyla picta 747Hylidae Trachycephalus jordani 742Hylidae Triprion petasatus 743Hyperoliidae Afrixalus fornasinii 714Hyperoliidae Afrixalus pygmaeus 714Hyperoliidae Alexteroon obstetricans 716Hyperoliidae Cryptothylax gresshoffi 714Hyperoliidae Heterixalus sp. 735Hyperoliidae Hyperolius alticola 714Hyperoliidae Hyperolius punticulatus 713Hyperoliidae Hyperolius tuberilinguis 713Hyperoliidae Kassina senegalensis 714Hyperoliidae Nesionixalus thomensis 714Hyperoliidae Opisthothylax immaculatus 714Hyperoliidae Phlyctimantis leonardi 714Hyperoliidae Tachycnemis seychellensis 733Leiopelmatidae Ascaphus truei 703Leiopelmatidae Leiopelma archeyi 703Leiopelmatidae Leiopelma hochstetteri 703Leptodactylidae Edalorhina perezi 756Leptodactylidae Leptodactylus fuscus 750Leptodactylidae Leptodactylus ocellatus 742Leptodactylidae Lithodytes lineatus 746Leptodactylidae Paratelmatobius sp. 730Leptodactylidae Physalaemus cuvieri 761Leptodactylidae Scythrophrys sawayae 728Leptodactylidae Vanzolinius discodactylus 745Limnodynastidae Adelotus brevis 721Limnodynastidae Heleioporus australiacus 720Limnodynastidae Lechriodus fletcheri 727Limnodynastidae Limnodynastes depressus 724Limnodynastidae Limnodynastes dumerilli 719Limnodynastidae Limnodynastes lignarius 720Limnodynastidae Limnodynastes ornatus 730Limnodynastidae Neobatrachus pictus 721Limnodynastidae Neobatrachus sudelli 721Limnodynastidae Philoria sphagnicola 724Mantellidae Aglyptodactylus madagascariensis 710Mantellidae Laliostoma labrosum 712Mantellidae Mantella aurantiaca 685Mantellidae Mantella nigricans 685Megophryidae Leptobrachium chapaense 728Megophryidae Leptobrachium hasselti 726Megophryidae Leptolalax pelodytoides 726Megophryidae Ophryophryne microstoma 725Megophryidae Xenophrys major 726Microhylidae Aphantophryne pansa 719Microhylidae Calluella guttulata 725Microhylidae Choerophryne sp. 719Microhylidae Cophixalus sphagnicola 718Microhylidae Ctenophryne geayei 727Microhylidae Dasypops schirchi 719Microhylidae Dyscophus guineti 716Microhylidae Gastrophryne elegans 720Microhylidae Gastrophryne olivacea 721Microhylidae Genyophryne thomsoni 728Microhylidae Hoplophryne rogersi 718Microhylidae Kalophrynus pleurostigma 716Microhylidae Kaloula pulchra 732Microhylidae Liophryne rhododactyla 718Microhylidae Microhyla heymonsi 725Microhylidae Microhyla sp. 698Microhylidae Oreophryne brachypus 719Microhylidae Phrynomantis bifasciatus 726Microhylidae Platyelis sp. 716Microhylidae Plethodontohyla sp. 717Microhylidae Scaphiophryne marmorata 716Microhylidae Synapturanus mirandaribeiroi 718Myobatrachidae Arenophryne rotunda 726Myobatrachidae Crinia nimba 724Myobatrachidae Metacrinia nichollsi 726Myobatrachidae Myobatachus gouldii 726Myobatrachidae Pseudophryne bibroni 726Myobatrachidae Pseudophryne coriacea 726Myobatrachidae Spicospina flammocaerulea 726Pelobatidae Pelobates fuscus 713

Anura (continued)Pelodytidae Pelodytes puntatus 703Petropedetidae Arthroleptides sp. 747Petropedetidae Conraua goliath 708Petropedetidae Conraua robusta 708Petropedetidae Petropedetes cameronensis 718Petropedetidae Petropedetes palmipes 726Phrynobatrachidae Dimorphognathus africanus 708Phrynobatrachidae Phrynobatrachus auritus 707Phrynobatrachidae Phrynobatrachus calcaratus 719Phrynobatrachidae Phrynobatrachus dendrobates 708Phrynobatrachidae Phrynobatrachus dispar 719Phrynobatrachidae Phrynobatrachus mababiensis 708Phrynobatrachidae Phrynobatrachus natalensis 708Phrynobatrachidae Phrynodon sandersoni 710Pipidae Silurana tropicalis 713Pipidae Xenopus gilli 713Ptychadenidae Ptychadena cooperi 714Pyxicephalidae Amietia angolensis 718Pyxicephalidae Amietia fuscigula 721Pyxicephalidae Amietia vertebralis 718Pyxicephalidae Arthroleptella bicolor 731Pyxicephalidae Aubria subsigillata 708Pyxicephalidae Aubria subsigillata 708Pyxicephalidae Pyxicephalus edulis 708Pyxicephalidae Tomopterna delalandii 713Ranidae Amerana mucosa 708Ranidae Amnirana albilabris 708Ranidae Amolops chapaensis 709Ranidae Aquarana catesbeiana 708Ranidae Aquarana clamitans 709Ranidae Aquarana grylio 708Ranidae Aquarana heckscheri 708Ranidae Aquarana aurora 708Ranidae Chalcorana chalconota 708Ranidae Huia nasica 709Ranidae Hylarana taipehensis 708Ranidae Lithobates palmipes 708Ranidae Meristogenys orphnocnemis 708Ranidae Nidirana adenopleura 714Ranidae Nidirana chapaensis 708Ranidae Odorrana grahami 709Ranidae Odorrana livida 709Ranidae Pantherana capito 708Ranidae Pantherana chiricahuensis 708Ranidae Pantherana forreri 708Ranidae Pantherana pipiens 708Ranidae Pantherana yavapaiensis 708Ranidae Papurana daemeli 708Ranidae Pelophylax nigromaculata 708Ranidae Pseudoamalops sauteri 713Ranidae Pseudorana johnsi 708Ranidae Rana japonica 709Ranidae Rana sylvatica 707Ranidae Rana temporaria 707Ranidae Staurois tuberlinguis 710Ranidae Sylvirana guentheri 708Ranidae Sylvirana maosonensis 708Ranidae Sylvirana nigrovittata 708Ranidae Trypheropsis warszewitschii 708Rhacophoridae Chirixalus doriae 709Rhacophoridae Chirixalus vittatus 710Rhacophoridae Kurixalus eiffingeri 709Rhacophoridae Kurixalus idiooticus 709Rhacophoridae Nyctixalus pictus 709Rhacophoridae Nyctixalus spinosus 709Rhacophoridae Philautus rhododiscus 709Rhacophoridae Rhacophorus bipunctatus 709Rhacophoridae Rhacophorus calcaneus 709Rhinophrynidae Rhinophrynus dorsalis 705Scaphiopodidae Scaphiopus couchii 703Scaphiopodidae Scaphiopus holbrooki 703Scaphiopodidae Spea hammondii 703Sooglossidae Nesomantis thomasseti 737Sooglossidae Sooglossus seychellensis 741

ArtiodactylaBovidae Gazella thomsoni 748




(bp)

CaudataAmbystomatidae Dicamptodon ensatus 694Amphiumidae Amphiuma tridactylum 694Cryptobranchidae Cryptobranchus alleganiensis 694Hynobiidae Batrachuperus pinchoni 694Plethodontidae Bolitoglossa rufescens 694Plethodontidae Desmognathus quadramaculatus 695Plethodontidae Eurycea wilderae 694Plethodontidae Gyrinophilus porphyriticus 694Plethodontidae Plethodon dunni 694Plethodontidae Plethodon jordani 694Plethodontidae Pseudoeurycea conanti 695Plethodontidae Thorius sp. 694Proteidae Necturus cf. beyeri 694Proteidae Necturus maculosus 694Rhyacotritonidae Rhyacotriton cascadae 694Salamandridae Pleurodeles waltl 694Salamandridae Triturus sp. 695Salamandridae Tylototriton shanjing 694

Caudata (continued)Sirenidae Pseudobranchus striatus 694Sirenidae Siren lacertina 694

GymnophionaCaeciliidae Boulengerula uluguruensis 701Caeciliidae Caecilia tentaculata 709Caeciliidae Crotaphatrema tchabalmboensis 727Caeciliidae Geotrypetes seraphini 710Caeciliidae Herpele squalostoma 700Caeciliidae Hypogeophis rostratus 702Caeciliidae Schistometopum gregorii 701Caeciliidae Siphonops hardyi 700Caeciliidae Typhlonectes natans 684Ichthyophiidae Ichthyophis peninsularis 683Ichthyophiidae Ichthyophis sp. 697Ichthyophiidae Uraeotyphlus narayani 683Rhinatrematidae Epicrionops sp. 714Rhinatrematidae Rhinatrema bivittatum 695

APPENDIX 4

BRANCH LENGTHS, BREMER SUPPORT, AND JACKKNIFE VALUES

Values given correspond to branches numbered in figures 50, 52, 53, 54, 56, 58, 59, 60, 61, 62, 63, and 65.

Branch TaxonBranchlength

Bremersupport Jackknife Branch Taxon

Branchlength

Bremersupport Jackknife

1 Amniota 117 96 1002 Mammalia 81 67 1003 Sauropsida 103 83 1004 Testudines 105 83 1005 Diapsida 94 75 1006 Amphibia 78 49 1007 Gymnophiona 89 78 1008 Rhinatrematidae 49 30 1009 Stegokrotaphia 58 47 100

10 Ichthyophiidae 89 82 10011 Unnamed 56 33 10012 Caeciliidae 60 44 10013 Unnamed 63 41 10014 Unnamed 34 21 10015 Unnamed 98 90 10016 Unnamed 44 27 10017 Scolecomorphinae 47 40 10018 Unnamed 73 32 10019 Unnamed 31 23 10020 Unnamed 55 39 10021 Unnamed 24 19 10022 Unnamed 25 17 10023 Batrachia 72 109 10024 Caudata 114 107 9925 Cryptobranchoidei 58 40 10026 Hynobiidae 91 80 10027 Cryptobranchidae 122 115 10028 Andrias 71 64 10029 Diadectosalamandroidei 43 30 9930 Hydatinosalamandroidei 38 29 10031 Perennibranchia 43 35 10032 Proteidae 166 163 10033 Sirenidae 108 98 10034 Siren 57 49 10035 Treptobranchia 43 29 10036 Ambystomatidae 78 69 10037 Dicamptodon 168 165 10038 Ambystoma 135 128 10039 Unnamed 54 52 10040 Salamandridae 72 63 10041 Pleurodelinae 35 28 10042 Unnamed 37 24 100

43 Unnamed 21 9 10044 Unnamed 20 6 9245 Unnamed 22 9 9946 Unnamed 26 21 10047 Unnamed 11 9 9948 Unnamed 7 2 7849 Plethosalamandroidei 50 41 9950 Xenosalamandroidei 48 31 9951 Plethodontidae 94 85 9952 Plethodontinae 36 24 10053 Unnamed 26 15 10054 Unnamed 45 38 10055 Unnamed 29 19 9956 Unnamed 39 26 10057 Desmognathus 37 26 10058 Unnamed 26 13 10059 Unnamed 77 66 10060 Unnamed 34 13 9761 Batrachoseps 85 43 10062 Unnamed 15 6 8863 Unnamed 25 15 9964 Unnamed 48 34 10065 Unnamed 24 21 9966 Unnamed 9 4 9767 Unnamed 7 1 5168 Unnamed 10 4 8769 Unnamed 9 6 9470 Unnamed 60 11 9971 Unnamed 5 2 6272 Pseudoeurycea 7 3 7673 Unnamed 12 9 9974 Anura 125 109 9975 Leiopelmatidae 55 41 10076 Leiopelma 72 65 10077 Lalagobatrachia 82 57 9978 Xenoanura 68 55 10079 Pipidae 45 48 10080 Unnamed 36 130 10081 Pipa 85 198 10082 Unnamed 145 17 10083 Xenopus 24 24 10084 Sokolanura 36 20 99




Branchlength


85 Costata 69 55 10086 Alytidae 68 48 10087 Discoglossus 138 130 10088 Bombinatoridae 200 198 10089 Unnamed 27 17 10090 Unnamed 28 24 10091 Acosmanura 81 65 9992 Anomocoela 85 65 10093 Pelodytoidea 57 33 10094 Scaphiopodidae 101 87 10095 Scaphiopus 82 72 10096 Pelobatoidea 74–75 53 10097 Pelobatidae 69 66 10098 Megophryidae 100 39 10099 Unnamed 65–66 27 100

100 Leptobrachium 61–62 37 100101 Unnamed 18–92 16 100102 Xenophrys 31–35 31 100103 Unnamed 39–42 10 100104 Ophryophryne 99 81 100105 Neobatrachia 127 108 100106 Heleophrynidae 187 186 100107 Phthanobatrachia 66 31 99108 Ranoides 110 31 99109 Allodapanura 45 31 100110 Microhylidae 72 34 100111 Unnamed 7 2 71112 Unnamed 17 3 90113 Unnamed 4 3 85114 Unnamed 36 33 97115 Unnamed 28 13 99116 Unnamed 50 9 98117 Unnamed 8 5 93118 Cophylinae 118 24 100119 Unnamed 71 6 99120 Unnamed 8 11 98121 Gastrophryninae 36 13 99122 Unnamed 67 58 100123 Unnamed 44 15 99124 Unnamed 54 34 100125 Unnamed 39 23 100126 Unnamed 29 18 99127 Gastrophryne 58 47 100128 Unnamed 27 16 99129 Unnamed 29 18 100130 Microhylinae 54 42 100131 Unnamed 24 45 98132 Unnamed 43 50 100133 Unnamed 115 92 100134 Unnamed 45 31 99135 Asterophryinae 100 24 100136 Unnamed 44 7 100137 Unnamed 22 13 98138 Unnamed 21 40 91139 Unnamed 54 22 100140 Unnamed 32 14 100141 Unnamed 38 7 98142 Unnamed 10 7 98143 Afrobatrachia 52 37 100144 Xenosyneunitanura 96 81 100145 Brevicipitidae 79 49 100146 Unnamed 77 53 100147 Callulina 103 103 100148 Laurentobatrachia 61 42 100149 Hyperoliidae 114 64 100150 Unnamed 14 9 98151 Unnamed 31 21 100152 Unnamed 76 29 100153 Unnamed 52 27 100154 Unnamed 43 32 100155 Afrixalus 36 16 99156 Unnamed 98 68 100157 Heterixalus 20 8 97158 Unnamed 42 23 100159 Unnamed 82 37 100160 Alexteroon 19 19 100161 Hyperolius 21 9 98162 Unnamed 14 8 98163 Unnamed 28 10 97

164 Arthroleptidae 57 37 100165 Leptopelinae 112 100 100166 Unnamed 53 37 100167 Unnamed 72 72 100168 Arthroleptinae 56 44 100169 Astylosternini 54 39 100170 Unnamed 45 21 99171 Unnamed 78 60 100172 Arthroleptini 38 28 100173 Unnamed 109 92 100174 Cardioglossa 79 70 100175 Arthroleptis 55 42 100176 Unnamed 45 32 100177 Unnamed 26 14 100178 Unnamed 46 32 100179 Unnamed 68 62 100180 Natatanura 65 34 99181 Ptychadenidae 135 100 100182 Unnamed 37 85 100183 Victoranura 39 20 99184 Ceratobatrachidae 114 43 100185 Unnamed 129 120 100186 Unnamed 41 22 100187 Unnamed 56 35 100188 Platymantis 100 82 100189 Telmatobatrachia 19 10 99190 Micrixalidae 105 42 100191 Ametrobatrachia 17 12 99192 Africanura 32 21 99193 Phrynobatrachidae 87 51 100194 Unnamed 45 26 100195 Unnamed 85 70 100196 Unnamed 74 103 100197 Unnamed 62 35 100198 Unnamed 115 61 100199 Unnamed 52 31 100200 Pyxicephaloidea 25 14 99201 Petropedetidae 33 15 99202 Conraua 89 24 100203 Unnamed 17 13 99204 Indirana 30 22 100205 Unnamed 51 39 100206 Petropedetes 77 54 100207 Unnamed 29 19 100208 Unnamed 10 5 89209 Pyxicephalidae 36 21 100210 Pyxicephalinae 117 105 100211 Aubria 189 187 100212 Cacosterninae 56 44 99213 Unnamed 43 6 94214 Unnamed 8 5 92215 Unnamed 28 9 99216 Unnamed 33 10 98217 Unnamed 8 2 85218 Amietia 33 6 99219 Unnamed 4 3 85220 Saukrobatrachia 26 17 99221 Dicroglossidae 39 31 100222 Occidozyginae 42 36 100223 Unnamed 24 15 99224 Unnamed 57 21 99225 Dicroglossinae 37 27 100226 Limnonectini 84 20 100227 Unnamed 45 14 100228 Unnamed 34 14 99229 Unnamed 9 6 98230 Unnamed 13 9 99231 Unnamed 30 10 99232 Dicroglossini 43 32 100233 Quasipaa 56 46 100234 Unnamed 26 20 100235 Unnamed 71 65 100236 Fejervarya 1 60 39 100237 Unnamed 43 32 100238 Sphaerotheca 57 53 100239 Unnamed 26 6 86240 Fejervarya 2 16 15 100241 Unnamed 29 19 100242 Unnamed 28 16 100




Branchlength


243 Hoplobatrachus 27 14 99244 Aglaioanura 33 19 99245 Rhacophoroidea 36 24 100246 Mantellidae 52 40 100247 Boophinae 81 67 100248 Mantellinae 38 21 100249 Laliostomini 50 30 100250 Mantellini 52 44 100251 Mantidactylus 52 35 100252 Mantella 83 68 100253 Rhacophoridae 57 46 100254 Rhacophorinae 61 42 100255 Unnamed 33 16 57256 Kurixalus 137 127 100257 Unnamed 15 2 100258 Unnamed 54 42 100259 Unnamed 74 54 100260 Nyctixalus 47 38 100261 Unnamed 38 27 100262 Rhacophorus 44 32 100263 Unnamed 30 10 96264 Unnamed 40 25 100265 Unnamed 41 29 100266 Polypedates 66 60 100267 Chiromantis 55 37 100268 Unnamed 57 39 100269 Ranoidea 23 17 99270 Nyctibatrachidae 18 8 97271 Nyctibatrachus 75 64 100272 Ranidae 57 37 99273 Unnamed 53 36 99274 Hylarana 37 21 100275 Unnamed 96 85 100276 Unnamed 36 13 99277 Unnamed 28 22 99278 Hydrophylax 45 10 99279 Unnamed 42 26 100280 Sylvirana 27 13 99281 Unnamed 37 22 100282 Unnamed 17 12 99283 Unnamed 39 31 100284 Unnamed 26–27 3 87285 Unnamed 32–34 15 100286 Unnamed 7–23 13 69287 Unnamed 25–26 23 52288 Pelophylax 12 2 58289 Unnamed 10–19 7 98290 Unnamed 32 10 99291 Babina 56 32 100292 Huia 70 55 100293 Unnamed 28 19 99294 Unnamed 43 16 99295 Unnamed 39 30 100296 Rana 50 39 100297 Unnamed 52 39 100298 Unnamed 34 26 100299 Unnamed 31 16 100300 Unnamed 18 8 98301 Lithobates 33 27 100302 Unnamed 59 45 100303 Unnamed 18 6 88304 Unnamed 8 2 56305 Unnamed 24 1 52306 Unnamed 42 28 100307 Unnamed 28 12 99308 Unnamed 32 9 90309 Unnamed 71 35 100310 Unnamed 19 5 78311 Unnamed 44 34 100312 Unnamed 9 7 99313 Unnamed 4 1 66314 Hyloides 60 35 100315 Sooglossidae 50 42 100316 Nasikabatrachus 122 117 100317 Sooglossus 62 62 100318 Notogaeanura 51 24 100319 Australobatrachia 62 54 100320 Batrachophrynidae 93 86 100321 Myobatrachoidea 48 31 100

322 Limnodynastidae 72 61 100323 Unnamed 47 30 100324 Unnamed 22 16 100325 Unnamed 26 18 100326 Neobatrachus 80 75 100327 Unnamed 33 20 100328 Unnamed 79 67 100329 Unnamed 35 17 99330 Limnodynastes 57 47 100331 Unnamed 20 13 99332 Unnamed 31 22 100333 Unnamed 48 41 100334 Myobatrachidae 38 24 100335 Unnamed 30 12 98336 Unnamed 49 36 100337 Unnamed 63 53 100338 Unnamed 27 20 100339 Unnamed 58 32 100340 Unnamed 45 47 100341 Unnamed 23 16 100342 Unnamed 36 27 100343 Unnamed 37 24 100344 Unnamed 55 48 100345 Pseudophryne 35 30 100346 Unnamed 56 27 100347 Unnamed 5 3 85348 Nobleobatrachia 96 88 100349 Meridianura 51 35 100350 Brachycephalidae 49 43 100351 Unnamed 52 38 100352 Unnamed 54 38 100353 Unnamed 35 27 100354 Unnamed 44 26 100355 Unnamed 38 26 100356 Unnamed 77 51 100357 Unnamed 110 96 100358 Syrrhophus 78 72 100359 Unnamed 32 25 100360 Phrynopus 61 42 100361 Craugastor 51 34 100362 Unnamed 102 85 100363 Unnamed 95 77 100364 Unnamed 75 50 100365 Unnamed 119 107 100366 Cladophrynia 58 45 100367 Cryptobatrachidae 34 22 100368 Tinctanura 43 29 100369 Amphignathodontidae 44 33 100370 Gastrotheca 67 47 100371 Athesphatanura 41 37 100372 Hylidae 35 37 100373 Unnamed (Phyllomedu-

sinae 1 Pelodryadinae)76 65 100

374 Phyllomedusinae 87 45 100375 Unnamed 42 24 99376 Unnamed 34 16 99377 Pelodryadinae 45 33 100378 Unnamed 49 37 100379 Unnamed 74 24 100380 Unnamed 40 25 100381 Unnamed 39 27 100382 Unnamed 58 40 100383 Unnamed 16 10 98384 Unnamed 20 11 99385 Unnamed 22 12 98386 Hylinae 32 24 100387 Unnamed 28 20 100388 Unnamed 49 29 100389 Scinax 115 97 100390 Cophomantini 61 52 100391 Hyloscirtus 61 40 100392 Unnamed 61 33 100393 Unnamed 44 30 100394 Unnamed 48 24 100395 Unnamed 37 30 100396 Unnamed 23 14 99397 Unnamed 32 24 100398 Unnamed 82 69 100399 Unnamed 64 48 100




Branchlength


400 Dendropsophus 69 55 100401 Unnamed 49 25 100402 Unnamed 53 37 100403 Unnamed 29 22 100404 Lophiohylini 65 42 100405 Unnamed 23 14 90406 Osteocephalus 18 8 87407 Unnamed 22 12 91408 Trachycephalus 45 25 100409 Hylini 85 78 100410 Unnamed 29 15 100411 Unnamed 43 32 100412 Unnamed 27 19 99413 Unnamed 16 4 75414 Unnamed 24 9 96415 Unnamed 23 5 89416 Unnamed 42 32 100417 Pseudacris 54 37 100418 Unnamed 54 5 100419 Unnamed 34 19 99420 Unnamed 15 5 85421 Unnamed 44 30 100422 Unnamed 23 14 99423 Unnamed 45 28 100424 Leptodactyliformes 24 17 100425 Diphyabatrachia 35 29 98426 Centrolenidae 41 12 99427 Centroleninae 67 22 100428 Unnamed 23 13 99429 Unnamed 20 11 99430 Leptodactylidae 30 23 99431 Unnamed 50 41 98432 Unnamed 70 47 100433 Unnamed 26 10 97434 Unnamed 30 15 99435 Unnamed 65 40 100436 Leptodactylus 61 47 100437 Unnamed 64 42 100438 Unnamed 46 34 100439 Unnamed 64 31 100440 Chthonobatrachia 18 13 100441 Ceratophryidae 34 18 98442 Telmatobiinae 70 62 100443 Unnamed 26 18 100444 Ceratophryinae 22 2 62445 Batrachylini 54 37 100446 Ceratophryini 46 38 100447 Unnamed 24 8 94448 Hesticobatrachia 34 26 98449 Cycloramphidae 21 9 98450 Hylodinae 70 5 91451 Unnamed 71 43 100452 Cycloramphinae 19 9 82453 Cycloramphini 42 30 96454 Alsodini 28 4 80455 Unnamed 8 4 81456 Unnamed 19 14 99457 Unnamed 44 10 100458 Unnamed 76 52 100459 Odontophrynus 48 38 100460 Agastorophrynia 39 30 98461 Dendrobatoidea 51 39 100462 Dendrobatidae 74 61 100463 Unnamed 66 51 100

464 Unnamed 56 32 100465 Unnamed 39 24 100466 Unnamed 53 29 100467 Unnamed 47 35 100468 Unnamed 68 45 100469 Bufonidae 51 33 99470 Unnamed 83 38 99471 Unnamed 39 22 100472 Atelopus 54 43 100473 Unnamed 114 114 100474 Unnamed 40 25 100475 Unnamed 58 20 100476 Rhaebo 51 42 100477 Unnamed 43 20 100478 Unnamed 30 25 100479 Unnamed 30 14 98480 Nectophryne 134 107 100481 Unnamed 15 9 97482 Unnamed 37 18 100483 Unnamed 12 8 97484 Unnamed 20 9 95485 Unnamed 27 10 94486 Unnamed 24 9 94487 Ansonia 25 9 90488 Unnamed 13 8 93489 Unnamed 9 6 94490 Unnamed 14 6 95491 Ingerophrynus 16 10 99492 Unnamed 15 11 100493 Unnamed 30 14 99494 Unnamed 12 8 92495 Unnamed 18 12 99496 Unnamed 31 16 99497 Unnamed 35 15 99498 Unnamed 15 10 98499 Bufo (sensu stricto) 59 28 100500 Unnamed 6 3 90501 Unnamed 18 5 71502 Unnamed 12 9 94503 Capensibufo 11 10 99504 Unnamed 10 7 94505 Unnamed 7 2 61506 Amietophrynus 9 2 65507 Unnamed 36 2 65508 Unnamed 22 15 99509 Unnamed 22 17 99510 Unnamed 30 22 99511 Unnamed 100 98 100512 Unnamed 25 27 94513 Anaxyrus 22 15 99514 Unnamed 44 33 100515 Unnamed 23 8 90516 Unnamed 28 21 100517 Unnamed 30 26 100518 Unnamed 13 6 81519 Cranopsis 25 11 99520 Unnamed 14 1 58521 Unnamed 16 11 99522 Chaunus 22 16 98523 Unnamed 13 7 78524 Unnamed 14 9 80525 Unnamed 13 6 75526 Unnamed 55 51 100527 Unnamed 21 17 99


APPENDIX 5

DNA SEQUENCE TRANSFORMATIONS FOR SELECTED BRANCHES/TAXA

Evidence is presented for taxa recognized solely on the basis of DNA sequence transformations, or taxa whosemolecular evidence was specifically noted in the text. The table is organized by branch number, with those taxalacking branch numbers following in alphabetical order. Optimization ambiguous transformations are excluded.Locus abbreviations are 28S (large nuclear ribosomal subunit), H1 (mitochondrial transcription unit H1), H3(histone H3), rhod (rhodopsin exon 1), SIA (seven in absentia), and tyr (tyrosinase). Other abbreviations are Br/Taxon/Frag (branch, taxon, and DNA fragment), Pos (position in aligned sequence), Anc (ancestral character),Der (derived character), A (adenine), C (cytosine), G (guanine), T (thymine), and ‘‘—’’ (gap).

Br/Taxon/Frag Pos Anc Der Br/Taxon/Frag Pos Anc Der Br/Taxon/Frag Pos Anc Der Br/Taxon/Frag Pos Anc Der

29 (Diadectosalamandroidei)28S frag. 4 71 T CH1 frag. 10 7 G CH1 frag. 10 23 T AH1 frag. 11 315 A —H1 frag. 11 409 T —H1 frag. 13 198 C AH1 frag. 14 143 C TH1 frag. 14 217 T AH1 frag. 16 94 A GH1 frag. 16 313 A —H1 frag. 17 47 C AH1 frag. 17 210 C TH1 frag. 18 276 A CH1 frag. 18 349 C AH1 frag. 19 136 G AH1 frag. 19 195 C AH1 frag. 19 331 G TH1 frag. 19 376 G —H1 frag. 19 509 A —H1 frag. 19 531 A —H1 frag. 2 218 C AH1 frag. 2 277 A —H1 frag. 2 285 A —H1 frag. 20 78 G AH1 frag. 21 124 C —H1 frag. 22 70 A TH1 frag. 23 33 C —H1 frag. 23 260 C TH1 frag. 23 283 C —H1 frag. 23 981 T AH1 frag. 23 1114 A TH1 frag. 23 1338 C AH1 frag. 23 1405 A —H1 frag. 23 1684 T —H1 frag. 23 1687 T —H1 frag. 23 1940 T —H1 frag. 3 415 A TH1 frag. 4 169 C AH1 frag. 8 159 G CH1 frag. 8 250 T AH1 frag. 9 84 C AH1 frag. 9 85 C AH3 frag. 2 26 T C

30 (Hydatinosalamandroidei)H1 frag. 11 31 T CH1 frag. 11 595 A CH1 frag. 11 694 C —H1 frag. 11 1294 T AH1 frag. 13 91 A —H1 frag. 14 45 C TH1 frag. 14 144 G AH1 frag. 14 182 — TH1 frag. 15 22 C TH1 frag. 16 466 — TH1 frag. 17 38 A TH1 frag. 17 133 — AH1 frag. 18 838 A TH1 frag. 18 878 A TH1 frag. 19 294 A —H1 frag. 19 369 A TH1 frag. 19 453 A —H1 frag. 19 496 C —H1 frag. 19 668 A —H1 frag. 2 73 T A

H1 frag. 23 743 — TH1 frag. 23 956 — AH1 frag. 23 1051 — AH1 frag. 23 1090 — CH1 frag. 23 1169 G AH1 frag. 23 1328 G AH1 frag. 23 1750 T —H1 frag. 4 205 — TH1 frag. 4 640 — AH1 frag. 6 23 T CH1 frag. 6 75 A —H1 frag. 7 35 C AH1 frag. 8 156 C —H1 frag. 8 628 A TH1 frag. 8 796 T ASIA frag. 1 9 A TSIA frag. 1 12 T CSIA frag. 2 20 C T

31 (Perennibranchia)28S frag. 2 312 C TH1 frag. 10 199 C TH1 frag. 11 36 T AH1 frag. 11 72 C TH1 frag. 11 249 — GH1 frag. 11 819 T CH1 frag. 11 1327 T —H1 frag. 14 93 A TH1 frag. 14 166 C AH1 frag. 14 244 G AH1 frag. 15 60 T AH1 frag. 16 94 G —H1 frag. 16 127 T —H1 frag. 16 170 T —H1 frag. 16 191 T —H1 frag. 16 221 A CH1 frag. 16 563 T GH1 frag. 18 488 C TH1 frag. 18 628 T —H1 frag. 19 131 A TH1 frag. 20 25 A TH1 frag. 21 76 T CH1 frag. 23 43 T AH1 frag. 23 1015 A TH1 frag. 23 1118 — AH1 frag. 23 1303 A TH1 frag. 23 1759 A TH1 frag. 23 1763 T AH1 frag. 23 1962 A TH1 frag. 8 28 A CH1 frag. 8 57 C TH1 frag. 8 69 A TH1 frag. 8 110 C TH1 frag. 8 589 C TH1 frag. 8 634 T AH1 frag. 8 714 A GH1 frag. 9 54 T CH1 frag. 9 73 C AH1 frag. 9 333 A CH3 frag. 1 48 G AH3 frag. 1 103 C AH3 frag. 1 135 C GH3 frag. 1 204 C A

35 (Treptobranchia)28S frag. 4 150 T CH1 frag. 11 141 A T

H1 frag. 11 264 C TH1 frag. 11 822 A —H1 frag. 11 1101 — CH1 frag. 12 41 A TH1 frag. 13 71 C AH1 frag. 13 130 C AH1 frag. 14 31 T AH1 frag. 14 89 T AH1 frag. 14 106 A CH1 frag. 15 25 G AH1 frag. 16 152 A TH1 frag. 16 429 C AH1 frag. 17 47 A TH1 frag. 17 182 T AH1 frag. 18 79 A GH1 frag. 18 116 T CH1 frag. 18 366 — CH1 frag. 18 756 T CH1 frag. 19 259 A —H1 frag. 19 749 A TH1 frag. 2 342 A TH1 frag. 2 407 A CH1 frag. 20 146 T AH1 frag. 21 93 C TH1 frag. 23 67 G AH1 frag. 23 670 — TH1 frag. 23 1676 A —H1 frag. 23 1707 A TH1 frag. 3 169 T AH1 frag. 4 64 T CH1 frag. 4 262 A GH1 frag. 4 263 G AH1 frag. 4 458 A CH1 frag. 4 487 — TH1 frag. 9 288 C TH1 frag. 9 763 T AH3 frag. 1 192 C GSIA frag. 1 3 T CSIA frag. 3 66 A GSIA frag. 3 72 C TSIA frag. 3 147 A G

41 (Pleurodelinae)H1 frag. 10 101 G AH1 frag. 11 89 C TH1 frag. 11 264 T —H1 frag. 11 1191 T AH1 frag. 11 1327 T —H1 frag. 12 6 A GH1 frag. 12 90 T AH1 frag. 14 208 A CH1 frag. 16 4 C TH1 frag. 17 22 T CH1 frag. 17 38 T CH1 frag. 17 136 A TH1 frag. 18 45 A —H1 frag. 18 479 A CH1 frag. 18 741 C —H1 frag. 18 750 G AH1 frag. 18 759 A TH1 frag. 18 854 T AH1 frag. 19 729 T CH1 frag. 21 50 — AH1 frag. 21 260 T AH1 frag. 22 11 T CH1 frag. 23 293 T C

H1 frag. 23 1130 — GH1 frag. 23 1726 A CH1 frag. 6 89 — CH1 frag. 8 57 C TH1 frag. 8 316 T CH1 frag. 8 335 T CH1 frag. 8 628 T CH1 frag. 8 790 T CH1 frag. 9 89 A GH1 frag. 9 409 T CH3 frag. 1 66 C GH3 frag. 1 81 C A

46 (unnamed taxon)H1 frag. 18 479 C AH1 frag. 18 536 — AH1 frag. 18 732 A TH1 frag. 19 42 A CH1 frag. 19 254 G —H1 frag. 19 278 C AH1 frag. 19 331 T AH1 frag. 19 431 C AH1 frag. 19 612 T CH1 frag. 19 796 C TH1 frag. 19 808 C TH1 frag. 20 54 A TH1 frag. 20 176 A GH1 frag. 20 182 T CH1 frag. 21 57 A CH1 frag. 21 239 — TH1 frag. 23 22 T CH1 frag. 23 293 C TH1 frag. 23 668 C AH1 frag. 23 1346 A CH1 frag. 6 31 C TH1 frag. 7 11 G AH1 frag. 8 250 A TH1 frag. 8 628 C TH1 frag. 8 675 — TH1 frag. 8 735 T C

49 (Plethosalamandroidei)H1 frag. 10 24 A GH1 frag. 10 101 G AH1 frag. 11 57 A TH1 frag. 11 89 C TH1 frag. 11 1191 T AH1 frag. 12 52 T AH1 frag. 13 172 C TH1 frag. 14 124 T CH1 frag. 15 58 A GH1 frag. 16 4 C TH1 frag. 16 681 T AH1 frag. 17 46 A TH1 frag. 17 160 T AH1 frag. 18 479 A TH1 frag. 18 750 G AH1 frag. 18 854 T —H1 frag. 19 417 T AH1 frag. 19 432 — CH1 frag. 20 140 A TH1 frag. 21 134 G —H1 frag. 21 177 C AH1 frag. 21 260 T CH1 frag. 23 49 T AH1 frag. 23 102 A TH1 frag. 23 182 T —



H1 frag. 23 521 A —H1 frag. 23 623 A —H1 frag. 23 789 A —H1 frag. 23 902 C —H1 frag. 23 951 G —H1 frag. 23 953 G —H1 frag. 23 1108 A —H1 frag. 23 1124 A —H1 frag. 23 1158 T —H1 frag. 23 1173 A —H1 frag. 23 1657 T AH1 frag. 23 1766 T AH1 frag. 6 77 — TH1 frag. 8 184 T CH1 frag. 8 331 — CH1 frag. 8 345 G AH1 frag. 8 369 A TH1 frag. 8 562 G AH1 frag. 8 634 T CH1 frag. 9 209 T —H1 frag. 9 520 A —H1 frag. 9 672 A Trhod frag. 1 94 G Arhod frag. 1 151 C Trhod frag. 2 93 C G

50 (Xenosalamandroidei)H1 frag. 11 40 G —H1 frag. 11 77 C TH1 frag. 11 213 C —H1 frag. 11 577 — CH1 frag. 11 1217 A CH1 frag. 11 1311 C —H1 frag. 12 59 A TH1 frag. 12 74 A TH1 frag. 13 70 T CH1 frag. 14 250 C AH1 frag. 15 15 T AH1 frag. 15 23 T AH1 frag. 15 25 G AH1 frag. 15 60 T AH1 frag. 16 5 A GH1 frag. 16 39 T AH1 frag. 16 201 T AH1 frag. 16 359 T CH1 frag. 16 672 A TH1 frag. 17 221 — AH1 frag. 18 322 A CH1 frag. 18 488 C TH1 frag. 18 748 T CH1 frag. 18 802 — AH1 frag. 19 15 A GH1 frag. 19 97 T CH1 frag. 19 99 T CH1 frag. 19 460 T GH1 frag. 19 573 G TH1 frag. 19 635 T —H1 frag. 20 60 A GH1 frag. 20 146 T AH1 frag. 20 176 A GH1 frag. 21 17 — AH1 frag. 21 243 T CH1 frag. 23 167 A CH1 frag. 23 293 T CH1 frag. 23 965 — TH1 frag. 23 1081 A GH1 frag. 23 1703 T CH1 frag. 23 1752 A —H1 frag. 23 1796 T —H1 frag. 25 34 C AH1 frag. 6 27 G AH1 frag. 6 91 T AH1 frag. 8 316 T AH1 frag. 8 598 A —H1 frag. 8 667 C T

72 (Pseudoeurycea)H1 frag. 21 57 A CH1 frag. 23 49 A GH1 frag. 23 1376 T CH1 frag. 23 1776 C —H1 frag. 23 1798 T —

H1 frag. 23 1816 A GH1 frag. 23 1833 — A

86 (Alytidae)28S frag. 2 753 C —28S frag. 2 764 A T28S frag. 3 217 C G28S frag. 3 424 G C28S frag. 3 582 G CH1 frag. 11 409 T AH1 frag. 11 457 C AH1 frag. 11 565 C AH1 frag. 11 694 C —H1 frag. 11 983 T AH1 frag. 11 1161 A CH1 frag. 11 1217 A CH1 frag. 13 121 A TH1 frag. 14 35 A CH1 frag. 14 166 C —H1 frag. 16 7 A CH1 frag. 16 46 — TH1 frag. 16 429 C —H1 frag. 17 56 — TH1 frag. 17 231 T AH1 frag. 17 320 — GH1 frag. 18 306 A CH1 frag. 18 447 T CH1 frag. 18 746 T AH1 frag. 19 91 C —H1 frag. 19 203 A CH1 frag. 19 415 A CH1 frag. 19 439 A GH1 frag. 19 771 A CH1 frag. 20 20 T —H1 frag. 21 10 T CH1 frag. 21 57 A TH1 frag. 21 218 C TH1 frag. 23 52 C TH1 frag. 23 199 A CH1 frag. 23 452 C —H1 frag. 23 942 A TH1 frag. 23 1154 A GH1 frag. 23 1186 — AH1 frag. 23 1256 T CH1 frag. 23 1376 T CH1 frag. 23 1496 — CH1 frag. 23 1919 C —H1 frag. 23 1962 A TH1 frag. 25 15 C TH1 frag. 25 86 G AH1 frag. 6 49 T AH1 frag. 6 81 A CH1 frag. 6 183 — TH1 frag. 8 132 T AH1 frag. 8 634 T CH1 frag. 9 520 A —H1 frag. 9 768 — AH3 frag. 1 51 T AH3 frag. 1 81 A CH3 frag. 1 114 T CH3 frag. 1 126 G TH3 frag. 2 39 G TH3 frag. 2 42 C Grhod frag. 1 90 T Crhod frag. 1 99 T Crhod frag. 1 101 G Arhod frag. 2 3 A Grhod frag. 2 69 T CSIA frag. 4 7 T CSIA frag. 4 61 T A

88 (Bombinatoridae/Bombina)28S frag. 2 132 T C28S frag. 2 467 — T28S frag. 2 711 — G28S frag. 2 763 — A28S frag. 3 370 G C28S frag. 3 420 — A28S frag. 3 535 C T28S frag. 4 83 T CH1 frag. 1 18 T CH1 frag. 1 20 A T

H1 frag. 1 40 T AH1 frag. 1 41 A GH1 frag. 1 64 A GH1 frag. 10 72 A TH1 frag. 10 261 T AH1 frag. 11 10 A —H1 frag. 11 17 — GH1 frag. 11 31 T CH1 frag. 11 47 T CH1 frag. 11 67 C AH1 frag. 11 79 A GH1 frag. 11 88 T CH1 frag. 11 141 A TH1 frag. 11 213 C TH1 frag. 11 230 C TH1 frag. 11 778 A —H1 frag. 11 910 C AH1 frag. 11 953 C GH1 frag. 11 1135 C —H1 frag. 11 1316 A TH1 frag. 12 4 T AH1 frag. 12 29 A CH1 frag. 12 52 G AH1 frag. 12 122 G AH1 frag. 14 9 G AH1 frag. 14 93 A CH1 frag. 14 100 T CH1 frag. 14 144 G TH1 frag. 14 146 A GH1 frag. 14 149 G AH1 frag. 14 208 A CH1 frag. 15 19 C TH1 frag. 15 22 C AH1 frag. 15 40 C TH1 frag. 16 5 A GH1 frag. 16 18 T CH1 frag. 16 23 G AH1 frag. 16 94 T —H1 frag. 16 127 T —H1 frag. 16 241 A GH1 frag. 16 509 A GH1 frag. 16 535 A CH1 frag. 16 576 A CH1 frag. 16 590 A CH1 frag. 16 648 A GH1 frag. 16 696 G AH1 frag. 17 2 C TH1 frag. 17 60 G AH1 frag. 17 125 T CH1 frag. 17 187 A TH1 frag. 17 372 T CH1 frag. 18 164 T —H1 frag. 18 185 C —H1 frag. 18 380 — AH1 frag. 18 433 A CH1 frag. 18 501 A TH1 frag. 18 579 — TH1 frag. 18 604 A TH1 frag. 18 656 A —H1 frag. 18 717 A CH1 frag. 18 748 T CH1 frag. 18 766 C TH1 frag. 18 830 C AH1 frag. 18 863 G AH1 frag. 18 866 C AH1 frag. 18 883 C TH1 frag. 19 109 C TH1 frag. 19 244 A CH1 frag. 19 250 — GH1 frag. 19 259 A CH1 frag. 19 283 — TH1 frag. 19 313 — CH1 frag. 19 350 A GH1 frag. 19 449 T AH1 frag. 19 531 A TH1 frag. 19 823 C AH1 frag. 19 826 A TH1 frag. 2 79 — GH1 frag. 2 88 A CH1 frag. 2 108 C T

H1 frag. 2 133 C TH1 frag. 2 210 G AH1 frag. 2 301 C AH1 frag. 2 407 A CH1 frag. 20 61 A GH1 frag. 21 44 — AH1 frag. 21 177 C AH1 frag. 21 178 C AH1 frag. 21 251 A GH1 frag. 23 49 T CH1 frag. 23 100 T AH1 frag. 23 102 T AH1 frag. 23 105 A CH1 frag. 23 236 A GH1 frag. 23 283 C TH1 frag. 23 981 T AH1 frag. 23 1097 G —H1 frag. 23 1150 — TH1 frag. 23 1169 G AH1 frag. 23 1181 C GH1 frag. 23 1270 T CH1 frag. 23 1607 C AH1 frag. 23 1695 A GH1 frag. 23 1722 A CH1 frag. 23 1745 C TH1 frag. 23 1759 T CH1 frag. 23 1824 T —H1 frag. 23 1940 T AH1 frag. 24 1 C TH1 frag. 24 10 A CH1 frag. 24 17 C TH1 frag. 24 35 G AH1 frag. 25 16 A CH1 frag. 25 24 T CH1 frag. 25 38 A GH1 frag. 3 48 A TH1 frag. 3 58 C TH1 frag. 3 160 T CH1 frag. 3 214 T CH1 frag. 3 251 C TH1 frag. 3 283 A GH1 frag. 3 384 T CH1 frag. 3 391 A GH1 frag. 3 402 C AH1 frag. 3 407 C AH1 frag. 4 8 C AH1 frag. 4 26 A GH1 frag. 4 169 C AH1 frag. 4 260 T CH1 frag. 4 268 T CH1 frag. 4 283 T AH1 frag. 4 286 A GH1 frag. 4 298 A TH1 frag. 4 363 T AH1 frag. 4 365 T CH1 frag. 4 386 T AH1 frag. 4 404 A GH1 frag. 4 408 A CH1 frag. 4 434 A GH1 frag. 4 439 C AH1 frag. 4 452 A —H1 frag. 4 467 G TH1 frag. 4 481 A GH1 frag. 4 489 T CH1 frag. 4 517 A GH1 frag. 4 592 T CH1 frag. 4 637 T CH1 frag. 4 649 A CH1 frag. 6 35 T CH1 frag. 6 52 T AH1 frag. 6 75 A CH1 frag. 6 85 T AH1 frag. 6 137 C AH1 frag. 6 176 — CH1 frag. 7 83 A —H1 frag. 7 84 A —H1 frag. 8 316 T CH1 frag. 8 582 T CH1 frag. 8 628 A CH1 frag. 8 644 A G



H1 frag. 8 647 A CH1 frag. 8 711 G AH1 frag. 8 735 C —H1 frag. 8 787 C —H1 frag. 8 792 C TH1 frag. 8 807 — GH1 frag. 8 828 T AH1 frag. 9 42 G TH1 frag. 9 281 T CH1 frag. 9 453 A TH3 frag. 1 84 G CH3 frag. 1 222 C TH3 frag. 2 5 T GH3 frag. 2 33 G AH3 frag. 2 63 C TH3 frag. 2 66 C Trhod frag. 1 78 G Arhod frag. 1 104 T Arhod frag. 1 110 C Trhod frag. 1 122 C Trhod frag. 1 131 T Crhod frag. 1 134 G Crhod frag. 1 135 T Crhod frag. 1 137 C Trhod frag. 1 150 C Trhod frag. 2 21 C Trhod frag. 2 31 C Trhod frag. 2 54 C Trhod frag. 2 67 T Grhod frag. 2 112 C T

92 (Anomocoela)H1 frag. 11 622 C —H1 frag. 11 897 — TH1 frag. 11 898 — CH1 frag. 11 1076 — TH1 frag. 11 1294 T CH1 frag. 13 69 C AH1 frag. 14 154 G —H1 frag. 14 166 C AH1 frag. 14 208 A TH1 frag. 14 250 C TH1 frag. 16 59 — GH1 frag. 16 292 A GH1 frag. 16 485 G CH1 frag. 16 590 A CH1 frag. 16 668 — CH1 frag. 17 5 T AH1 frag. 17 46 A CH1 frag. 17 407 T AH1 frag. 18 7 C TH1 frag. 18 388 C TH1 frag. 18 784 — CH1 frag. 18 838 A —H1 frag. 19 5 — CH1 frag. 19 109 C TH1 frag. 19 249 — AH1 frag. 19 278 C TH1 frag. 19 668 C TH1 frag. 19 808 C TH1 frag. 2 73 T CH1 frag. 2 256 A CH1 frag. 2 301 C —H1 frag. 20 68 G AH1 frag. 20 146 T AH1 frag. 20 176 A GH1 frag. 21 113 A TH1 frag. 23 250 G TH1 frag. 23 606 — CH1 frag. 23 737 — TH1 frag. 23 762 C AH1 frag. 23 1097 G CH1 frag. 23 1160 — GH1 frag. 23 1256 T AH1 frag. 23 1338 C AH1 frag. 23 1358 A TH1 frag. 23 1444 G —H1 frag. 23 1460 G TH1 frag. 23 1669 C TH1 frag. 23 1951 A TH1 frag. 3 120 T A

H1 frag. 3 248 G AH1 frag. 3 266 C TH1 frag. 3 366 C TH1 frag. 3 391 A GH1 frag. 3 402 C TH1 frag. 3 410 A TH1 frag. 4 280 C TH1 frag. 4 375 — CH1 frag. 4 391 A CH1 frag. 6 137 C AH1 frag. 7 35 C GH1 frag. 8 306 C TH1 frag. 8 629 — TH1 frag. 9 453 A TH3 frag. 1 18 G CH3 frag. 1 72 C TH3 frag. 1 99 C TH3 frag. 1 138 C TH3 frag. 1 195 G TH3 frag. 1 204 C TH3 frag. 2 29 T Crhod frag. 1 78 G Arhod frag. 1 120 C Trhod frag. 1 122 C Arhod frag. 1 153 G Arhod frag. 2 9 A Grhod frag. 2 33 G Crhod frag. 2 73 G TSIA frag. 1 12 T CSIA frag. 1 36 T CSIA frag. 2 14 A GSIA frag. 3 43 T ASIA frag. 3 44 C GSIA frag. 3 171 G CSIA frag. 4 49 T GSIA frag. 4 67 T C

93 (Pelodytoidea)28S frag. 2 442 C —28S frag. 2 613 C —28S frag. 2 714 G —28S frag. 2 753 C —28S frag. 2 764 A —H1 frag. 11 16 A TH1 frag. 11 230 C TH1 frag. 12 116 G AH1 frag. 14 106 A CH1 frag. 14 142 C TH1 frag. 14 146 A GH1 frag. 14 260 G TH1 frag. 15 21 T CH1 frag. 16 31 A GH1 frag. 16 94 T —H1 frag. 16 127 T AH1 frag. 16 201 T AH1 frag. 16 382 A CH1 frag. 16 509 A —H1 frag. 16 690 A TH1 frag. 17 437 C AH1 frag. 18 95 A CH1 frag. 18 138 A —H1 frag. 18 315 — AH1 frag. 18 545 — CH1 frag. 18 830 C TH1 frag. 19 273 — TH1 frag. 19 274 — TH1 frag. 19 600 C TH1 frag. 2 100 A CH1 frag. 2 203 A GH1 frag. 20 16 T AH1 frag. 20 77 G AH1 frag. 23 25 A TH1 frag. 23 38 C TH1 frag. 23 96 A TH1 frag. 23 902 C TH1 frag. 23 963 A —H1 frag. 23 1019 — TH1 frag. 23 1169 G TH1 frag. 23 1334 A TH1 frag. 3 92 C TH1 frag. 3 117 G A

H1 frag. 4 120 T CH1 frag. 4 232 C TH1 frag. 4 268 T CH1 frag. 4 286 A GH1 frag. 4 481 A GH1 frag. 6 164 — AH1 frag. 8 316 T CH1 frag. 8 488 C TH1 frag. 9 652 T CH1 frag. 9 775 A Trhod frag. 1 69 C TSIA frag. 3 48 G TSIA frag. 3 66 G ASIA frag. 3 153 A G

96 (Pelobatoidea)28S frag. 2 589 — C28S frag. 2 590 — G28S frag. 2 721 — CH1 frag. 1 2 T CH1 frag. 10 72 A —H1 frag. 10 76 A —H1 frag. 11 116 — CH1 frag. 11 138 A CH1 frag. 11 565 C TH1 frag. 11 988 — CH1 frag. 11 1217 A —H1 frag. 11 1248 C —H1 frag. 13 168 C AH1 frag. 14 51 A GH1 frag. 14 102 T CH1 frag. 14 129 C TH1 frag. 14 217 A TH1 frag. 15 54 G AH1 frag. 16 32 C TH1 frag. 16 319 — AH1 frag. 16 429 C TH1 frag. 17 52 A TH1 frag. 17 231 C —H1 frag. 18 209 A —H1 frag. 18 615 C TH1 frag. 18 727 C TH1 frag. 19 66 A TH1 frag. 19 376 G CH1 frag. 19 531 A CH1 frag. 2 108 C TH1 frag. 2 360 T —H1 frag. 21 133 A TH1 frag. 21 219 — TH1 frag. 23 105 A TH1 frag. 23 789 A TH1 frag. 23 1221 C TH1 frag. 23 1478 G —H1 frag. 23 1518 A —H1 frag. 23 1607 C —H1 frag. 23 1657 C —H1 frag. 23 1676 C —H1 frag. 23 1787 T —H1 frag. 23 1962 A —H1 frag. 3 58 C AH1 frag. 3 108 A CH1 frag. 3 214 T AH1 frag. 4 26 A TH1 frag. 4 148 A TH1 frag. 4 211 A TH1 frag. 4 263 G AH1 frag. 4 271 T AH1 frag. 4 441 A CH1 frag. 4 493 C TH1 frag. 6 66 C —H1 frag. 6 167 A TH1 frag. 6 181 A CH1 frag. 7 81 C TH1 frag. 7 84 A CH1 frag. 8 232 A CH1 frag. 8 628 A TH1 frag. 8 696 A GH1 frag. 8 711 G AH1 frag. 8 804 A GH1 frag. 8 818 C TH1 frag. 9 89 G A

H1 frag. 9 226 A TH1 frag. 9 788 A CH3 frag. 1 108 C AH3 frag. 1 147 A Grhod frag. 1 33 G Arhod frag. 1 168 C Trhod frag. 1 169 A Grhod frag. 1 174 G Arhod frag. 2 106 A T

97 (Pelobatidae)H1 frag. 10 174 — CH1 frag. 11 53 T GH1 frag. 11 134 A CH1 frag. 11 141 A TH1 frag. 11 409 T CH1 frag. 11 517 — CH1 frag. 11 795 — CH1 frag. 11 901 — AH1 frag. 11 991 — TH1 frag. 11 1081 — AH1 frag. 11 1161 A TH1 frag. 11 1266 A TH1 frag. 11 1311 C AH1 frag. 11 1333 T CH1 frag. 12 41 A GH1 frag. 22 70 A GH1 frag. 23 18 — AH1 frag. 23 25 A —H1 frag. 23 50 C TH1 frag. 23 72 C TH1 frag. 23 89 G AH1 frag. 23 490 T CH1 frag. 23 559 T AH1 frag. 23 602 T AH1 frag. 23 762 A TH1 frag. 23 1015 A CH1 frag. 23 1161 — AH1 frag. 23 1181 C AH1 frag. 23 1316 C TH1 frag. 23 1711 A CH1 frag. 23 1793 A CH1 frag. 23 1799 — CH1 frag. 23 1908 — AH1 frag. 25 15 C TH1 frag. 25 86 G AH1 frag. 6 84 — CH1 frag. 6 199 C TH1 frag. 6 213 A CH1 frag. 8 28 A CH1 frag. 8 41 A TH1 frag. 8 69 C TH1 frag. 8 179 C TH1 frag. 8 192 G AH1 frag. 8 565 A TH1 frag. 8 667 C TH1 frag. 8 828 T AH1 frag. 9 46 T CH1 frag. 9 202 C —H1 frag. 9 256 C TH1 frag. 9 367 A TH1 frag. 9 618 A CH1 frag. 9 781 — CH1 frag. 9 782 — Crhod frag. 1 6 T Crhod frag. 1 94 G Arhod frag. 1 134 G Crhod frag. 1 140 A Trhod frag. 1 159 G Arhod frag. 2 6 C Trhod frag. 2 24 C Trhod frag. 2 37 C Trhod frag. 2 41 C Trhod frag. 2 54 C Trhod frag. 2 66 G Crhod frag. 2 100 G Trhod frag. 2 101 C Arhod frag. 2 115 C Trhod frag. 2 136 T Crhod frag. 2 139 G A



99 (unnamed taxon)H1 frag. 10 93 A GH1 frag. 11 16 A TH1 frag. 11 77 C TH1 frag. 11 86 A GH1 frag. 11 95 T CH1 frag. 11 116 C AH1 frag. 11 124 C —H1 frag. 11 264 C TH1 frag. 11 315 A GH1 frag. 11 392 C —H1 frag. 11 852 C TH1 frag. 12 112 G AH1 frag. 13 39 A —H1 frag. 13 73 A —H1 frag. 13 107 G AH1 frag. 14 13 T AH1 frag. 14 64 A TH1 frag. 16 1 A GH1 frag. 16 7 A GH1 frag. 16 127 T CH1 frag. 16 359 C TH1 frag. 16 563 C —H1 frag. 16 576 C TH1 frag. 16 658 C TH1 frag. 17 47 C TH1 frag. 17 182 T AH1 frag. 17 416 — GH1 frag. 18 52 A CH1 frag. 18 164 T CH1 frag. 18 276 A CH1 frag. 18 581 C TH1 frag. 18 746 T CH1 frag. 18 756 T CH1 frag. 18 830 C AH1 frag. 19 278 T CH1 frag. 20 20 C GH1 frag. 20 140 T CH1 frag. 21 8 C TH1 frag. 23 789 T —H1 frag. 23 944 G AH1 frag. 23 963 A —H1 frag. 23 968 C —H1 frag. 23 1027 A —H1 frag. 23 1097 C —H1 frag. 23 1320 C TH1 frag. 23 1376 T AH1 frag. 23 1695 A GH1 frag. 23 1704 C TH1 frag. 25 14 G AH1 frag. 25 87 C TH3 frag. 1 72 T CH3 frag. 1 120 T CH3 frag. 2 39 G Crhod frag. 1 33 A Crhod frag. 1 78 A Grhod frag. 1 135 T Crhod frag. 2 61 G Arhod frag. 2 85 C Grhod frag. 2 108 A TSIA frag. 2 32 G ASIA frag. 2 41 A GSIA frag. 2 59 C TSIA frag. 3 48 G CSIA frag. 3 54 C TSIA frag. 3 78 A GSIA frag. 4 88 T G

101 (unnamed taxon)H1 frag. 10 7 A CH1 frag. 10 9 T CH1 frag. 10 23 T GH1 frag. 10 192 — TH1 frag. 10 199 C AH1 frag. 10 261 T CH1 frag. 11 19 A GH1 frag. 11 130 A CH1 frag. 11 469 — TH1 frag. 11 887 A TH1 frag. 11 1336 T CH1 frag. 12 14 A T

H1 frag. 12 125 A TH1 frag. 13 18 G TH1 frag. 13 172 C AH1 frag. 14 83 A TH1 frag. 14 108 C TH1 frag. 14 193 T CH1 frag. 14 250 T AH1 frag. 16 54 — GH1 frag. 16 292 G TH1 frag. 16 319 A TH1 frag. 16 333 A TH1 frag. 16 648 A CH1 frag. 17 46 C AH1 frag. 17 52 T CH1 frag. 17 120 T —H1 frag. 17 122 A —H1 frag. 17 136 A —H1 frag. 17 160 A —H1 frag. 17 187 A —H1 frag. 17 210 T CH1 frag. 17 251 T CH1 frag. 18 138 A —H1 frag. 18 218 C TH1 frag. 18 433 A CH1 frag. 18 501 A CH1 frag. 18 539 A —H1 frag. 18 656 A GH1 frag. 18 698 A GH1 frag. 18 707 T GH1 frag. 19 109 T —H1 frag. 19 123 A CH1 frag. 19 286 C AH1 frag. 19 715 A TH1 frag. 19 749 C TH1 frag. 20 25 A GH1 frag. 20 66 T CH1 frag. 21 171 A TH1 frag. 21 179 C TH1 frag. 22 20 T CH1 frag. 23 48 A GH1 frag. 23 299 G —H1 frag. 23 898 — TH1 frag. 23 922 — TH1 frag. 23 1160 G TH1 frag. 23 1181 C TH1 frag. 23 1303 C AH1 frag. 23 1686 — CH1 frag. 23 1781 A TH1 frag. 23 1824 T CH1 frag. 23 1882 A TH1 frag. 23 1968 T AH1 frag. 25 32 G AH1 frag. 6 62 A —H1 frag. 6 67 T —H1 frag. 6 75 A —H1 frag. 6 85 T —H1 frag. 6 98 A —H1 frag. 6 104 C —H1 frag. 6 115 A —H1 frag. 6 181 C —H1 frag. 6 213 A —H1 frag. 8 40 T CH1 frag. 8 173 T GH1 frag. 8 184 T CH1 frag. 8 232 C —H1 frag. 8 525 C AH1 frag. 8 619 — CH1 frag. 9 28 A GH1 frag. 9 48 T CH1 frag. 9 281 T CH1 frag. 9 309 — CH1 frag. 9 558 A CH1 frag. 9 618 A —H1 frag. 9 739 A GH1 frag. 9 818 T CH3 frag. 1 0 C TH3 frag. 1 27 C TH3 frag. 1 28 C AH3 frag. 1 81 A CH3 frag. 1 216 G A

102 (unnamed taxon)H1 frag. 21 57 A TH1 frag. 21 113 T CH1 frag. 21 133 T CH1 frag. 21 190 A GH1 frag. 21 277 C AH1 frag. 22 55 T CH1 frag. 23 5 T CH1 frag. 23 17 G AH1 frag. 23 25 A GH1 frag. 23 40 T CH1 frag. 23 67 G AH1 frag. 23 114 A TH1 frag. 23 195 — CH1 frag. 23 224 A TH1 frag. 23 260 C TH1 frag. 23 283 C TH1 frag. 23 606 C TH1 frag. 23 762 A CH1 frag. 23 854 C TH1 frag. 23 1027 A CH1 frag. 23 1074 T CH1 frag. 23 1081 A TH1 frag. 23 1114 A TH1 frag. 23 1135 T —H1 frag. 23 1160 T —H1 frag. 23 1169 G —H1 frag. 23 1201 G AH1 frag. 23 1226 T AH1 frag. 23 1256 A TH1 frag. 23 1458 — TH1 frag. 23 1687 A TH1 frag. 23 1825 T CH1 frag. 24 8 C TH1 frag. 24 17 C TH1 frag. 25 20 A T

108 (Ranoides)28S frag. 2 720 G —H1 frag. 10 14 C TH1 frag. 10 19 G AH1 frag. 11 27 G AH1 frag. 12 14 C TH1 frag. 12 21 G AH1 frag. 12 127 A TH1 frag. 13 151 C TH1 frag. 14 72 — AH1 frag. 14 142 C TH1 frag. 14 147 G AH1 frag. 14 149 G AH1 frag. 15 19 C TH1 frag. 15 20 C TH1 frag. 15 60 T AH1 frag. 16 72 — GH1 frag. 16 152 A TH1 frag. 16 249 — TH1 frag. 16 467 G —H1 frag. 16 665 T CH1 frag. 17 160 C —H1 frag. 17 306 — AH1 frag. 18 93 C TH1 frag. 18 185 C TH1 frag. 19 155 T CH1 frag. 19 215 A GH1 frag. 19 216 T CH1 frag. 19 286 C AH1 frag. 19 826 A TH1 frag. 2 16 C AH1 frag. 2 196 T CH1 frag. 2 200 G AH1 frag. 2 301 C AH1 frag. 2 419 A CH1 frag. 22 10 T CH1 frag. 23 250 G AH1 frag. 23 274 C AH1 frag. 23 729 C TH1 frag. 23 1386 — AH1 frag. 23 1607 C AH1 frag. 23 1695 A TH1 frag. 23 1759 T AH1 frag. 23 1828 C A

H1 frag. 23 1962 A TH1 frag. 3 124 T AH1 frag. 3 342 G TH1 frag. 4 308 — GH1 frag. 4 391 A CH1 frag. 4 673 T AH1 frag. 6 46 C AH1 frag. 6 81 A CH1 frag. 7 76 C TH1 frag. 7 83 A —H1 frag. 7 84 A —H1 frag. 8 162 C AH1 frag. 8 179 C TH1 frag. 8 192 G AH1 frag. 8 352 — AH1 frag. 8 369 G TH1 frag. 8 488 C AH1 frag. 8 544 A CH1 frag. 8 580 C AH1 frag. 8 647 A CH1 frag. 8 726 A TH1 frag. 8 822 — AH1 frag. 9 73 C AH1 frag. 9 281 T AH1 frag. 9 633 C —rhod frag. 1 A Crhod frag. 1 3 T Crhod frag. 1 12 T Crhod frag. 1 21 C Trhod frag. 1 107 T Crhod frag. 1 117 T Arhod frag. 1 157 T Crhod frag. 2 3 A Grhod frag. 2 51 T Crhod frag. 2 73 G Arhod frag. 2 82 G Crhod frag. 2 126 C ASIA frag. 2 41 A GSIA frag. 2 59 C TSIA frag. 3 12 C ASIA frag. 3 108 T CSIA frag. 3 117 C TSIA frag. 3 129 C Ttyr frag. 1 40 C Ttyr frag. 2 14 G Atyr frag. 2 93 A Ctyr frag. 2 96 A Ctyr frag. 2 100 G Ctyr frag. 2 108 G Atyr frag. 2 128 G Atyr frag. 2 138 T Gtyr frag. 2 172 C Ttyr frag. 2 207 C Ttyr frag. 2 270 G Ctyr frag. 3 63 C Atyr frag. 3 85 A Gtyr frag. 3 88 C Ttyr frag. 3 91 A Ttyr frag. 3 103 C Ttyr frag. 3 119 C Ttyr frag. 3 127 A Ttyr frag. 3 128 C Ttyr frag. 3 140 G Atyr frag. 3 164 G Atyr frag. 3 173 C T

109 (Allodapanura)H1 frag. 1 68 C TH1 frag. 11 536 C TH1 frag. 11 622 C TH1 frag. 11 868 — AH1 frag. 11 872 — AH1 frag. 11 938 — CH1 frag. 11 1089 C AH1 frag. 12 65 — AH1 frag. 16 221 C —H1 frag. 16 313 C —H1 frag. 16 509 A TH1 frag. 18 371 A TH1 frag. 19 54 T AH1 frag. 19 185 G A



H1 frag. 19 208 C TH1 frag. 19 244 A CH1 frag. 19 796 A GH1 frag. 21 277 C TH1 frag. 22 37 T CH1 frag. 23 762 C AH1 frag. 23 1041 T —H1 frag. 23 1905 T —H1 frag. 3 407 A —H1 frag. 4 578 — TH1 frag. 4 639 — CH1 frag. 6 51 — AH1 frag. 6 181 A TH1 frag. 8 241 — CH1 frag. 8 316 T AH1 frag. 8 335 T AH1 frag. 8 423 C TH1 frag. 9 580 C Arhod frag. 1 99 T CSIA frag. 3 33 C TSIA frag. 3 64 T Ctyr frag. 2 210 C Ttyr frag. 3 35 G Ttyr frag. 3 64 A Gtyr frag. 3 79 C Ttyr frag. 3 122 G Atyr frag. 3 181 G A

110 (Microhylidae)28S frag. 2 473 T C28S frag. 2 644 — C28S frag. 2 719 C G28S frag. 2 790 C A28S frag. 3 424 G CH1 frag. 10 261 C TH1 frag. 11 144 T CH1 frag. 11 726 — GH1 frag. 11 1045 A TH1 frag. 11 1217 A CH1 frag. 12 52 C —H1 frag. 13 8 G AH1 frag. 13 125 A CH1 frag. 14 44 T CH1 frag. 15 50 T CH1 frag. 16 16 A GH1 frag. 16 25 T CH1 frag. 16 414 A TH1 frag. 16 556 — TH1 frag. 16 557 — TH1 frag. 17 231 C TH1 frag. 17 423 A GH1 frag. 18 116 A TH1 frag. 18 397 — AH1 frag. 18 607 — CH1 frag. 18 727 C TH1 frag. 18 872 A CH1 frag. 19 376 T AH1 frag. 19 668 A TH1 frag. 2 7 C AH1 frag. 2 407 A TH1 frag. 20 129 T AH1 frag. 23 190 — CH1 frag. 23 213 A GH1 frag. 23 1532 — CH1 frag. 23 1607 A TH1 frag. 23 1846 C TH1 frag. 23 1946 — AH1 frag. 4 120 T —H1 frag. 4 201 — AH1 frag. 4 308 G CH1 frag. 4 330 T —H1 frag. 4 637 T CH1 frag. 5 12 A GH1 frag. 6 167 A —H1 frag. 8 24 A TH1 frag. 8 28 A TH1 frag. 8 122 A CH1 frag. 8 260 C AH1 frag. 8 313 C TH1 frag. 8 523 A CH1 frag. 9 216 — T

H1 frag. 9 226 A GH1 frag. 9 652 T CH1 frag. 9 775 C TH3 frag. 1 114 T CH3 frag. 1 117 G CH3 frag. 1 193 C AH3 frag. 2 29 T CH3 frag. 2 39 G Crhod frag. 1 36 A Grhod frag. 1 66 T Crhod frag. 1 117 A Crhod frag. 1 135 C Trhod frag. 1 162 T Crhod frag. 2 43 T Arhod frag. 2 53 A Trhod frag. 2 130 G —SIA frag. 3 9 T CSIA frag. 3 120 G CSIA frag. 3 168 T CSIA frag. 3 177 A G

111 (unnamed taxon)28S frag. 2 369 — CH1 frag. 2 66 — CH1 frag. 2 438 T AH1 frag. 3 355 A TH1 frag. 4 337 C TH1 frag. 4 351 G AH3 frag. 1 55 C A

118 (Cophylinae)28S frag. 2 567 C —H1 frag. 11 16 A GH1 frag. 11 47 T —H1 frag. 11 67 C —H1 frag. 11 409 T —H1 frag. 11 663 A CH1 frag. 11 726 G CH1 frag. 11 778 C —H1 frag. 11 910 C TH1 frag. 11 938 C —H1 frag. 11 983 T —H1 frag. 11 1342 T AH1 frag. 12 6 A CH1 frag. 13 6 A —H1 frag. 13 33 T —H1 frag. 13 75 T —H1 frag. 13 127 A TH1 frag. 13 132 G AH1 frag. 14 13 T CH1 frag. 14 91 T AH1 frag. 14 193 T CH1 frag. 14 243 G AH1 frag. 14 263 T CH1 frag. 15 23 C AH1 frag. 16 33 C TH1 frag. 16 86 — TH1 frag. 16 355 — CH1 frag. 16 547 C —H1 frag. 16 557 A CH1 frag. 17 38 A TH1 frag. 18 45 T CH1 frag. 18 93 T CH1 frag. 18 94 A CH1 frag. 18 408 — CH1 frag. 18 581 C TH1 frag. 18 707 T CH1 frag. 18 821 T CH1 frag. 18 872 C AH1 frag. 19 83 C AH1 frag. 19 331 G —H1 frag. 19 338 A —H1 frag. 19 350 G —H1 frag. 19 356 C —H1 frag. 19 376 A TH1 frag. 19 439 G —H1 frag. 19 715 T CH1 frag. 20 66 A GH1 frag. 20 176 A GH1 frag. 21 10 C TH1 frag. 21 171 G AH1 frag. 21 238 — T

H1 frag. 22 36 G AH1 frag. 23 9 A CH1 frag. 23 22 T CH1 frag. 23 102 A TH1 frag. 23 190 C —H1 frag. 23 250 T —H1 frag. 23 265 A CH1 frag. 23 559 C TH1 frag. 23 1015 A CH1 frag. 23 1181 C AH1 frag. 23 1292 — CH1 frag. 23 1310 T CH1 frag. 23 1316 T CH1 frag. 23 1532 C —H1 frag. 23 1739 A TH1 frag. 23 1750 A CH1 frag. 23 1846 T CH1 frag. 24 20 T CH1 frag. 6 25 T CH1 frag. 6 27 G AH1 frag. 8 23 T CH1 frag. 8 24 T AH1 frag. 8 41 A TH1 frag. 8 90 — CH1 frag. 8 139 C TH1 frag. 8 568 A CH1 frag. 8 611 A TH1 frag. 8 667 A CH1 frag. 8 828 T CH1 frag. 9 132 T —H1 frag. 9 138 C —H1 frag. 9 173 A —H1 frag. 9 185 A —H1 frag. 9 202 A —H1 frag. 9 226 G —H1 frag. 9 315 C —H1 frag. 9 333 C —H1 frag. 9 343 A —H1 frag. 9 367 A —H1 frag. 9 506 C —H1 frag. 9 520 A —H1 frag. 9 533 A —H1 frag. 9 558 A —H1 frag. 9 580 A —H1 frag. 9 693 A —H1 frag. 9 798 C —H1 frag. 9 818 T CH3 frag. 1 45 C TH3 frag. 1 69 G AH3 frag. 1 192 C GH3 frag. 1 195 A CSIA frag. 1 36 T CSIA frag. 2 44 C TSIA frag. 3 33 T CSIA frag. 3 42 T GSIA frag. 3 60 A GSIA frag. 3 64 C TSIA frag. 3 159 C GSIA frag. 4 76 T Gtyr frag. 1 50 A Gtyr frag. 2 92 G Atyr frag. 2 191 G Atyr frag. 2 194 A Gtyr frag. 3 91 T Atyr frag. 3 113 T Atyr frag. 3 126 C Atyr frag. 3 153 G A

121 (Gastrophryninae)H1 frag. 1 71 A TH1 frag. 11 67 C AH1 frag. 11 595 A TH1 frag. 11 778 C AH1 frag. 11 1000 A TH1 frag. 13 69 C AH1 frag. 13 151 T CH1 frag. 14 124 T CH1 frag. 15 58 A GH1 frag. 16 191 C TH1 frag. 16 414 T CH1 frag. 16 590 A —

H1 frag. 17 118 G TH1 frag. 17 300 — GH1 frag. 18 322 A GH1 frag. 18 393 — CH1 frag. 18 447 C —H1 frag. 19 119 A TH1 frag. 2 154 T CH1 frag. 21 57 A —H1 frag. 3 398 C AH1 frag. 4 672 T AH1 frag. 8 41 A CH1 frag. 8 428 — TH1 frag. 8 545 C TH1 frag. 9 46 A TH1 frag. 9 349 — TH1 frag. 9 383 C AH1 frag. 9 440 — CH3 frag. 1 198 G ASIA frag. 2 38 C TSIA frag. 3 9 C Ttyr frag. 1 46 T Ctyr frag. 2 47 T Gtyr frag. 2 83 T Ctyr frag. 3 47 G A

129 (unnamed taxon)H1 frag. 11 872 C AH1 frag. 11 1161 A —H1 frag. 13 159 T CH1 frag. 16 201 T —H1 frag. 17 33 A TH1 frag. 17 176 — AH1 frag. 18 267 — TH1 frag. 18 276 A TH1 frag. 18 349 C TH1 frag. 18 821 T CH1 frag. 19 600 C TH1 frag. 2 152 C —H1 frag. 20 20 C AH1 frag. 21 90 C AH1 frag. 23 942 C TH1 frag. 23 981 A —H1 frag. 23 997 A TH1 frag. 23 1103 — AH1 frag. 3 2 A GH1 frag. 3 398 C AH1 frag. 3 402 C TH1 frag. 4 191 T CH1 frag. 8 84 — CH1 frag. 8 241 C TH1 frag. 8 568 A CH1 frag. 9 216 T Crhod frag. 1 51 T CSIA frag. 2 59 T CSIA frag. 3 42 T C

130 (Microhylinae)28S frag. 2 434 — G28S frag. 2 682 — C28S frag. 3 491 — G28S frag. 3 603 A GH1 frag. 1 50 A GH1 frag. 1 57 A GH1 frag. 10 52 C TH1 frag. 11 368 A CH1 frag. 11 595 A TH1 frag. 11 868 A CH1 frag. 11 1089 A TH1 frag. 11 1327 T AH1 frag. 12 65 A GH1 frag. 13 125 C AH1 frag. 16 170 T AH1 frag. 16 556 T CH1 frag. 16 614 T CH1 frag. 17 31 T —H1 frag. 17 182 T AH1 frag. 17 296 T AH1 frag. 17 423 G AH1 frag. 18 185 C TH1 frag. 19 278 C AH1 frag. 20 1 C TH1 frag. 20 68 G A



H1 frag. 20 73 A GH1 frag. 21 10 C TH1 frag. 21 171 G AH1 frag. 23 52 C TH1 frag. 23 602 T —H1 frag. 23 1221 C TH1 frag. 23 1331 C TH1 frag. 23 1518 A CH1 frag. 23 1616 C AH1 frag. 4 13 A TH1 frag. 6 181 C TH1 frag. 6 199 A TH1 frag. 8 41 A TH1 frag. 8 313 T AH1 frag. 8 523 C TH1 frag. 9 609 C AH3 frag. 1 T CH3 frag. 1 124 A Crhod frag. 1 57 T Crhod frag. 1 66 C Trhod frag. 1 125 T CSIA frag. 1 4 T CSIA frag. 2 32 G CSIA frag. 3 3 A GSIA frag. 3 111 A GSIA frag. 3 153 A Gtyr frag. 1 21 T Gtyr frag. 2 130 T Ctyr frag. 3 50 T A

134 (unnamed taxon)28S frag. 2 567 C TH1 frag. 10 199 C AH1 frag. 11 53 T GH1 frag. 11 439 C AH1 frag. 11 852 C AH1 frag. 11 938 C TH1 frag. 11 1294 T CH1 frag. 11 1333 T AH1 frag. 13 69 C AH1 frag. 16 19 C AH1 frag. 16 27 T AH1 frag. 16 648 A GH1 frag. 16 681 C TH1 frag. 17 333 C TH1 frag. 18 13 A GH1 frag. 18 539 T —H1 frag. 18 724 — CH1 frag. 19 42 A TH1 frag. 19 61 G —H1 frag. 19 119 A TH1 frag. 2 65 T —H1 frag. 2 154 T CH1 frag. 2 180 A TH1 frag. 2 439 C TH1 frag. 21 57 A —H1 frag. 21 163 — AH1 frag. 23 452 C TH1 frag. 23 623 A CH1 frag. 23 1169 C TH1 frag. 3 58 C TH1 frag. 3 362 G AH1 frag. 4 283 T CH1 frag. 4 316 C AH1 frag. 5 17 C AH1 frag. 6 91 T CH1 frag. 8 40 A TH1 frag. 8 74 A TH1 frag. 8 260 A CH1 frag. 8 441 A CH1 frag. 8 696 A GH1 frag. 8 735 A GH1 frag. 9 343 A CH1 frag. 9 645 — TH1 frag. 9 818 T CSIA frag. 1 39 C T

135 (Asterophryinae)28S frag. 2 453 C T28S frag. 2 650 — GH1 frag. 1 22 G AH1 frag. 10 52 C A

H1 frag. 10 217 T —H1 frag. 10 269 C TH1 frag. 11 7 G AH1 frag. 11 88 T CH1 frag. 11 778 C —H1 frag. 11 870 — CH1 frag. 11 887 A TH1 frag. 11 1314 — TH1 frag. 11 1315 — TH1 frag. 11 1336 T —H1 frag. 11 1342 T —H1 frag. 12 41 A GH1 frag. 12 143 A CH1 frag. 13 130 C TH1 frag. 14 9 G AH1 frag. 14 238 A TH1 frag. 16 33 C TH1 frag. 16 72 G AH1 frag. 16 115 — CH1 frag. 16 241 A —H1 frag. 16 573 — TH1 frag. 16 665 C TH1 frag. 16 677 G AH1 frag. 16 680 G TH1 frag. 17 54 C TH1 frag. 17 210 A CH1 frag. 18 1 G AH1 frag. 18 116 C TH1 frag. 18 306 A CH1 frag. 18 530 C —H1 frag. 18 563 A CH1 frag. 18 597 — AH1 frag. 18 717 A CH1 frag. 18 741 C —H1 frag. 18 792 A TH1 frag. 18 883 C TH1 frag. 19 24 G —H1 frag. 19 66 A TH1 frag. 19 369 C AH1 frag. 19 439 G AH1 frag. 2 7 A CH1 frag. 2 285 A —H1 frag. 20 9 A TH1 frag. 20 60 G —H1 frag. 21 8 C TH1 frag. 21 172 G AH1 frag. 21 270 G CH1 frag. 22 10 C TH1 frag. 22 11 C TH1 frag. 22 13 C TH1 frag. 22 23 G AH1 frag. 22 61 G AH1 frag. 23 52 C TH1 frag. 23 67 G AH1 frag. 23 103 A CH1 frag. 23 190 C —H1 frag. 23 274 A CH1 frag. 23 283 C TH1 frag. 23 440 — AH1 frag. 23 693 A —H1 frag. 23 1131 G AH1 frag. 23 1303 C TH1 frag. 23 1816 A CH1 frag. 23 1946 A —H1 frag. 3 2 A TH1 frag. 3 8 T CH1 frag. 3 251 C TH1 frag. 3 252 C TH1 frag. 3 321 G AH1 frag. 3 398 C TH1 frag. 4 391 A CH1 frag. 4 441 C AH1 frag. 4 592 C AH1 frag. 4 670 A CH1 frag. 5 12 G AH1 frag. 5 35 G AH1 frag. 8 41 A CH1 frag. 8 86 — AH1 frag. 8 313 T CH1 frag. 8 488 T A

H1 frag. 8 824 — CH1 frag. 9 226 G AH1 frag. 9 281 C AH1 frag. 9 725 C TH3 frag. 1 12 C TH3 frag. 1 84 C GH3 frag. 1 189 G CSIA frag. 3 6 A GSIA frag. 3 51 T CSIA frag. 3 60 A CSIA frag. 3 84 G CSIA frag. 3 123 T CSIA frag. 4 22 G TSIA frag. 4 23 T CSIA frag. 4 46 T CSIA frag. 4 76 T C

143 (Afrobatrachia)28S frag. 2 386 C G28S frag. 2 639 G —28S frag. 2 655 G —28S frag. 2 768 C AH1 frag. 1 59 T AH1 frag. 10 43 A —H1 frag. 11 264 C TH1 frag. 11 429 — AH1 frag. 11 565 C AH1 frag. 11 819 C AH1 frag. 11 1327 T GH1 frag. 12 80 C —H1 frag. 12 112 G AH1 frag. 12 116 G AH1 frag. 13 91 T AH1 frag. 16 333 A CH1 frag. 17 118 G —H1 frag. 17 333 C TH1 frag. 18 388 C TH1 frag. 19 3 C TH1 frag. 2 152 C TH1 frag. 2 171 A CH1 frag. 2 437 C AH1 frag. 20 176 A GH1 frag. 21 133 A TH1 frag. 23 22 T CH1 frag. 23 59 G AH1 frag. 23 822 — TH1 frag. 23 981 T AH1 frag. 23 1169 C AH1 frag. 3 22 C AH1 frag. 3 169 A TH1 frag. 3 176 A TH1 frag. 3 338 — CH1 frag. 3 396 — TH1 frag. 4 592 T AH1 frag. 6 23 C TH1 frag. 8 69 C TH1 frag. 8 352 A GH1 frag. 8 550 G AH1 frag. 8 626 C AH1 frag. 9 397 — AH1 frag. 9 506 A TH1 frag. 9 558 A —H1 frag. 9 818 T Crhod frag. 2 126 A Gtyr frag. 1 G Atyr frag. 1 12 A Ctyr frag. 2 157 A Ctyr frag. 2 195 G Atyr frag. 2 258 A Gtyr frag. 3 53 T C

144 (Xenosyneunitanura)28S frag. 2 330 G —28S frag. 2 719 C —H1 frag. 11 67 C TH1 frag. 11 139 A CH1 frag. 11 368 A CH1 frag. 11 852 C TH1 frag. 11 937 — CH1 frag. 11 1071 C AH1 frag. 11 1217 A TH1 frag. 11 1259 T —

H1 frag. 12 148 T —H1 frag. 12 186 A CH1 frag. 14 72 A —H1 frag. 16 39 T AH1 frag. 16 535 A —H1 frag. 16 672 A TH1 frag. 17 274 A —H1 frag. 18 276 A CH1 frag. 18 306 A TH1 frag. 18 349 C TH1 frag. 18 508 — TH1 frag. 18 648 C AH1 frag. 19 123 A CH1 frag. 19 216 C AH1 frag. 19 439 G TH1 frag. 19 509 C TH1 frag. 2 32 G AH1 frag. 2 67 — CH1 frag. 2 133 C TH1 frag. 2 277 A —H1 frag. 20 60 G AH1 frag. 20 115 T —H1 frag. 21 218 C —H1 frag. 23 52 C TH1 frag. 23 1074 T —H1 frag. 23 1131 G CH1 frag. 23 1338 C —H1 frag. 23 1444 G —H1 frag. 23 1825 A TH1 frag. 3 58 C TH1 frag. 3 184 A TH1 frag. 3 297 C AH1 frag. 3 351 — CH1 frag. 3 365 T CH1 frag. 4 94 A TH1 frag. 4 292 T —H1 frag. 4 351 G AH1 frag. 6 181 T CH1 frag. 7 96 A TH1 frag. 8 46 T CH1 frag. 8 51 C TH1 frag. 8 52 A GH1 frag. 8 74 A TH1 frag. 8 181 A GH1 frag. 8 369 T —H1 frag. 8 458 — TH1 frag. 8 556 T CH1 frag. 8 558 G AH1 frag. 8 565 A CH1 frag. 8 611 A TH1 frag. 8 816 T CH1 frag. 8 828 T AH1 frag. 9 5 C AH1 frag. 9 457 — GH1 frag. 9 538 — CH1 frag. 9 539 — CH1 frag. 9 693 A —H1 frag. 9 840 C Arhod frag. 1 2 A Crhod frag. 2 3 G Arhod frag. 2 42 C Grhod frag. 2 80 G Arhod frag. 2 127 C Grhod frag. 2 129 A TSIA frag. 1 36 T CSIA frag. 1 39 C TSIA frag. 2 53 A GSIA frag. 3 24 C TSIA frag. 3 54 C TSIA frag. 3 78 G ASIA frag. 3 114 G TSIA frag. 4 22 G ASIA frag. 4 73 G Ttyr frag. 1 7 C Gtyr frag. 1 46 T Ctyr frag. 1 82 C Ttyr frag. 2 11 C Ttyr frag. 2 39 A Ctyr frag. 2 138 G Atyr frag. 2 177 C T



tyr frag. 2 204 C Atyr frag. 2 213 T Atyr frag. 3 44 G Atyr frag. 3 51 G Atyr frag. 3 52 A Ctyr frag. 3 123 C T

148 (Laurentobatrachia)28S frag. 2 714 G C28S frag. 2 764 A C28S frag. 3 306 — CH1 frag. 11 392 C AH1 frag. 11 868 A CH1 frag. 11 1089 A —H1 frag. 12 103 A —H1 frag. 12 127 T AH1 frag. 14 91 T AH1 frag. 16 31 A GH1 frag. 16 359 C AH1 frag. 16 547 C AH1 frag. 16 590 A TH1 frag. 17 11 A CH1 frag. 17 47 C TH1 frag. 17 182 T AH1 frag. 17 318 — CH1 frag. 18 93 T CH1 frag. 18 371 T —H1 frag. 18 766 C TH1 frag. 18 782 A —H1 frag. 18 863 G AH1 frag. 19 24 G TH1 frag. 19 91 C TH1 frag. 19 247 C TH1 frag. 19 403 C AH1 frag. 19 816 G AH1 frag. 2 16 A CH1 frag. 2 118 C AH1 frag. 2 210 A GH1 frag. 2 238 C TH1 frag. 2 345 — CH1 frag. 20 73 A GH1 frag. 20 182 C TH1 frag. 21 76 C TH1 frag. 22 55 T CH1 frag. 23 250 A TH1 frag. 23 1238 — GH1 frag. 23 1359 G AH1 frag. 23 1427 A CH1 frag. 23 1556 — AH1 frag. 3 124 A TH1 frag. 3 165 — AH1 frag. 4 370 — AH1 frag. 4 673 A CH1 frag. 6 199 C AH1 frag. 7 55 C TH1 frag. 8 249 A —H1 frag. 8 735 T AH1 frag. 9 729 — Arhod frag. 2 6 C Grhod frag. 2 27 C Trhod frag. 2 82 C Grhod frag. 2 118 T CSIA frag. 3 51 T CSIA frag. 3 156 T Atyr frag. 1 14 T Gtyr frag. 1 29 C Gtyr frag. 2 53 C Ttyr frag. 3 47 T Atyr frag. 3 134 A G

161 (Hyperolius)28S frag. 2 567 G AH1 frag. 16 401 — CH1 frag. 18 24 C TH1 frag. 18 254 T AH1 frag. 18 509 A TH1 frag. 19 54 A TH1 frag. 19 178 C TH1 frag. 19 331 G AH1 frag. 19 396 A TH1 frag. 19 651 A CH1 frag. 19 729 C A

H1 frag. 19 749 T CH1 frag. 23 693 A TH1 frag. 23 1074 T AH1 frag. 23 1221 C —H1 frag. 23 1911 — Ttyr frag. 2 23 C Ttyr frag. 2 65 C Ttyr frag. 2 67 C Gtyr frag. 2 222 T Ctyr frag. 3 79 C G

164 (Arthroleptidae)28S frag. 2 319 — G28S frag. 3 370 G CH1 frag. 1 G AH1 frag. 1 30 C TH1 frag. 10 54 — TH1 frag. 10 101 G AH1 frag. 10 266 C TH1 frag. 11 12 G AH1 frag. 11 89 C TH1 frag. 11 910 T —H1 frag. 11 927 A CH1 frag. 13 168 A CH1 frag. 14 65 G —H1 frag. 14 129 T CH1 frag. 15 54 A GH1 frag. 16 127 T CH1 frag. 16 614 T AH1 frag. 17 31 T AH1 frag. 17 429 A CH1 frag. 18 52 A CH1 frag. 18 95 A CH1 frag. 18 388 T AH1 frag. 18 503 — AH1 frag. 19 119 A TH1 frag. 19 338 A —H1 frag. 19 560 A TH1 frag. 2 15 C AH1 frag. 20 60 G TH1 frag. 20 180 C TH1 frag. 23 17 G AH1 frag. 23 693 A CH1 frag. 23 1214 T —H1 frag. 23 1221 C AH1 frag. 3 262 T CH1 frag. 3 355 A GH1 frag. 3 362 G AH1 frag. 4 120 T AH1 frag. 4 630 T AH1 frag. 7 15 T CH1 frag. 8 139 C TH1 frag. 8 263 — AH1 frag. 8 545 A TH1 frag. 9 73 A CH1 frag. 9 202 C AH1 frag. 9 492 A CH3 frag. 1 42 C TH3 frag. 1 57 G CH3 frag. 1 66 C TH3 frag. 1 126 A Crhod frag. 2 21 C Trhod frag. 2 61 G Atyr frag. 1 55 T Ctyr frag. 2 17 C Ttyr frag. 2 20 G Atyr frag. 2 56 G Atyr frag. 2 92 A Gtyr frag. 2 207 T A

165 (Leptopelinae)28S frag. 2 606 — C28S frag. 3 603 A GH1 frag. 1 22 G AH1 frag. 10 6 C TH1 frag. 10 24 G AH1 frag. 10 261 C TH1 frag. 11 16 A GH1 frag. 11 72 C AH1 frag. 11 130 A CH1 frag. 11 146 C TH1 frag. 11 663 A G

H1 frag. 11 1226 — TH1 frag. 12 6 A GH1 frag. 12 7 G TH1 frag. 12 12 T CH1 frag. 12 84 — CH1 frag. 12 186 A CH1 frag. 13 18 G TH1 frag. 13 91 A TH1 frag. 13 130 C TH1 frag. 13 156 T AH1 frag. 14 28 C AH1 frag. 14 60 — TH1 frag. 14 143 C AH1 frag. 14 238 A TH1 frag. 14 250 C AH1 frag. 14 260 G TH1 frag. 15 42 A TH1 frag. 16 141 — AH1 frag. 16 170 T AH1 frag. 16 333 C TH1 frag. 16 450 A CH1 frag. 16 648 A TH1 frag. 16 691 A GH1 frag. 17 5 T CH1 frag. 17 12 A TH1 frag. 17 296 C TH1 frag. 17 372 T —H1 frag. 18 164 T CH1 frag. 18 306 A CH1 frag. 18 530 C AH1 frag. 18 648 C TH1 frag. 18 673 A CH1 frag. 18 717 A TH1 frag. 18 825 — AH1 frag. 19 14 — AH1 frag. 19 54 A TH1 frag. 19 66 A TH1 frag. 19 172 A CH1 frag. 19 318 T —H1 frag. 19 439 G AH1 frag. 19 826 T AH1 frag. 2 44 G AH1 frag. 2 176 — AH1 frag. 2 207 G AH1 frag. 2 237 C TH1 frag. 2 240 G AH1 frag. 2 425 C TH1 frag. 2 437 A CH1 frag. 20 23 C AH1 frag. 21 76 T —H1 frag. 21 113 A TH1 frag. 21 243 T —H1 frag. 22 37 C TH1 frag. 22 47 — TH1 frag. 22 55 C —H1 frag. 23 2 G CH1 frag. 23 52 C AH1 frag. 23 100 A TH1 frag. 23 182 T GH1 frag. 23 1131 G CH1 frag. 23 1154 A TH1 frag. 23 1181 C AH1 frag. 23 1321 A GH1 frag. 23 1460 G TH1 frag. 23 1554 T CH1 frag. 23 1704 C AH1 frag. 24 8 C TH1 frag. 25 44 A TH1 frag. 3 8 A CH1 frag. 3 44 A TH1 frag. 3 249 A TH1 frag. 3 266 C AH1 frag. 4 211 A TH1 frag. 4 254 T CH1 frag. 4 280 C TH1 frag. 4 298 A TH1 frag. 4 316 C TH1 frag. 4 337 C AH1 frag. 4 343 G T

H1 frag. 4 346 C AH1 frag. 4 349 C AH1 frag. 4 351 G TH1 frag. 4 577 — CH1 frag. 4 637 T —H1 frag. 5 9 A GH1 frag. 5 33 A TH1 frag. 6 25 T CH1 frag. 7 42 A CH1 frag. 7 97 C AH1 frag. 8 69 T CH1 frag. 8 177 A CH1 frag. 8 181 A GH1 frag. 8 298 G AH1 frag. 8 488 A CH1 frag. 8 544 C TH1 frag. 8 550 A GH1 frag. 8 694 — AH1 frag. 8 716 — TH1 frag. 8 735 A GH1 frag. 9 67 T CH1 frag. 9 126 C T

168 (Arthroleptinae)H1 frag. 11 67 C AH1 frag. 11 264 T CH1 frag. 11 368 A CH1 frag. 11 409 T —H1 frag. 11 938 C AH1 frag. 11 1191 T —H1 frag. 12 113 — GH1 frag. 12 116 A GH1 frag. 14 93 A CH1 frag. 14 208 A TH1 frag. 16 94 T —H1 frag. 16 382 A CH1 frag. 16 436 — AH1 frag. 16 629 A CH1 frag. 17 182 A GH1 frag. 17 383 A TH1 frag. 17 424 — CH1 frag. 18 155 — TH1 frag. 18 628 T AH1 frag. 18 720 A CH1 frag. 18 866 A GH1 frag. 19 3 T CH1 frag. 19 449 T CH1 frag. 19 485 — AH1 frag. 19 531 A CH1 frag. 19 715 A TH1 frag. 2 328 C TH1 frag. 23 25 C TH1 frag. 23 59 A GH1 frag. 23 216 — GH1 frag. 23 602 T —H1 frag. 23 997 A TH1 frag. 23 1097 G AH1 frag. 23 1169 A CH1 frag. 23 1518 A CH1 frag. 23 1951 A CH1 frag. 3 58 C AH1 frag. 3 169 T —H1 frag. 3 176 T GH1 frag. 3 338 C TH1 frag. 4 292 T —H1 frag. 4 325 A TH1 frag. 4 386 T CH1 frag. 6 55 T GH1 frag. 6 62 A TH1 frag. 8 74 A TH1 frag. 8 441 A CH1 frag. 8 523 A CH1 frag. 8 667 A TH1 frag. 9 27 A GH1 frag. 9 343 A —H1 frag. 9 409 A Ctyr frag. 2 23 C Ttyr frag. 2 35 C Ttyr frag. 3 50 T Ctyr frag. 3 52 A C



169 (Astylosternini)H1 frag. 10 55 T AH1 frag. 11 40 G —H1 frag. 11 656 — GH1 frag. 11 657 — CH1 frag. 11 694 T CH1 frag. 11 778 A CH1 frag. 11 1113 A CH1 frag. 11 1311 A CH1 frag. 12 148 T AH1 frag. 13 159 A CH1 frag. 14 64 T CH1 frag. 14 72 A CH1 frag. 14 214 — CH1 frag. 15 50 T CH1 frag. 16 333 C —H1 frag. 16 590 T CH1 frag. 16 626 — CH1 frag. 16 660 — GH1 frag. 17 11 C TH1 frag. 17 251 T —H1 frag. 17 350 A CH1 frag. 17 407 T CH1 frag. 17 435 — AH1 frag. 18 816 — CH1 frag. 19 24 T AH1 frag. 19 217 A CH1 frag. 19 364 — AH1 frag. 2 65 T CH1 frag. 20 129 T CH1 frag. 21 133 T AH1 frag. 23 299 G AH1 frag. 23 785 — TH1 frag. 23 1074 T —H1 frag. 23 1088 A CH1 frag. 23 1124 A TH1 frag. 23 1226 T CH1 frag. 23 1346 A CH1 frag. 23 1750 T AH1 frag. 23 1962 T AH1 frag. 3 342 T CH1 frag. 3 391 A GH1 frag. 4 434 A GH1 frag. 5 35 A GH1 frag. 8 28 A CH1 frag. 8 407 C —H1 frag. 8 611 A CH1 frag. 8 626 A CH1 frag. 9 511 A TH1 frag. 9 703 — Ctyr frag. 1 29 G Atyr frag. 2 83 C Atyr frag. 2 240 C Ttyr frag. 2 243 C Atyr frag. 3 153 A G

172 (Arthroleptini)H1 frag. 10 204 — CH1 frag. 11 15 A TH1 frag. 11 149 T CH1 frag. 11 762 A CH1 frag. 11 1327 G AH1 frag. 11 1336 T CH1 frag. 12 21 A GH1 frag. 12 41 A TH1 frag. 13 117 C AH1 frag. 14 35 A TH1 frag. 14 44 T AH1 frag. 14 75 — TH1 frag. 14 106 A TH1 frag. 14 243 G AH1 frag. 17 18 A TH1 frag. 17 437 C TH1 frag. 18 276 A TH1 frag. 19 216 C TH1 frag. 19 278 C TH1 frag. 19 460 A CH1 frag. 19 788 A CH1 frag. 19 796 G AH1 frag. 20 10 T CH1 frag. 20 73 G A

H1 frag. 23 40 C TH1 frag. 23 1338 C TH1 frag. 23 1427 C AH1 frag. 8 711 G AH1 frag. 8 796 C AH1 frag. 8 804 A TH1 frag. 9 17 A GH1 frag. 9 22 A GH1 frag. 9 52 T CH1 frag. 9 54 T CH1 frag. 9 256 C TH1 frag. 9 432 T —SIA frag. 2 32 C ASIA frag. 3 39 C T

175 (Arthroleptis)28S frag. 2 790 C A28S frag. 3 187 G C28S frag. 3 263 — C28S frag. 3 264 — CH1 frag. 10 54 T AH1 frag. 11 368 C —H1 frag. 11 505 A —H1 frag. 11 536 T —H1 frag. 11 1245 A CH1 frag. 12 41 T CH1 frag. 12 113 G AH1 frag. 15 50 T CH1 frag. 15 58 A GH1 frag. 16 681 T CH1 frag. 17 54 C TH1 frag. 17 306 A TH1 frag. 17 333 T AH1 frag. 18 155 T CH1 frag. 18 539 A CH1 frag. 18 821 T AH1 frag. 18 830 A CH1 frag. 18 865 A TH1 frag. 19 460 C —H1 frag. 19 796 A —H1 frag. 20 115 T CH1 frag. 20 129 T CH1 frag. 23 133 G AH1 frag. 23 1074 T CH1 frag. 23 1303 C AH1 frag. 23 1607 A CH1 frag. 23 1732 T AH1 frag. 23 1992 C TH1 frag. 6 59 — CH1 frag. 7 24 C TH1 frag. 7 40 A CH1 frag. 7 43 G AH1 frag. 7 78 C TH1 frag. 7 95 C TH1 frag. 8 28 A TH1 frag. 8 41 A CH1 frag. 8 710 A TH1 frag. 9 14 A GH1 frag. 9 57 T CH1 frag. 9 79 G AH1 frag. 9 85 C AH1 frag. 9 90 G Atyr frag. 2 19 A Gtyr frag. 2 41 C Ttyr frag. 2 126 C Gtyr frag. 2 219 T Ctyr frag. 2 273 T Ctyr frag. 3 61 G Ctyr frag. 3 70 T Ctyr frag. 3 114 T Atyr frag. 3 134 G A

180 (Natatanura)28S frag. 2 768 C —H1 frag. 1 38 C TH1 frag. 1 64 A TH1 frag. 10 23 T CH1 frag. 11 368 A CH1 frag. 11 778 A —H1 frag. 13 127 A TH1 frag. 14 93 A TH1 frag. 16 450 A —

H1 frag. 16 590 A CH1 frag. 17 350 A TH1 frag. 18 654 A TH1 frag. 18 746 T CH1 frag. 18 838 A TH1 frag. 18 866 A GH1 frag. 19 24 G AH1 frag. 19 91 C TH1 frag. 19 278 C AH1 frag. 19 415 A TH1 frag. 19 560 A TH1 frag. 19 635 C —H1 frag. 2 133 C AH1 frag. 2 371 — CH1 frag. 2 432 C TH1 frag. 2 437 C TH1 frag. 2 443 G AH1 frag. 20 62 — GH1 frag. 20 77 G —H1 frag. 23 2 G CH1 frag. 23 25 C TH1 frag. 23 184 — CH1 frag. 23 299 G CH1 frag. 23 1108 C —H1 frag. 23 1840 T AH1 frag. 23 1940 T —H1 frag. 3 8 A CH1 frag. 3 160 T AH1 frag. 4 64 T —H1 frag. 4 223 A CH1 frag. 4 280 C —H1 frag. 4 439 C AH1 frag. 6 229 C AH1 frag. 7 24 C —H1 frag. 8 74 A TH1 frag. 8 407 C TH1 frag. 8 554 G AH1 frag. 8 735 T GH1 frag. 9 693 A CH3 frag. 1 57 G CH3 frag. 1 162 G CH3 frag. 1 189 G CH3 frag. 2 39 G Arhod frag. 2 42 C Grhod frag. 2 97 A Ctyr frag. 1 18 T Ctyr frag. 1 46 T Gtyr frag. 2 23 C Ttyr frag. 2 101 A Gtyr frag. 2 159 T Ctyr frag. 2 183 C Ttyr frag. 2 208 G Ttyr frag. 2 249 T Gtyr frag. 3 52 A Gtyr frag. 3 137 T G

181 (Ptychadenidae/Ptychadena)H1 frag. 1 20 A GH1 frag. 1 54 T AH1 frag. 1 76 C TH1 frag. 10 43 A —H1 frag. 14 89 T CH1 frag. 14 106 A CH1 frag. 14 208 A TH1 frag. 15 42 A TH1 frag. 16 7 A GH1 frag. 16 201 T CH1 frag. 16 249 T CH1 frag. 16 292 A GH1 frag. 16 359 C AH1 frag. 16 548 — AH1 frag. 16 549 — AH1 frag. 17 356 — CH1 frag. 17 446 C AH1 frag. 18 38 T AH1 frag. 18 52 A GH1 frag. 18 209 A GH1 frag. 18 232 C TH1 frag. 18 282 — GH1 frag. 18 411 A TH1 frag. 18 514 A T

H1 frag. 18 530 C TH1 frag. 18 563 A TH1 frag. 18 727 C TH1 frag. 18 766 C TH1 frag. 18 863 G AH1 frag. 19 148 A TH1 frag. 19 197 A TH1 frag. 19 201 A TH1 frag. 19 213 T CH1 frag. 19 461 — CH1 frag. 2 118 C AH1 frag. 2 140 C TH1 frag. 2 215 A TH1 frag. 2 277 A GH1 frag. 2 389 T CH1 frag. 2 420 A GH1 frag. 20 68 G AH1 frag. 20 146 T GH1 frag. 22 72 T AH1 frag. 23 265 A TH1 frag. 23 883 C —H1 frag. 23 983 — GH1 frag. 23 997 A TH1 frag. 23 1201 G AH1 frag. 23 1245 C TH1 frag. 23 1346 A TH1 frag. 23 1356 A GH1 frag. 23 1444 G AH1 frag. 23 1555 — AH1 frag. 23 1704 C TH1 frag. 23 1951 A CH1 frag. 23 1977 C TH1 frag. 24 5 T CH1 frag. 24 16 C TH1 frag. 24 33 A GH1 frag. 25 16 A GH1 frag. 3 41 G AH1 frag. 3 129 — TH1 frag. 3 138 — GH1 frag. 3 142 — AH1 frag. 3 170 — GH1 frag. 3 190 — TH1 frag. 3 193 — CH1 frag. 3 194 — TH1 frag. 3 195 — TH1 frag. 3 200 — CH1 frag. 3 206 — TH1 frag. 3 207 — TH1 frag. 3 226 — TH1 frag. 3 227 — TH1 frag. 3 241 — TH1 frag. 3 243 — TH1 frag. 3 249 A GH1 frag. 3 258 C AH1 frag. 3 291 — TH1 frag. 3 292 — AH1 frag. 3 293 — AH1 frag. 3 294 — AH1 frag. 3 295 — CH1 frag. 3 298 — AH1 frag. 3 306 — CH1 frag. 3 343 — CH1 frag. 3 344 — GH1 frag. 3 346 — GH1 frag. 3 347 — GH1 frag. 3 348 — GH1 frag. 4 13 A GH1 frag. 4 214 — TH1 frag. 4 335 A GH1 frag. 4 338 T AH1 frag. 4 447 A GH1 frag. 5 20 A CH1 frag. 5 29 G AH1 frag. 6 12 C TH1 frag. 6 49 T —H1 frag. 6 104 C —H1 frag. 6 137 C TH1 frag. 6 163 C AH1 frag. 7 11 G AH1 frag. 7 54 C T



H1 frag. 8 47 C AH1 frag. 8 148 C TH1 frag. 8 300 A GH1 frag. 8 352 A TH1 frag. 8 488 A TH1 frag. 8 557 — GH1 frag. 8 568 A —H1 frag. 8 569 A GH1 frag. 8 714 A CH1 frag. 8 752 — AH1 frag. 8 818 C AH1 frag. 9 71 T —H1 frag. 9 202 C TH1 frag. 9 227 — GH1 frag. 9 258 — AH1 frag. 9 383 C —H1 frag. 9 432 T —H1 frag. 9 618 A TH1 frag. 9 739 A TH1 frag. 9 798 A Grhod frag. 1 C Trhod frag. 1 27 G Arhod frag. 1 107 C Grhod frag. 1 128 C Trhod frag. 1 129 C Trhod frag. 1 135 C Trhod frag. 1 165 C Trhod frag. 1 171 C Trhod frag. 2 41 C Trhod frag. 2 54 C Trhod frag. 2 86 A T

183 (Victoranura)28S frag. 2 764 A —H1 frag. 11 392 C AH1 frag. 11 663 A TH1 frag. 12 120 A CH1 frag. 13 168 A CH1 frag. 17 118 G AH1 frag. 17 231 C TH1 frag. 17 333 C AH1 frag. 18 276 A TH1 frag. 18 388 C TH1 frag. 19 737 — CH1 frag. 2 88 A —H1 frag. 2 100 A TH1 frag. 2 162 — AH1 frag. 2 342 A —H1 frag. 21 76 C TH1 frag. 23 182 T CH1 frag. 23 1376 T CH1 frag. 23 1816 A GH1 frag. 23 1968 T CH1 frag. 4 106 — CH1 frag. 4 211 A —H1 frag. 4 308 G AH1 frag. 6 91 T CH1 frag. 8 41 A CH1 frag. 8 260 C —H1 frag. 8 313 C TH1 frag. 8 423 C —H1 frag. 9 256 C TH1 frag. 9 495 — TH1 frag. 9 517 T AH1 frag. 9 755 A CH3 frag. 1 3 C Trhod frag. 2 100 G Ctyr frag. 1 G Atyr frag. 1 28 T Ctyr frag. 2 258 A Gtyr frag. 2 276 C Ttyr frag. 3 98 G C

184 (Ceratobatrachidae)28S frag. 3 134 T GH1 frag. 10 269 C TH1 frag. 11 7 G AH1 frag. 11 16 A TH1 frag. 11 505 C TH1 frag. 11 852 C TH1 frag. 12 128 T CH1 frag. 13 91 T C

H1 frag. 13 121 A —H1 frag. 13 125 A TH1 frag. 13 132 G AH1 frag. 14 7 T GH1 frag. 14 13 T CH1 frag. 14 69 — TH1 frag. 14 126 A GH1 frag. 14 166 C TH1 frag. 14 244 G AH1 frag. 14 263 T CH1 frag. 15 6 A GH1 frag. 15 33 A CH1 frag. 15 34 G AH1 frag. 15 57 T CH1 frag. 16 337 — TH1 frag. 17 372 T CH1 frag. 18 164 T CH1 frag. 18 185 T AH1 frag. 18 488 T AH1 frag. 18 530 C AH1 frag. 18 655 — CH1 frag. 18 761 T CH1 frag. 18 878 T CH1 frag. 18 885 A CH1 frag. 19 278 A TH1 frag. 19 427 T CH1 frag. 19 596 C AH1 frag. 19 622 A GH1 frag. 2 438 T CH1 frag. 20 61 A GH1 frag. 21 57 A CH1 frag. 21 270 G —H1 frag. 23 69 T CH1 frag. 23 83 A GH1 frag. 23 96 A TH1 frag. 23 213 A GH1 frag. 23 236 A —H1 frag. 23 260 C —H1 frag. 23 1097 G AH1 frag. 23 1131 G AH1 frag. 23 1338 C AH1 frag. 23 1346 A CH1 frag. 23 1364 A CH1 frag. 23 1427 A TH1 frag. 23 1478 A —H1 frag. 23 1743 A CH1 frag. 23 1776 A GH1 frag. 23 1798 T CH1 frag. 23 1840 A CH1 frag. 23 1905 T —H1 frag. 24 6 T CH1 frag. 24 29 A GH1 frag. 3 44 A TH1 frag. 3 303 C TH1 frag. 3 315 — AH1 frag. 3 362 G AH1 frag. 4 306 A GH1 frag. 4 330 T CH1 frag. 4 475 — AH1 frag. 5 17 A CH1 frag. 7 42 A CH1 frag. 7 76 T CH1 frag. 8 62 T AH1 frag. 8 122 A TH1 frag. 8 221 — CH1 frag. 8 223 — CH1 frag. 8 345 G AH1 frag. 8 488 A —H1 frag. 8 514 C TH1 frag. 8 551 A TH1 frag. 8 568 A CH1 frag. 8 696 A —H1 frag. 8 732 — CH1 frag. 8 735 G AH1 frag. 8 796 C GH1 frag. 8 804 A TH1 frag. 8 831 G AH1 frag. 9 104 C AH1 frag. 9 326 — CH1 frag. 9 453 A T

H1 frag. 9 467 G AH1 frag. 9 522 — TH1 frag. 9 618 A —rhod frag. 1 3 C Trhod frag. 1 9 T Crhod frag. 1 161 A Trhod frag. 2 42 G Trhod frag. 2 61 G ASIA frag. 2 20 C TSIA frag. 2 71 A CSIA frag. 3 109 C ASIA frag. 3 123 T CSIA frag. 3 126 C TSIA frag. 4 52 C TSIA frag. 4 55 G Atyr frag. 1 52 T Ctyr frag. 2 26 C Ttyr frag. 2 66 A Gtyr frag. 2 67 C Ttyr frag. 2 80 C Ttyr frag. 2 285 G Atyr frag. 3 13 C Ttyr frag. 3 14 G Ttyr frag. 3 53 T Atyr frag. 3 56 G Atyr frag. 3 67 C T

189 (Telmatobatrachia)H1 frag. 11 598 — TH1 frag. 11 600 — GH1 frag. 11 1093 — AH1 frag. 21 251 T AH1 frag. 22 62 A GH1 frag. 23 644 — CH1 frag. 23 762 C AH1 frag. 23 1041 T AH1 frag. 23 1233 A GH1 frag. 23 1411 — CH1 frag. 23 1518 A CH1 frag. 23 1657 T CH1 frag. 23 1865 A GH1 frag. 23 1970 T —H1 frag. 6 50 — AH1 frag. 8 249 A TH1 frag. 9 98 C Trhod frag. 2 86 A Ctyr frag. 3 181 G T

190 (Micrixalidae)H1 frag. 10 159 A CH1 frag. 11 16 A GH1 frag. 11 27 A GH1 frag. 11 36 T CH1 frag. 11 67 C AH1 frag. 11 79 A GH1 frag. 11 112 — AH1 frag. 11 113 — CH1 frag. 11 138 A TH1 frag. 11 312 — AH1 frag. 11 910 C AH1 frag. 11 1190 — CH1 frag. 11 1248 A TH1 frag. 11 1316 A TH1 frag. 11 1327 T CH1 frag. 12 74 T AH1 frag. 21 124 A CH1 frag. 21 133 A CH1 frag. 21 155 T CH1 frag. 22 8 T AH1 frag. 22 20 T CH1 frag. 22 53 C TH1 frag. 22 54 T CH1 frag. 22 55 T CH1 frag. 22 63 G AH1 frag. 23 25 T AH1 frag. 23 38 T CH1 frag. 23 103 A CH1 frag. 23 129 C TH1 frag. 23 149 A GH1 frag. 23 152 A GH1 frag. 23 184 C AH1 frag. 23 258 — G

H1 frag. 23 293 T AH1 frag. 23 727 — CH1 frag. 23 729 T AH1 frag. 23 940 — AH1 frag. 23 1014 — TH1 frag. 23 1124 A —H1 frag. 23 1214 T CH1 frag. 23 1288 T CH1 frag. 23 1295 T CH1 frag. 23 1378 G AH1 frag. 23 1676 C TH1 frag. 23 1766 C AH1 frag. 23 1770 A GH1 frag. 23 1802 T CH1 frag. 23 1803 G AH1 frag. 23 1811 C TH1 frag. 23 1977 C TH1 frag. 23 1995 G AH1 frag. 24 10 A TH1 frag. 24 24 G AH1 frag. 6 85 T CH1 frag. 8 49 — CH1 frag. 8 59 T —H1 frag. 8 62 T CH1 frag. 8 469 T AH1 frag. 8 553 A GH1 frag. 8 554 A TH1 frag. 8 714 A GH1 frag. 8 816 T CH1 frag. 8 828 T —H1 frag. 9 28 A GH1 frag. 9 33 T CH1 frag. 9 43 A CH1 frag. 9 48 T CH1 frag. 9 71 T AH1 frag. 9 170 — GH1 frag. 9 171 — AH1 frag. 9 453 A GH1 frag. 9 467 G CH1 frag. 9 495 T CH1 frag. 9 672 T AH1 frag. 9 755 C —rhod frag. 1 12 C Trhod frag. 1 159 G Crhod frag. 1 162 T Crhod frag. 2 57 C Trhod frag. 2 112 C Trhod frag. 2 132 A Ttyr frag. 1 19 C Atyr frag. 1 21 T Gtyr frag. 1 43 C Ttyr frag. 1 46 G Atyr frag. 2 36 T Ctyr frag. 2 41 T Ctyr frag. 2 46 G Atyr frag. 2 47 C Ttyr frag. 2 92 A Gtyr frag. 2 98 C Ttyr frag. 2 100 C Gtyr frag. 2 174 G Atyr frag. 2 189 C Gtyr frag. 2 201 T Ctyr frag. 2 208 T Gtyr frag. 2 216 C Ttyr frag. 2 222 T Ctyr frag. 2 233 A Gtyr frag. 2 266 A Gtyr frag. 3 4 G Atyr frag. 3 56 G Ttyr frag. 3 94 C Ttyr frag. 3 128 T Ctyr frag. 3 173 T C

191 (Ametrobatrachia)H1 frag. 10 261 C TH1 frag. 11 467 — AH1 frag. 11 963 — TH1 frag. 23 963 A TH1 frag. 23 1062 — TH1 frag. 23 1077 — AH1 frag. 23 1781 C T



H1 frag. 7 36 — TH1 frag. 8 232 A CH1 frag. 8 352 A GH1 frag. 8 387 — CH1 frag. 9 202 C TH1 frag. 9 315 A TH1 frag. 9 492 A TH1 frag. 9 788 A TH1 frag. 9 798 A Ttyr frag. 3 155 A G

193 (Phrynobatrachidae)H1 frag. 1 50 A GH1 frag. 1 66 C TH1 frag. 10 55 T AH1 frag. 10 260 C AH1 frag. 11 27 A GH1 frag. 11 57 A —H1 frag. 11 457 C TH1 frag. 11 694 C —H1 frag. 11 983 C AH1 frag. 11 1045 A TH1 frag. 11 1093 A CH1 frag. 12 120 C AH1 frag. 13 110 — CH1 frag. 13 127 T —H1 frag. 14 31 T AH1 frag. 14 104 T CH1 frag. 16 72 G AH1 frag. 16 576 A TH1 frag. 17 210 A CH1 frag. 17 333 A —H1 frag. 17 392 — GH1 frag. 18 254 T AH1 frag. 18 447 T AH1 frag. 18 766 C TH1 frag. 18 767 C TH1 frag. 18 861 G AH1 frag. 18 863 G AH1 frag. 19 172 A CH1 frag. 19 542 A CH1 frag. 19 651 T CH1 frag. 19 822 A CH1 frag. 2 118 C AH1 frag. 2 162 A CH1 frag. 21 76 T AH1 frag. 23 40 T CH1 frag. 23 182 C TH1 frag. 23 299 C TH1 frag. 23 559 C TH1 frag. 23 729 T CH1 frag. 23 1074 T AH1 frag. 23 1097 G AH1 frag. 23 1427 A —H1 frag. 23 1554 T —H1 frag. 3 155 G —H1 frag. 3 266 C AH1 frag. 3 339 — CH1 frag. 4 673 A CH1 frag. 6 49 T AH1 frag. 6 137 C —H1 frag. 6 213 A CH1 frag. 8 10 T CH1 frag. 8 93 C —H1 frag. 8 122 A CH1 frag. 8 249 T —H1 frag. 8 554 A GH1 frag. 8 569 A GH1 frag. 8 714 A —H1 frag. 8 816 T —H1 frag. 8 838 C TH1 frag. 9 432 T AH1 frag. 9 453 A TH1 frag. 9 708 A CH1 frag. 9 739 A GH3 frag. 1 168 C Arhod frag. 1 54 A Grhod frag. 1 171 C Trhod frag. 2 79 C TSIA frag. 3 51 T C

SIA frag. 3 78 G ASIA frag. 3 99 G ASIA frag. 3 105 A GSIA frag. 3 120 G TSIA frag. 3 153 A GSIA frag. 4 61 T Ctyr frag. 1 4 A Ctyr frag. 1 13 C Ttyr frag. 1 28 C Ttyr frag. 1 46 G Ttyr frag. 2 80 C Ttyr frag. 2 157 A Ctyr frag. 2 159 C Ttyr frag. 2 171 C Ttyr frag. 2 193 C Atyr frag. 2 213 C Ttyr frag. 2 241 T Atyr frag. 3 39 A Gtyr frag. 3 134 A G

200 (Pyxicephaloidea)28S frag. 2 473 T CH1 frag. 1 38 T CH1 frag. 11 887 A TH1 frag. 11 953 C AH1 frag. 11 1232 A CH1 frag. 16 359 C TH1 frag. 17 81 A —H1 frag. 18 411 A TH1 frag. 18 628 T CH1 frag. 18 741 C AH1 frag. 19 147 C TH1 frag. 20 68 G AH1 frag. 23 789 A TH1 frag. 23 1346 A TH1 frag. 23 1951 A TH1 frag. 3 26 T CH1 frag. 4 100 T AH1 frag. 4 191 C AH1 frag. 6 62 A TH1 frag. 6 91 C TH1 frag. 8 568 A CH1 frag. 8 628 A TH1 frag. 9 188 — CH1 frag. 9 202 T AH1 frag. 9 609 C T

201 (Petropedetidae)H1 frag. 1 52 C TH1 frag. 11 57 A TH1 frag. 11 130 T CH1 frag. 11 392 A CH1 frag. 11 483 — TH1 frag. 12 80 C AH1 frag. 13 87 — AH1 frag. 13 172 C AH1 frag. 16 333 A CH1 frag. 16 535 A CH1 frag. 17 118 A TH1 frag. 18 153 — TH1 frag. 18 276 T AH1 frag. 18 322 C TH1 frag. 18 539 A CH1 frag. 23 1427 A GH1 frag. 23 1607 A TH1 frag. 23 1811 C TH1 frag. 3 8 C AH1 frag. 3 370 G AH1 frag. 3 415 T CH1 frag. 4 4 T CH1 frag. 4 292 T AH1 frag. 4 505 — AH1 frag. 8 29 T CH1 frag. 9 226 A TH1 frag. 9 564 — CH3 frag. 2 39 A CSIA frag. 3 42 T ASIA frag. 3 120 G Atyr frag. 1 52 T Atyr frag. 2 104 T Ctyr frag. 2 165 T C

209 (Pyxicephalidae)28S frag. 3 424 G CH1 frag. 10 52 T AH1 frag. 10 101 G AH1 frag. 11 89 C TH1 frag. 11 264 C TH1 frag. 13 127 T AH1 frag. 14 85 C AH1 frag. 14 142 T CH1 frag. 15 25 A GH1 frag. 16 513 — TH1 frag. 17 388 — GH1 frag. 17 437 C TH1 frag. 18 260 — CH1 frag. 19 369 T —H1 frag. 19 771 C TH1 frag. 2 162 A TH1 frag. 21 133 A CH1 frag. 23 152 A GH1 frag. 23 644 C AH1 frag. 23 1088 G CH1 frag. 23 1288 T CH1 frag. 23 1776 A TH1 frag. 3 209 — TH1 frag. 3 313 — AH1 frag. 3 342 T CH1 frag. 6 26 A TH1 frag. 8 272 A —H3 frag. 1 193 C Arhod frag. 1 21 T Crhod frag. 1 104 C Trhod frag. 1 165 C Gtyr frag. 2 64 A Ttyr frag. 2 67 C Gtyr frag. 2 97 A Ttyr frag. 3 51 G Atyr frag. 3 120 C T

210 (Pyxicephalinae)H1 frag. 1 20 A GH1 frag. 11 67 C —H1 frag. 11 141 A TH1 frag. 11 467 A —H1 frag. 11 983 C —H1 frag. 11 1327 T AH1 frag. 12 153 T AH1 frag. 13 69 C AH1 frag. 13 117 C TH1 frag. 14 72 A —H1 frag. 14 78 A —H1 frag. 14 149 A GH1 frag. 14 217 T AH1 frag. 15 5 G TH1 frag. 15 19 T CH1 frag. 15 23 C AH1 frag. 16 2 T CH1 frag. 16 221 C TH1 frag. 16 266 T GH1 frag. 16 292 A CH1 frag. 16 563 A CH1 frag. 17 231 T AH1 frag. 17 274 A TH1 frag. 17 372 T AH1 frag. 18 164 T CH1 frag. 18 254 T CH1 frag. 18 349 T —H1 frag. 18 411 T CH1 frag. 18 870 C TH1 frag. 19 42 T CH1 frag. 19 160 A TH1 frag. 19 175 A CH1 frag. 19 213 T AH1 frag. 19 216 T AH1 frag. 19 278 A CH1 frag. 19 496 A TH1 frag. 20 176 A GH1 frag. 21 57 A CH1 frag. 23 22 T CH1 frag. 23 140 T CH1 frag. 23 224 C GH1 frag. 23 299 C —

H1 frag. 23 623 A CH1 frag. 23 729 T CH1 frag. 23 883 C —H1 frag. 23 1077 A TH1 frag. 23 1097 G AH1 frag. 23 1154 C TH1 frag. 23 1181 C AH1 frag. 23 1214 T CH1 frag. 23 1334 T CH1 frag. 23 1376 C TH1 frag. 23 1386 A TH1 frag. 23 1554 T —H1 frag. 23 1569 A —H1 frag. 23 1722 G AH1 frag. 23 1798 T AH1 frag. 23 1803 G —H1 frag. 23 1816 G AH1 frag. 23 1824 T CH1 frag. 24 17 C TH1 frag. 24 19 C AH1 frag. 3 58 T AH1 frag. 3 262 C TH1 frag. 3 268 C TH1 frag. 3 362 G AH1 frag. 3 391 A GH1 frag. 4 13 A GH1 frag. 4 137 — AH1 frag. 4 325 T CH1 frag. 4 383 — CH1 frag. 4 404 T AH1 frag. 4 414 A —H1 frag. 4 452 A CH1 frag. 4 585 — CH1 frag. 4 649 A CH1 frag. 4 673 A CH1 frag. 5 3 C AH1 frag. 6 34 G AH1 frag. 6 167 T CH3 frag. 1 6 G AH3 frag. 1 45 C TH3 frag. 1 57 C TH3 frag. 1 99 C TH3 frag. 1 189 C GH3 frag. 2 42 C Grhod frag. 1 9 T Crhod frag. 1 36 A Grhod frag. 1 125 C Trhod frag. 2 21 C Trhod frag. 2 28 C Trhod frag. 2 33 G Arhod frag. 2 112 C TSIA frag. 3 82 G ASIA frag. 3 102 C TSIA frag. 3 153 A GSIA frag. 4 22 A TSIA frag. 4 55 G Atyr frag. 1 4 A Ctyr frag. 1 18 C Ttyr frag. 1 28 C Ttyr frag. 1 29 A Gtyr frag. 1 46 G Ttyr frag. 1 55 C Ttyr frag. 2 20 G Atyr frag. 2 47 C Ttyr frag. 2 83 C Ttyr frag. 2 144 G Atyr frag. 2 153 G Atyr frag. 2 159 C Ttyr frag. 2 194 C Atyr frag. 2 213 C Ttyr frag. 2 234 C Ttyr frag. 2 237 C Ttyr frag. 3 31 C Ttyr frag. 3 70 T Atyr frag. 3 167 C T

212 (Cacosterninae)28S frag. 2 315 — G28S frag. 2 496 — T28S frag. 2 613 C G28S frag. 2 724 — C



28S frag. 2 727 — C28S frag. 2 729 — AH1 frag. 1 50 A GH1 frag. 1 70 A GH1 frag. 11 762 A —H1 frag. 11 819 C TH1 frag. 12 21 A GH1 frag. 16 301 — TH1 frag. 18 116 A CH1 frag. 18 488 T AH1 frag. 18 604 A CH1 frag. 18 648 C AH1 frag. 19 145 A TH1 frag. 19 148 T GH1 frag. 19 406 — TH1 frag. 19 695 A TH1 frag. 2 171 C TH1 frag. 2 312 — TH1 frag. 2 407 T AH1 frag. 21 190 A GH1 frag. 23 25 T CH1 frag. 23 182 C TH1 frag. 23 602 T AH1 frag. 23 1245 C TH1 frag. 23 1732 T CH1 frag. 23 1743 A GH1 frag. 3 8 C TH1 frag. 3 47 C TH1 frag. 4 283 C TH1 frag. 4 343 A GH1 frag. 6 213 A CH1 frag. 7 13 A TH1 frag. 7 39 C TH1 frag. 8 69 C TH1 frag. 8 122 A CH1 frag. 8 313 T CH1 frag. 8 628 T GH1 frag. 9 73 C AH1 frag. 9 212 — GH1 frag. 9 226 A CH1 frag. 9 716 — GH1 frag. 9 739 A Grhod frag. 1 78 G Arhod frag. 1 85 A Crhod frag. 1 131 C Trhod frag. 2 147 T GSIA frag. 1 12 A GSIA frag. 2 14 A Gtyr frag. 1 75 T Ctyr frag. 2 66 A Gtyr frag. 2 68 T Ctyr frag. 2 183 T C

218 (Amietia)H1 frag. 1 70 G AH1 frag. 11 642 — CH1 frag. 11 819 T CH1 frag. 11 963 T CH1 frag. 14 144 A GH1 frag. 15 42 A TH1 frag. 16 359 T CH1 frag. 16 614 T AH1 frag. 17 167 — TH1 frag. 18 260 C AH1 frag. 18 411 T CH1 frag. 18 488 A TH1 frag. 18 891 T AH1 frag. 19 201 A GH1 frag. 19 449 T CH1 frag. 2 215 C —H1 frag. 21 133 C GH1 frag. 23 114 A TH1 frag. 23 294 — CH1 frag. 23 559 C TH1 frag. 23 1464 — TH1 frag. 23 1828 A TH1 frag. 24 10 A TH1 frag. 3 20 T CH1 frag. 3 51 G AH1 frag. 3 126 C TH1 frag. 4 298 A G

H1 frag. 4 649 A GH1 frag. 5 7 T CH1 frag. 7 96 A CH1 frag. 8 511 A Gtyr frag. 2 183 C Ttyr frag. 3 2 C A

220 (Saukrobatrachia)H1 frag. 11 663 T AH1 frag. 11 1161 A CH1 frag. 16 313 C TH1 frag. 18 254 T —H1 frag. 18 411 A CH1 frag. 18 877 T CH1 frag. 19 560 T AH1 frag. 19 749 C AH1 frag. 2 210 A GH1 frag. 2 328 C AH1 frag. 2 437 T CH1 frag. 23 452 C TH1 frag. 23 1181 C AH1 frag. 23 1245 C TH1 frag. 23 1358 C TH1 frag. 3 214 T GH1 frag. 4 223 C AH1 frag. 4 306 A CH1 frag. 8 211 — AH1 frag. 8 711 G TH1 frag. 9 228 — GH1 frag. 9 383 C —H1 frag. 9 672 T CH3 frag. 1 114 T CH3 frag. 2 33 G CH3 frag. 2 60 G C

221 (Dicroglossidae)H1 frag. 10 14 T CH1 frag. 10 19 A GH1 frag. 11 320 — TH1 frag. 11 409 T AH1 frag. 11 983 C TH1 frag. 12 103 A TH1 frag. 13 172 C AH1 frag. 14 25 — CH1 frag. 14 63 A GH1 frag. 14 89 T CH1 frag. 16 382 A TH1 frag. 17 210 A CH1 frag. 17 407 T —H1 frag. 18 116 A TH1 frag. 18 490 — CH1 frag. 18 868 A CH1 frag. 19 449 T CH1 frag. 19 729 C —H1 frag. 21 251 A TH1 frag. 21 270 G AH1 frag. 23 1060 C AH1 frag. 23 1169 C TH1 frag. 23 1427 A GH1 frag. 23 1518 C —H1 frag. 25 53 C TH1 frag. 25 69 G AH1 frag. 7 40 A —H1 frag. 8 116 T AH1 frag. 9 343 A TH1 frag. 9 521 — CH1 frag. 9 693 C Arhod frag. 1 10 A Grhod frag. 1 72 G Arhod frag. 2 57 C TSIA frag. 3 120 G ASIA frag. 3 156 T Atyr frag. 1 85 C Ttyr frag. 3 53 T Ctyr frag. 3 167 C T

222 (Occidozyginae)H1 frag. 10 55 T CH1 frag. 10 205 — AH1 frag. 11 57 A TH1 frag. 11 92 T CH1 frag. 11 392 A —H1 frag. 11 595 A —

H1 frag. 11 622 A TH1 frag. 11 1035 — CH1 frag. 12 52 C AH1 frag. 12 143 A CH1 frag. 13 8 G TH1 frag. 13 130 C TH1 frag. 14 13 T AH1 frag. 14 127 A GH1 frag. 14 208 A TH1 frag. 15 34 G AH1 frag. 15 56 T CH1 frag. 16 94 T CH1 frag. 16 305 — CH1 frag. 16 658 A GH1 frag. 22 6 G TH1 frag. 22 8 T GH1 frag. 22 17 C GH1 frag. 22 20 T CH1 frag. 23 67 G AH1 frag. 23 81 G AH1 frag. 23 1041 A TH1 frag. 23 1221 C TH1 frag. 23 1811 C TH1 frag. 23 1825 A TH1 frag. 23 1919 A TH1 frag. 24 19 C Arhod frag. 1 78 G Arhod frag. 1 134 G Crhod frag. 2 80 G ASIA frag. 3 9 T CSIA frag. 3 42 T CSIA frag. 3 54 T CSIA frag. 3 138 T CSIA frag. 3 160 C TSIA frag. 4 76 T CSIA frag. 4 79 T G

225 (Dicroglossinae)H1 frag. 11 53 T GH1 frag. 12 80 C AH1 frag. 13 16 A TH1 frag. 13 43 — GH1 frag. 13 55 A CH1 frag. 14 6 C TH1 frag. 14 90 T AH1 frag. 14 177 C TH1 frag. 15 15 A TH1 frag. 17 333 A CH1 frag. 18 138 A TH1 frag. 18 550 A CH1 frag. 18 886 G AH1 frag. 19 42 A TH1 frag. 19 212 C TH1 frag. 19 757 — CH1 frag. 21 277 C AH1 frag. 22 15 A GH1 frag. 23 293 T —H1 frag. 23 623 A CH1 frag. 23 1154 A GH1 frag. 23 1183 — CH1 frag. 23 1569 A TH1 frag. 23 1732 T CH1 frag. 23 1846 C TH1 frag. 6 213 A —H1 frag. 7 13 A TH1 frag. 8 47 C AH1 frag. 8 306 C TH1 frag. 8 553 A GH1 frag. 8 568 A CH1 frag. 9 432 T CH1 frag. 9 545 C —SIA frag. 3 3 G ASIA frag. 3 141 T Ctyr frag. 2 31 T Ctyr frag. 3 98 C T

226 (Limnonectini)H1 frag. 1 64 T CH1 frag. 10 101 G AH1 frag. 11 89 C TH1 frag. 11 146 C TH1 frag. 11 320 T A

H1 frag. 11 1316 A TH1 frag. 11 1327 T GH1 frag. 12 136 — CH1 frag. 12 148 T —H1 frag. 12 153 A CH1 frag. 12 187 G AH1 frag. 13 125 A TH1 frag. 14 93 T CH1 frag. 16 382 T CH1 frag. 16 585 — CH1 frag. 17 47 T AH1 frag. 18 110 — CH1 frag. 18 322 C AH1 frag. 18 488 T AH1 frag. 18 530 C AH1 frag. 18 717 C TH1 frag. 18 767 C TH1 frag. 18 861 G AH1 frag. 19 771 C TH1 frag. 2 360 T CH1 frag. 20 73 A GH1 frag. 22 23 G AH1 frag. 23 38 T CH1 frag. 23 52 C TH1 frag. 23 69 T CH1 frag. 23 83 A GH1 frag. 23 113 T CH1 frag. 23 224 C TH1 frag. 23 602 T AH1 frag. 23 896 — AH1 frag. 23 1233 G AH1 frag. 23 1478 A CH1 frag. 23 1882 A GH1 frag. 23 1962 T CH1 frag. 3 22 A CH1 frag. 3 150 A TH1 frag. 3 160 A GH1 frag. 3 252 C TH1 frag. 3 342 T CH1 frag. 3 361 G AH1 frag. 3 365 T CH1 frag. 4 673 A CH1 frag. 5 6 C TH1 frag. 6 25 T CH1 frag. 6 27 G AH1 frag. 8 29 T CH1 frag. 8 37 C AH1 frag. 8 52 A CH1 frag. 8 69 C TH1 frag. 8 556 T GH1 frag. 8 667 A TH1 frag. 8 816 T AH1 frag. 9 42 G AH1 frag. 9 71 T AH1 frag. 9 460 — TH3 frag. 2 33 C GH3 frag. 2 36 A CH3 frag. 2 42 C GH3 frag. 2 60 C Grhod frag. 1 142 A Grhod frag. 2 91 C TSIA frag. 1 42 G ASIA frag. 3 48 G ASIA frag. 3 78 G ASIA frag. 3 108 C TSIA frag. 3 168 A CSIA frag. 4 31 G Atyr frag. 1 4 A Ctyr frag. 1 11 A Gtyr frag. 1 44 T Atyr frag. 1 73 C Ttyr frag. 2 87 A Ctyr frag. 2 100 C Ttyr frag. 2 124 T Ctyr frag. 2 285 G Ttyr frag. 3 64 A Ctyr frag. 3 88 T Gtyr frag. 3 115 C Ttyr frag. 3 128 T C



228 (unnamed taxon)H1 frag. 10 55 T AH1 frag. 10 217 T CH1 frag. 11 561 — TH1 frag. 11 1093 A CH1 frag. 12 127 T AH1 frag. 13 82 T CH1 frag. 13 172 A CH1 frag. 14 127 A GH1 frag. 14 128 G AH1 frag. 16 39 T CH1 frag. 16 672 A GH1 frag. 17 26 A GH1 frag. 17 38 A TH1 frag. 18 322 A TH1 frag. 18 514 A CH1 frag. 18 746 C TH1 frag. 19 695 A CH1 frag. 2 218 T CH1 frag. 2 371 C TH1 frag. 22 43 C TH1 frag. 22 62 G AH1 frag. 23 559 C —H1 frag. 23 1077 A TH1 frag. 23 1338 C AH1 frag. 23 1478 C TH1 frag. 23 1834 A CH1 frag. 3 214 G AH1 frag. 4 100 T CH1 frag. 7 39 C TH1 frag. 8 816 A CH1 frag. 9 281 A TH1 frag. 9 609 C TH1 frag. 9 618 A TH1 frag. 9 693 A T

232 (Dicroglossini)H1 frag. 11 409 T GH1 frag. 11 513 — AH1 frag. 11 598 T CH1 frag. 11 606 — CH1 frag. 11 831 — CH1 frag. 11 983 T CH1 frag. 11 1146 — AH1 frag. 12 21 A GH1 frag. 12 52 A CH1 frag. 21 133 C AH1 frag. 23 2 C GH1 frag. 23 644 C TH1 frag. 23 981 C TH1 frag. 23 1411 C TH1 frag. 6 22 C TH1 frag. 8 233 A TH1 frag. 8 281 T —H1 frag. 8 298 T —H1 frag. 9 43 T CH1 frag. 9 54 C TH1 frag. 9 202 A CH1 frag. 9 367 A TH1 frag. 9 798 G Arhod frag. 2 139 T Ctyr frag. 1 4 A Gtyr frag. 1 67 C Ttyr frag. 2 84 G Atyr frag. 2 261 T Ctyr frag. 3 119 T C

214 (Aglaioanura)H1 frag. 11 457 C TH1 frag. 11 762 A CH1 frag. 12 4 A GH1 frag. 12 14 T CH1 frag. 14 208 A CH1 frag. 14 217 T AH1 frag. 16 535 A TH1 frag. 17 333 A TH1 frag. 18 143 — CH1 frag. 18 371 A —H1 frag. 2 118 C TH1 frag. 2 162 A TH1 frag. 2 238 C TH1 frag. 20 68 G A

H1 frag. 23 644 C TH1 frag. 24 5 T CH1 frag. 24 33 A GH1 frag. 4 94 A TH1 frag. 4 169 C AH1 frag. 4 561 — TH1 frag. 6 49 T AH1 frag. 8 122 A TH1 frag. 8 369 T —H1 frag. 8 488 A CH1 frag. 8 735 G AH1 frag. 9 233 — CH1 frag. 9 533 A CH1 frag. 9 708 A GH3 frag. 1 15 C AH3 frag. 2 18 A TH3 frag. 2 19 G C

245 (Rhacophoroidea)H1 frag. 11 467 A TH1 frag. 11 1139 — TH1 frag. 13 35 — AH1 frag. 16 127 T CH1 frag. 16 313 T AH1 frag. 16 429 C AH1 frag. 16 509 A CH1 frag. 18 322 C TH1 frag. 18 563 A TH1 frag. 18 830 A CH1 frag. 18 838 T CH1 frag. 23 452 T AH1 frag. 23 623 A —H1 frag. 23 1015 A TH1 frag. 23 1776 A GH1 frag. 3 108 A TH1 frag. 3 124 C AH1 frag. 3 331 — TH1 frag. 4 120 T AH1 frag. 4 191 C TH1 frag. 4 404 T CH1 frag. 4 408 A TH1 frag. 4 439 A TH1 frag. 8 201 — TH1 frag. 8 249 T AH1 frag. 8 568 A CH1 frag. 9 104 C AH3 frag. 1 168 C AH3 frag. 1 184 C AH3 frag. 1 186 C Atyr frag. 1 29 A Gtyr frag. 2 53 C Ttyr frag. 2 98 C Atyr frag. 2 198 C Ttyr frag. 3 32 T Gtyr frag. 3 98 C T

246 (Mantellidae)H1 frag. 11 602 — TH1 frag. 12 80 C AH1 frag. 13 40 — CH1 frag. 14 72 A —H1 frag. 16 2 T CH1 frag. 16 170 T CH1 frag. 16 221 C AH1 frag. 16 547 C TH1 frag. 18 144 — AH1 frag. 18 752 A GH1 frag. 18 758 G AH1 frag. 18 761 T CH1 frag. 18 870 C TH1 frag. 18 877 C TH1 frag. 19 54 T AH1 frag. 19 148 A TH1 frag. 19 154 A GH1 frag. 19 164 A CH1 frag. 19 181 G AH1 frag. 19 209 C TH1 frag. 19 216 T CH1 frag. 2 20 C AH1 frag. 2 90 — AH1 frag. 2 362 — AH1 frag. 20 23 C A

H1 frag. 21 57 A CH1 frag. 21 90 A TH1 frag. 22 61 A GH1 frag. 23 105 A TH1 frag. 23 963 T AH1 frag. 23 1181 A CH1 frag. 23 1233 G CH1 frag. 23 1386 A —H1 frag. 23 1743 A CH1 frag. 23 1816 G AH1 frag. 23 1846 C TH1 frag. 25 34 C AH1 frag. 4 223 A TH1 frag. 4 592 T CH1 frag. 7 54 C TH1 frag. 8 544 T CH1 frag. 9 392 — CH1 frag. 9 493 — AH3 frag. 1 78 C Arhod frag. 1 104 C Trhod frag. 1 144 C Trhod frag. 2 80 G Arhod frag. 2 134 C Gtyr frag. 1 28 C Ttyr frag. 1 40 T Atyr frag. 1 55 T Ctyr frag. 2 100 C T

247 (Boophinae/Boophis)H1 frag. 1 36 A GH1 frag. 1 48 A TH1 frag. 10 261 T CH1 frag. 11 134 A TH1 frag. 11 317 — CH1 frag. 11 887 A TH1 frag. 11 1071 C TH1 frag. 13 82 T CH1 frag. 13 126 A GH1 frag. 14 193 T —H1 frag. 15 40 C TH1 frag. 16 36 T CH1 frag. 16 94 T CH1 frag. 16 361 — AH1 frag. 16 676 A GH1 frag. 17 38 A GH1 frag. 18 93 T CH1 frag. 18 185 T CH1 frag. 18 283 — AH1 frag. 18 868 A CH1 frag. 19 531 A TH1 frag. 19 542 A TH1 frag. 2 16 A CH1 frag. 2 118 T CH1 frag. 2 241 C TH1 frag. 20 66 A GH1 frag. 20 68 A GH1 frag. 20 73 A GH1 frag. 20 151 A GH1 frag. 20 180 C TH1 frag. 23 21 G AH1 frag. 23 23 T CH1 frag. 23 38 T CH1 frag. 23 40 T CH1 frag. 23 43 T CH1 frag. 23 52 C TH1 frag. 23 224 C TH1 frag. 23 293 T CH1 frag. 23 764 — TH1 frag. 23 1041 A TH1 frag. 23 1062 T GH1 frag. 23 1124 A GH1 frag. 23 1226 T AH1 frag. 23 1722 G AH1 frag. 23 1811 C TH1 frag. 23 1828 A TH1 frag. 23 1951 A TH1 frag. 3 58 T AH1 frag. 3 372 T AH1 frag. 3 402 T CH1 frag. 4 215 — AH1 frag. 4 271 T C

H1 frag. 4 292 T AH1 frag. 4 325 T AH1 frag. 4 365 T CH1 frag. 4 434 A GH1 frag. 4 458 A CH1 frag. 7 11 G AH1 frag. 8 94 — TH1 frag. 8 174 A GH1 frag. 8 201 T AH1 frag. 8 249 A CH1 frag. 8 294 T CH1 frag. 8 300 G AH1 frag. 8 313 T CH1 frag. 8 545 T CH1 frag. 8 726 T CH1 frag. 8 788 — TH1 frag. 8 804 A GH1 frag. 8 838 C TH1 frag. 9 42 G TH1 frag. 9 54 T CH1 frag. 9 67 C TH1 frag. 9 506 A —H3 frag. 1 81 A GH3 frag. 1 126 A GH3 frag. 1 195 C AH3 frag. 1 243 T CH3 frag. 2 5 T GH3 frag. 2 18 T Grhod frag. 1 165 C T

248 (Mantellinae)H1 frag. 11 315 A TH1 frag. 11 368 C TH1 frag. 11 422 — AH1 frag. 11 457 T CH1 frag. 11 983 C —H1 frag. 11 1135 C —H1 frag. 12 9 C AH1 frag. 13 156 T AH1 frag. 14 144 A GH1 frag. 14 208 C TH1 frag. 15 22 T CH1 frag. 18 145 — TH1 frag. 18 411 C —H1 frag. 18 530 C AH1 frag. 18 654 T AH1 frag. 19 42 A TH1 frag. 19 449 T CH1 frag. 2 240 G AH1 frag. 2 425 C TH1 frag. 23 420 — TH1 frag. 23 710 — TH1 frag. 23 789 A TH1 frag. 23 1334 A CH1 frag. 23 1704 C TH1 frag. 4 106 C —H1 frag. 4 149 — AH1 frag. 5 10 — GH1 frag. 5 16 A TH1 frag. 7 36 T GH1 frag. 8 33 C TH1 frag. 8 387 C AH1 frag. 8 425 — CH1 frag. 9 71 T AH3 frag. 1 18 G CH3 frag. 1 117 G CH3 frag. 1 204 C AH3 frag. 2 20 C Atyr frag. 1 21 T C

249 (Laliostomini)28S frag. 2 714 G CH1 frag. 10 159 A GH1 frag. 11 23 T CH1 frag. 11 79 A GH1 frag. 11 1217 A CH1 frag. 13 127 T AH1 frag. 14 89 T CH1 frag. 14 177 C TH1 frag. 16 1 A GH1 frag. 16 201 T CH1 frag. 16 566 — T



H1 frag. 17 33 A TH1 frag. 17 103 A TH1 frag. 17 306 A CH1 frag. 18 125 — GH1 frag. 18 126 — TH1 frag. 18 209 A GH1 frag. 18 322 T —H1 frag. 18 494 C TH1 frag. 18 581 C AH1 frag. 18 717 C TH1 frag. 19 83 C AH1 frag. 19 181 A TH1 frag. 19 278 A TH1 frag. 19 286 A CH1 frag. 19 424 A GH1 frag. 19 749 A CH1 frag. 19 771 C TH1 frag. 2 171 C AH1 frag. 2 360 T CH1 frag. 21 260 A TH1 frag. 23 1427 A TH1 frag. 23 1478 A GH1 frag. 23 1919 A TH1 frag. 3 26 T CH1 frag. 4 316 C TH1 frag. 4 373 G AH1 frag. 6 25 T CH1 frag. 8 177 A GH1 frag. 8 211 A CH1 frag. 8 441 A TH1 frag. 8 469 C AH1 frag. 8 696 A GH1 frag. 9 84 C TH1 frag. 9 229 — TH1 frag. 9 546 — TH1 frag. 9 609 C —H1 frag. 9 739 A Gtyr frag. 2 273 C Ttyr frag. 3 155 G A

253 (Rhacophoridae)H1 frag. 10 52 T AH1 frag. 11 663 A CH1 frag. 11 694 C AH1 frag. 11 819 C TH1 frag. 11 1093 A —H1 frag. 13 163 A TH1 frag. 15 34 G AH1 frag. 16 31 A GH1 frag. 16 72 G AH1 frag. 16 242 — TH1 frag. 16 333 A TH1 frag. 16 590 C —H1 frag. 16 665 C TH1 frag. 17 306 A TH1 frag. 18 52 A TH1 frag. 18 232 C TH1 frag. 18 306 A TH1 frag. 18 349 C AH1 frag. 18 457 — AH1 frag. 18 604 A TH1 frag. 18 615 C TH1 frag. 18 650 — AH1 frag. 18 732 C TH1 frag. 18 878 T CH1 frag. 19 24 A TH1 frag. 19 271 T AH1 frag. 19 356 C TH1 frag. 19 796 A TH1 frag. 19 826 T AH1 frag. 2 140 C AH1 frag. 2 154 T CH1 frag. 2 191 — TH1 frag. 2 196 C AH1 frag. 2 218 T AH1 frag. 23 163 C —H1 frag. 23 199 A TH1 frag. 23 250 A GH1 frag. 23 521 T AH1 frag. 23 1214 T CH1 frag. 23 1256 T C

H1 frag. 23 1342 A TH1 frag. 23 1676 C TH1 frag. 4 100 T AH1 frag. 4 306 C AH1 frag. 5 9 A TH1 frag. 5 28 G AH1 frag. 6 25 T AH1 frag. 6 213 A CH1 frag. 8 47 C AH1 frag. 9 27 A GH1 frag. 9 46 T AH1 frag. 9 49 T CH1 frag. 9 59 T AH1 frag. 9 73 A TH1 frag. 9 256 T CH1 frag. 9 281 A CH1 frag. 9 498 — C

254 (Rhacophorinae)H1 frag. 11 600 G —H1 frag. 11 963 T CH1 frag. 11 1056 — TH1 frag. 11 1113 A TH1 frag. 11 1217 A —H1 frag. 11 1324 A TH1 frag. 12 148 T AH1 frag. 13 69 C TH1 frag. 13 123 A TH1 frag. 13 168 C AH1 frag. 14 106 A CH1 frag. 15 3 A TH1 frag. 16 7 A GH1 frag. 16 243 — GH1 frag. 16 400 — CH1 frag. 16 535 T CH1 frag. 16 614 T —H1 frag. 17 47 T AH1 frag. 18 140 — CH1 frag. 18 185 T AH1 frag. 18 838 C AH1 frag. 18 866 G AH1 frag. 19 91 T AH1 frag. 19 376 T AH1 frag. 19 427 T CH1 frag. 19 622 A GH1 frag. 2 16 A CH1 frag. 2 180 A CH1 frag. 2 287 — AH1 frag. 20 146 T CH1 frag. 21 133 A CH1 frag. 23 25 T CH1 frag. 23 529 — CH1 frag. 23 602 T AH1 frag. 23 644 T CH1 frag. 23 854 A CH1 frag. 23 1015 T —H1 frag. 23 1781 T CH1 frag. 23 1793 A TH1 frag. 24 1 C TH1 frag. 24 35 G AH1 frag. 24 38 T CH1 frag. 3 407 T AH1 frag. 4 106 C TH1 frag. 4 191 T AH1 frag. 4 439 T CH1 frag. 4 562 — CH1 frag. 7 36 T —H1 frag. 7 97 C AH1 frag. 8 201 T CH1 frag. 8 313 T CH1 frag. 8 335 T GH1 frag. 8 469 C AH1 frag. 8 488 C AH1 frag. 8 523 T AH1 frag. 9 16 — TH1 frag. 9 28 A —H1 frag. 9 48 T —H1 frag. 9 55 — AH1 frag. 9 432 T CH1 frag. 9 558 A C

256 (Kurixalus)28S frag. 2 753 C TH1 frag. 1 68 T CH1 frag. 10 43 A CH1 frag. 10 143 A —H1 frag. 11 23 T CH1 frag. 11 368 C AH1 frag. 11 439 T AH1 frag. 11 536 G TH1 frag. 11 663 C —H1 frag. 11 762 C —H1 frag. 11 852 C —H1 frag. 11 958 — TH1 frag. 11 959 — TH1 frag. 11 1138 — TH1 frag. 11 1248 A TH1 frag. 11 1327 T GH1 frag. 12 80 C TH1 frag. 12 103 A TH1 frag. 12 174 A GH1 frag. 13 198 C TH1 frag. 14 68 — AH1 frag. 14 208 C —H1 frag. 14 217 A TH1 frag. 14 260 G AH1 frag. 16 191 C AH1 frag. 16 464 A CH1 frag. 16 672 A TH1 frag. 16 700 C AH1 frag. 17 16 C AH1 frag. 17 306 T AH1 frag. 17 350 T AH1 frag. 18 13 A GH1 frag. 18 143 C TH1 frag. 18 433 T —H1 frag. 18 488 T AH1 frag. 18 539 T AH1 frag. 18 767 C TH1 frag. 18 861 G AH1 frag. 19 197 A TH1 frag. 19 203 A TH1 frag. 19 212 C TH1 frag. 19 224 A TH1 frag. 19 350 A GH1 frag. 19 369 C AH1 frag. 19 379 — TH1 frag. 19 396 A TH1 frag. 19 823 C AH1 frag. 2 7 C TH1 frag. 2 20 C AH1 frag. 2 154 C TH1 frag. 2 187 C AH1 frag. 2 192 — AH1 frag. 2 207 G AH1 frag. 2 237 C TH1 frag. 2 301 A CH1 frag. 2 430 — TH1 frag. 2 439 C —H1 frag. 21 57 A TH1 frag. 22 5 G AH1 frag. 22 18 C TH1 frag. 22 20 T CH1 frag. 23 48 C AH1 frag. 23 81 G AH1 frag. 23 902 C TH1 frag. 23 942 C AH1 frag. 23 997 A CH1 frag. 23 1154 C AH1 frag. 23 1256 C TH1 frag. 23 1359 G AH1 frag. 23 1386 A CH1 frag. 23 1478 A TH1 frag. 23 1758 G AH1 frag. 23 1811 C TH1 frag. 23 1840 A CH1 frag. 23 1974 C TH1 frag. 23 1977 C TH1 frag. 24 5 C TH1 frag. 24 16 C TH1 frag. 24 17 C T

H1 frag. 24 33 G AH1 frag. 25 30 C TH1 frag. 25 34 C AH1 frag. 25 41 A GH1 frag. 3 26 T CH1 frag. 3 141 T CH1 frag. 3 150 A GH1 frag. 3 266 C TH1 frag. 3 268 C TH1 frag. 3 321 G AH1 frag. 4 316 C TH1 frag. 4 373 G AH1 frag. 4 380 C TH1 frag. 4 463 A TH1 frag. 5 32 T CH1 frag. 7 35 C TH1 frag. 7 43 G AH1 frag. 7 79 — TH1 frag. 7 80 — AH1 frag. 7 87 A CH1 frag. 7 96 A TH1 frag. 8 37 C TH1 frag. 8 59 T CH1 frag. 8 62 T CH1 frag. 8 122 T AH1 frag. 8 352 G AH1 frag. 8 553 A GH1 frag. 8 568 C TH1 frag. 8 626 C AH1 frag. 8 711 T AH1 frag. 8 816 T AH1 frag. 8 838 C TH1 frag. 9 52 C TH1 frag. 9 409 C —H1 frag. 9 498 C AH1 frag. 9 558 C TH1 frag. 9 693 C TH1 frag. 9 755 C AH1 frag. 9 798 T CH1 frag. 9 840 T Crhod frag. 1 161 A Trhod frag. 2 134 C Gtyr frag. 1 29 G Ctyr frag. 2 8 T Atyr frag. 2 36 T Ctyr frag. 2 50 G Ttyr frag. 2 77 C Ttyr frag. 2 168 C Ttyr frag. 2 213 C Ttyr frag. 2 266 A Gtyr frag. 2 277 C Ttyr frag. 3 2 C Ttyr frag. 3 28 T Atyr frag. 3 31 C Ttyr frag. 3 63 A Ctyr frag. 3 70 T Ctyr frag. 3 158 G Ctyr frag. 3 170 C T

267 (Chiromantis)H1 frag. 11 264 T CH1 frag. 11 409 G —H1 frag. 11 648 — CH1 frag. 11 963 C —H1 frag. 11 1089 T —H1 frag. 12 74 T AH1 frag. 12 120 C AH1 frag. 14 64 C TH1 frag. 14 102 T CH1 frag. 16 27 T CH1 frag. 16 31 G CH1 frag. 16 266 T CH1 frag. 17 200 — AH1 frag. 17 306 T —H1 frag. 17 350 T AH1 frag. 17 446 C TH1 frag. 18 1 G AH1 frag. 18 140 C TH1 frag. 18 185 A —H1 frag. 18 209 A TH1 frag. 18 581 C A



H1 frag. 18 628 C AH1 frag. 18 868 A TH1 frag. 19 651 C TH1 frag. 2 7 C AH1 frag. 2 16 C AH1 frag. 2 44 G AH1 frag. 2 154 C TH1 frag. 2 237 C TH1 frag. 2 328 T —H1 frag. 2 419 T CH1 frag. 20 7 G AH1 frag. 20 25 A TH1 frag. 22 15 A GH1 frag. 22 45 T CH1 frag. 22 70 C TH1 frag. 23 103 C AH1 frag. 23 1131 G AH1 frag. 23 1169 C AH1 frag. 23 1359 G AH1 frag. 3 55 C AH1 frag. 4 263 G AH1 frag. 4 408 T AH1 frag. 4 493 C TH1 frag. 4 670 A CH1 frag. 6 62 A —H1 frag. 8 10 T CH1 frag. 8 569 A GH1 frag. 8 626 C AH1 frag. 9 17 A GH1 frag. 9 263 — AH1 frag. 9 570 — Arhod frag. 2 132 A Crhod frag. 2 134 C Arhod frag. 2 136 T A

270 (Nyctibatrachidae)H1 frag. 12 112 A GH1 frag. 21 113 A CH1 frag. 21 124 A CH1 frag. 23 105 A CH1 frag. 23 641 — TH1 frag. 23 1676 C TH1 frag. 23 1977 C TH1 frag. 25 14 G AH1 frag. 25 87 C TH1 frag. 7 13 A TH1 frag. 8 172 T CH1 frag. 9 492 T CH1 frag. 9 506 A Trhod frag. 2 139 T Atyr frag. 2 250 A Ctyr frag. 3 13 C Ttyr frag. 3 28 T Ctyr frag. 3 120 C A

272 (Ranidae)H1 frag. 10 35 — TH1 frag. 11 409 T CH1 frag. 11 467 A —H1 frag. 11 852 C TH1 frag. 11 953 C —H1 frag. 11 1000 A TH1 frag. 12 160 C AH1 frag. 14 109 C AH1 frag. 14 238 A GH1 frag. 16 7 A GH1 frag. 16 17 A GH1 frag. 16 24 T CH1 frag. 16 563 A TH1 frag. 17 33 A CH1 frag. 17 182 T AH1 frag. 17 251 T GH1 frag. 17 274 A GH1 frag. 17 383 A TH1 frag. 18 433 T AH1 frag. 18 758 G TH1 frag. 18 766 C TH1 frag. 18 767 C TH1 frag. 18 861 G AH1 frag. 18 863 G AH1 frag. 19 178 T CH1 frag. 19 518 — T

H1 frag. 19 560 A TH1 frag. 19 771 C TH1 frag. 23 182 C AH1 frag. 23 199 A TH1 frag. 23 224 C TH1 frag. 23 238 — TH1 frag. 23 789 A CH1 frag. 23 1062 T —H1 frag. 23 1181 A —H1 frag. 23 1221 C AH1 frag. 23 1233 G AH1 frag. 23 1245 T CH1 frag. 23 1378 G —H1 frag. 23 1607 A CH1 frag. 23 1867 — AH1 frag. 6 25 T CH1 frag. 6 46 A CH1 frag. 6 91 C TH1 frag. 7 35 C —H1 frag. 7 39 C AH1 frag. 8 139 C TH1 frag. 8 161 C AH1 frag. 8 748 A GH1 frag. 9 71 T CH1 frag. 9 84 C TH1 frag. 9 233 C Arhod frag. 1 3 C Trhod frag. 1 9 T Crhod frag. 1 134 G Trhod frag. 2 33 G Arhod frag. 2 112 C T

274 (Hylarana)H1 frag. 10 73 — TH1 frag. 11 368 C TH1 frag. 11 409 C AH1 frag. 11 457 T CH1 frag. 11 663 A CH1 frag. 13 69 C GH1 frag. 14 177 C TH1 frag. 16 152 T AH1 frag. 16 259 — GH1 frag. 16 629 A TH1 frag. 18 411 C AH1 frag. 18 504 — TH1 frag. 18 838 T CH1 frag. 19 61 G —H1 frag. 19 338 A CH1 frag. 19 449 T CH1 frag. 2 301 A CH1 frag. 21 90 A CH1 frag. 23 152 A GH1 frag. 23 250 A TH1 frag. 23 439 — TH1 frag. 23 613 — CH1 frag. 23 729 T —H1 frag. 23 902 C AH1 frag. 23 1041 A TH1 frag. 23 1288 T CH1 frag. 23 1303 A TH1 frag. 23 1356 A GH1 frag. 23 1834 A TH1 frag. 3 268 C TH1 frag. 4 289 — AH1 frag. 4 541 — GH1 frag. 4 548 A TH1 frag. 5 18 C AH1 frag. 6 229 A GH1 frag. 9 409 T CSIA frag. 4 79 T G

285 (unnamed taxon)H1 frag. 10 3 A GH1 frag. 10 24 A CH1 frag. 10 26 T CH1 frag. 10 261 C TH1 frag. 11 12 G AH1 frag. 11 505 C TH1 frag. 11 565 C TH1 frag. 11 600 G AH1 frag. 11 973 — TH1 frag. 11 1217 T A

H1 frag. 11 1266 A CH1 frag. 21 83 — CH1 frag. 23 942 C TH1 frag. 23 1169 C TH1 frag. 23 1338 C AH1 frag. 23 1607 C TH1 frag. 24 10 A GH1 frag. 6 81 C TH1 frag. 6 199 C TH1 frag. 7 13 A TH1 frag. 8 249 T CH1 frag. 8 457 — AH1 frag. 8 542 G AH1 frag. 8 548 C TH1 frag. 8 792 A CH1 frag. 9 247 — TH1 frag. 9 533 C —H1 frag. 9 681 — CH1 frag. 9 739 A Grhod frag. 1 94 G Arhod frag. 2 9 A Grhod frag. 2 61 G A

287 (unnamed taxon)H1 frag. 11 27 A GH1 frag. 11 72 C TH1 frag. 11 88 T —H1 frag. 11 392 A TH1 frag. 11 1071 C —H1 frag. 13 151 T CH1 frag. 15 40 T AH1 frag. 17 210 A TH1 frag. 17 306 A CH1 frag. 18 328 — TH1 frag. 18 433 A TH1 frag. 18 615 C AH1 frag. 18 648 A TH1 frag. 18 870 T AH1 frag. 19 369 A TH1 frag. 19 376 A TH1 frag. 21 251 A TH1 frag. 23 105 A CH1 frag. 23 587 — GH1 frag. 23 693 C TH1 frag. 23 789 C AH1 frag. 23 1015 A GH1 frag. 8 773 T CH1 frag. 9 409 T CH1 frag. 9 455 — GH1 frag. 9 708 A G

288 (Pelophylax)H1 frag. 16 201 T AH1 frag. 16 241 A GH1 frag. 16 313 A CH1 frag. 16 547 C AH1 frag. 17 350 T CH1 frag. 17 372 T CH1 frag. 18 164 T CH1 frag. 18 232 C —H1 frag. 18 330 A TH1 frag. 19 350 A CH1 frag. 19 523 — CH1 frag. 20 5 A C

296 (Rana)H1 frag. 10 60 — CH1 frag. 11 7 G TH1 frag. 11 1179 — AH1 frag. 11 1217 T CH1 frag. 13 168 C AH1 frag. 14 93 T CH1 frag. 17 33 C AH1 frag. 17 58 C AH1 frag. 17 118 T CH1 frag. 18 276 A TH1 frag. 18 654 T CH1 frag. 18 758 T AH1 frag. 19 146 G AH1 frag. 19 181 G AH1 frag. 19 217 A TH1 frag. 19 531 A CH1 frag. 19 596 C T

H1 frag. 19 749 A CH1 frag. 2 389 T CH1 frag. 2 397 C TH1 frag. 20 62 G AH1 frag. 22 61 A GH1 frag. 22 62 G AH1 frag. 23 11 C TH1 frag. 23 96 T CH1 frag. 23 584 — GH1 frag. 23 1834 A —H1 frag. 24 19 C AH1 frag. 3 47 T CH1 frag. 3 266 C AH1 frag. 3 342 G —H1 frag. 4 575 A CH1 frag. 6 229 G —H1 frag. 8 40 A TH1 frag. 8 792 A CH1 frag. 9 315 T —H1 frag. 9 400 A TH1 frag. 9 638 T CH3 frag. 1 117 G Crhod frag. 2 86 A TSIA frag. 2 53 A GSIA frag. 2 59 T CSIA frag. 3 45 T Ctyr frag. 1 25 G Atyr frag. 1 58 C Ttyr frag. 2 41 C Ttyr frag. 2 85 T Atyr frag. 3 22 A Gtyr frag. 3 109 C Ttyr frag. 3 155 A C

314 (Hyloides)28S frag. 2 354 — C28S frag. 2 483 — C28S frag. 3 379 — C28S frag. 3 385 — C28S frag. 3 389 — C28S frag. 3 487 — GH1 frag. 11 1294 T CH1 frag. 12 103 A TH1 frag. 14 208 A TH1 frag. 16 94 T AH1 frag. 16 414 A CH1 frag. 17 54 C AH1 frag. 17 372 T CH1 frag. 18 232 C —H1 frag. 18 322 A CH1 frag. 18 632 — AH1 frag. 18 727 C AH1 frag. 18 782 A TH1 frag. 19 109 C TH1 frag. 19 376 T CH1 frag. 2 154 T CH1 frag. 2 333 — AH1 frag. 20 68 G AH1 frag. 21 251 T CH1 frag. 23 52 C TH1 frag. 23 283 C AH1 frag. 23 559 C AH1 frag. 23 981 T —H1 frag. 23 1131 G —H1 frag. 23 1569 A —H1 frag. 3 258 C AH1 frag. 3 327 — CH1 frag. 4 94 A CH1 frag. 4 529 — CH1 frag. 4 548 A CH1 frag. 4 603 — AH1 frag. 4 637 T AH1 frag. 6 137 C —H1 frag. 8 741 C AH1 frag. 8 828 T AH1 frag. 9 609 C AH1 frag. 9 755 A CH1 frag. 9 788 A CH3 frag. 1 69 G AH3 frag. 1 117 G CH3 frag. 2 5 T C



rhod frag. 2 103 T CSIA frag. 2 66 T CSIA frag. 3 48 G ASIA frag. 3 75 G Atyr frag. 1 7 C Gtyr frag. 1 18 T Atyr frag. 1 55 T Ctyr frag. 1 58 C Ttyr frag. 2 8 T Gtyr frag. 2 195 G Atyr frag. 2 261 T Ctyr frag. 3 25 T Ctyr frag. 3 49 G Atyr frag. 3 98 G C

315 (Sooglossidae)H1 frag. 10 3 A GH1 frag. 10 20 G AH1 frag. 10 26 T CH1 frag. 10 141 — AH1 frag. 11 13 A TH1 frag. 11 144 T CH1 frag. 11 409 T —H1 frag. 11 595 A —H1 frag. 11 663 A CH1 frag. 11 887 A —H1 frag. 11 1000 A —H1 frag. 12 74 T CH1 frag. 12 153 A CH1 frag. 21 155 T CH1 frag. 22 13 C TH1 frag. 23 149 A GH1 frag. 23 236 A GH1 frag. 23 452 C TH1 frag. 23 762 C TH1 frag. 23 1201 G —H1 frag. 23 1225 — AH1 frag. 23 1268 — CH1 frag. 23 1270 A CH1 frag. 23 1295 T CH1 frag. 23 1348 A CH1 frag. 23 1359 G —H1 frag. 23 1444 G AH1 frag. 23 1726 C AH1 frag. 23 1940 T CH1 frag. 8 30 C AH1 frag. 8 59 T CH1 frag. 8 115 — AH1 frag. 8 441 A —H1 frag. 8 523 A TH1 frag. 8 551 A TH1 frag. 8 565 A CH1 frag. 8 583 — CH1 frag. 8 584 — CH1 frag. 8 593 T CH1 frag. 8 598 A CH1 frag. 8 643 A GH1 frag. 8 687 G AH1 frag. 8 726 A CH1 frag. 9 432 T CH1 frag. 9 467 G AH1 frag. 9 579 — TH1 frag. 9 739 A CH1 frag. 9 840 T Arhod frag. 1 60 T Crhod frag. 1 110 C T

318 (Notogaeanura)28S frag. 3 370 G CH1 frag. 1 68 C TH1 frag. 10 43 A —H1 frag. 11 96 T CH1 frag. 11 457 C AH1 frag. 11 1327 T AH1 frag. 13 130 C TH1 frag. 13 159 A TH1 frag. 14 177 C TH1 frag. 16 16 A GH1 frag. 16 25 T CH1 frag. 17 118 G AH1 frag. 18 358 — AH1 frag. 18 628 T C

H1 frag. 18 717 A CH1 frag. 18 741 C GH1 frag. 18 775 T —H1 frag. 19 201 A CH1 frag. 19 729 C AH1 frag. 2 118 C AH1 frag. 20 129 T AH1 frag. 21 90 A —H1 frag. 23 67 G AH1 frag. 23 963 A —H1 frag. 23 1154 A CH1 frag. 23 1607 C TH1 frag. 3 321 G AH1 frag. 4 120 T AH1 frag. 4 148 A CH1 frag. 4 619 — CH1 frag. 4 624 — CH1 frag. 6 169 — CH1 frag. 7 84 A TH1 frag. 8 10 T CH1 frag. 8 369 G CH1 frag. 8 569 A GH1 frag. 8 626 C TH1 frag. 9 71 T AH1 frag. 9 558 A —rhod frag. 1 97 A Trhod frag. 2 42 C GSIA frag. 1 39 C TSIA frag. 3 156 T GSIA frag. 4 55 G Atyr frag. 1 31 C Ttyr frag. 1 43 C Ttyr frag. 2 68 T Ctyr frag. 3 10 C Ttyr frag. 3 50 T Ctyr frag. 3 51 G Ctyr frag. 3 61 G A

319 (Australobatrachia)28S frag. 2 567 C T28S frag. 2 639 G —28S frag. 2 719 C —H1 frag. 1 52 T GH1 frag. 10 250 G AH1 frag. 11 53 T GH1 frag. 11 146 C TH1 frag. 11 671 — TH1 frag. 11 677 — GH1 frag. 11 685 — CH1 frag. 12 153 A —H1 frag. 12 186 A CH1 frag. 12 187 G AH1 frag. 13 74 — AH1 frag. 13 156 T CH1 frag. 14 268 T GH1 frag. 16 266 C —H1 frag. 16 398 A CH1 frag. 16 629 A —H1 frag. 17 333 C AH1 frag. 17 383 A GH1 frag. 18 254 T CH1 frag. 18 378 — CH1 frag. 18 563 A CH1 frag. 18 842 — CH1 frag. 19 531 A CH1 frag. 2 20 C GH1 frag. 2 171 A TH1 frag. 2 218 T AH1 frag. 22 15 A GH1 frag. 23 40 T CH1 frag. 23 602 T CH1 frag. 23 1027 A GH1 frag. 23 1612 — AH1 frag. 23 1796 A CH1 frag. 3 51 G AH1 frag. 3 126 C TH1 frag. 3 370 A TH1 frag. 4 238 — TH1 frag. 4 408 A CH1 frag. 4 504 — AH1 frag. 4 637 A C

H1 frag. 5 9 A GH1 frag. 5 28 G AH1 frag. 6 13 C TH1 frag. 6 43 — CH1 frag. 6 62 A TH1 frag. 8 24 A GH1 frag. 8 177 A GH1 frag. 8 232 A —H1 frag. 8 354 — CH1 frag. 8 580 C TH1 frag. 9 28 A GH1 frag. 9 87 T AH1 frag. 9 124 A GH1 frag. 9 580 C TH1 frag. 9 659 — AH3 frag. 1 81 A CH3 frag. 1 117 C Trhod frag. 2 79 C GSIA frag. 1 21 G ASIA frag. 4 19 A T

320 (Batrachophrynidae)28S frag. 2 354 C —28S frag. 2 386 C —28S frag. 2 505 C —28S frag. 2 655 G —28S frag. 2 671 G —28S frag. 2 692 G —28S frag. 3 332 C —28S frag. 3 370 C —28S frag. 3 385 C G28S frag. 3 424 G —28S frag. 3 487 G —H1 frag. 11 67 C AH1 frag. 11 92 T CH1 frag. 11 144 T CH1 frag. 11 409 T CH1 frag. 11 536 C AH1 frag. 11 684 — CH1 frag. 11 983 T CH1 frag. 11 1129 — CH1 frag. 12 14 C TH1 frag. 12 74 T CH1 frag. 12 143 A TH1 frag. 13 168 A CH1 frag. 14 141 T CH1 frag. 14 144 A GH1 frag. 14 243 A CH1 frag. 15 22 T CH1 frag. 15 27 A GH1 frag. 16 7 A GH1 frag. 16 19 T AH1 frag. 16 191 C TH1 frag. 16 230 — TH1 frag. 16 414 C AH1 frag. 16 505 — GH1 frag. 16 614 T —H1 frag. 16 691 A GH1 frag. 16 696 A GH1 frag. 17 5 T CH1 frag. 17 38 A GH1 frag. 17 54 A CH1 frag. 17 160 C AH1 frag. 17 289 — GH1 frag. 17 296 C TH1 frag. 18 13 A GH1 frag. 18 604 A CH1 frag. 18 648 C TH1 frag. 18 746 T CH1 frag. 18 821 T CH1 frag. 19 3 C TH1 frag. 19 42 A CH1 frag. 19 140 C TH1 frag. 19 155 T CH1 frag. 19 197 A CH1 frag. 19 215 A GH1 frag. 19 350 A GH1 frag. 19 788 A TH1 frag. 20 61 A GH1 frag. 20 68 A GH1 frag. 21 121 — C

H1 frag. 22 23 G AH1 frag. 23 59 G AH1 frag. 23 224 C TH1 frag. 23 452 C TH1 frag. 23 784 — AH1 frag. 23 872 — CH1 frag. 23 874 — CH1 frag. 23 875 — CH1 frag. 23 1097 G AH1 frag. 23 1154 C TH1 frag. 23 1245 C TH1 frag. 23 1316 C TH1 frag. 23 1321 A GH1 frag. 23 1328 G AH1 frag. 23 1351 C TH1 frag. 23 1508 — GH1 frag. 23 1704 C TH1 frag. 23 1776 A GH1 frag. 25 17 T CH1 frag. 25 20 C AH3 frag. 1 42 C GH3 frag. 2 8 G TH3 frag. 2 31 C Trhod frag. 2 15 C Trhod frag. 2 118 T CSIA frag. 1 18 T CSIA frag. 3 60 A GSIA frag. 3 90 C TSIA frag. 3 153 A GSIA frag. 3 165 T CSIA frag. 3 177 A GSIA frag. 3 183 C GSIA frag. 4 13 C GSIA frag. 4 49 T G

321 (Myobatrachoidea)28S frag. 3 93 — C28S frag. 3 297 — C28S frag. 3 575 G CH1 frag. 10 115 C TH1 frag. 10 269 C TH1 frag. 11 7 G AH1 frag. 11 457 A —H1 frag. 11 1017 — AH1 frag. 11 1217 A CH1 frag. 12 160 T CH1 frag. 14 217 A TH1 frag. 14 252 A CH1 frag. 17 437 C AH1 frag. 18 349 C AH1 frag. 18 447 T AH1 frag. 18 514 A CH1 frag. 2 140 C TH1 frag. 23 789 A —H1 frag. 23 883 C —H1 frag. 23 902 C —H1 frag. 23 942 C TH1 frag. 23 1074 T AH1 frag. 23 1334 A CH1 frag. 23 1364 A CH1 frag. 23 1444 G AH1 frag. 23 1554 T CH1 frag. 3 22 C AH1 frag. 4 191 T AH1 frag. 4 280 C TH1 frag. 6 23 C TH1 frag. 8 37 C TH1 frag. 8 40 A TH1 frag. 8 132 T CH1 frag. 8 173 T CH1 frag. 8 274 — AH1 frag. 8 275 — AH1 frag. 8 316 T AH1 frag. 8 726 A CH1 frag. 8 748 A GH1 frag. 9 17 A GH1 frag. 9 54 T CH1 frag. 9 739 A TH3 frag. 1 51 C TH3 frag. 1 111 G Arhod frag. 1 169 A G



SIA frag. 2 62 C GSIA frag. 3 48 A CSIA frag. 3 120 G C

322 (Limnodynastidae)28S frag. 2 129 A G28S frag. 2 330 G C28S frag. 2 354 C T28S frag. 2 442 C G28S frag. 2 692 G A28S frag. 2 790 C A28S frag. 2 797 G A28S frag. 3 8 T C28S frag. 3 53 G A28S frag. 3 74 — A28S frag. 3 75 G C28S frag. 3 134 T G28S frag. 3 187 G —28S frag. 3 478 — G28S frag. 3 586 C G28S frag. 4 130 — TH1 frag. 10 76 A CH1 frag. 11 15 A CH1 frag. 11 1045 A CH1 frag. 11 1135 C AH1 frag. 11 1336 T CH1 frag. 12 52 C TH1 frag. 13 160 — AH1 frag. 14 13 T AH1 frag. 14 64 A CH1 frag. 14 83 A CH1 frag. 14 142 C TH1 frag. 15 15 A CH1 frag. 16 4 C TH1 frag. 16 31 A CH1 frag. 16 106 — TH1 frag. 16 414 C TH1 frag. 16 429 C AH1 frag. 16 683 T CH1 frag. 17 33 A CH1 frag. 17 274 A TH1 frag. 17 350 A CH1 frag. 17 446 C AH1 frag. 18 750 G AH1 frag. 18 756 T CH1 frag. 18 821 T AH1 frag. 18 872 A CH1 frag. 2 198 — AH1 frag. 21 124 A CH1 frag. 23 274 C TH1 frag. 23 1181 C TH1 frag. 23 1607 T CH1 frag. 23 1743 A CH1 frag. 23 1763 T CH1 frag. 23 1940 T AH1 frag. 4 75 — CH1 frag. 4 169 C AH1 frag. 4 408 C TH1 frag. 4 529 C —H1 frag. 7 42 A CH1 frag. 8 545 A CH1 frag. 8 667 C AH1 frag. 9 84 A CH1 frag. 9 173 A Grhod frag. 1 9 T Crhod frag. 1 69 C Trhod frag. 1 90 T Crhod frag. 1 97 T Crhod frag. 1 131 T Grhod frag. 1 137 C Trhod frag. 1 140 A Crhod frag. 2 3 A Grhod frag. 2 66 G Crhod frag. 2 67 T Grhod frag. 2 69 T Arhod frag. 2 93 C Grhod frag. 2 136 T C

334 (Myobatrachidae)H1 frag. 11 27 G AH1 frag. 11 622 C AH1 frag. 11 778 C T

H1 frag. 11 887 A TH1 frag. 12 112 G AH1 frag. 13 125 A CH1 frag. 14 208 T AH1 frag. 16 614 T AH1 frag. 17 107 — GH1 frag. 17 182 T —H1 frag. 17 251 T CH1 frag. 18 322 C TH1 frag. 18 378 C AH1 frag. 18 838 A TH1 frag. 2 32 A GH1 frag. 2 218 A CH1 frag. 2 301 C AH1 frag. 2 407 A TH1 frag. 21 155 T AH1 frag. 23 40 C AH1 frag. 23 236 A GH1 frag. 23 283 A CH1 frag. 23 623 A —H1 frag. 23 1060 C TH1 frag. 23 1226 T CH1 frag. 23 1342 A TH1 frag. 23 1348 A CH1 frag. 23 1627 A TH1 frag. 23 1919 A —H1 frag. 3 108 A CH1 frag. 3 214 T CH1 frag. 4 232 A CH1 frag. 6 167 A —H3 frag. 1 12 C TH3 frag. 1 105 G TSIA frag. 2 44 C GSIA frag. 2 48 T CSIA frag. 4 88 T C

348 (Nobleobatrachia)H1 frag. 1 40 T AH1 frag. 10 101 G AH1 frag. 11 89 C TH1 frag. 11 126 C TH1 frag. 11 439 C —H1 frag. 11 1017 — TH1 frag. 11 1170 — TH1 frag. 12 52 C TH1 frag. 13 97 A TH1 frag. 14 9 G AH1 frag. 14 238 A TH1 frag. 16 36 T —H1 frag. 16 201 T —H1 frag. 16 313 C AH1 frag. 16 359 C TH1 frag. 16 386 — TH1 frag. 16 467 G AH1 frag. 16 487 — AH1 frag. 16 590 A TH1 frag. 16 672 A —H1 frag. 17 58 A TH1 frag. 17 196 — AH1 frag. 18 185 C TH1 frag. 18 514 A —H1 frag. 18 868 A TH1 frag. 18 872 A TH1 frag. 18 883 C TH1 frag. 19 403 C AH1 frag. 19 651 T —H1 frag. 19 749 C TH1 frag. 19 814 — TH1 frag. 2 196 T AH1 frag. 2 301 C —H1 frag. 23 173 — TH1 frag. 23 250 G AH1 frag. 23 283 A TH1 frag. 23 623 A TH1 frag. 23 997 A —H1 frag. 23 1041 T CH1 frag. 23 1181 C AH1 frag. 23 1221 C TH1 frag. 23 1303 C AH1 frag. 23 1342 A TH1 frag. 23 1364 A T

H1 frag. 23 1781 C TH1 frag. 23 1951 A —H1 frag. 23 1962 A TH1 frag. 24 5 T CH1 frag. 24 33 A GH1 frag. 3 108 A TH1 frag. 3 355 A GH1 frag. 4 286 A TH1 frag. 4 346 T CH1 frag. 4 617 — CH1 frag. 6 181 A CH1 frag. 7 24 C —H1 frag. 7 74 G AH1 frag. 8 69 C TH1 frag. 8 281 T CH1 frag. 8 667 C TH1 frag. 9 5 C TH1 frag. 9 52 T CH1 frag. 9 202 C AH1 frag. 9 226 A GH1 frag. 9 506 A CH1 frag. 9 775 C TH1 frag. 9 818 T CH3 frag. 1 45 C TH3 frag. 1 55 C AH3 frag. 1 111 G TH3 frag. 1 114 T AH3 frag. 1 147 A GH3 frag. 1 225 G CH3 frag. 1 243 A GH3 frag. 2 42 C Grhod frag. 1 9 T Crhod frag. 1 12 T Arhod frag. 1 93 A Crhod frag. 1 107 T Grhod frag. 1 128 C Trhod frag. 2 24 C Trhod frag. 2 73 G Arhod frag. 2 82 G Crhod frag. 2 126 C Trhod frag. 2 127 C Grhod frag. 2 129 A TSIA frag. 1 27 A GSIA frag. 2 14 A CSIA frag. 2 44 C GSIA frag. 3 24 C ASIA frag. 3 39 C TSIA frag. 3 42 T CSIA frag. 3 135 G ASIA frag. 3 138 T ASIA frag. 4 1 C TSIA frag. 4 79 T G

349 (Meridianura)H1 frag. 10 199 C TH1 frag. 11 622 C TH1 frag. 11 694 C —H1 frag. 11 927 A —H1 frag. 11 1089 C AH1 frag. 11 1294 C TH1 frag. 12 14 C TH1 frag. 13 8 G AH1 frag. 13 169 — CH1 frag. 14 208 T AH1 frag. 16 152 A TH1 frag. 16 429 C AH1 frag. 16 658 A CH1 frag. 16 683 T AH1 frag. 17 46 A CH1 frag. 17 47 C TH1 frag. 17 182 T AH1 frag. 17 383 A —H1 frag. 18 322 C TH1 frag. 18 358 A TH1 frag. 18 821 T CH1 frag. 19 376 C TH1 frag. 19 668 A TH1 frag. 19 695 C TH1 frag. 19 771 A TH1 frag. 2 171 A CH1 frag. 23 224 C T

H1 frag. 23 568 — TH1 frag. 23 635 — CH1 frag. 23 908 — TH1 frag. 23 1027 A TH1 frag. 23 1627 A CH1 frag. 23 1704 C AH1 frag. 23 1754 A TH1 frag. 24 17 C TH1 frag. 4 169 C AH1 frag. 5 12 A GH1 frag. 6 167 A —H1 frag. 7 96 A CH1 frag. 8 523 A TH1 frag. 8 722 — TH1 frag. 9 93 C TH1 frag. 9 333 C AH1 frag. 9 788 C AH3 frag. 1 3 C TH3 frag. 1 48 A GH3 frag. 1 193 C AH3 frag. 1 195 G Arhod frag. 1 36 A Grhod frag. 1 104 T Crhod frag. 2 118 T C

350 (Brachycephalidae)28S frag. 2 330 G C28S frag. 2 787 G AH1 frag. 11 457 A —H1 frag. 11 1268 C TH1 frag. 12 8 G AH1 frag. 12 163 A —H1 frag. 13 39 A —H1 frag. 14 109 C AH1 frag. 14 129 C TH1 frag. 14 146 A GH1 frag. 14 149 G AH1 frag. 15 54 G AH1 frag. 16 16 G AH1 frag. 16 25 C TH1 frag. 17 231 A —H1 frag. 18 488 T AH1 frag. 18 604 A TH1 frag. 18 830 C TH1 frag. 19 331 G —H1 frag. 19 356 C —H1 frag. 19 439 G —H1 frag. 19 453 A —H1 frag. 19 460 A —H1 frag. 19 635 C TH1 frag. 2 407 A TH1 frag. 21 277 C TH1 frag. 22 53 C TH1 frag. 22 63 G AH1 frag. 23 490 T CH1 frag. 23 1256 T AH1 frag. 23 1348 A TH1 frag. 23 1444 G CH1 frag. 8 148 C TH1 frag. 8 369 C TH1 frag. 8 536 G AH1 frag. 9 545 C —H1 frag. 9 725 C Arhod frag. 1 21 C Trhod frag. 1 51 T Crhod frag. 1 162 T CSIA frag. 3 84 A Ctyr frag. 1 7 G Atyr frag. 1 12 A Ctyr frag. 2 128 G Atyr frag. 2 222 T Ctyr frag. 2 234 C Ttyr frag. 2 266 A Gtyr frag. 3 98 C Ttyr frag. 3 153 A G

358 (Syrrhophus)28S frag. 2 405 — G28S frag. 2 406 — G28S frag. 2 480 — C28S frag. 2 573 — G28S frag. 2 574 — G



28S frag. 2 575 — G28S frag. 2 578 — G28S frag. 2 630 — C28S frag. 3 97 — C28S frag. 3 204 — C28S frag. 3 208 — C28S frag. 3 210 — C28S frag. 3 211 — C28S frag. 3 221 — T28S frag. 3 222 — T28S frag. 3 313 — C28S frag. 3 314 — C28S frag. 3 317 — C28S frag. 3 484 — G28S frag. 3 485 — G28S frag. 4 131 T CH1 frag. 11 57 A —H1 frag. 11 96 C TH1 frag. 11 1191 C TH1 frag. 11 1259 T CH1 frag. 13 33 C TH1 frag. 13 93 — AH1 frag. 13 97 T AH1 frag. 14 51 A GH1 frag. 14 102 T CH1 frag. 15 28 G AH1 frag. 16 191 C AH1 frag. 16 266 C TH1 frag. 16 414 C AH1 frag. 17 52 A TH1 frag. 17 160 C AH1 frag. 17 296 C AH1 frag. 17 407 C TH1 frag. 18 615 C AH1 frag. 18 648 C TH1 frag. 18 707 T AH1 frag. 19 15 A —H1 frag. 19 61 G TH1 frag. 19 91 C AH1 frag. 19 245 — CH1 frag. 19 278 C TH1 frag. 19 695 T AH1 frag. 2 420 A GH1 frag. 21 161 — CH1 frag. 23 102 A TH1 frag. 23 140 T AH1 frag. 23 577 — AH1 frag. 23 623 T AH1 frag. 23 1146 — AH1 frag. 23 1338 C AH1 frag. 23 1451 — GH1 frag. 23 1824 T —H1 frag. 23 1974 C TH1 frag. 24 38 T CH1 frag. 25 90 T CH1 frag. 3 47 C TH1 frag. 4 64 T AH1 frag. 4 343 G AH1 frag. 4 346 C AH1 frag. 8 37 C TH1 frag. 8 62 T CH1 frag. 8 722 T —H1 frag. 9 47 G AH1 frag. 9 51 C TH1 frag. 9 151 — AH1 frag. 9 226 G Arhod frag. 1 9 C Trhod frag. 2 136 T Ctyr frag. 2 105 G Atyr frag. 2 131 T Ctyr frag. 3 73 C Ttyr frag. 3 88 A T

361 (Craugastor)28S frag. 2 240 C T28S frag. 2 262 — T28S frag. 2 264 — G28S frag. 2 490 — G28S frag. 2 491 — T28S frag. 2 584 G —28S frag. 2 671 G C

28S frag. 2 719 C —28S frag. 2 762 — AH1 frag. 10 7 A GH1 frag. 11 40 G —H1 frag. 11 83 — AH1 frag. 11 1113 A CH1 frag. 12 80 A TH1 frag. 12 126 — AH1 frag. 13 69 C AH1 frag. 13 127 A TH1 frag. 13 156 T CH1 frag. 14 208 A —H1 frag. 15 33 A CH1 frag. 16 1 A GH1 frag. 16 450 A TH1 frag. 17 4 A GH1 frag. 17 33 A CH1 frag. 17 274 A TH1 frag. 18 254 C AH1 frag. 18 433 C AH1 frag. 18 821 T AH1 frag. 18 838 A CH1 frag. 19 61 G CH1 frag. 19 123 A TH1 frag. 19 307 A —H1 frag. 19 318 G —H1 frag. 19 338 A —H1 frag. 19 449 C AH1 frag. 2 171 C AH1 frag. 2 187 C TH1 frag. 2 196 A TH1 frag. 20 20 T AH1 frag. 20 54 A TH1 frag. 20 77 A GH1 frag. 23 5 A TH1 frag. 23 24 A TH1 frag. 23 38 T CH1 frag. 23 559 A CH1 frag. 23 823 — TH1 frag. 23 1154 C —H1 frag. 23 1245 T CH1 frag. 23 1322 C TH1 frag. 23 1393 — CH1 frag. 23 1684 T AH1 frag. 3 26 A CH1 frag. 4 526 — GH1 frag. 5 17 C AH1 frag. 6 226 A CH1 frag. 7 9 G AH1 frag. 7 55 C TH1 frag. 7 74 A TH1 frag. 8 369 T CH1 frag. 8 714 A GH1 frag. 9 28 A GH1 frag. 9 49 T CH1 frag. 9 98 T CH1 frag. 9 409 T CH1 frag. 9 652 T CH3 frag. 1 126 T Grhod frag. 1 10 A Grhod frag. 1 12 A Ctyr frag. 1 25 G Atyr frag. 2 62 T Gtyr frag. 2 68 C Ttyr frag. 2 171 T Ctyr frag. 3 38 A Gtyr frag. 3 82 T Ctyr frag. 3 119 C T

366 (Cladophrynia)28S frag. 2 172 — C28S frag. 2 518 — G28S frag. 2 570 — G28S frag. 2 768 C A28S frag. 3 337 — G28S frag. 3 344 — G28S frag. 3 345 — GH1 frag. 11 27 G AH1 frag. 11 53 T GH1 frag. 11 279 — AH1 frag. 11 505 A T

H1 frag. 11 1049 — AH1 frag. 11 1071 C AH1 frag. 13 69 C TH1 frag. 13 82 C AH1 frag. 13 151 C —H1 frag. 16 191 C TH1 frag. 16 386 T AH1 frag. 17 413 — TH1 frag. 18 349 C AH1 frag. 18 654 A —H1 frag. 18 656 G —H1 frag. 18 717 C TH1 frag. 18 732 C TH1 frag. 18 822 — AH1 frag. 18 838 A TH1 frag. 19 808 C AH1 frag. 2 438 T AH1 frag. 22 61 A GH1 frag. 23 316 — CH1 frag. 23 350 — TH1 frag. 23 362 — TH1 frag. 23 379 — CH1 frag. 23 387 — AH1 frag. 23 397 — CH1 frag. 23 762 C AH1 frag. 23 807 — TH1 frag. 23 811 — TH1 frag. 23 1154 C TH1 frag. 23 1329 — TH1 frag. 23 1382 — AH1 frag. 3 20 T AH1 frag. 4 94 C TH1 frag. 4 529 C AH1 frag. 4 617 C AH1 frag. 4 619 C TH1 frag. 6 199 C AH1 frag. 8 37 C TH1 frag. 8 628 C TH1 frag. 8 727 — CH1 frag. 9 48 C TH1 frag. 9 506 C TSIA frag. 1 3 C TSIA frag. 1 21 G Atyr frag. 1 75 T Ctyr frag. 2 207 C Atyr frag. 3 73 C Ttyr frag. 3 181 G T

367 (Cryptobatrachidae)H1 frag. 11 23 T CH1 frag. 11 264 C GH1 frag. 11 713 — TH1 frag. 11 887 A CH1 frag. 11 1333 T CH1 frag. 13 156 T CH1 frag. 13 159 T AH1 frag. 13 163 A CH1 frag. 14 28 C TH1 frag. 15 43 A GH1 frag. 16 398 A TH1 frag. 18 164 T CH1 frag. 18 254 T AH1 frag. 18 325 — AH1 frag. 18 494 C TH1 frag. 19 203 A CH1 frag. 19 286 C TH1 frag. 19 788 A CH1 frag. 20 20 T AH1 frag. 22 15 A GH1 frag. 23 72 C TH1 frag. 23 89 G AH1 frag. 23 173 T AH1 frag. 23 213 A GH1 frag. 23 902 C AH1 frag. 23 908 T CH1 frag. 6 26 A —H1 frag. 8 74 A TH1 frag. 8 122 A CH1 frag. 8 139 C TH1 frag. 8 300 A GH1 frag. 8 544 A T

H1 frag. 8 828 A TH1 frag. 9 791 — T

368 (Tinctanura)28S frag. 2 243 T G28S frag. 2 254 A C28S frag. 2 339 — T28S frag. 2 692 G C28S frag. 3 370 C A28S frag. 3 385 T —28S frag. 3 424 G —H1 frag. 1 36 A GH1 frag. 1 72 C TH1 frag. 11 421 — CH1 frag. 11 541 — TH1 frag. 11 910 C —H1 frag. 11 1113 A TH1 frag. 13 33 C AH1 frag. 16 170 C —H1 frag. 16 298 — TH1 frag. 18 584 — TH1 frag. 18 615 C TH1 frag. 18 628 C TH1 frag. 19 509 C TH1 frag. 19 796 A TH1 frag. 2 184 — TH1 frag. 2 238 C TH1 frag. 2 420 A GH1 frag. 23 48 C TH1 frag. 23 327 — TH1 frag. 23 404 — TH1 frag. 23 416 — TH1 frag. 23 707 — AH1 frag. 23 729 C AH1 frag. 23 1338 C AH1 frag. 23 1518 A CH1 frag. 23 1695 A GH1 frag. 23 1759 T CH1 frag. 23 1828 C AH1 frag. 3 108 T AH1 frag. 3 214 T AH1 frag. 3 355 G TH1 frag. 8 741 A TH1 frag. 9 383 C AH1 frag. 9 580 C TH1 frag. 9 714 — Gtyr frag. 3 128 C T

369 (Amphignathodontidae)H1 frag. 10 86 A TH1 frag. 10 97 T CH1 frag. 10 199 T CH1 frag. 11 126 T CH1 frag. 11 819 C AH1 frag. 11 1000 A —H1 frag. 11 1071 A TH1 frag. 11 1170 T CH1 frag. 11 1248 C TH1 frag. 13 169 C AH1 frag. 14 83 A TH1 frag. 16 382 A CH1 frag. 16 509 A CH1 frag. 17 182 A CH1 frag. 17 196 A CH1 frag. 18 185 T CH1 frag. 18 632 A —H1 frag. 19 338 A —H1 frag. 19 378 — CH1 frag. 19 749 T CH1 frag. 23 173 T GH1 frag. 23 224 T CH1 frag. 23 356 — CH1 frag. 23 815 — AH1 frag. 23 1233 A GH1 frag. 23 1435 — GH1 frag. 23 1657 T CH1 frag. 8 177 A GH1 frag. 8 249 A CH1 frag. 8 470 — CH1 frag. 8 667 T CH1 frag. 9 22 A GH1 frag. 9 281 T A



H1 frag. 9 367 A TH1 frag. 9 708 A Crhod frag. 1 66 T Crhod frag. 1 135 C Trhod frag. 2 80 G Arhod frag. 2 134 C ASIA frag. 3 39 T CSIA frag. 3 144 T Ctyr frag. 1 73 T Atyr frag. 2 98 C Ttyr frag. 2 194 C A

371 (Athesphatanura)28S frag. 2 719 C —28S frag. 2 788 — A28S frag. 3 54 A G28S frag. 3 379 C —28S frag. 3 389 C —H1 frag. 11 392 C —H1 frag. 11 565 C AH1 frag. 11 1161 A TH1 frag. 11 1191 C TH1 frag. 14 250 C AH1 frag. 15 42 A GH1 frag. 16 388 — TH1 frag. 16 547 C AH1 frag. 17 118 A —H1 frag. 17 296 C TH1 frag. 17 333 C TH1 frag. 17 407 C AH1 frag. 18 648 C GH1 frag. 18 830 C AH1 frag. 19 147 C TH1 frag. 2 437 C TH1 frag. 21 139 — AH1 frag. 23 379 C AH1 frag. 23 883 C AH1 frag. 23 1359 G AH1 frag. 23 1627 C AH1 frag. 23 1754 T AH1 frag. 4 169 A CH1 frag. 4 286 T AH1 frag. 4 548 C TH1 frag. 8 29 T CH1 frag. 8 281 C TH1 frag. 9 52 C TH1 frag. 9 798 A CH3 frag. 1 168 T Grhod frag. 2 127 G Crhod frag. 2 129 T ASIA frag. 3 84 A Ttyr frag. 1 12 A Ctyr frag. 2 222 T Ctyr frag. 3 88 A G

372 (Hylidae)28S frag. 2 284 T C28S frag. 2 358 — G28S frag. 2 516 — GH1 frag. 12 21 G AH1 frag. 14 64 A TH1 frag. 17 160 C TH1 frag. 17 231 A TH1 frag. 17 437 C TH1 frag. 18 518 — AH1 frag. 18 581 C TH1 frag. 18 616 — CH1 frag. 18 872 T AH1 frag. 19 286 C TH1 frag. 23 397 C TH1 frag. 23 452 C TH1 frag. 23 733 — TH1 frag. 23 811 T AH1 frag. 4 292 A GH1 frag. 4 391 A TH1 frag. 4 619 T AH1 frag. 8 514 C TH1 frag. 8 727 C TH1 frag. 9 46 T AH1 frag. 9 580 T Arhod frag. 2 118 C Trhod frag. 2 147 T A

tyr frag. 2 77 C Ttyr frag. 3 64 A —tyr frag. 3 114 T Atyr frag. 3 127 A T

372 (unnamed taxon)28S frag. 2 312 C G28S frag. 2 453 C T28S frag. 2 537 — T28S frag. 2 757 G A28S frag. 3 281 — T28S frag. 3 370 A T28S frag. 4 131 T C28S frag. 4 138 T GH1 frag. 1 72 T CH1 frag. 11 53 G TH1 frag. 11 393 — TH1 frag. 11 536 C —H1 frag. 11 887 A TH1 frag. 11 1050 — TH1 frag. 11 1071 A TH1 frag. 11 1248 C TH1 frag. 12 139 A TH1 frag. 16 4 C TH1 frag. 17 38 A CH1 frag. 17 47 T AH1 frag. 17 161 — AH1 frag. 18 24 C TH1 frag. 18 322 T CH1 frag. 18 433 C —H1 frag. 18 530 C TH1 frag. 18 604 A TH1 frag. 18 648 G AH1 frag. 18 717 T AH1 frag. 18 750 G AH1 frag. 19 140 C TH1 frag. 2 180 A TH1 frag. 2 184 T CH1 frag. 2 277 A —H1 frag. 2 439 C TH1 frag. 20 7 G AH1 frag. 23 417 — AH1 frag. 23 419 — AH1 frag. 23 490 T AH1 frag. 23 902 C AH1 frag. 23 1337 A TH1 frag. 23 1410 — TH1 frag. 23 1828 A —H1 frag. 24 5 C TH1 frag. 24 33 G AH1 frag. 3 22 A TH1 frag. 3 327 C AH1 frag. 6 199 A CH1 frag. 8 37 T CH1 frag. 8 667 T CH1 frag. 9 281 T CH1 frag. 9 409 A TH1 frag. 9 818 C TH3 frag. 1 T CH3 frag. 1 3 T Crhod frag. 1 90 T Crhod frag. 1 168 C Trhod frag. 1 169 A GSIA frag. 2 59 C TSIA frag. 4 13 C TSIA frag. 4 52 C TSIA frag. 4 67 T Ctyr frag. 1 22 T Gtyr frag. 1 73 T Ctyr frag. 2 14 A Gtyr frag. 2 111 C Ttyr frag. 2 130 A Ttyr frag. 2 141 G Atyr frag. 2 193 C Atyr frag. 2 223 G Atyr frag. 2 224 A Gtyr frag. 2 266 A Gtyr frag. 3 2 C Atyr frag. 3 58 — Gtyr frag. 3 128 T A

tyr frag. 3 161 T Ctyr frag. 3 170 C T

377 (Pelodryadinae)H1 frag. 11 421 C AH1 frag. 11 480 — CH1 frag. 12 103 T AH1 frag. 14 31 T AH1 frag. 17 231 T CH1 frag. 17 337 — AH1 frag. 18 276 A —H1 frag. 18 374 — GH1 frag. 18 766 C TH1 frag. 18 861 A —H1 frag. 19 376 T AH1 frag. 19 695 T AH1 frag. 19 796 T CH1 frag. 2 7 C AH1 frag. 2 133 T —H1 frag. 2 238 T CH1 frag. 20 20 T AH1 frag. 20 23 C AH1 frag. 23 103 T CH1 frag. 23 236 A TH1 frag. 23 400 — AH1 frag. 23 733 T AH1 frag. 23 1245 C TH1 frag. 23 1256 T AH1 frag. 23 1356 A GH1 frag. 23 1444 G AH1 frag. 23 1687 A TH1 frag. 23 1704 A TH1 frag. 3 355 T AH1 frag. 4 148 C AH1 frag. 4 343 G AH1 frag. 6 181 C AH1 frag. 8 441 A TH1 frag. 8 511 G AH1 frag. 8 647 A TH1 frag. 9 256 C —H3 frag. 2 57 C Trhod frag. 1 101 G Atyr frag. 2 68 C Ttyr frag. 2 198 C Gtyr frag. 2 207 A Ctyr frag. 3 63 G Atyr frag. 3 82 T Ctyr frag. 3 93 C Gtyr frag. 3 99 T C

386 (Hylinae)28S frag. 3 187 G C28S frag. 3 344 G C28S frag. 3 487 G CH1 frag. 11 279 A TH1 frag. 12 148 T AH1 frag. 14 93 A TH1 frag. 16 382 A TH1 frag. 16 563 A CH1 frag. 17 182 A —H1 frag. 19 635 C AH1 frag. 21 113 A TH1 frag. 23 365 — CH1 frag. 23 855 — CH1 frag. 23 1687 A GH1 frag. 23 1763 T CH1 frag. 4 386 T AH1 frag. 4 401 T CH1 frag. 4 548 T —H1 frag. 8 582 T CH1 frag. 9 28 A GH1 frag. 9 48 T CH1 frag. 9 343 A CH1 frag. 9 609 A CH3 frag. 2 29 C Trhod frag. 2 16 T CSIA frag. 3 48 A Ttyr frag. 1 76 T Atyr frag. 2 67 T Ctyr frag. 2 225 C Atyr frag. 2 273 T C

tyr frag. 3 62 — Ctyr frag. 3 155 A G

442 (Telmatobiinae)H1 frag. 10 199 T CH1 frag. 11 505 T CH1 frag. 11 887 T CH1 frag. 11 1012 C TH1 frag. 11 1117 — GH1 frag. 11 1266 A CH1 frag. 12 9 C AH1 frag. 12 90 T CH1 frag. 12 148 T CH1 frag. 13 97 T AH1 frag. 13 132 G AH1 frag. 13 156 T CH1 frag. 13 172 C TH1 frag. 13 179 C TH1 frag. 14 93 A CH1 frag. 15 33 A CH1 frag. 15 40 C TH1 frag. 16 21 T AH1 frag. 16 31 A GH1 frag. 16 57 A GH1 frag. 16 152 T CH1 frag. 16 333 A TH1 frag. 16 547 A CH1 frag. 16 590 T CH1 frag. 16 671 T CH1 frag. 17 54 A CH1 frag. 17 81 A TH1 frag. 17 85 A CH1 frag. 17 182 A CH1 frag. 17 255 — AH1 frag. 17 279 T CH1 frag. 18 45 T AH1 frag. 18 615 T CH1 frag. 18 632 A TH1 frag. 18 838 T CH1 frag. 18 887 A TH1 frag. 19 147 T CH1 frag. 19 148 G AH1 frag. 19 201 C AH1 frag. 19 403 A TH1 frag. 19 509 T AH1 frag. 19 729 A CH1 frag. 19 823 C TH1 frag. 21 243 T CH1 frag. 21 251 C AH1 frag. 23 54 A GH1 frag. 23 86 G TH1 frag. 23 182 A GH1 frag. 23 224 T AH1 frag. 23 387 T CH1 frag. 23 903 A TH1 frag. 23 1233 A TH1 frag. 23 1256 T CH1 frag. 23 1337 A TH1 frag. 23 1434 — CH1 frag. 23 1824 T CH1 frag. 23 1825 T CH1 frag. 4 394 — CH1 frag. 8 249 A TH1 frag. 8 727 C TH1 frag. 9 281 T CH1 frag. 9 367 A TH3 frag. 1 6 A GH3 frag. 1 84 G CH3 frag. 1 102 C TH3 frag. 1 124 C AH3 frag. 1 126 T GH3 frag. 1 192 G AH3 frag. 2 66 C Trhod frag. 2 139 T A

424 (Leptodactyliformes)28S frag. 2 190 C —28S frag. 2 202 C —28S frag. 2 203 G —28S frag. 2 243 G —28S frag. 2 518 G —28S frag. 2 519 G —



28S frag. 2 521 G —28S frag. 2 570 G —28S frag. 2 584 G —28S frag. 2 675 C —28S frag. 3 345 G CH1 frag. 1 73 T AH1 frag. 11 421 C AH1 frag. 11 626 — GH1 frag. 11 957 — AH1 frag. 17 279 — TH1 frag. 18 371 A —H1 frag. 18 637 — TH1 frag. 2 210 A GH1 frag. 2 389 T CH1 frag. 2 407 A TH1 frag. 23 404 T AH1 frag. 4 672 C Ttyr frag. 3 22 A G

425 (Diphyabatrachia)28S frag. 2 339 T G28S frag. 2 535 G —28S frag. 3 344 G CH1 frag. 1 57 T AH1 frag. 11 368 A CH1 frag. 11 505 T AH1 frag. 11 819 C AH1 frag. 12 9 C AH1 frag. 15 33 A GH1 frag. 16 127 G AH1 frag. 16 292 A CH1 frag. 16 388 T AH1 frag. 16 487 A —H1 frag. 16 658 C TH1 frag. 17 182 A TH1 frag. 17 413 T CH1 frag. 18 324 — GH1 frag. 18 411 T CH1 frag. 18 494 C —H1 frag. 2 328 T AH1 frag. 23 89 G AH1 frag. 23 381 — CH1 frag. 23 408 — CH1 frag. 23 1461 — AH1 frag. 23 1714 A GH1 frag. 23 1748 T CH1 frag. 4 603 A TH1 frag. 8 57 T CH1 frag. 8 200 A CH1 frag. 8 554 A GH1 frag. 9 633 C —H1 frag. 9 755 C AH1 frag. 9 775 T CSIA frag. 3 90 C Ttyr frag. 3 161 T C

426 (Centrolenidae)H1 frag. 1 22 G AH1 frag. 11 92 T CH1 frag. 11 634 — TH1 frag. 11 1017 T —H1 frag. 11 1049 A CH1 frag. 11 1191 T CH1 frag. 11 1327 A CH1 frag. 12 80 A CH1 frag. 13 55 A TH1 frag. 13 168 A CH1 frag. 18 209 A GH1 frag. 18 254 T AH1 frag. 18 322 T CH1 frag. 18 629 — AH1 frag. 18 637 T AH1 frag. 19 203 A CH1 frag. 19 729 A CH1 frag. 23 103 T CH1 frag. 23 792 — TH1 frag. 23 908 T —H1 frag. 23 1154 T AH1 frag. 23 1607 T AH1 frag. 23 1798 T AH1 frag. 25 22 A GH1 frag. 3 26 T C

H1 frag. 3 384 T CH1 frag. 5 9 A GH1 frag. 6 25 T CH1 frag. 8 40 T AH1 frag. 9 281 T CH1 frag. 9 333 A Crhod frag. 1 93 C Trhod frag. 1 107 G Arhod frag. 1 171 C Arhod frag. 2 79 C Trhod frag. 2 92 A Trhod frag. 2 103 C Trhod frag. 2 109 C Trhod frag. 2 118 C TSIA frag. 3 126 C TSIA frag. 4 73 G A

427 (Centroleninae)H1 frag. 10 93 A GH1 frag. 10 266 C TH1 frag. 11 12 G AH1 frag. 11 146 C TH1 frag. 11 953 C AH1 frag. 11 1116 — CH1 frag. 12 132 — CH1 frag. 12 187 G AH1 frag. 14 64 A CH1 frag. 14 83 A CH1 frag. 16 21 T AH1 frag. 16 25 C TH1 frag. 16 565 — CH1 frag. 17 16 C AH1 frag. 17 47 T CH1 frag. 17 54 A CH1 frag. 17 103 T CH1 frag. 17 251 T —H1 frag. 17 279 T CH1 frag. 17 333 T CH1 frag. 17 407 A TH1 frag. 17 446 T AH1 frag. 18 52 A TH1 frag. 18 411 C AH1 frag. 18 553 — CH1 frag. 18 866 A GH1 frag. 18 868 T AH1 frag. 19 124 — CH1 frag. 19 356 C TH1 frag. 19 496 T CH1 frag. 19 673 — AH1 frag. 19 788 A TH1 frag. 19 808 A GH1 frag. 2 238 T CH1 frag. 2 308 — CH1 frag. 2 360 T AH1 frag. 20 1 A CH1 frag. 21 113 A TH1 frag. 23 350 T CH1 frag. 23 387 T AH1 frag. 23 811 T CH1 frag. 23 854 A CH1 frag. 23 1027 T CH1 frag. 23 1074 T AH1 frag. 23 1627 A CH1 frag. 23 1687 A TH1 frag. 23 1743 A CH1 frag. 23 1750 T CH1 frag. 23 1754 A CH1 frag. 23 1763 T CH1 frag. 4 67 — CH1 frag. 4 232 A TH1 frag. 4 386 T GH1 frag. 4 391 A CH1 frag. 4 499 T CH1 frag. 4 672 T CH1 frag. 6 181 C AH1 frag. 7 84 T CH1 frag. 8 28 A CH1 frag. 8 120 — AH1 frag. 9 31 C AH1 frag. 9 343 A CH1 frag. 9 432 T A

H1 frag. 9 506 T AH1 frag. 9 511 T Arhod frag. 1 9 C Trhod frag. 1 169 A G

430 (Leptodactylidae)28S frag. 2 187 A G28S frag. 2 284 T C28S frag. 2 671 G C28S frag. 3 115 T AH1 frag. 11 421 A TH1 frag. 11 762 A CH1 frag. 11 957 A CH1 frag. 12 21 G AH1 frag. 13 82 A TH1 frag. 15 50 A CH1 frag. 16 563 A CH1 frag. 18 433 C TH1 frag. 18 542 — CH1 frag. 18 615 T AH1 frag. 19 201 C AH1 frag. 19 403 A TH1 frag. 19 496 T AH1 frag. 19 544 — TH1 frag. 21 155 T —H1 frag. 23 224 T CH1 frag. 23 807 T —H1 frag. 23 1321 G AH1 frag. 23 1825 T CH1 frag. 4 223 A TH1 frag. 5 17 C AH1 frag. 6 81 A TH1 frag. 9 739 A TH1 frag. 9 798 C TH3 frag. 1 108 A Trhod frag. 2 126 T C

436 (Leptodactylus)28S frag. 2 488 — G28S frag. 2 505 C G28S frag. 3 219 — T28S frag. 3 337 G CH1 frag. 1 57 G TH1 frag. 1 73 A TH1 frag. 10 125 — AH1 frag. 11 415 — AH1 frag. 11 595 A TH1 frag. 11 626 G TH1 frag. 11 722 — TH1 frag. 11 887 A TH1 frag. 11 1017 T —H1 frag. 11 1170 T AH1 frag. 12 60 A TH1 frag. 14 83 A CH1 frag. 14 89 T CH1 frag. 16 16 A GH1 frag. 16 691 A GH1 frag. 17 4 A GH1 frag. 17 5 T CH1 frag. 17 52 A TH1 frag. 17 333 T CH1 frag. 17 350 A GH1 frag. 18 209 A GH1 frag. 18 474 A TH1 frag. 18 530 C AH1 frag. 18 707 T AH1 frag. 18 822 A TH1 frag. 19 668 T —H1 frag. 19 771 T AH1 frag. 2 389 C TH1 frag. 21 139 C TH1 frag. 23 312 — CH1 frag. 23 379 A TH1 frag. 23 416 T AH1 frag. 23 795 C AH1 frag. 23 854 A CH1 frag. 23 927 — AH1 frag. 23 1627 A CH1 frag. 23 1717 A GH1 frag. 4 22 A TH1 frag. 4 64 T AH1 frag. 4 94 T G

H1 frag. 4 271 T CH1 frag. 4 386 T AH1 frag. 4 434 A GH1 frag. 7 84 T AH1 frag. 8 200 C —H1 frag. 8 544 A TH1 frag. 9 652 T AH3 frag. 2 36 G Crhod frag. 1 104 C Grhod frag. 1 169 A Grhod frag. 2 42 G Atyr frag. 2 136 G Ttyr frag. 2 141 G Atyr frag. 2 183 C Ttyr frag. 3 14 G Ttyr frag. 3 67 T Ctyr frag. 3 93 C G

440 (Chthonobatrachia)H1 frag. 11 315 A CH1 frag. 11 631 — AH1 frag. 11 887 A TH1 frag. 13 55 A CH1 frag. 14 64 A CH1 frag. 18 530 C TH1 frag. 23 96 A TH1 frag. 23 173 T AH1 frag. 23 335 — AH1 frag. 23 903 — AH1 frag. 23 1245 C TH1 frag. 3 58 C TH3 frag. 1 162 G CH3 frag. 1 174 T GH3 frag. 2 42 G CSIA frag. 3 84 T CSIA frag. 4 70 T Ctyr frag. 2 273 T C

441 (Ceratophryidae)28S frag. 2 172 C —28S frag. 2 567 C —28S frag. 3 344 G T28S frag. 3 487 G —H1 frag. 1 68 T CH1 frag. 10 217 T AH1 frag. 11 16 A GH1 frag. 11 778 A TH1 frag. 11 1049 A TH1 frag. 17 103 T AH1 frag. 17 210 T AH1 frag. 17 254 — AH1 frag. 17 335 — AH1 frag. 18 13 A GH1 frag. 18 256 — GH1 frag. 18 276 A TH1 frag. 18 349 A TH1 frag. 18 488 T AH1 frag. 18 606 — CH1 frag. 19 376 T AH1 frag. 19 753 — AH1 frag. 23 100 A TH1 frag. 23 102 A TH1 frag. 23 409 — TH1 frag. 23 464 — TH1 frag. 23 811 T AH1 frag. 3 214 A GH1 frag. 3 384 T CH1 frag. 6 115 A TH1 frag. 8 93 C TH1 frag. 9 708 A CH1 frag. 9 798 C TH3 frag. 1 108 A TH3 frag. 1 129 G A

444 (Ceratophryinae)28S frag. 2 187 A —H1 frag. 11 264 C AH1 frag. 11 290 — TH1 frag. 11 368 A TH1 frag. 11 421 A TH1 frag. 13 163 A TH1 frag. 15 56 T CH1 frag. 16 388 T A



H1 frag. 18 539 A CH1 frag. 19 286 C TH1 frag. 20 7 G AH1 frag. 23 452 C AH1 frag. 23 1154 T CH1 frag. 23 1338 A TH1 frag. 23 1554 T AH1 frag. 23 1754 A TH1 frag. 4 202 — AH1 frag. 6 181 C AH1 frag. 9 580 T CH3 frag. 1 3 T CH3 frag. 2 57 C TSIA frag. 3 141 C T

445 (Batrachylini)28S frag. 2 330 G A28S frag. 2 339 T C28S frag. 2 714 G —28S frag. 3 295 — C28S frag. 3 353 — A28S frag. 3 354 — A28S frag. 3 416 C A28S frag. 3 453 C AH1 frag. 1 57 T AH1 frag. 11 72 C TH1 frag. 11 953 C TH1 frag. 11 1217 A —H1 frag. 12 52 T CH1 frag. 12 153 A TH1 frag. 13 39 A TH1 frag. 13 55 C TH1 frag. 13 159 T AH1 frag. 14 28 C AH1 frag. 14 238 T AH1 frag. 16 535 C AH1 frag. 17 168 — TH1 frag. 17 296 T AH1 frag. 17 413 T CH1 frag. 18 433 C AH1 frag. 18 491 — CH1 frag. 18 530 T CH1 frag. 18 563 A CH1 frag. 18 637 T —H1 frag. 18 830 A GH1 frag. 19 278 C AH1 frag. 19 596 C TH1 frag. 21 139 A TH1 frag. 22 61 G AH1 frag. 23 794 — CH1 frag. 23 908 T —H1 frag. 23 1060 C TH1 frag. 23 1329 T AH1 frag. 4 191 T AH1 frag. 4 211 A CH1 frag. 4 403 — AH1 frag. 4 672 T CH1 frag. 6 26 A CH1 frag. 6 62 A TH1 frag. 7 19 G AH1 frag. 8 511 G AH1 frag. 9 755 C Trhod frag. 1 96 C Trhod frag. 1 99 T Arhod frag. 2 6 C Grhod frag. 2 93 C Grhod frag. 2 126 T GSIA frag. 1 3 T CSIA frag. 3 126 C TSIA frag. 3 168 A C

446 (Ceratophyrini)28S frag. 2 182 C T28S frag. 2 283 — T28S frag. 2 671 G T28S frag. 2 788 A —28S frag. 2 790 T C28S frag. 3 54 G A28S frag. 3 344 T —28S frag. 3 370 A —28S frag. 3 577 — CH1 frag. 1 41 A G

H1 frag. 11 36 T CH1 frag. 11 778 T —H1 frag. 11 1170 T AH1 frag. 12 74 A TH1 frag. 13 8 A GH1 frag. 14 31 T CH1 frag. 14 250 A CH1 frag. 15 33 A GH1 frag. 16 221 A TH1 frag. 16 266 A TH1 frag. 16 292 A TH1 frag. 16 509 A CH1 frag. 16 576 C TH1 frag. 17 47 T CH1 frag. 18 494 C AH1 frag. 18 628 T AH1 frag. 18 717 T CH1 frag. 18 761 T AH1 frag. 19 271 C TH1 frag. 19 376 A CH1 frag. 2 277 A GH1 frag. 25 22 A GH1 frag. 25 40 T CH1 frag. 3 258 A TH1 frag. 3 376 — CH1 frag. 3 391 T CH1 frag. 4 169 C AH1 frag. 4 415 — GH1 frag. 4 499 T CH1 frag. 6 81 A CH1 frag. 6 213 A CH1 frag. 8 116 T AH1 frag. 9 432 T AH1 frag. 9 633 C —H1 frag. 9 710 — Arhod frag. 1 125 T C

448 (Hesticobatrachia)28S frag. 2 339 T C28S frag. 2 532 — G28S frag. 2 533 — G28S frag. 3 347 — A28S frag. 3 376 — CH1 frag. 11 53 G TH1 frag. 11 72 C TH1 frag. 11 663 A CH1 frag. 13 82 A CH1 frag. 16 292 A TH1 frag. 16 576 C TH1 frag. 17 160 C TH1 frag. 17 350 A —H1 frag. 18 822 A TH1 frag. 19 271 C TH1 frag. 19 356 C TH1 frag. 19 600 C TH1 frag. 2 218 T AH1 frag. 23 105 A TH1 frag. 23 902 C TH1 frag. 23 1669 C TH1 frag. 4 94 T CH1 frag. 4 211 A —H1 frag. 6 25 T CH1 frag. 9 580 T AH1 frag. 9 755 C TSIA frag. 3 39 T CSIA frag. 3 48 A GSIA frag. 3 180 C Ttyr frag. 3 155 A C

449 (Cycloramphidae)H1 frag. 11 852 C TH1 frag. 11 983 T CH1 frag. 12 103 T AH1 frag. 13 33 A —H1 frag. 16 535 C AH1 frag. 17 140 — CH1 frag. 18 276 A —H1 frag. 18 563 A TH1 frag. 19 752 — CH1 frag. 2 328 T —H1 frag. 21 57 A —H1 frag. 23 904 — T

H1 frag. 4 280 C TH3 frag. 2 5 C Trhod frag. 1 60 T Crhod frag. 2 6 C GSIA frag. 3 141 C Ttyr frag. 2 195 A Gtyr frag. 3 65 A Gtyr frag. 3 181 T G

450 (Hylodinae)H1 frag. 11 16 A CH1 frag. 11 457 A TH1 frag. 11 565 A TH1 frag. 12 163 A TH1 frag. 13 6 A —H1 frag. 13 55 C —H1 frag. 14 4 G AH1 frag. 14 38 A CH1 frag. 14 51 A GH1 frag. 15 11 G AH1 frag. 16 191 T CH1 frag. 16 633 — GH1 frag. 16 691 A TH1 frag. 17 296 T CH1 frag. 17 429 A TH1 frag. 18 139 — CH1 frag. 18 191 — CH1 frag. 18 488 T AH1 frag. 19 24 G TH1 frag. 19 42 A TH1 frag. 19 668 T CH1 frag. 19 749 T CH1 frag. 23 72 C TH1 frag. 23 89 G AH1 frag. 23 173 A —H1 frag. 23 318 — TH1 frag. 23 379 A TH1 frag. 23 404 A TH1 frag. 23 416 T AH1 frag. 23 559 A CH1 frag. 23 729 A TH1 frag. 23 1256 T AH1 frag. 23 1444 G —H1 frag. 23 1627 A TH1 frag. 25 30 C TH1 frag. 4 191 T CH1 frag. 4 262 A GH1 frag. 4 441 C AH1 frag. 4 493 C TH1 frag. 4 499 T CH1 frag. 9 367 A TH1 frag. 9 409 A CH1 frag. 9 708 A TH1 frag. 9 775 T AH3 frag. 1 69 C GH3 frag. 1 96 C TH3 frag. 1 111 T AH3 frag. 1 192 G Crhod frag. 1 A Grhod frag. 1 39 A Crhod frag. 1 87 A Grhod frag. 1 97 T Crhod frag. 1 125 T Crhod frag. 2 12 A Grhod frag. 2 16 T Crhod frag. 2 113 G ASIA frag. 3 126 C ASIA frag. 3 129 C TSIA frag. 4 76 T Gtyr frag. 1 76 T Ctyr frag. 2 19 A Gtyr frag. 2 29 C Ttyr frag. 2 44 T Ctyr frag. 2 50 T Ctyr frag. 2 225 C Gtyr frag. 2 266 A Gtyr frag. 3 47 T Gtyr frag. 3 63 G Ctyr frag. 3 73 T Ctyr frag. 3 98 C T

452 (Cycloramphinae)H1 frag. 11 368 A CH1 frag. 11 663 C —H1 frag. 11 1095 — TH1 frag. 11 1248 C TH1 frag. 12 160 T AH1 frag. 17 198 — TH1 frag. 18 358 T AH1 frag. 18 451 — AH1 frag. 18 520 — TH1 frag. 19 788 A TH1 frag. 23 1754 A TH1 frag. 4 126 C TH1 frag. 7 6 A TH1 frag. 9 633 C TH3 frag. 1 15 A CH3 frag. 1 108 A Grhod frag. 1 169 A Grhod frag. 2 93 C Gtyr frag. 3 82 T C

453 (Cycloramphini)28S frag. 2 246 G T28S frag. 2 567 C G28S frag. 3 54 G A28S frag. 3 337 G —28S frag. 3 344 G —28S frag. 3 345 C T28S frag. 3 347 A TH1 frag. 11 53 T GH1 frag. 11 541 T AH1 frag. 14 89 T CH1 frag. 16 386 A CH1 frag. 17 140 C TH1 frag. 17 160 T AH1 frag. 17 251 T —H1 frag. 17 372 T AH1 frag. 18 539 A CH1 frag. 19 350 A GH1 frag. 2 342 A CH1 frag. 20 182 T CH1 frag. 21 243 T AH1 frag. 23 10 C TH1 frag. 23 48 T CH1 frag. 23 362 T AH1 frag. 24 19 C AH1 frag. 25 17 T CH1 frag. 3 26 T CH1 frag. 4 94 C TH1 frag. 4 316 C TH1 frag. 4 614 A CH1 frag. 6 27 G AH1 frag. 6 62 A TH1 frag. 8 93 C TH1 frag. 8 122 A TH1 frag. 8 272 T AH1 frag. 8 511 G AH1 frag. 9 618 A CH1 frag. 9 798 C TH3 frag. 1 42 C TH3 frag. 1 99 C TH3 frag. 1 168 G TH3 frag. 1 240 G AH3 frag. 2 42 C G

454 (Alsodini)28S frag. 2 206 — G28S frag. 2 209 — C28S frag. 2 703 — C28S frag. 3 487 G CH1 frag. 11 505 T CH1 frag. 11 1012 C TH1 frag. 11 1049 A TH1 frag. 12 139 A TH1 frag. 14 250 A CH1 frag. 18 474 A TH1 frag. 18 604 A —H1 frag. 18 830 A CH1 frag. 19 376 T GH1 frag. 23 807 T CH1 frag. 23 903 A CH1 frag. 23 1519 — T



H1 frag. 5 9 A GH1 frag. 9 315 A —rhod frag. 2 69 T Crhod frag. 2 139 T ASIA frag. 1 12 T GSIA frag. 1 39 T GSIA frag. 2 8 T CSIA frag. 4 22 G Atyr frag. 2 273 C Ttyr frag. 3 91 A Gtyr frag. 3 140 A Gtyr frag. 3 155 C A

460 (Agastorophrynia)28S frag. 2 330 G —28S frag. 2 494 G C28S frag. 3 232 — G28S frag. 3 283 — T28S frag. 3 284 — T28S frag. 3 289 — C28S frag. 3 371 — CH1 frag. 11 536 C TH1 frag. 11 626 G —H1 frag. 11 1089 A CH1 frag. 13 69 T —H1 frag. 16 241 A CH1 frag. 16 629 A —H1 frag. 17 196 A TH1 frag. 18 234 — TH1 frag. 18 411 T CH1 frag. 18 604 A CH1 frag. 18 615 T AH1 frag. 18 717 T AH1 frag. 19 42 A CH1 frag. 2 88 A TH1 frag. 21 76 A TH1 frag. 23 340 — TH1 frag. 23 1634 — CH1 frag. 23 1952 — AH1 frag. 24 1 C TH1 frag. 4 64 T CH1 frag. 4 169 C TH1 frag. 4 447 A GH1 frag. 6 163 C TH1 frag. 8 272 T CH1 frag. 8 511 G Arhod frag. 2 126 T GSIA frag. 1 39 T CSIA frag. 3 138 A CSIA frag. 3 168 A Ctyr frag. 1 23 T Atyr frag. 1 49 G Ctyr frag. 1 75 C T

461 (Dendrobatoidea)H1 frag. 11 279 A CH1 frag. 11 413 — CH1 frag. 11 509 — AH1 frag. 11 1000 A —H1 frag. 11 1071 A CH1 frag. 12 21 G AH1 frag. 12 74 A TH1 frag. 14 93 A TH1 frag. 14 208 A TH1 frag. 15 33 A CH1 frag. 15 56 T CH1 frag. 16 535 C TH1 frag. 16 683 A TH1 frag. 18 641 — CH1 frag. 18 830 A TH1 frag. 19 146 G AH1 frag. 19 147 T CH1 frag. 19 148 G TH1 frag. 19 203 A CH1 frag. 19 286 C TH1 frag. 2 223 A TH1 frag. 23 25 T CH1 frag. 23 199 A TH1 frag. 23 213 A GH1 frag. 23 452 C —H1 frag. 23 521 A —H1 frag. 23 568 T —

H1 frag. 23 635 C —H1 frag. 23 693 A —H1 frag. 23 698 G —H1 frag. 23 942 T CH1 frag. 23 1245 T CH1 frag. 23 1554 T AH1 frag. 24 19 C AH1 frag. 4 94 C AH1 frag. 4 265 G AH1 frag. 4 392 — CH1 frag. 4 484 C TH1 frag. 5 8 — GH1 frag. 5 16 A —H1 frag. 6 23 C TH1 frag. 8 122 A CH1 frag. 8 260 C TH1 frag. 8 369 C TH1 frag. 8 545 A TH1 frag. 9 432 T —H1 frag. 9 672 A TH1 frag. 9 755 T AH1 frag. 9 775 T CH3 frag. 1 162 C GH3 frag. 2 42 C G

469 (Bufonidae)28S frag. 2 172 C —28S frag. 2 312 C —28S frag. 2 613 G —28S frag. 2 639 G —28S frag. 2 655 G —28S frag. 2 769 A C28S frag. 3 76 — T28S frag. 3 87 — C28S frag. 3 347 A GH1 frag. 1 41 A GH1 frag. 10 101 A GH1 frag. 11 27 A GH1 frag. 11 88 T CH1 frag. 11 89 T CH1 frag. 11 827 — TH1 frag. 11 830 — AH1 frag. 11 1170 T CH1 frag. 12 9 C AH1 frag. 13 29 T AH1 frag. 14 193 T AH1 frag. 14 238 T CH1 frag. 16 152 T —H1 frag. 16 382 A TH1 frag. 16 485 T AH1 frag. 17 372 T AH1 frag. 17 410 — TH1 frag. 19 28 — AH1 frag. 19 201 C AH1 frag. 2 14 A CH1 frag. 2 133 T AH1 frag. 2 218 A CH1 frag. 20 7 G AH1 frag. 23 96 T AH1 frag. 23 421 — AH1 frag. 23 1342 T CH1 frag. 23 1714 A GH1 frag. 23 1748 T CH1 frag. 3 394 — CH1 frag. 4 191 T CH1 frag. 4 548 T CH1 frag. 8 33 C AH1 frag. 8 562 G AH1 frag. 8 727 C AH3 frag. 1 114 A CH3 frag. 1 129 G Arhod frag. 1 85 A Crhod frag. 2 3 A Grhod frag. 2 9 A Grhod frag. 2 42 G Crhod frag. 2 51 T CSIA frag. 3 171 G C

476 (Rhaebo)28S frag. 2 466 — T28S frag. 2 505 C GH1 frag. 10 269 C T

H1 frag. 11 7 G AH1 frag. 11 126 T CH1 frag. 11 1166 — GH1 frag. 12 9 A CH1 frag. 12 160 T GH1 frag. 14 4 G AH1 frag. 14 144 A GH1 frag. 14 177 T CH1 frag. 15 22 T CH1 frag. 16 21 A TH1 frag. 16 298 T AH1 frag. 16 382 T AH1 frag. 16 535 C TH1 frag. 17 196 T CH1 frag. 17 413 T GH1 frag. 18 52 A TH1 frag. 19 123 A CH1 frag. 19 449 T AH1 frag. 19 542 C TH1 frag. 2 437 T AH1 frag. 23 50 C TH1 frag. 23 776 — AH1 frag. 23 1711 A CH1 frag. 23 1793 T CH1 frag. 3 20 A TH1 frag. 3 299 T CH1 frag. 3 391 T —H1 frag. 4 316 C TH1 frag. 4 373 G AH1 frag. 4 386 T AH1 frag. 4 461 A CH1 frag. 4 603 C TH1 frag. 6 34 G AH1 frag. 8 161 T CH1 frag. 8 488 T AH1 frag. 8 601 — CH1 frag. 8 628 T —H1 frag. 8 647 A GH1 frag. 8 721 C TH1 frag. 8 809 G AH1 frag. 9 315 A —H1 frag. 9 321 T CH1 frag. 9 714 A CH3 frag. 1 111 T AH3 frag. 1 162 C GH3 frag. 1 213 C Trhod frag. 1 102 G Trhod frag. 2 79 C T

491 (Ingerophrynus)H1 frag. 2 20 T CH1 frag. 2 323 — CH1 frag. 23 387 A TH1 frag. 23 1097 G AH1 frag. 23 1796 A CH1 frag. 23 1828 C AH1 frag. 4 264 A GH1 frag. 4 401 T —H1 frag. 4 489 T CH1 frag. 8 232 C TH1 frag. 8 249 A TH1 frag. 8 260 A CH1 frag. 8 313 C TH1 frag. 8 523 C TH1 frag. 8 735 C TH1 frag. 9 321 T —

499 (Bufo)H1 frag. 1 71 A CH1 frag. 11 31 T CH1 frag. 11 1259 T CH1 frag. 13 7 T —H1 frag. 13 14 A —H1 frag. 13 121 T CH1 frag. 13 193 T CH1 frag. 14 208 A GH1 frag. 15 33 C TH1 frag. 16 19 C TH1 frag. 16 96 — GH1 frag. 16 308 — AH1 frag. 16 648 T CH1 frag. 18 24 T C

H1 frag. 18 79 A TH1 frag. 18 109 T AH1 frag. 18 237 T AH1 frag. 18 254 C AH1 frag. 18 349 A GH1 frag. 18 571 T CH1 frag. 18 868 A TH1 frag. 19 145 A CH1 frag. 19 181 G AH1 frag. 19 203 A GH1 frag. 19 209 C TH1 frag. 19 771 C TH1 frag. 19 808 A GH1 frag. 2 88 T CH1 frag. 2 171 T CH1 frag. 21 133 C TH1 frag. 22 55 T CH1 frag. 23 224 T CH1 frag. 23 274 C TH1 frag. 23 283 T CH1 frag. 23 335 A CH1 frag. 23 416 T CH1 frag. 23 421 A TH1 frag. 23 789 C —H1 frag. 23 811 T AH1 frag. 23 902 T CH1 frag. 23 1074 A GH1 frag. 23 1154 A GH1 frag. 23 1233 A GH1 frag. 23 1245 T CH1 frag. 23 1256 A GH1 frag. 23 1364 T CH1 frag. 23 1607 T AH1 frag. 23 1940 T CH1 frag. 24 12 G AH1 frag. 6 169 C —H1 frag. 8 461 — AH1 frag. 9 46 T Crhod frag. 1 94 G Arhod frag. 1 128 T Arhod frag. 2 79 C Grhod frag. 2 113 G Arhod frag. 2 116 T Crhod frag. 2 129 T Crhod frag. 2 130 A C

506 (Amietophrynus)H1 frag. 23 17 A GH1 frag. 23 1337 C TH1 frag. 23 1554 T AH1 frag. 23 1739 C AH1 frag. 23 1781 T CH1 frag. 23 1798 T CH1 frag. 23 1973 T GH1 frag. 6 199 A TH1 frag. 8 562 A G

513 (Anaxyrus)H1 frag. 1 40 A GH1 frag. 11 887 T CH1 frag. 11 1089 C TH1 frag. 11 1235 — AH1 frag. 14 193 A TH1 frag. 14 208 A TH1 frag. 16 99 C TH1 frag. 16 221 A TH1 frag. 16 648 T CH1 frag. 17 333 A CH1 frag. 18 741 A CH1 frag. 19 376 A CH1 frag. 19 668 T CH1 frag. 23 103 A TH1 frag. 23 1214 A TH1 frag. 3 108 C AH1 frag. 7 39 T CH1 frag. 7 84 T CH1 frag. 7 96 C AH1 frag. 8 313 C TH1 frag. 8 523 C Trhod frag. 2 80 G A



519 (Cranopsis)H1 frag. 11 1161 T AH1 frag. 12 148 A GH1 frag. 12 186 C AH1 frag. 14 93 A TH1 frag. 16 221 A CH1 frag. 16 648 T AH1 frag. 16 678 C AH1 frag. 17 333 A TH1 frag. 17 372 A TH1 frag. 17 411 — TH1 frag. 18 322 C AH1 frag. 18 539 T AH1 frag. 18 581 A TH1 frag. 18 707 C TH1 frag. 18 732 C TH1 frag. 2 88 T AH1 frag. 21 139 T CH1 frag. 23 1074 A TH1 frag. 23 1181 A TH1 frag. 3 130 T CH1 frag. 4 452 A GH1 frag. 4 672 C TH1 frag. 8 69 T CH1 frag. 8 735 T CH1 frag. 9 708 A T

522 (Chaunus)28S frag. 2 453 C TH1 frag. 11 1170 C TH1 frag. 13 8 T AH1 frag. 14 193 A GH1 frag. 16 127 T CH1 frag. 16 590 A GH1 frag. 17 310 — CH1 frag. 20 23 C TH1 frag. 21 76 A CH1 frag. 23 224 T CH1 frag. 23 335 A —H1 frag. 23 362 C —H1 frag. 23 397 C AH1 frag. 23 888 — CH1 frag. 23 1233 A GH1 frag. 23 1321 G AH1 frag. 23 1973 A CH1 frag. 4 246 A TH1 frag. 6 181 C TH1 frag. 8 444 — AH1 frag. 9 43 C Arhod frag. 1 51 T C

Amolops/Amolops hongkongensisH1 frag. 10 55 A —H1 frag. 11 86 A —H1 frag. 11 89 C —H1 frag. 11 91 A —H1 frag. 11 92 T —H1 frag. 11 95 T —H1 frag. 11 96 T —H1 frag. 11 120 G —H1 frag. 11 130 T —H1 frag. 11 134 A —H1 frag. 11 138 A —H1 frag. 11 139 A —H1 frag. 11 146 C —H1 frag. 11 155 A —H1 frag. 11 160 G —H1 frag. 11 213 C —H1 frag. 11 230 C —H1 frag. 11 264 C —H1 frag. 11 315 A —H1 frag. 11 368 C —H1 frag. 11 409 C —H1 frag. 11 425 A —H1 frag. 11 439 C —H1 frag. 11 505 C —H1 frag. 11 565 C —H1 frag. 11 600 G —H1 frag. 11 622 A —H1 frag. 11 663 A —H1 frag. 11 668 C —H1 frag. 11 852 T —

H1 frag. 11 963 C —H1 frag. 11 983 C —H1 frag. 11 1000 C —H1 frag. 11 1113 G —H1 frag. 11 1135 C —H1 frag. 11 1161 C —H1 frag. 11 1191 C —H1 frag. 11 1232 A —H1 frag. 11 1327 T AH1 frag. 11 1333 T CH1 frag. 12 9 C TH1 frag. 12 103 A TH1 frag. 12 128 C TH1 frag. 12 148 T CH1 frag. 12 173 C TH1 frag. 12 177 G —H1 frag. 12 186 T CH1 frag. 13 82 T CH1 frag. 13 116 C TH1 frag. 13 141 A —H1 frag. 13 167 — TH1 frag. 13 168 C AH1 frag. 13 172 C TH1 frag. 14 12 C TH1 frag. 14 35 A —H1 frag. 14 51 A GH1 frag. 14 63 A GH1 frag. 14 86 C GH1 frag. 14 89 T CH1 frag. 14 102 T CH1 frag. 14 158 C —H1 frag. 14 242 G AH1 frag. 14 260 G TH1 frag. 15 36 T CH1 frag. 15 43 G AH1 frag. 15 50 C TH1 frag. 16 127 T AH1 frag. 16 170 T AH1 frag. 16 266 T AH1 frag. 16 429 C TH1 frag. 16 464 A TH1 frag. 16 535 A TH1 frag. 16 576 C GH1 frag. 16 614 T CH1 frag. 17 20 G AH1 frag. 17 22 T CH1 frag. 17 81 A TH1 frag. 17 231 G AH1 frag. 17 383 T AH1 frag. 17 446 A CH1 frag. 18 79 A GH1 frag. 18 106 — CH1 frag. 18 107 — AH1 frag. 18 108 — AH1 frag. 18 109 T CH1 frag. 18 411 C TH1 frag. 18 447 T AH1 frag. 18 514 T —H1 frag. 18 530 T AH1 frag. 18 628 C TH1 frag. 18 667 — CH1 frag. 18 866 G AH1 frag. 19 24 A TH1 frag. 19 54 T AH1 frag. 19 91 T AH1 frag. 19 148 A TH1 frag. 19 154 A GH1 frag. 19 159 — AH1 frag. 19 203 A CH1 frag. 19 211 A GH1 frag. 19 349 — AH1 frag. 19 453 A —H1 frag. 19 518 T AH1 frag. 19 531 A CH1 frag. 19 578 A TH1 frag. 19 729 C AH1 frag. 19 796 A GH1 frag. 19 819 T CH1 frag. 20 16 T CH1 frag. 20 146 T C

H1 frag. 21 57 A TH1 frag. 21 90 T CH1 frag. 21 218 C TH1 frag. 22 62 G AH1 frag. 23 21 G AH1 frag. 23 24 A GH1 frag. 23 163 C —H1 frag. 23 182 T GH1 frag. 23 199 A —H1 frag. 23 238 T CH1 frag. 23 274 C AH1 frag. 23 942 C AH1 frag. 23 1214 T CH1 frag. 23 1226 T —H1 frag. 23 1256 T CH1 frag. 23 1270 A GH1 frag. 23 1288 T CH1 frag. 23 1342 T CH1 frag. 23 1518 T AH1 frag. 23 1711 C AH1 frag. 23 1726 C TH1 frag. 23 1732 T GH1 frag. 24 24 G AH1 frag. 25 50 T —H1 frag. 6 81 C TH1 frag. 6 163 C TH1 frag. 6 199 C TH1 frag. 7 15 T CH1 frag. 7 91 — TH1 frag. 7 92 C TH1 frag. 8 29 T CH1 frag. 8 109 — TH1 frag. 8 116 C TH1 frag. 8 139 T CH1 frag. 8 159 G AH1 frag. 8 161 A CH1 frag. 8 249 T AH1 frag. 8 344 — GH1 frag. 8 350 — TH1 frag. 8 351 — TH1 frag. 8 387 T AH1 frag. 8 501 — AH1 frag. 8 503 C AH1 frag. 8 514 T CH1 frag. 8 525 C TH1 frag. 8 551 G AH1 frag. 8 626 T CH1 frag. 8 628 T GH1 frag. 8 665 — TH1 frag. 8 696 A GH1 frag. 8 714 A GH1 frag. 8 816 T —H1 frag. 9 66 — TH1 frag. 9 67 C GH1 frag. 9 71 C TH1 frag. 9 81 C TH1 frag. 9 281 A —H1 frag. 9 367 C AH1 frag. 9 467 G AH1 frag. 9 528 — TH1 frag. 9 615 — TH1 frag. 9 652 A —H1 frag. 9 693 C TH1 frag. 9 775 C T

Aquixalus/Aquixalus gracilipesH1 frag. 1 36 A TH1 frag. 1 38 T CH1 frag. 1 72 C TH1 frag. 10 19 A GH1 frag. 10 24 A GH1 frag. 10 43 A —H1 frag. 10 269 C TH1 frag. 11 7 G AH1 frag. 11 31 T CH1 frag. 11 36 T CH1 frag. 11 79 A GH1 frag. 11 86 A GH1 frag. 11 282 — GH1 frag. 11 505 C TH1 frag. 11 819 T A

H1 frag. 11 852 C TH1 frag. 11 933 — CH1 frag. 11 1057 — CH1 frag. 11 1089 T GH1 frag. 11 1232 A CH1 frag. 11 1245 A CH1 frag. 11 1248 A GH1 frag. 11 1333 T CH1 frag. 12 74 T CH1 frag. 12 125 T AH1 frag. 12 153 A GH1 frag. 12 187 G AH1 frag. 13 4 T CH1 frag. 13 33 T CH1 frag. 13 125 A CH1 frag. 13 127 T CH1 frag. 14 9 G AH1 frag. 14 63 A GH1 frag. 14 64 C TH1 frag. 14 65 G AH1 frag. 14 80 — CH1 frag. 14 102 T CH1 frag. 14 238 A GH1 frag. 14 250 C TH1 frag. 15 12 A GH1 frag. 15 15 A TH1 frag. 15 45 C TH1 frag. 15 50 C TH1 frag. 16 8 G AH1 frag. 16 10 A GH1 frag. 16 127 C TH1 frag. 16 201 T CH1 frag. 16 359 C TH1 frag. 16 563 A CH1 frag. 17 23 A TH1 frag. 17 429 A GH1 frag. 18 433 T CH1 frag. 18 494 C TH1 frag. 18 741 C TH1 frag. 18 883 C TH1 frag. 19 54 T AH1 frag. 19 119 A GH1 frag. 19 154 A GH1 frag. 19 197 A CH1 frag. 19 203 A CH1 frag. 19 211 A CH1 frag. 19 213 T CH1 frag. 19 216 T CH1 frag. 19 356 T AH1 frag. 19 514 — TH1 frag. 19 542 A GH1 frag. 19 600 C TH1 frag. 19 612 T CH1 frag. 19 749 A CH1 frag. 2 42 C AH1 frag. 2 328 A CH1 frag. 2 420 A GH1 frag. 2 424 A CH1 frag. 20 1 T CH1 frag. 20 16 T CH1 frag. 21 57 A CH1 frag. 21 76 T CH1 frag. 21 124 A GH1 frag. 21 251 A TH1 frag. 22 10 C AH1 frag. 22 11 C AH1 frag. 22 23 G AH1 frag. 23 559 C AH1 frag. 23 1060 C TH1 frag. 23 1169 C AH1 frag. 23 1181 A CH1 frag. 23 1221 C AH1 frag. 23 1226 T CH1 frag. 23 1316 T CH1 frag. 23 1342 T CH1 frag. 23 1478 A GH1 frag. 23 1607 A GH1 frag. 23 1726 C TH1 frag. 23 1750 T CH1 frag. 23 1865 G A



H1 frag. 23 1882 A TH1 frag. 23 1968 C —H1 frag. 25 17 T CH1 frag. 25 32 G AH1 frag. 3 16 G AH1 frag. 3 20 T AH1 frag. 3 176 A GH1 frag. 3 184 A GH1 frag. 3 342 T AH1 frag. 3 402 T AH1 frag. 4 24 A GH1 frag. 4 26 A GH1 frag. 4 94 T GH1 frag. 4 169 A —H1 frag. 4 274 A GH1 frag. 4 283 T CH1 frag. 4 292 T AH1 frag. 4 298 A GH1 frag. 4 404 C TH1 frag. 4 408 T CH1 frag. 4 461 A GH1 frag. 4 477 T AH1 frag. 4 565 — AH1 frag. 4 627 — TH1 frag. 4 637 C AH1 frag. 4 663 T CH1 frag. 5 5 G AH1 frag. 6 31 C TH1 frag. 6 62 A TH1 frag. 6 81 C TH1 frag. 6 137 C —H1 frag. 6 181 A CH1 frag. 8 37 C GH1 frag. 8 41 T CH1 frag. 8 69 C TH1 frag. 8 97 — TH1 frag. 8 181 A GH1 frag. 8 232 T CH1 frag. 8 321 A GH1 frag. 8 550 G AH1 frag. 8 551 A GH1 frag. 8 569 A —H1 frag. 8 611 A GH1 frag. 8 711 T CH1 frag. 9 5 T AH1 frag. 9 14 A GH1 frag. 9 22 A CH1 frag. 9 46 A CH1 frag. 9 57 T CH1 frag. 9 73 T CH1 frag. 9 367 A TH1 frag. 9 506 A CH1 frag. 9 812 A Grhod frag. 1 21 T Crhod frag. 1 85 A Crhod frag. 1 87 G Arhod frag. 1 104 C Trhod frag. 1 107 C Trhod frag. 2 86 C Arhod frag. 2 97 C Arhod frag. 2 98 C Arhod frag. 2 100 C Grhod frag. 2 113 G Arhod frag. 2 115 A Crhod frag. 2 126 A Crhod frag. 2 130 G A

Duttaphrynus/Bufo melanostictus28S frag. 4 40 G AH1 frag. 1 20 A GH1 frag. 10 86 T AH1 frag. 11 91 A GH1 frag. 11 536 T CH1 frag. 11 622 T —H1 frag. 11 663 T GH1 frag. 11 1009 — CH1 frag. 11 1049 A CH1 frag. 11 1316 A TH1 frag. 12 59 T —H1 frag. 12 153 A CH1 frag. 12 160 T C

H1 frag. 13 33 A CH1 frag. 13 47 T AH1 frag. 13 121 T CH1 frag. 13 159 T AH1 frag. 13 169 C AH1 frag. 14 78 T AH1 frag. 14 166 C TH1 frag. 14 244 G AH1 frag. 15 54 A GH1 frag. 16 1 A TH1 frag. 16 11 A GH1 frag. 16 100 T —H1 frag. 16 127 T —H1 frag. 16 279 — AH1 frag. 16 292 C AH1 frag. 16 398 T AH1 frag. 16 443 — TH1 frag. 16 537 T CH1 frag. 16 590 A TH1 frag. 16 648 A GH1 frag. 16 691 A TH1 frag. 17 372 A GH1 frag. 17 413 T CH1 frag. 18 1 G CH1 frag. 18 83 T AH1 frag. 18 138 A GH1 frag. 18 254 C —H1 frag. 18 357 — CH1 frag. 18 727 C AH1 frag. 18 822 T CH1 frag. 19 54 A CH1 frag. 19 63 — AH1 frag. 19 140 T CH1 frag. 19 195 C TH1 frag. 19 203 A GH1 frag. 19 244 A GH1 frag. 19 403 A TH1 frag. 19 668 T CH1 frag. 2 32 A GH1 frag. 2 63 — TH1 frag. 2 100 A TH1 frag. 2 133 C AH1 frag. 2 184 C AH1 frag. 2 277 G AH1 frag. 2 437 T CH1 frag. 2 439 T CH1 frag. 20 7 A GH1 frag. 20 20 T AH1 frag. 20 129 A CH1 frag. 20 182 T CH1 frag. 21 155 T CH1 frag. 23 87 G AH1 frag. 23 199 C AH1 frag. 23 213 A GH1 frag. 23 359 — TH1 frag. 23 404 A —H1 frag. 23 416 T GH1 frag. 23 623 T CH1 frag. 23 811 T CH1 frag. 23 854 A CH1 frag. 23 912 A TH1 frag. 23 1068 — CH1 frag. 23 1181 A CH1 frag. 23 1245 T CH1 frag. 23 1270 A CH1 frag. 23 1329 C TH1 frag. 23 1554 T GH1 frag. 23 1607 T CH1 frag. 23 1781 T AH1 frag. 23 1793 T GH1 frag. 23 1940 T AH1 frag. 23 1962 C TH1 frag. 3 22 A TH1 frag. 3 26 T CH1 frag. 3 401 — AH1 frag. 4 126 T AH1 frag. 4 169 T GH1 frag. 4 265 G AH1 frag. 4 401 T —H1 frag. 4 408 A G

H1 frag. 4 430 A GH1 frag. 4 447 A GH1 frag. 4 484 C TH1 frag. 4 529 A TH1 frag. 7 74 A GH1 frag. 8 40 T CH1 frag. 8 59 T CH1 frag. 9 367 A GH1 frag. 9 490 — GH3 frag. 1 75 T CH3 frag. 1 138 C TH3 frag. 1 213 C TH3 frag. 2 81 G Crhod frag. 1 42 A Grhod frag. 1 94 G Trhod frag. 1 96 T Grhod frag. 2 69 T Crhod frag. 2 80 A Grhod frag. 2 112 C Trhod frag. 2 118 C Arhod frag. 2 130 A TSIA frag. 2 32 A GSIA frag. 2 53 A CSIA frag. 4 76 T G

Meristogenys/MeristogenysorphnocnemisH1 frag. 10 6 T GH1 frag. 10 80 — CH1 frag. 10 217 T AH1 frag. 11 57 T AH1 frag. 11 79 A GH1 frag. 11 368 C TH1 frag. 11 392 A TH1 frag. 11 446 — TH1 frag. 11 595 A —H1 frag. 11 762 C TH1 frag. 11 819 C TH1 frag. 11 887 C TH1 frag. 11 963 C TH1 frag. 11 983 C TH1 frag. 11 1205 — TH1 frag. 11 1333 T CH1 frag. 12 106 — CH1 frag. 21 133 A TH1 frag. 21 178 C TH1 frag. 22 62 G AH1 frag. 23 299 C TH1 frag. 23 506 — GH1 frag. 23 963 T AH1 frag. 23 1003 — TH1 frag. 23 1015 A CH1 frag. 23 1077 G —H1 frag. 23 1303 A GH1 frag. 23 1342 T CH1 frag. 23 1427 C TH1 frag. 23 1951 T AH1 frag. 24 17 C TH1 frag. 25 20 C AH1 frag. 6 25 C TH1 frag. 6 31 C AH1 frag. 6 62 A TH1 frag. 6 126 — TH1 frag. 6 167 A —H1 frag. 6 181 A TH1 frag. 6 213 C TH1 frag. 7 6 A CH1 frag. 7 78 C TH1 frag. 8 29 T CH1 frag. 8 69 C TH1 frag. 8 85 — CH1 frag. 8 161 A GH1 frag. 8 181 G AH1 frag. 8 352 A GH1 frag. 8 514 T CH1 frag. 8 550 G AH1 frag. 8 553 A GH1 frag. 8 568 T AH1 frag. 8 626 T AH1 frag. 8 714 A GH1 frag. 8 735 A G

H1 frag. 8 748 G CH1 frag. 8 772 — CH1 frag. 8 773 T CH1 frag. 8 796 T CH1 frag. 8 838 C AH1 frag. 9 1 T CH1 frag. 9 22 A GH1 frag. 9 27 A GH1 frag. 9 28 A GH1 frag. 9 48 T CH1 frag. 9 52 T CH1 frag. 9 84 T AH1 frag. 9 90 G AH1 frag. 9 367 C GH1 frag. 9 481 T AH1 frag. 9 507 — TH1 frag. 9 580 C AH1 frag. 9 637 — TH1 frag. 9 672 T AH1 frag. 9 755 T CH1 frag. 9 840 T Crhod frag. 1 45 C T

Opisthodon/Limnodynastes ornatus28S frag. 2 448 — C28S frag. 2 473 T C28S frag. 2 492 — G28S frag. 2 493 — T28S frag. 3 389 C TH1 frag. 1 22 G TH1 frag. 1 33 C TH1 frag. 11 368 C TH1 frag. 11 392 C TH1 frag. 11 409 T GH1 frag. 11 536 C TH1 frag. 11 681 — GH1 frag. 11 682 A TH1 frag. 11 849 — TH1 frag. 11 1079 A —H1 frag. 11 1161 A TH1 frag. 11 1336 C TH1 frag. 12 96 — CH1 frag. 13 91 T CH1 frag. 13 117 C TH1 frag. 13 141 A CH1 frag. 16 382 T AH1 frag. 16 429 C TH1 frag. 16 547 A GH1 frag. 16 654 — GH1 frag. 16 681 C TH1 frag. 17 12 C TH1 frag. 17 38 A GH1 frag. 17 52 A TH1 frag. 17 118 G —H1 frag. 17 160 C AH1 frag. 17 423 G AH1 frag. 18 185 C TH1 frag. 18 377 — TH1 frag. 18 378 A TH1 frag. 18 388 C TH1 frag. 18 411 C AH1 frag. 18 512 — AH1 frag. 18 550 A TH1 frag. 18 563 C AH1 frag. 18 628 T —H1 frag. 18 727 A TH1 frag. 18 767 T CH1 frag. 18 830 C TH1 frag. 18 838 A CH1 frag. 18 861 A GH1 frag. 18 872 C AH1 frag. 18 878 T CH1 frag. 19 119 C TH1 frag. 19 197 A CH1 frag. 19 415 C TH1 frag. 19 439 G TH1 frag. 19 542 C TH1 frag. 19 796 A GH1 frag. 2 16 C TH1 frag. 2 65 T CH1 frag. 2 328 C T



H1 frag. 2 438 A GH1 frag. 20 25 G AH1 frag. 20 115 T CH1 frag. 21 113 A GH1 frag. 23 224 C TH1 frag. 23 547 — AH1 frag. 23 652 — CH1 frag. 23 654 T CH1 frag. 23 693 A GH1 frag. 23 729 C TH1 frag. 23 942 T AH1 frag. 23 1233 G AH1 frag. 3 214 T CH1 frag. 4 169 A CH1 frag. 4 254 C TH1 frag. 4 502 — AH1 frag. 4 503 — AH1 frag. 6 163 C TH3 frag. 1 108 C Trhod frag. 1 3 T Crhod frag. 1 36 A Grhod frag. 2 85 G Arhod frag. 2 94 C TSIA frag. 1 4 T CSIA frag. 1 12 T CSIA frag. 1 21 A GSIA frag. 2 47 C GSIA frag. 2 53 A CSIA frag. 2 71 G CSIA frag. 3 3 A GSIA frag. 3 48 C TSIA frag. 3 69 C GSIA frag. 3 96 G ASIA frag. 3 144 T CSIA frag. 3 156 A GSIA frag. 4 19 T CSIA frag. 4 37 T CSIA frag. 4 67 T C

Phrynoidis/Bufo asperH1 frag. 1 38 A CH1 frag. 1 50 A GH1 frag. 1 57 A TH1 frag. 10 86 T AH1 frag. 10 101 G AH1 frag. 11 23 T CH1 frag. 11 488 — TH1 frag. 11 565 A TH1 frag. 11 887 T CH1 frag. 11 1046 — AH1 frag. 11 1217 T AH1 frag. 11 1232 T CH1 frag. 11 1294 T CH1 frag. 11 1327 T CH1 frag. 11 1336 C TH1 frag. 12 52 T CH1 frag. 12 125 T CH1 frag. 12 143 C TH1 frag. 12 148 A GH1 frag. 13 117 A TH1 frag. 14 35 A CH1 frag. 14 59 A GH1 frag. 14 78 T AH1 frag. 14 90 T CH1 frag. 14 113 T CH1 frag. 16 3 T CH1 frag. 16 19 T AH1 frag. 16 388 A —H1 frag. 16 439 — CH1 frag. 16 547 A TH1 frag. 16 652 — CH1 frag. 17 58 T CH1 frag. 17 333 C GH1 frag. 17 413 T CH1 frag. 17 437 C TH1 frag. 18 24 T CH1 frag. 18 45 T CH1 frag. 18 138 A GH1 frag. 18 570 T CH1 frag. 18 821 A CH1 frag. 18 830 A G

H1 frag. 19 135 A GH1 frag. 19 137 T CH1 frag. 19 231 T CH1 frag. 19 254 A GH1 frag. 19 600 T AH1 frag. 19 662 — CH1 frag. 19 729 A —H1 frag. 19 826 A TH1 frag. 2 73 T CH1 frag. 2 180 T AH1 frag. 2 184 C AH1 frag. 2 218 C AH1 frag. 2 277 A GH1 frag. 2 420 A GH1 frag. 20 7 A GH1 frag. 20 10 T CH1 frag. 21 113 T AH1 frag. 21 133 C AH1 frag. 23 48 T CH1 frag. 23 67 A GH1 frag. 23 100 A CH1 frag. 23 103 A CH1 frag. 23 274 C TH1 frag. 23 623 T CH1 frag. 23 693 T CH1 frag. 23 799 T AH1 frag. 23 902 T CH1 frag. 23 908 T AH1 frag. 23 1041 T CH1 frag. 23 1329 C TH1 frag. 23 1333 T CH1 frag. 23 1356 A GH1 frag. 23 1359 G AH1 frag. 23 1595 — AH1 frag. 23 1643 — AH1 frag. 23 1793 T CH1 frag. 23 1798 T CH1 frag. 23 1828 C TH1 frag. 23 1919 A TH1 frag. 23 1940 T CH1 frag. 23 1962 C AH1 frag. 24 10 A GH1 frag. 24 17 C TH1 frag. 3 22 A CH1 frag. 3 55 G AH1 frag. 3 58 C TH1 frag. 3 124 C AH1 frag. 3 327 C TH1 frag. 3 368 A TH1 frag. 4 239 — CH1 frag. 4 417 — GH1 frag. 4 473 A GH1 frag. 6 27 G AH1 frag. 6 163 A GH1 frag. 8 139 C TH1 frag. 8 177 A CH1 frag. 8 316 T CH1 frag. 8 582 T CH1 frag. 9 47 G AH1 frag. 9 321 T CH1 frag. 9 511 T CH1 frag. 9 672 A CH1 frag. 9 775 A GH3 frag. 1 15 C AH3 frag. 1 69 C GH3 frag. 1 114 C AH3 frag. 1 195 A Grhod frag. 2 42 C TSIA frag. 4 76 T A

Pseudepidalea/Bufo viridis28S frag. 3 133 C AH1 frag. 10 93 A GH1 frag. 10 199 C TH1 frag. 10 217 C AH1 frag. 11 31 T CH1 frag. 11 36 C TH1 frag. 11 79 A TH1 frag. 11 86 A GH1 frag. 11 95 T CH1 frag. 11 1008 — T

H1 frag. 11 1048 — TH1 frag. 11 1049 A TH1 frag. 11 1071 A CH1 frag. 11 1170 C TH1 frag. 11 1248 A TH1 frag. 13 14 A TH1 frag. 13 116 A GH1 frag. 13 156 T CH1 frag. 14 35 A GH1 frag. 14 56 A GH1 frag. 14 193 A GH1 frag. 15 60 T AH1 frag. 16 14 C TH1 frag. 16 40 G AH1 frag. 16 118 — CH1 frag. 16 119 — CH1 frag. 16 127 T CH1 frag. 16 216 — TH1 frag. 16 221 A GH1 frag. 16 311 — CH1 frag. 16 398 T CH1 frag. 16 590 A GH1 frag. 16 671 C TH1 frag. 17 16 C AH1 frag. 17 58 T CH1 frag. 17 210 C AH1 frag. 18 322 C AH1 frag. 18 501 C TH1 frag. 18 604 T AH1 frag. 18 707 C TH1 frag. 18 741 A GH1 frag. 18 822 T AH1 frag. 19 153 A TH1 frag. 19 197 A TH1 frag. 19 376 T CH1 frag. 19 823 C TH1 frag. 2 171 T CH1 frag. 20 23 C AH1 frag. 23 224 T CH1 frag. 23 387 A TH1 frag. 23 421 A TH1 frag. 23 807 A TH1 frag. 23 902 T CH1 frag. 23 1088 G AH1 frag. 23 1233 A GH1 frag. 23 1256 A GH1 frag. 23 1518 A CH1 frag. 23 1793 T CH1 frag. 3 327 C TH1 frag. 4 191 C AH1 frag. 4 223 C AH1 frag. 4 254 C AH1 frag. 4 286 A GH1 frag. 4 452 A TH1 frag. 4 592 A TH1 frag. 4 670 A CH1 frag. 7 6 A TH1 frag. 8 57 T CH1 frag. 8 200 C TH1 frag. 8 232 C AH1 frag. 8 316 T CH1 frag. 8 446 — AH1 frag. 8 554 A GH1 frag. 9 27 G AH1 frag. 9 281 T —H1 frag. 9 618 A GH1 frag. 9 693 A CH3 frag. 1 6 A Grhod frag. 1 3 C Trhod frag. 2 136 C TSIA frag. 1 36 C TSIA frag. 1 42 G CSIA frag. 3 90 C T

Rhinella/Bufo margaritiferH1 frag. 19 151 A TH1 frag. 19 153 A GH1 frag. 19 244 A CH1 frag. 19 307 C TH1 frag. 19 424 G AH1 frag. 19 623 C T

H1 frag. 20 54 A TH1 frag. 21 76 A GH1 frag. 21 133 C TH1 frag. 21 139 C TH1 frag. 23 11 C TH1 frag. 23 25 T CH1 frag. 23 48 T CH1 frag. 23 70 C TH1 frag. 23 103 A CH1 frag. 23 335 A GH1 frag. 23 693 T AH1 frag. 23 1154 A GH1 frag. 23 1181 A GH1 frag. 23 1245 T CH1 frag. 23 1303 T CH1 frag. 23 1322 C TH1 frag. 23 1358 T CH1 frag. 23 1359 G AH1 frag. 23 1427 A CH1 frag. 23 1714 G AH1 frag. 23 1739 A TH1 frag. 23 1748 C TH1 frag. 23 1750 T AH1 frag. 23 1828 C TH1 frag. 8 10 C TH1 frag. 8 93 T CH1 frag. 8 172 T CH1 frag. 8 232 C TH1 frag. 8 268 — CH1 frag. 8 272 T AH1 frag. 8 281 T CH1 frag. 8 298 G AH1 frag. 8 313 C TH1 frag. 8 520 A CH1 frag. 8 544 A TH1 frag. 8 556 T AH1 frag. 8 569 G AH1 frag. 8 611 T CH1 frag. 8 628 T CH1 frag. 8 727 C —H1 frag. 8 787 C TH1 frag. 9 5 C AH1 frag. 9 281 T CH1 frag. 9 362 — CH1 frag. 9 545 C TH1 frag. 9 632 — TH1 frag. 9 633 C TH1 frag. 9 672 A TH1 frag. 9 693 A TH1 frag. 9 714 G AH1 frag. 9 775 A CH1 frag. 9 818 C T

Salamandrinae/SalamandrasalamandraH1 frag. 10 23 A GH1 frag. 10 250 G AH1 frag. 11 86 G AH1 frag. 11 210 — CH1 frag. 11 211 — CH1 frag. 11 212 — AH1 frag. 11 499 — TH1 frag. 11 593 — CH1 frag. 11 818 — TH1 frag. 11 1161 A TH1 frag. 11 1266 C TH1 frag. 11 1342 T AH1 frag. 12 41 T CH1 frag. 12 45 T AH1 frag. 12 59 A CH1 frag. 13 97 A TH1 frag. 13 116 A GH1 frag. 13 168 A CH1 frag. 13 172 C TH1 frag. 14 146 A GH1 frag. 14 238 A GH1 frag. 15 21 T CH1 frag. 15 33 A GH1 frag. 16 8 G AH1 frag. 16 127 T CH1 frag. 16 201 T A



H1 frag. 16 232 — TH1 frag. 16 382 A —H1 frag. 16 509 A TH1 frag. 17 120 T AH1 frag. 17 231 A GH1 frag. 18 121 A —H1 frag. 18 138 A TH1 frag. 18 254 A CH1 frag. 18 276 C TH1 frag. 18 366 C AH1 frag. 18 514 A CH1 frag. 18 563 A TH1 frag. 18 707 C —H1 frag. 18 872 T CH1 frag. 19 42 A GH1 frag. 19 153 A TH1 frag. 19 195 A TH1 frag. 19 203 A CH1 frag. 19 237 A GH1 frag. 19 439 A CH1 frag. 19 715 A CH1 frag. 19 823 C TH1 frag. 20 51 T AH1 frag. 20 107 A GH1 frag. 21 23 C TH1 frag. 21 57 A CH1 frag. 21 90 A TH1 frag. 21 218 C TH1 frag. 21 243 T CH1 frag. 23 54 A TH1 frag. 23 61 G A

H1 frag. 23 70 C TH1 frag. 23 140 T AH1 frag. 23 556 — TH1 frag. 23 920 A GH1 frag. 23 1015 A GH1 frag. 23 1081 A TH1 frag. 23 1088 A TH1 frag. 23 1090 C TH1 frag. 23 1338 A GH1 frag. 23 1752 A GH1 frag. 23 1763 T CH1 frag. 23 1776 A GH1 frag. 24 34 T AH1 frag. 25 16 A GH1 frag. 25 20 A CH1 frag. 7 35 A TH1 frag. 7 78 C TH1 frag. 8 545 T GH1 frag. 8 554 A GH1 frag. 8 562 G AH1 frag. 8 710 A TH1 frag. 8 714 A GH1 frag. 8 792 A —H1 frag. 9 90 G AH1 frag. 9 283 — TH1 frag. 9 284 — TH1 frag. 9 294 — AH1 frag. 9 629 — GH1 frag. 9 633 A TH1 frag. 9 672 A CH1 frag. 9 708 A G

H1 frag. 9 775 A GH1 frag. 9 788 A TH3 frag. 1 37 C TH3 frag. 1 63 C TH3 frag. 1 99 C TH3 frag. 1 105 G CH3 frag. 1 219 C Trhod frag. 1 10 G Arhod frag. 1 78 G Crhod frag. 1 129 C Trhod frag. 1 140 C Trhod frag. 1 153 G Trhod frag. 2 27 C Trhod frag. 2 33 G Crhod frag. 2 39 G Trhod frag. 2 46 G T

StephopaedesH1 frag. 23 22 T CH1 frag. 23 70 C TH1 frag. 23 86 G AH1 frag. 23 102 A TH1 frag. 23 140 T CH1 frag. 23 340 C TH1 frag. 23 362 T —H1 frag. 23 404 A —H1 frag. 23 568 T CH1 frag. 23 762 T CH1 frag. 23 799 A CH1 frag. 23 807 T CH1 frag. 23 917 C AH1 frag. 23 1124 A T

H1 frag. 23 1154 A TH1 frag. 23 1303 T CH1 frag. 23 1321 G AH1 frag. 23 1329 C AH1 frag. 23 1333 T CH1 frag. 23 1358 T CH1 frag. 23 1364 T CH1 frag. 23 1695 G AH1 frag. 23 1732 T CH1 frag. 23 1759 C TH1 frag. 23 1824 T CH1 frag. 24 17 T CH1 frag. 24 19 C AH1 frag. 25 20 C T

VandijkophrynusH1 frag. 22 55 T CH1 frag. 23 5 T CH1 frag. 23 73 C TH1 frag. 23 199 T CH1 frag. 23 557 — CH1 frag. 23 789 C AH1 frag. 23 1071 — TH1 frag. 23 1072 — TH1 frag. 23 1108 T CH1 frag. 23 1181 A CH1 frag. 23 1342 T CH1 frag. 23 1549 — CH1 frag. 23 1627 A TH1 frag. 23 1745 G A


APPENDIX 6

NOMENCLATURAL NOTES

AMPHIBIA: Amphibia in the sense that we use it(Gray, 1825; de Queiroz and Gauthier, 1992; Can-natella and Hillis, 1993) corresponds reasonablyclosely to Lissamphibia of recent authors, al-though our concept excludes all fossil taxa outsideof the living crown group, and is identical to themeaning of the term as used by the vast majorityof scientists in day-to-day discourse. Lissamphi-bia was originally conceived of by Haeckel(1866) to include salamanders and frogs, but spe-cifically excluded caecilians, making it synony-mous with Batrachii Latreille (1800) and Batra-chia of Rafinesque (1814) (which were Latiniza-tions of the French vernacular Batraciens Brong-niart, 1800a; Dubois, 2004b).35 Gadow (1901)subsequently transferred caecilians into his Lis-samphibia, and this concept of the taxon has per-sisted (e.g., Parsons and Williams, 1963), even asthe familiar name ‘‘Amphibia’’ has had its intend-ed meaning concomitantly eroded through its var-iable use for very different concepts of living andfossil groups (e.g., Huxley, 1863; Cope, 1880;Romer, 1933; Milner, 1993; Laurin and Reisz,1997; Laurin, 2002; Ruta et al., 2003). We think,as did de Queiroz and Gauthier (1992) and Can-natella and Hillis (1993), that by restricting thename Amphibia to the best-known group (livingamphibians; the concept of Gray, 1825, not ofLinnaeus, 1758, the latter a heterogeneous taxoncontaining various amphibians and reptiles) willstabilize nomenclature without putting undue re-straint on the formulation of systematic hypothe-ses. Dubois (2004b) has suggested that the nameAmphibia should be attributed to de Blainville(1816). This attribution would require that one ar-bitrarily choose between two uses by de Blainvillein the original paper. On page 107 of his Prod-romus, he uses the term ‘‘Amphybiens’’ as aFrench colloquial equivalent of his equally FrenchNudipelliferes. On page 111, he uses the name‘‘Amphibiens’’ for an order containing solely‘‘Protees et les Sirens’’ (proteids and sirenids),rendering Amphibiens de Blainville a synonym ofPerennibranchia Latreille (1825). We follow deBlainville in his use of the term as a formal taxonname—in other words, as a synonym of Peren-nibranchia Latreille (1825).

Another synonym of Amphibia, as we employit, is Neobatrachii, coined by Sarasin and Sarasin

35 Although in regulated nomenclature the coining ofcertain vernacular (i.e., non-Latinized) names can be re-garded as constituting the coining of a new scientificnames (e.g., Art. 11.7.2; ICZN, 1999), we see no reasonto extend that practice to unregulated nomenclature.

(1890: 245) as a subclass for all living amphibi-ans. If one is unwilling to accept ‘‘Amphibia’’ asrestricted to crown-group amphibians because ofthe rather large paleontological literature constru-ing this term to early tetrapods, then Neobatrachii,unlike Lissamphibia, is the taxonomic name ofchoice because it is untroubled by variable appli-cation (Dubois, 2004b). (It is, however, homony-mous with Neobatrachia Reig, 1958, a taxon offrogs [Dubois, 2004b], so should this become acommunication problem in the future, a new namemust be selected to replace Neobatrachia Reig.)

GYMNOPHIONA AND APODA: The names Apodaand Gymnophiona have been used more-or-lessinterchangeably for the taxon of caecilians for along time. The first use of the name Apoda abovethe family group was by Linnaeus (1758) for agroup of fishes, thereby making all subsequentuses of Apoda above the family group in Am-phibia junior homonyms (although homonymy inabove-family-group nomenclature does not haveagreed-upon procedures to address it, and hom-onymy above the family-group level is consideredby many to be a nonproblem). Oppel (1810) pro-posed the name Apoda explicitly as a family forcaecilians, rendering his use of this name unavail-able for above-family taxonomy under the provi-sions of the current International Code of Zoolog-ical Nomenclature (Dubois, 1984a: 112; ICZN,1999; but see Dubois, 2004b). Fischer von Wald-heim (1813) applied the name as a composite tax-on containing caecilians, amphisbaenians, andsnakes. Merrem (1820) was the first to use thename Apoda, as have many subsequent authors,in the modern sense as an order for caecilians.Dubois (2004b) regarded the homonymy of Apo-da Linnaeus, 1758, and Apoda Merrem, 1820, asgood reason to reject use of Apoda Merrem, 1820.Although there are no rules in unregulated no-menclature, we agree with Dubois (2004b) for aslightly different reason: that the name Apoda hasbeen used—recently—in confusing ways in influ-ential publications. Trueb and Cloutier (1991)considered the name Apoda Merrem, 1820, to ap-ply to the living crown group of caecilians andthe name Gymnophiona to apply to Apoda 1Eocaecilia (a fossil form). Cannatella and Hillis(1993) and S.E. Evans and Sigogneau-Russell(2001) subsequently considered the name Gym-nophiona to apply to the living crown group andthe name Apoda to apply to their Gymnophiona1 Eocaecilia, and Dubois (2005) treated Gym-nophiona as including both the living crowngroup (his epifamily Caecilioidia) and Eocaecilia


(his epifamily Eocaecilioidia). This is problemat-ic, and for this reason we provide the name Par-abatrachia (etymology: para- [Greek: beside, re-sembling] 1 batrachos [Greek: frog, i.e., with ref-erence to Batrachia]) for the taxon composed ofliving caecilians 1 Eocaecilia Jenkins and Walsh,1993. The diagnosis of Parabatrachia is identicalto Gymnophiona, except that limbs are retained(Trueb and Cloutier, 1991).

Gymnophia Rafinesque (1814: 104) is the old-est name available for the living crown-group tax-on, and this was assumed (Dubois, 1984a, 2004b)to have been emended to Gymnophiona by J.Muller (1832: 198), although there is no evidencein Muller’s paper that he was aware of the pub-lication of Rafinesque (1814). It appears that J.Muller (1831) published the name Gymnophidiaas alternative name for his Coeciliae (presumablya subsequent usage of Caeciliae Wagler, 1830) inignorance of Rafinesque’s (1814) earlier paper,and provided the name Gymnophiona J. Muller,1832, as a replacement name for his earlier Gym-nophidia. Gymnophia Rafinesque, 1814, is an ear-lier name, but predominant usage favors Gym-nophiona J. Muller, 1832. Other names that areavailable for this taxon are: (1) Nuda Fitzinger,1826; (2) Caeciliae Wagler, 1830; (3) Gymnophi-dia J. Muller, 1831; and (4) Pseudo-ophidia deBlainville, 1835 (a Latinization of Pseudophidiensde Blainville, 1816). Gymnodermia Rafinesque,1815, is not available for this taxon, having orig-inally been formed as a family-group taxon com-posed of caecilians and amphisbaenians.

BATRACHIA: As a concept, Batrachia extendsfrom Batraciens Brongniart (1800a), a French ver-nacular name for salamanders plus frogs, but spe-cifically excludes caecilians. This was subse-quently Latinized (brought into scientific nomen-clature in our view) by Latreille (1800) as Batra-chii and as Batrachia of Rafinesque (1814). Trueband Cloutier (1991) applied the name Batrachiato the clade composed of salamanders plus frogs,which is, in fact, the original content of the taxonso named (Dubois, 2004b). As early as Merrem(1820) the content of the group called Batrachiawas expanded to include all living amphibians.Other available names for this taxon (in terms ofimplied content), although all junior to BatrachiaLatreille, 1800, are Achelata Fischer von Wald-heim, 1813; Dipnoa Leuckart, 1821; AmphibiaLatreille, 1825; Caducibranchia Berthold, 1827;Astatodipnoa Wagler, 1828; Lissamphibia Haeck-el, 1866; and Paratoidia Gardiner, 1982. Parato-idea de Queiroz and Gauthier, 1992 (an apparentlyincorrect subsequent spelling of Paratoidia Gar-diner, 1982), was defined as Batrachia plus all fos-sil relatives more closely related to Batrachia than

to Gymnophiona, and is therefore not synony-mous.

CAUDATA: Caudata Scopoli (1777) originallyincluded several reptile taxa as well as salaman-ders and clearly referred to a taxon quite differentfrom that with which it is associated today. Du-meril (1806: 94) used the name Caudati as theLatin equivalent of his Urodeles (but as an ex-plicit family and therefore unavailable for use inunregulated nomenclature—contra Dubois,2004b). This was likely a subsequent use of Sco-poli’s Caudata, but redefined, excluding the reptiletaxa, and with a new content. Oppel (1810) usedCaudata in the modern sense of content, but fol-lowed earlier authors in its application as a fam-ily-group taxon, rendering it unavailable for useabove the family-group level (contra Dubois,2004b). Fischer von Waldheim (1813: 58) treatedCaudati as an unranked taxon, above the familygroup, for salamanders and as a synonym of hisUrodeli, and it is this author to whom should beattributed Caudata in the sense that we now useit. Stejneger (1907) used the name Caudata in itsmodern usage, but attributed the name/concept toScopoli.

Urodeles Dumeril (1806), unfortunately, wasalso coined as a family for salamanders and istherefore unavailable for above-family-group no-menclature. It also was not Latinized, althoughsome such family-group and genus-group namesare protected in regulated nomenclature. Fischervon Waldheim (1813) was the first user of thename Caudati as an order, but he applied the nameas a synonym of his Urodeli.

The nomenclatural question here is not one ofpriority. Clearly, Caudata Scopoli does not applyto the taxon of salamanders, and Fischer vonWaldheim (1813) named Urodeli and Caudati assynonyms, with all uses of these names prior toFischer von Waldheim (1813) being applied asfamilies and therefore unavailable under the cur-rent Code. We therefore accept Caudati Fischervon Waldheim (1813), as emended to Caudata, asthe name for crown-group salamanders, becausethis is the usage preferred by most working am-phibian systematists (e.g., Duellman and Trueb,1986).

Trueb and Cloutier (1991) and Cannatella andHillis (1993) applied the name Urodela to thelarger group of fossil and living salamanders. Thiswas a novel application and the first time thatUrodela and Caudata (named originally as objec-tive synonyms) were explicitly construed to applyto different taxa. Should this usage be accepted,the authorship of Urodela in this sense should beattributed to Trueb and Cloutier (1991), who pro-vided both the concept and the underyling diag-


nosis, although the name would be a homonym ofall earlier uses.

Another name of note in this discussion is Gra-dientia, which has had some use for the taxon ofsalamanders, but as originally conceived (Lauren-ti, 1768) the taxon was heterogeneous, containingsalamanders, crocodiles, at least one frog, andseveral lizards (Dubois, 2004b). It was not untilMerrem (1820) that Gradientia was used as anorder for salamanders. But, importantly in ourview, Gradientia does not enjoy any current us-age.

Names that are synonymous with Caudata inour sense (and that of Fischer von Waldheim,1813) are Urodelia Rafinesque, 1815; GradientiaMerrem, 1820 (not Gradientia Laurenti, 1768);Batrachoidei Mayer, 1849; Saurobatrachii Fatio,1872; Mecodonta Wiedersheim, 1877; and Neo-caudata Cannatella and Hillis, 1993 (at least undertheir cladographic definition as applied to our to-pology).

CRYPTOBRANCHOIDEI: Dunn (1922) first recog-nized this monophyletic group as a superfamily,Cryptobranchoidea, which was shortly thereafter(Noble, 1931) regarded as a suborder, albeit re-taining the superfamily name ending. Tamarunov(1964b) first changed the name ending to avoidimplying a regulated superfamily rank, an emen-dation that we follow.

DIADECTOSALAMANDROIDEI: The name Salaman-droidea (as an above-family-group name) hasbeen applied by different authors to several dif-ferent concepts: (1) all salamanders, excludingAmphiuma (Sarasin and Sarasin, 1890); (2) Sala-mandridae 1 Amphiumidae 1 Plethodontidae(Noble, 1931; following Dunn, 1922, who usedthe name as a superfamily for Ambystomatidae[sensu lato], Salamandridae, and Plethodontidae);(3) restricted to the family Salamandridae (Regal,1966; Laurent, 1986 ‘‘1985’’; Dubois, 2005); (4)Salamandridae, Amphiumidae, Plethodontidae,and Brachosauroididae (fossil taxon; Tamarunov,1964b, as Salamandroidei); and (5) all salaman-ders, excluding Sirenidae and Cryptobranchoidea(Duellman and Trueb, 1986).

We could have redefined ‘‘Salamandroidea’’ fora sixth time, this time to include sirenids. Ratherthan do this, and extend the confusion, we providea new name to correspond to a new taxonomicconcept, Diadectosalamandroidei: all salamandersexcluding Cryptobranchoidea.

PERENNIBRANCHIA: Merrem (1820) provided thename Amphipneusta for Hypochthon (5 Proteus)and Siren. Unfortunately, he named this taxon asa tribe, between order and genus, thereby imply-ing under the current International Code of Zoo-logical Nomenclature (ICZN, 1999) that it shouldbe considered to be within the family group and

therefore unavailable for above-family-group no-menclature. Similarly, Rafinesque (1815) coinedthe name Meantia as an explicit family-groupname (and therefore unavailable) for Larvarius (5Proteus), Proteus, Exobranchia (5 Necturus), andSirena (5 Siren). The next oldest name that canbe legitimately construed to attach to this taxon isPerennibranchia Latreille (1825), which wascoined to contain Siren and Proteus. Other avail-able names that are synonyms are Branchiurom-algaei Ritgen, 1828; Dysmolgae Ritgen, 1828; Di-plopneumena Hogg, 1838; ManentibranchiaHogg, 1838; Externibranchia Hogg, 1839b; Bran-chiata Fitzinger, 1843; Ramibranchia A.H.A. Du-meril, 1863; and Perennibranchiata Knauer, 1883.

ANURA: For 60 years (Romer, 1945), Salientiahas been considered to contain the fossil taxonProanura and the extant crown group, Anura. Thisuse has been followed by most workers (e.g., Ta-marunov, 1964a, 1964b; Trueb and Cloutier,1991; Cannatella and Hillis, 1993; Ford and Can-natella, 1993). We accept this usage, although formost of their history the names Salientia and An-ura were used interchangeably. Salientia, as firstcoined (Laurenti, 1768: 24), was the order con-taining frogs but also sharing Proteus with Lau-renti’s Gradientia. Merrem (1820: 163), in his in-fluential classification, used Salientia for an orderof frogs alone and this usage was followed bymany subsequent workers (e.g., Wied-Neuwied,1825; Hogg, 1839a; Gray, 1850a; Gunther, 1859‘‘1858’’). But, if the name Salientia is to be con-strued as something other than the crown group,it must be given the authorship of Romer (1945),who provided the concept that is current today.Cannatella and Hillis (1993) cladographically de-fined Salientia to mean a taxon containing Anuraand all of its fossil relatives more closely relatedto it than to Caudata—in other words, SalientiaRomer, 1945.

The concept Anura started as anoures (A.M.C.Dumeril, 1806: 93), French vernacular for thefrog ‘‘famille’’ (and therefore unavailable forabove-family-group nomenclature, contra Dubois,2004b), which was subsequently Latinized andranked as an order as Anuri by Fischer von Wald-heim (1813: 58), as Anuria by Rafinesque (1815:78), as Anoura by Gray (1825: 213), and ulti-mately as Anura by Hogg (1839a: 270). Syno-nyms of Anura (and of most uses of Salientia be-fore 1945) are Ecaudata Scopoli, 1777: 464;Ecaudati Fischer von Waldheim, 1813: 58; Acau-data Knauer, 1883: 100; Batrachia Tschudi, 1838:25; Heteromorpha Fitzinger, 1835: 107; MiuraVan der Hoeven, 1833: 307; Pygomolgaei Ritgen,1828: 278; and Raniformia Hogg, 1839a: 271.

LEIOPELMATIDAE: Had we retained two mono-typic familes for Ascaphus (Ascaphidae) and


Leiopelma (Leiopelmatidae), the name Amphicoe-la Noble, 1931, would have been available for thistaxon in unregulated nomenclature. Subsequentauthors (e.g., Romer, 1945; Reig, 1958) have ex-tended the concept of this taxon to various fossilgroups, and it remains an open question whetherthese taxa are internal or external to the originalimplied clade.

LALAGOBATRACHIA: The names available forthis taxon demonstrate the illusion of precisionthat can result from retaining cladographically op-timized taxonomic names when the underlying to-pology changes in ways that require a substantialreconceptualization of diagnosis and content. Thetaxon whose cladographic position as defined byFord and Cannatella (1993) that corresponds toLalagobatrachia in content and most closely ap-proximates it in diagnostic features is Discoglos-sanura (Discoglossidae and all frogs other thanLeiopelma and Ascaphus, the most recent com-mon ancestor of this group and all of its descen-dants), as understood on the preferred tree of Fordand Cannatella (1993). The name that their cla-dographic definition would require to be appliedis Pipanura (Pipimorpha 1 Neobatrachia), al-though the resulting content of this application issubstantially different from that intended and thediagnosis is entirely different.

XENOANURA: The name Pipoidea Ford and Can-natella (1993) had its placement defined clado-graphically as including Pipidae and Rhinophryn-idae, their most recent common ancestor, and allof its descendants (which likely includes Paleo-batrachidae, a fossil taxon), while Xenoanura Sav-age (1973: 352) had as its original content Pipi-dae, Rhinophrynidae, and Paleobatrachidae.Therefore these two names are subjective syno-nyms. We employ the older name.

SOKOLANURA: The cladographically definednames Bombinanura and Discoglossanura provid-ed by Ford and Cannatella (1993) optimize defi-nitionally on this branch, so in one sense they aresynonyms of our Sokolanura, except that the con-tent and diagnoses of Bombinanura and Disco-glossanura under this optimization are significant-ly different from that which was originally pro-posed. Rather than engender considerable confu-sion we coin a new name.

COSTATA: As originally coined (Nicholls, 1916:86), Opisthocoela contained solely Discoglossidae(5 Bombinatoridae and Alytidae in our usage),rendering it a synonym of Costati Lataste, 1879.Opisthocoela was subsequently used to containLeiopelmatidae, Discoglossidae, and Pipidae(Ahl, 1930: 83) or Discoglossidae and Pipidae(Noble, 1931: 486). The original use of Costati(Lataste, 1879: 339) was as a taxon containingDiscoglossidae and Alytidae (equivalent in con-

tent to Bombinatoridae and Alytidae in our us-age), rendering Costati and Opisthocoela syno-nyms in their original forms. We employ the oldername as emended by Stejneger (1907).

ALYTIDAE: Within the framework of regardingDiscoglossidae and Bombinatoridae to be subfam-ilies of a larger Discoglossidae, Dubois (1987) ex-plained the nomenclatural issues as well as thehistory of his 1982 appeal to the InternationalCommission of Zoological Nomenclature to giveDiscoglossidae precedence over Bombinatoridae(as well as over Alytae and Bombitatores). Dubois(2005) used the older name, Alytidae, for this tax-on formerly known as Discoglossidae, noting theuse of Alytini by Sanchız (1984), among others.We follow this usage as consistent with the Inter-national Code of Zoological Nomenclature(ICZN, 1999).

ACOSMANURA: Acosmanura is identical in con-tent with Ranoidei Dubois (1983), which is a ju-nior homonym of Ranoidei Sokol (1977) (5Acosmanura 1 Xenoanura). Sokol applied thename Ranoidei to the group containing all frogsexcluding his Discoglossoidei (Leiopelmatidaeand Discoglossidae, both sensu lato).

NEOBATRACHIA: Sarasin and Sarasin (1890:245) coined a new taxon name, Neobatrachii, asa subclass for all living amphibians. This name ishomonymous with Neobatrachia Reig, which wascoined by Reig as a taxon of frogs (Dubois,2004b, 2005). Because Neobatrachii Sarasin andSarasin, 1890, is so unfamiliar, we see littlechance that this homonymy will cause any con-fusion (contra Dubois, 2004b, 2005). Regardless,should homonymy become an issue in unregulat-ed taxonomic names, this taxon will require a newname.

BATRACHOPHRYNIDAE: If Batrachophrynus isnot closely allied with Caudiverbera and Telma-tobufo, it is nomenclaturally unfortunate becauseBatrachophrynidae Cope, 1875, is the oldest namefor the inclusive taxon as long as Batrachophry-nus is considered to be a member of the familygroup. We suspect that additional work will showBatrachophrynus to attach elsewhere in the gen-eral cladogram, which will render the name of thefamily containing only Telmatobufo and Caudiv-erbera as Calyptocephalellidae Reig, 1960.

BUFONIDAE: A number of the generic namesused in our work require comment.

Chascax Ritgen, 1828 (type species: Bombi-nator strumosus Merrem, 1820), is a senior namefor Peltophryne Fitzinger, 1843, but is a nomenoblitum under Article 23.9 of the InternationalCode of Zoological Nomenclature (ICZN, 1999).

Epidalea Cope, 1864. Calamita Oken, 1816, isa senior synonym of Epidalea Cope, 1864. How-


ever, Calamita Oken, 1816, is unavailable accord-ing to Opinion 417 (Anonymous, 1956).

Rhinella Fitzinger, 1826. Other names that areavailable for Rhinella Fitzinger, 1826 (type spe-cies: Bufo (Oxyrhynchus) proboscideus Spix,1824, by monotypy); Otilophus Cuvier, 1829(type species: Rana margaritifera Laurenti, 1768,by original designation); Eurhina Fitzinger, 1843(type species: Bufo (Oxyrhynchus) proboscideusSpix, 1824, by original designation); and Trachy-cara Tschudi, 1845 (type species: Trachycara fus-ca Tschudi, 1834, by original designation). Ox-yrhynchus Spix, 1824 (no type species designat-ed) is not available for this taxon because it is ajunior homonym of Oxyrhynchus Leach, 1818 (afish).

Rhaebo Cope, 1862. A senior synonym ofRhaebo Cope, 1862, is Phrynomorphus Fitzinger,1843: 32 (type species: Bufo leschenaulti Dumeriland Bibron, 1841 [5 Bufo guttatus Schneider,1799]), which is a junior homonym of Phryno-morphus Curtis, 1831, an insect genus.

RANOIDES: Two other names are available forthis taxon: Diplasiocoela Nicholls, 1916 (whichwas coined as a synonym of Firmisternia sensuBoulenger, 1882), and Firmisternia Boulenger,1882. Surprisingly, the first use of the name Fir-misternia (Cope, 1875: 8) explicitly excludedRaniformia (ranids, rhacophorids, petropedetids,hyperoliids, and Leptopelis in Cope’s sense) and

Gastrechmia (Hemisotidae), and included onlyPhryniscidae, Dendrobatidae (excluding Colos-tethidae), Engystomidae, and Brevicipitidae. If thename Firmisternia were to be applied to thisbranch in the cladogram, the intended contentwould have to to come from Firmisternia Boulen-ger, 1882, not Firmisternia Cope, 1875.

Complicating the application of this name isRanoidei Sokol, 1977. Sokol (1977) named Ran-oidei as a suborder to include all taxa not in hisDiscoglossoidea (in his usage, composed of Dis-coglossidae [sensu lato, including Bombinatori-dae] and Leiopelmatidae [including Ascaphus]).In other words, Ranoidei Sokol, 1977, is com-posed of our Acosmanura 1 Xenoanura. Subse-quently, Dubois (1983) applied the name Ranoideito all frogs, excluding his Pipoidei (5 Xenoanura1 Anomocoela of our usage) and Discoglossoidei.This renders Ranoidei Dubois, 1983, a synonymof Acosmanura.

Our inclination is to preserve as closely as pos-sible the near-universal vernacular term for thisgroup, ‘‘ranoid’’. We also would have liked to usethe form ‘‘Ranoidei’’, but, unfortunately, thiswould have engendered confusion with RanoideiSokol and Ranoidei Dubois. We therefore haveformed the name as Ranoides, a taxon name ex-plicitly above regulated nomenclature. To main-tain parallel spelling in its sister taxon, we alsoform the new name for the old Hyloidea as Hy-loides.

APPENDIX 7

NEW AND REVIVED COMBINATIONS AND CLARIFICATIONS REGARDING TAXONOMIC CONTENT

Because many users of this work will not befamiliar with gender agreement and other arcanaof nomenclature, we present here the names ofspecies affected by generic changes made (and, insome cases referenced) within this paper. In someplaces (noted) we provide the entire content ofcertain taxa for clarity.

CAUDATA

PLETHODONTIDAE

(1) Eurycea Rafinesque, 1822. The synonymyof Haideotriton Carr, 1939, with Eurycea Rafin-esque, 1822, results in Eurycea wallacei (Carr,1939) new combination.

(2) Pseudoeurycea Taylor, 1944. The synony-my of Ixalotriton Wake and Johnson, 1989, withPseudoeurycea Taylor, 1944, results in two namechanges: Pseudoeurycea nigra (Wake and John-son, 1989) new combination; Pseudoeurycea par-

va Lynch and Wake, 1989. Synonymy of Linea-triton Tanner, 1950, with Pseudoeurycea Taylor,1944, results in the three name changes: Pseu-doeurycea lineola (Cope, 1865) new combination;P. orchileucos (Brodie, Mendelson, and Camp-bell, 2002) new combination; and P. orchimelas(Brodie, Mendelson, and Campbell, 2002) newcombination.

ANURA

SOOGLOSSIDAE

(1) Sooglossus Boulenger, 1906. The placementof Nesomantis Boulenger, 1909, into the synony-my of Sooglossus Boulenger, 1906, results in onename change: Sooglossus thomasseti (Boulenger,1909) new combination.

LIMNODYNASTIDAE

(1) Opisthodon Steindachner, 1867. Recogni-tion of the Limnodynastes ornatus group as the


genus Opisthodon Steindachner, 1867, results intwo resurrected combinations: Opisthodon orna-tus (Gray, 1842); and O. spenceri (Parker, 1940).

BRACHYCEPHALIDAE

(1) The partition of former EleutherodactylusDumeril and Bibron, 1841, into the genera Crau-gastor, ‘‘Eleutherodactylus’’, ‘‘Euhyas’’, ‘‘Pelor-ius’’, and Syrrhophus, results in the following newor revived combinations.

(a) Craugastor Cope, 1862 (all combinationspreviously made by implication by Crawford andSmith, 2005). Craugastor adamastus (Campbell,1994) new combination; C. alfredi (Boulenger,1898) new combination; C. amniscola (Campbelland Savage, 2000) new combination; C. anciano(Savage, McCranie, and Wilson, 1988) new com-bination; C. andi (Savage, 1974) new combina-tion; C. angelicus (Savage, 1975) new combina-tion; C. anomalus (Boulenger, 1898) new combi-nation; C. aphanus (Campbell, 1994) new com-bination; C. augusti (Duges In Brocchi, 1879)new combination; C. aurilegulus (Savage, Mc-Cranie, and Wilson, 1988) new combination; C.azueroensis (Savage, 1975) new combination; C.biporcatus (Peters, 1863) new combination; C.bocourti (Brocchi, 1877) new combination; C.bransfordii (Cope, 1886) new combination; C.brevirostris (Shreve, 1936) new combination; C.brocchi (Boulenger In Brocchi, 1882) new com-bination; C. bufoniformis (Boulenger, 1896) newcombination; C. catalinae (Campbell and Savage,2000) new combination; C. cerasinus (Cope, 1875‘‘1876’’) new combination; C. chac (Savage,1987) new combination; C. charadra (Campbelland Savage, 2000) new combination; C. cheiro-plethus (Lynch, 1990) new combination; C. chry-sozetetes (McCranie, Savage, and Wilson, 1989)new combination; C. coffeus (McCranie and Koh-ler, 1999) new combination; C. crassidigitus (Tay-lor, 1952) new combination; C. cruzi (McCranie,Savage, and Wilson, 1989) new combination; C.cuaquero (Savage, 1980) new combination; C.daryi (Ford and Savage, 1984) new combination;C. decoratus (Taylor, 1942) new combination; C.emcelae (Lynch, 1985) new combination; C. em-leni (Dunn and Emlen, 1932) new combination;C. epochthidius (McCranie and Wilson, 1997)new combination; C. escoces (Savage, 1975) newcombination; C. fecundus (McCranie and Wilson,1997) new combination; C. fitzingeri (Schmidt,1857) new combination; C. fleischmanni (Boett-ger, 1892) new combination; C. galacticorhinus(Canseco-Marquez and Smith, 2004) new com-bination; C. glaucus (Lynch, 1967) new combi-nation; C. gollmeri (Peters, 1863) new combina-tion; C. greggi (Bumzahem, 1955) new combi-

nation; C. guerreroensis (Lynch, 1967) new com-bination; C. gulosus (Cope, 1875 ‘‘1876’’) newcombination; C. hobartsmithi (Taylor, 1937) newcombination; C. inachus (Campbell and Savage,2000) new combination; C. jota (Lynch, 1980)new combination; C. laevissimus (Werner, 1896)new combination; C. laticeps (Dumeril, 1853)new combination; C. lauraster (Savage, Mc-Cranie, and Espinal, 1996) new combination; C.lineatus (Brocchi, 1879) new combination; C. loki(Shannon and Werler, 1955) new combination; C.longirostris (Boulenger, 1898) new combination;C. matudai (Taylor, 1941) new combination; C.megacephalus (Cope, 1875 ‘‘1876’’) new combi-nation; C. megalotympanum (Shannon and Werler,1955) new combination; C. melanostictus (Cope,1875) new combination; C. merendonensis(Schmidt, 1933) new combination; C. mexicanus(Brocchi, 1877) new combination; C. milesi(Schmidt, 1933) new combination; C. mimus(Taylor, 1955) new combination; C. monnichorum(Dunn, 1940) new combination; C. myllomyllon(Savage, 2000) new combination; C. necerus(Lynch, 1975) new combination; C. noblei (Bar-bour and Dunn, 1921) new combination; C. obe-sus (Barbour, 1928) new combination; C. occi-dentalis (Taylor, 1941) new combination; C. olan-chano (McCranie and Wilson, 1999) new combi-nation; C. omiltemanus (Gunther, 1900) newcombination; C. omoaensis (McCranie and Wil-son, 1997) new combination; C. opimus (Savageand Myers, 2002) new combination; C. palenque(Campbell and Savage, 2000) new combination;C. pechorum (McCranie and Wilson, 1999) newcombination; C. pelorus (Campbell and Savage,2000) new combination; C. persimilis (Barbour,1926) new combination; C. phasma (Lips andSavage, 1996) new combination; C. podiciferus(Cope, 1875) new combination; C. polymniae(Campbell, Lamar, and Hillis, 1989) new combi-nation; C. polyptychus (Cope, 1886) new combi-nation; C. pozo (Johnson and Savage, 1995) newcombination; C. psephosypharus (Campbell, Sav-age, and Meyer, 1994) new combination; C. punc-tariolus (Peters, 1863) new combination; C. pyg-maeus (Taylor, 1937) new combination; C. rani-formis (Boulenger, 1896) new combination; C.ranoides (Cope, 1886) new combination; C. rayo(Savage and DeWeese, 1979) new combination;C. rhodopis (Cope, 1867) new combination; C.rhyacobatrachus (Campbell and Savage, 2000)new combination; C. rivulus (Campbell and Sav-age, 2000) new combination; C. rostralis (Werner,1896) new combination; C. rugosus (Peters, 1873)new combination; C. rugulosus (Cope, 1870) newcombination; C. rupinius (Campbell and Savage,2000) new combination; C. sabrinus (Campbelland Savage, 2000) new combination; C. saltuar-


ius (McCranie and Wilson, 1997) new combina-tion; C. sandersoni (Schmidt, 1941) new combi-nation; C. sartori (Lynch, 1965) new combina-tion; C. silvicola (Lynch, 1967) new combination;C. spatulatus (Smith, 1939) new combination; C.stadelmani (Schmidt, 1936) new combination; C.stejnegerianus (Cope, 1893) new combination; C.stuarti (Lynch, 1967) new combination; C. taba-sarae (Savage, Hollingsworth, Lips, and Jaslow,2004) new combination; C. talamancae (Dunn,1931) new combination; C. tarahumaraensis(Taylor, 1940) new combination; C. taurus (Tay-lor, 1958) new combination; C. taylori (Lynch,1966) new combination; C. trachydermus (Camp-bell, 1994) new combination; C. uno (Savage,1984) new combination; C. vocalis (Taylor, 1940)new combination; C. vulcani (Shannon and Wer-ler, 1955) new combination; C. xucanebi (Stuart,1941) new combination; C. yucatanensis (Lynch,1965) new combination; C. zygodactylus (Lynchand Myers, 1983) new combination.

(b) ‘‘Euhyas’’ Fitzinger, 1843: ‘‘Euhyas’’ ac-monis (Schwartz, 1960) new combination; ‘‘E.’’adela (Diaz, Cadiz, and Hedges, 2003) new com-bination; ‘‘E.’’ albipes (Barbour and Shreve,1937) new combination; ‘‘E.’’ alcoae (Schwartz,1971); ‘‘E.’’ alticola (Lynn, 1937) new combi-nation; ‘‘E.’’ amadeus (Hedges, Thomas, andFranz, 1987) new combination; ‘‘E.’’ andrewsi(Lynn, 1937) new combination; ‘‘E.’’ apostates(Schwartz, 1973) new combination; ‘‘E.’’ arms-trongi (Noble and Hassler, 1933) new combina-tion; ‘‘E.’’ atkinsi (Dunn, 1925) new combination;‘‘E.’’ briceni (Boulenger, 1903) new combination;‘‘E.’’ caribe (Hedges and Thomas, 1992) newcombination; ‘‘E.’’ casparii (Dunn, 1926) newcombination; ‘‘E.’’ cavernicola (Lynn, 1954) newcombination; ‘‘E.’’ corona (Hedges and Thomas,1992) new combination; ‘‘E.’’ counouspea(Schwartz, 1964) new combination; ‘‘E.’’ cubana(Barbour, 1942) new combination; ‘‘E.’’ cuneata(Cope, 1862) new combination; ‘‘E.’’ dimidiatus(Cope, 1862) new combination; ‘‘E.’’ dolomedes(Hedges and Thomas, 1992) new combination;‘‘E.’’ emiliae (Dunn, 1926) new combination;‘‘E.’’ etheridgei (Schwartz, 1958) new combina-tion; ‘‘E.’’ furcyensis (Shreve and Williams, 1963)new combination; ‘‘E.’’ fusca (Lynn and Dent,1943) new combination; ‘‘E.’’ glandulifer (Coch-ran, 1935) new combination; ‘‘E.’’ glandulifero-ides (Shreve, 1936) new combination; ‘‘E.’’ gla-phycompus (Schwartz, 1973) new combination;‘‘E.’’ glaucoreia (Schwartz and Fowler, 1973)new combination; ‘‘E.’’ goini (Schwartz, 1960)new combination; ‘‘E.’’ gossei (Dunn, 1926) newcombination; ‘‘E.’’ grabhami (Dunn, 1926) newcombination; ‘‘E.’’ grahami (Schwartz, 1979)new combination; ‘‘E.’’ greyi (Dunn, 1926) new

combination; ‘‘E.’’ griphus (Crombie, 1986) newcombination; ‘‘E.’’ guanahacabibes Estrada andRodriguez, 1985 new combination; ‘‘E.’’ gundla-chi (Schmidt, 1920) new combination; ‘‘E.’’ ib-eria (Estrada and Hedges, 1996) new combina-tion; ‘‘E.’’ intermedia (Barbour and Shreve, 1937)new combination; ‘‘E.’’ jamaicensis (Barbour,1910) new combination; ‘‘E.’’ jaumei (Estradaand Alonso, 1997) new combination; ‘‘E.’’ jugans(Cochran, 1937) new combination; ‘‘E.’’ junori(Dunn, 1926) new combination; ‘‘E.’’ karlschmid-ti (Grant, 1931) new combination; ‘‘E.’’ klini-kowskii (Schwartz, 1959) new combination; ‘‘E.’’leoncei (Shreve and Williams, 1963) new combi-nation; ‘‘E.’’ limbata (Cope, 1862); ‘‘E.’’ lucioi(Schwartz, 1980) new combination; ‘‘E.’’ luteola(Gosse, 1851) new combination; ‘‘E.’’ maestren-sis (Dıaz, Cadiz, and Navarro, 2005) new com-bination; ‘‘E.’’ minuta Noble, 1923 new combi-nation; ‘‘E.’’ monensis (Meerwarth, 1901) newcombination; ‘‘E.’’ nubicola Dunn, 1926 newcombination; ‘‘E.’’ orcutti (Dunn, 1928); ‘‘E.’’ or-ientalis (Barbour and Shreve, 1937) new combi-nation; ‘‘E.’’ oxyrhynca (Dumeril and Bibron,1841) new combination; ‘‘E.’’ pantoni (Dunn,1926); ‘‘E.’’ parabates (Schwartz, 1964) newcombination; ‘‘E.’’ paulsoni (Schwartz, 1964)new combination; ‘‘E.’’ pentasyringos (Schwartzand Fowler, 1973) new combination; ‘‘E.’’ pezo-petra (Schwartz, 1960) new combination; ‘‘E.’’pictissima (Cochran, 1935) new combination;‘‘E.’’ pinarensis (Dunn, 1926) new combination;‘‘E.’’ planirostris (Cope, 1862) new combination;‘‘E.’’ rhodesi (Schwartz, 1980) new combination;‘‘E.’’ richmondi (Stejneger, 1904) new combina-tion; ‘‘E.’’ ricordii (Dumeril and Bibron, 1841);‘‘E.’’ rivularis (Diaz, Estrada, and Hedges, 2001)new combination; ‘‘E.’’ schmidti (Noble, 1923)new combination; ‘‘E.’’ sciagraphus (Schwartz,1973) new combination; ‘‘E.’’ semipalmata(Shreve, 1936) new combination; ‘‘E.’’ simulans(Diaz and Fong, 2001); ‘‘E.’’ sisyphodemus(Crombie, 1977) new combination; ‘‘E.’’ syming-toni (Schwartz, 1957) new combination; ‘‘E.’’ te-tajulia (Estrada and Hedges, 1996) new combi-nation; ‘‘E.’’ thomasi (Schwartz, 1959) new com-bination; ‘‘E.’’ thorectes (Hedges, 1988) newcombination; ‘‘E.’’ toa (Estrada and Hedges,1991) new combination; ‘‘E.’’ tonyi (Estrada andHedges, 1997) new combination; ‘‘E.’’ turquinen-sis (Barbour and Shreve, 1937) new combination;‘‘E.’’ varleyi (Dunn, 1925) new combination;‘‘E.’’ ventrilineata (Shreve, 1936) new combina-tion; ‘‘E.’’ warreni (Schwartz, 1976); ‘‘E.’’ wein-landi (Barbour, 1914) new combination; ‘‘E.’’zeus (Schwartz, 1958) new combination; ‘‘E.’’zugi (Schwartz, 1958) new combination.

(c) ‘‘Pelorius’’ Hedges, 1989. ‘‘Pelorius’’ chlo-


rophenax (Schwartz, 1976) new combination;‘‘P.’’ hypostenor (Schwartz, 1965) new combi-nation; ‘‘P.’’ inoptatus (Barbour, 1914) new com-bination; ‘‘P.’’ nortoni (Schwartz, 1976) newcombination; ‘‘P.’’ parapelates (Hedges andThomas, 1987) new combination; ‘‘P.’’ ruthae(Noble, 1923) new combination.

(d) Syrrhophus Cope, 1878 (all resurrectedcombinations either previously formed or impliedby prior authors). Syrrhophus angustidigitorum(Taylor, 1940); S. cystignathoides (Cope, 1877);S. dennisi Lynch, 1970; S. dilatus (Davis and Dix-on, 1955); S. dixoni (Lynch, 1991); S. grandis(Dixon, 1957); S. guttilatus (Cope, 1879); S. in-terorbitalis Langebartel and Shannon, 1956; S. le-prus Cope, 1879; S. longipes (Baird, 1859); S.marnockii Cope, 1878; S. maurus (Hedges, 1989);S. modestus Taylor, 1942; S. nitidus (Peters,1870); S. nivicolimae Dixon and Webb, 1966; S.pallidus Duellman, 1958; S. pipilans Taylor, 1940;S. rubrimaculatus Taylor and Smith, 1945; S. ru-fescens (Duellman and Dixon, 1959); S. saxatilis(Webb, 1962); S. syristes (Hoyt, 1965); S. tere-tistes Duellman, 1958; S. verrucipes Cope, 1885;S. verruculatus (Peters, 1870).

HYLIDAE: PELODRYADINAE

(1) Litoria Tschudi, 1838: The synonymy ofNyctimystes Stejneger, 1916, and CycloranaSteindachner, 1867 (with retention of Cycloranaas a subgenus within Litoria), with Litoria Tschu-di, 1838, results in the following new or revivedcombinations.

(a) Cyclorana Steindachner, 1867. Litoria (Cy-clorana) alboguttata (Gunther, 1867); L. (C.) aus-tralis (Gray, 1842) new combination; L. (C.) brev-ipes (Peters, 1871) new combination; L. (C.) cryp-totis (Tyler and Martin, 1977) new combination;L. (C.) cultripes (Parker, 1940) new combination;L. (C.) longipes (Tyler and Martin, 1977) newcombination; L. (C.) maculosa (Tyler and Martin,1977) new combination; L. (C.) maini (Tyler andMartin, 1977) new combination; L. (C.) manya(van Beurden and McDonald, 1980) new combi-nation; L. (C.) novaehollandiae (Steindachner,1867) new combination; L. (C.) platycephala(Gunther, 1873) new combination; L. (C.) vagita(Tyler, Davies, and Martin, 1981) new combina-tion; L. (C.) verrucosa (Tyler and Martin, 1977)new combination.

(b) Nyctimystes Stejneger, 1916. Litoria avo-calis (Zweifel, 1958) new combination; L. chees-manae (Tyler, 1964) new combination; L. dayi(Gunther, 1897) new combination; L. daymani(Zweifel, 1958) new combination; L. disrupta(Tyler, 1963) new combination; L. fluviatilis(Zweifel, 1958) new combination; L. foricula (Ty-

ler, 1963) new combination; L. granti (Boulenger,1914) new combination; L. gularis (Parker, 1936)new combination; L. humeralis (Boulenger, 1912)new combination; L. kubori (Zweifel, 1958) newcombination; L. michaeltyleri new name;36 L.montana (Peters and Doria, 1878) new combina-tion; L. narinosa (Zweifel, 1958) new combina-tion; L. obsoleta (Lonnberg, 1900) new combi-nation; L. oktediensis (Richards and Johnston,1993) new combination; L. papua (Boulenger,1897) new combination; L. perimetri (Zweifel,1958) new combination; L. persimilis (Zweifel,1958) new combination; L. pulchra (Wandolleck,1911 ‘‘1910’’) new combination; L. rueppelli(Boettger, 1895) new combination; L. semipal-mata (Parker, 1936) new combination; L. trachy-dermis (Zweifel, 1983) new combination; L. zwei-feli (Tyler, 1967) new combination.

LEPTODACTYLIDAE

(1) Leptodactylus Fitzinger, 1826. The place-ment of Adenomera Steindachner, 1867, as a syn-onym of Lithodytes Fitzinger, 1843, and Lithody-tes as a subgenus of Leptodactylus, as well as theplacement of Vanzolinius Heyer, 1974, as a syn-onym of Leptodactylus, results in the new or re-vived combinations.

(a) Adenomera Steindachner, 1867, and Lith-odytes Fitzinger, 1843. Leptodactylus (Lithodytes)andreae Muller, 1923; L. (L.) araucarius (Kwetand Angulo, 2002) new combination; L. (L.) bok-ermanni Heyer, 1973; L. (L.) diptyx Boettger,1885; L. (L.) hylaedactylus (Cope, 1868); L. (L.)lineatus (Schneider, 1799); L. (L.) lutzi (Heyer,1975) new combination; L. (L.) marmoratus(Steindachner, 1867); L. (L.) martinezi (Boker-mann, 1956).

(b) Vanzolinius Heyer, 1974. Leptodactylus dis-codactylus Boulenger, 1884 ‘‘1883’’.

DENDROBATIDAE

Ameerega Bauer, 1986. Although AmeeregaBauer, 1986, is an older name for the clade cur-rently referred to by other authors as Epipedoba-tes Myers, 1987, an extensive revision of Dendro-batidae is under way, rendering a much differentgeneric taxonomy from that employed in this pa-per (Grant et al., in press). For this reason we donot provide a list of new combinations for speciesof former Epipedobates.

36 When placed in Litoria, Nyctimystes tyleri Zweifel,1983, becomes a secondary homonym of Litoria tyleriMartin, Watson, Gartside, Littlejohn, and Loftus-Hills,1979 ‘‘1978’’. Although we expect that ongoing workwill correct this nomenclatural anomaly, we propose Li-toria michaeltyleri nomen novum to replace Nyctimystestyleri Zweifel, 1983.


BUFONIDAE

The extensive generic rearrangements result inmany name changes:

(1) Altiphrynoides Dubois, 1987 ‘‘1986’’. Thesynonymy of Altiphrynoides Dubois, 1987‘‘1986’’, and Spinophrynoides Dubois, 1987‘‘1986’’, results in a single name change: Alti-phrynoides osgoodi (Loveridge, 1932) new com-bination.

(2) Amietophrynus new genus. The componentsof Amietophrynus come from several former spe-cies groups of ‘‘Bufo’’, all exhibiting the 20-chro-mosome condition, with the exception of the A.pardalis group, which has reversed to the 22-chromosome condition (Cunningham and Cherry,2004): A. asmarae (Tandy, Bogart, Largen, andFeener, 1982) new combination; A. blanfordii(Boulenger, 1882) new combination; A. brauni(Nieden, 1911) new combination; A. buchneri(Peters, 1882) new combination; A. camerunensis(Parker, 1936) new combination; A. chudeaui(Chabanaud, 1919); A. cristiglans (Inger andMenzies, 1961) new combination; A. danielae(Perret, 1977) new combination; A. djohongensis(Hulselmans, 1977) new combination; A. fuligin-atus (de Witte, 1932) new combination; A. funer-eus (Bocage, 1866) new combination; A. garmani(Meek, 1897) new combination; A. gracilipes(Boulenger, 1899) new combination; A. gutturalis(Power, 1927) new combination; A. kassasii (BahaEl Din, 1993) new combination; A. kerinyagae(Keith, 1968) new combination; A. kisoloensis(Loveridge, 1932) new combination; A. langan-oensis (Largen, Tandy, and Tandy, 1978) newcombination; A. latifrons (Boulenger, 1900) newcombination; A. lemairii (Boulenger, 1901) newcombination; A. maculatus (Hallowell, 1854) newcombination; A. pantherinus (Smith, 1828) newcombination; A. pardalis (Hewitt, 1935) newcombination; A. perreti (Schiøtz, 1963) new com-bination; A. poweri (Hewitt, 1935) new combi-nation; A. rangeri (Hewitt, 1935) new combina-tion; A. reesi (Poynton, 1977) new combination;A. regularis (Reuss, 1833) new combination; A.steindachneri (Pfeffer, 1893) new combination; A.superciliaris (Boulenger, 1888) new combination;A. taiensis (Rodel and Ernst, 2000) new combi-nation (including Bufo amieti Tandy and Perret,2000, according to S. Stuart, personal commun.);A. togoensis (Ahl, 1924) new combination; A. tub-erosus (Gunther, 1858) new combination; A. tur-kanae (Tandy and Feener, 1985) new combina-tion; A. urunguensis (Loveridge, 1932) new com-bination; A. villiersi (Angel, 1940) new combi-nation; A. vittatus (Boulenger, 1906) newcombination; A. xeros (Tandy, Tandy, Keith, andDuff-MacKay, 1976) new combination.

(3) Anaxyrus Tschudi, 1845. Recognition ofthis major clade of Nearctic ‘‘Bufo’’ as a genusrequires a number of new name combinations:Anaxyrus americanus (Holbrook, 1836) new com-bination; A. baxteri (Porter, 1968) new combina-tion; A. boreas (Baird and Girard, 1852) newcombination; A. californicus (Camp, 1915) newcombination; A. canorus (Camp, 1916) new com-bination; A. cognatus (Say in James, 1823) newcombination; A. compactilis (Wiegmann, 1833)new combination; A. debilis (Girard, 1854) newcombination; A. exsul (Myers, 1942) new com-bination; A. fowleri (Hinckley, 1882) new com-bination; A. hemiophrys (Cope, 1886) new com-bination; A. houstonensis (Sanders, 1953) newcombination; A. kelloggi (Taylor, 1938) new com-bination; A. mexicanus (Brocchi, 1879) new com-bination; A. microscaphus (Cope, 1867) ‘‘1866’’new combination; A. nelsoni (Stejneger, 1893)new combination; A. punctatus (Baird and Girard,1852) new combination; A. quercicus (Holbrook,1840) new combination; A. retiformis (Sandersand Smith, 1951) new combination; A. speciosus(Girard, 1854) new combination; A. terrestris(Bonnaterre, 1789) new combination; A. wood-housii (Girard, 1854) new combination.

(4) Bufo Laurent, 1768. This taxon is Bufo (sen-su stricto). All other species in Bufo (sensu lato)should have the generic name Bufo placed in quo-tation marks (i.e., ‘‘Bufo’’) inasmuch as they arenot part of the clade formally called Bufo, sensustricto. Members of Bufo sensu stricto are Bufoandrewsi Schmidt, 1925; B. aspinius (Yang, Liu,and Rao, 1996); B. bankorensis Barbour, 1908; B.bufo (Linnaeus, 1758); B. gargarizans Cantor,1842; B. japonicus Temminck and Schlegel, 1838;B. kabischi Herrmann and Kuhnel, 1997; B. min-shanicus Stejneger, 1926; B. spinosus Daudin,1803; B. tibetanus Zarevskij, 1926; B. torrenticolaMatsui, 1976; B. tuberculatus Zarevskij, 1926; B.verrucosissimus (Pallas, 1814); B. wolongensisHerrmann and Kuhnel, 1997.

(5) Former ‘‘Bufo’’ species not allocated to ge-nus (see discussion under ‘‘Taxonomy’’ and aboveunder Bufo) are:

(a) Nomina dubia. ‘‘Bufo’’ brevirostris Rao,1937; ‘‘B.’’ simus Schmidt, 1857.

(b) Unassigned to group. ‘‘B.’’ koynayensis So-man, 1963; ‘‘B.’’ ocellatus Gunther, 1858.

(c) ‘‘Bufo’’ arabicus group, ‘‘Bufo’’ arabicusHeyden, 1827; ‘‘B.’’ dhufarensis Parker, 1931;‘‘B.’’ dodsoni Boulenger, 1895; ‘‘B.’’ scortecciiBalletto and Cherchi, 1970.

(d) ‘‘Bufo’’ mauritanicus group: ‘‘Bufo’’ maur-itanicus Schlegel, 1841).

(e) ‘‘Bufo’’ pentoni group, ‘‘Bufo’’ pentoni An-derson, 1893; ‘‘B.’’ tihamicus Balletto and Cher-chi, 1973.


(f) ‘‘Bufo’’ scaber group: ‘‘Bufo’’ atukoraleiBogert and Senanayake, 1966; ‘‘B.’’ kotagamaiFernando, Dayawansa, and Siriwardhane, 1994;‘‘B.’’ parietalis Boulenger, 1882; ‘‘B.’’ scaberSchneider, 1799; ‘‘B.’’ silentvalleyensis Pillai,1981.

(g) ‘‘Bufo’’ stejnegeri group. ‘‘Bufo’’ ailaoanusKou, 1984; ‘‘B.’’ cryptotympanicus Liu and Hu,1962; ‘‘B.’’ pageoti Bourret, 1937; ‘‘B.’’ stejne-geri Schmidt, 1931.

(h) ‘‘Bufo’’ stomaticus group. ‘‘Bufo’’ beddomiiGunther, 1876; ‘‘B.’’ hololius Gunther, 1876;‘‘B.’’ olivaceus Blanford, 1874; ‘‘B.’’ stomaticusLutken, 1864; ‘‘B.’’ stuarti Smith, 1929; ‘‘B.’’ su-matranus Peters, 1871 (provisional allocation);‘‘B.’’ valhallae Meade-Waldo, 1909 (provisional-ly allocated).

(6) Chaunus Wagler, 1828: Recognition of thismajor clade of predominantly Neotropical ‘‘Bufo’’(excluding Rhinella) as a genus requires a numberof new name combinations. Although we do notreject the use of species groups (see Blair, 1972a;Duellman and Schulte, 1992), we think that theserequire considerable reevaluation regarding theirmonophyly and utility. Recommended changesare Chaunus abei (Baldissera, Caramaschi, andHaddad, 2004) new combination; C. achalensis(Cei, 1972) new combination; C. achavali (Ma-neyro, Arrieta, and de Sa, 2004) new combina-tion; C. amabilis (Pramuk and Kadivar, 2003) newcombination; C. amboroensis (Harvey and Smith,1993) new combination; C. arborescandens(Duellman and Schulte, 1992) new combination;C. arenarum (Hensel, 1867) new combination; C.arequipensis (Vellard, 1959) new combination; C.arunco (Molina, 1782) new combination; C. ata-camensis (Cei, 1962) new combination; C. beebei(Gallardo, 1965) new combination; C. bergi (Ces-pedez, 2000) new combination; C. chavin (Lehr,Kohler, Aguilar, and Ponce, 2001) new combina-tion; C. cophotis (Boulenger, 1900) new combi-nation; C. corynetes (Duellman and Ochoa-M.,1991) new combination; C. crucifer (Wied-Neu-wied, 1821) new combination; C. diptychus(Cope, 1862) new combination; C. dorbignyi (Du-meril and Bibron, 1841) new combination; C. fer-nandezae (Gallardo, 1957) new combination; C.fissipes (Boulenger, 1903) new combination; C.gallardoi (Carrizo, 1992) new combination; C.gnustae (Gallardo, 1967) new combination; C.granulosus (Spix, 1824) new combination; C.henseli (Lutz, 1934) new combination; C. icteri-cus (Spix, 1824) new combination; C. inca (Stej-neger, 1913) new combination; C. jimi (Stevaux,2002) new combination; C. justinianoi (Harveyand Smith, 1994) new combination; C. limensis(Werner, 1901) new combination; C. marinus(Linnaeus, 1758) new combination; C. nesiotes

(Duellman and Toft, 1979) new combination; C.ornatus (Spix, 1824) new combination; C. poep-pigii (Tschudi, 1845) new combination; C. pom-bali (Baldissera, Caramaschi, and Haddad, 2004)new combination; C. pygmaeus (Myers and Car-valho, 1952) new combination; C. quechua (Gal-lardo, 1961) new combination; C. rubescens(Lutz, 1925) new combination; C. rubropunctatus(Guichenot, 1848) new combination; C. rumbolli(Carrizo, 1992) new combination; C. schneideri(Werner, 1894) new combination; C. spinulosus(Wiegmann, 1834) new combination; C. vellardi(Leviton and Duellman, 1978) new combination;C. veraguensis (Schmidt, 1857) new combination.

(7) Cranopsis Cope, 1875. Recognition of theMiddle American clade of ‘‘Bufo’’ as CranopsisCope, 1875, renders the following new or revivedcombinations: Cranopsis alvaria (Girard in Baird,1849) new combination; C. aucoinae (O’Neill andMendelson, 2004) new combination; C. bocourti(Brocchi, 1877) new combination; C. campbelli(Mendelson, 1994) new combination; C. canali-fera (Cope, 1877) new combination; C. cavifrons(Firschein, 1950) new combination; C. coccifer(Cope, 1866) new combination; C. conifera(Cope, 1862) new combination; C. cristata (Wieg-mann, 1833) new combination; C. cycladen(Lynch and Smith, 1966) new combination; C.fastidiosa (Cope, 1875) new combination; C.gemmifer (Taylor, 1940) new combination; C.holdridgei (Taylor, 1952) new combination; C.ibarrai (Stuart, 1954) new combination; C. leu-comyos (McCranie and Wilson, 2000) new com-bination; C. luetkenii (Boulenger, 1891) new com-bination; C. macrocristata (Firschein and Smith,1957) new combination; C. marmorea (Wieg-mann, 1833) new combination; C. mazatlanensis(Taylor, 1940) new combination; C. melanochlora(Cope, 1877) new combination; C. nebulifer (Gi-rard, 1854) new combination; C. occidentalis (Ca-merano, 1879) new combination; C. periglenes(Savage, 1967); C. peripatetes (Savage, 1972)new combination; C. perplexa (Taylor, 1943) newcombination; C. pisinna (Mendelson, Williams,Sheil, and Mulcahy, 2005) new combination; C.porteri (Mendelson, Williams, Sheil, and Mulca-hy, 2005) new combination; C. signifera (Men-delson, Williams, Sheil, and Mulcahy, 2005) newcombination; C. spiculata (Mendelson, 1997) newcombination; C. tacanensis (Smith, 1852) newcombination; C. tutelaria (Mendelson, 1997) newcombination; C. valliceps (Wiegmann, 1833) newcombination.

(8) Duttaphrynus new genus. Recognition ofthe former ‘‘Bufo’’ melanostictus group as a genusrequires the following name changes: Duttaphry-nus crocus (Wogan, Win, Thin, Lwin, Shein, Kyi,and Tun, 2003) new combination; D. cyphosus


(Ye, 1977) new combination; D. himalayanus(Gunther, 1864) new combination; D. melanostic-tus (Schneider, 1799) new combination; D. micro-tympanum (Boulenger, 1882) new combination;D. noellerti (Manamendra-Arachchi and Pethiya-goda, 1998) new combination.

(9) Epidalea Cope, 1864. Recognition as a ge-nus of the former ‘‘Bufo’’ calamita group rendersone revived name: Epidalea calamita (Laurenti,1768).

(10) Ingerophrynus new genus. Recognition ofthe former ‘‘Bufo’’ biporcatus group 1 allies re-sults in the following new combinations: Ingero-phrynus biporcatus (Gravenhorst, 1829) newcombination; I. celebensis (Gunther, 1859‘‘1858’’) new combination; I. claviger (Peters,1863) new combination; I. divergens (Peters,1871) new combination; I. galeatus (Gunther,1864) new combination; I. kumquat (Das andLim, 2001) new combination; I. macrotis (Bou-lenger, 1887) new combination; I. parvus (Bou-lenger, 1887) new combination; I. philippinicus(Boulenger, 1887) new combination; I. quadri-porcatus (Boulenger, 1887) new combination.

(11) Mertensophryne Tihen, 1960. Placing Ste-phopaedes Channing, 1979 ‘‘1978’’ (as a subge-nus) and the ‘‘Bufo’’ taitanus group within Mer-tensophryne provides the following new combi-nations.

(a) Mertensophryne, unassigned to subgenus(the former ‘‘Bufo’’ taitanus group): Mertenso-phryne lindneri (Mertens, 1955) new combina-tion; M. lonnbergi (Andersson, 1911) new com-bination; M. melanopleura (Schmidt and Inger,1959) new combination; M. micranotis (Loverid-ge, 1925) new combination; M. mocquardi (An-gel, 1924) new combination; M. nyikae (Lover-idge, 1953) new combination; M. schmidti (Gran-dison, 1972); M. taitana Peters, 1878 new com-bination; M. uzunguensis (Loveridge, 1932) newcombination.

(b) Mertensophryne, subgenus Stephopaedes:Mertensophryne (Stephopaedes) anotis (Boulen-ger, 1907) new combination; M. (S.) howelli(Poynton and Clarke, 1999) new combination; M.(S.) loveridgei (Poynton, 1991) new combination;Mertensophryne (Stephopaedes) usambarae(Poynton and Clarke, 1999).

(12) Nannophryne Gunther, 1870: With the res-urrection of Nannophryne, the single species,Nannophryne variegata Gunther, 1870, takes itsoriginal form.

(13) Peltophryne Fitzinger, 1843. Resurrectionof Peltophryne results in the following names be-ing revived: Peltophryne cataulaciceps (Schwartz,1959); P. empusa Cope, 1862; P. fluviatica(Schwartz, 1972); P. fracta (Schwartz, 1972); P.fustiger (Schwartz, 1960); P. guentheri (Cochran,

1941); P. gundlachi (Ruibal, 1959); P. lemurCope, 1869 ‘‘1868’’; P. longinasus (Stejneger,1905); P. peltocephala (Tschudi, 1838); P. taladai(Schwartz, 1960).

(14) Phrynoidis Fitzinger, 1843. Recognition ofthe former ‘‘Bufo’’ asper group as Phrynoidis re-sults in two new combinations: Phrynoidis aspera(Gravenhorst, 1829); P. juxtaspera (Inger, 1964)new combination.

(15) Poyntonophrynus new genus. Recognitionof the former ‘‘Bufo’’ vertebralis group as a genusresults in the following new combinations: Poyn-tonophrynus beiranus (Loveridge, 1932) newcombination; P. damaranus (Mertens, 1954) newcombination; P. dombensis (Bocage, 1895) newcombination; P. fenoulheti (Hewitt and Methuen,1912) new combination; P. grandisonae (Poyntonand Haacke, 1993) new combination; P. hoeschi(Ahl, 1934) new combination; P. kavangensis(Poynton and Broadley, 1988) new combination;P. lughensis (Loveridge, 1932) new combination;P. parkeri (Loveridge, 1932) new combination; P.vertebralis (Smith, 1848) new combination.

(16) Pseudepidalea new genus. Recognition ofthe former ‘‘Bufo’’ viridis group as a genus resultsin the following new combinations: Pseudepida-lea brongersmai (Hoogmoed, 1972) new combi-nation; P. latastii (Boulenger, 1882) new combi-nation; P. luristanica (Schmidt, 1952) new com-bination; P. oblonga (Nikolskii, 1896) new com-bination; P. pewzowi (Bedriaga, 1898) newcombination; P. pseudoraddei (Mertens, 1971)new combination; P. raddei (Strauch, 1876) newcombination; P. surda (Boulenger, 1891) newcombination; P. taxkorensis (Fei, 1999) new com-bination; P. viridis (Laurenti, 1768) new combi-nation.

(17) Rhaebo Cope, 1862. Recognition of theformer ‘‘Bufo’’ guttatus group results in the fol-lowing name changes: Rhaebo anderssoni (Melin,1941) new combination; R. blombergi (Myers andFunkhouser, 1951) new combination; R. caeru-leostictus (Gunther, 1859) new combination[placed here on the basis of comments by Hoog-moed, 1989a]; R. glaberrimus (Gunther, 1869)new combination; R. guttatus (Schneider, 1799)new combination; R. haematiticus (Cope, 1862);R. hypomelas Boulenger, 1913 (placed here pro-visionally).

(18) Rhinella Fitzinger, 1826. Recognition ofthe former ‘‘Bufo’’ margaritifer group as the ge-nus Rhinella results in the following name chang-es: Rhinella acutirostris (Spix, 1824) new com-bination; R. alata (Thominot, 1884) new combi-nation; R. castaneotica (Caldwell, 1991) newcombination; R. ceratophrys (Boulenger, 1882)new combination; R. cristinae (Velez-Rodriguezand Ruiz-Carranza, 2002) new combination; R.


dapsilis (Myers and Carvalho, 1945) new com-bination; R. intermedia (Gunther, 1858) new com-bination; R. iserni Jimenez de la Espada, 1875; R.margaritifer (Laurenti, 1768) new combination;R. nasica (Werner, 1903) new combination; R.proboscidea (Spix, 1824); R. roqueana (Melin,1941) new combination; R. scitula (Caramaschiand Niemeyer, 2003) new combination; R. scler-ocephala (Mijares-Urrutia and Arends-R., 2001)new combination; R. stanlaii (Lotters and Kohler,2000) new combination; R. sternosignata (Gun-ther, 1858).

(19) Vandijkophrynus new genus. Recognitionof the former ‘‘Bufo’’ angusticeps group as Van-dijkophrynus results in the following name chang-es: Vandijkophrynus amatolicus (Hewitt, 1925)new combination; V. angusticeps (Smith, 1848)new combination; V. gariepensis (Smith, 1848)new combination; V. inyangae (Poynton, 1963)new combination; V. robinsoni (Branch andBraacke, 1996) new combination.

MICROHYLIDAE: ASTEROPHRYINAE

(1) Xenorhina Peters, 1863. The synonymy ofXenobatrachus Peters and Doria, 1878, with Xe-norhina Peters, 1863, results in the followingchanges: Xenorhina anorbis (Blum and Menzies,1989 ‘‘1988’’) new combination; X. arfakiana(Blum and Menzies, 1989 ‘‘1988’’) new combi-nation; X. bidens van Kampen, 1909; X. fuscigula(Blum and Menzies, 1989 ‘‘1988’’) new combi-nation; X. gigantea van Kampen, 1915; X. huon(Blum and Menzies, 1989 ‘‘1988’’) new combi-nation; X. macrops van Kampen, 1913; X. mehelyi(Boulenger, 1898) new combination; X. multisica(Blum and Menzies, 1989 ‘‘1988’’) new combi-nation; X. obesa (Zweifel, 1960) new combina-tion; X. ocellata van Kampen, 1913; X. ophiodon(Peters and Doria, 1878) new combination; X.rostrata (Mehely, 1898); X. scheepstrai (Blumand Menzies, 1989 ‘‘1988’’) new combination; X.schiefenhoeveli (Blum and Menzies, 1989‘‘1988’’) new combination; X. subcrocea (Men-zies and Tyler, 1977) new combination; X. tumula(Blum and Menzies, 1989 ‘‘1988’’) new combi-nation; X. zweifeli (Kraus and Allison, 2002) newcombination.

MICROHYLIDAE: COPHYLINAE

(1) Rhombophryne Boettger, 1880. Transfer ofseveral species of ‘‘Plethodontohyla’’ Boulenger,1882, into Rhombophryne Boettger, 1880, rendersthe following name changes: Rhombophryne al-luaudi (Mocquard, 1901) new combination;Rhombophryne coudreaui (Angel, 1938) newcombination; Rhombophryne laevipes (Mocquard,1895) new combination.

ARTHROLEPTIDAE

(1) Arthroleptis Smith, 1849. The synonymy ofSchoutedenella de Witte, 1921, with ArthroleptisSmith, 1849, results in the following revived com-binations: Arthroleptis crusculum Angel, 1950; A.discodactyla (Laurent, 1954); A. hematogaster(Laurent, 1954); A. lameerei de Witte, 1921; A.loveridgei de Witte, 1933; A. milletihorsini Angel,1922; A. mossoensis (Laurent, 1954); A. nimbaen-sis Angel, 1950; A. phrynoides (Laurent, 1976);A. pyrrhoscelis Laurent, 1952; A. schubotzi Nie-den, 1911 ‘‘1910’’; A. spinalis Boulenger, 1919;A. sylvatica (Laurent, 1954); A. troglodytes Poyn-ton, 1963; A. vercammeni (Laurent, 1954); A. xen-ochirus Boulenger, 1905; A. xenodactyla Boulen-ger, 1909; A. xenodactyloides Hewitt, 1933; A.zimmeri Ahl, 1925 ‘‘1923’’.

HYPEROLIIDAE

(1) Hyperolius Rapp, 1842. The synonymy ofNesionixalus Perret, 1976, with Hyperolius Rapp,1842 (and recognition of Nesionixalus as a sub-genus), results in the following revived combi-nations: Hyperolius (Nesionixalus) molleri (Be-driaga, 1892); Hyperolius (Nesionixalus) thomen-sis Bocage, 1886.

CERATOBATRACHIDAE

(1) Ingerana Dubois, 1987 ‘‘1986’’. Treatmentof Liurana Dubois, 1987 ‘‘1986’’, as a synonymof Ingerana results in three name changes: Inger-ana alpina (Huang and Ye, 1997) new combina-tion; I. medogensis (Fei, Ye, and Huang, 1997)new combination; I. reticulata (Zhao and Li,1984) new combination.

PHRYNOBATRACHIDAE

(1) Phrynobatrachus Gunther, 1862. PlacingDimorphognathus Boulenger, 1906, into the syn-onymy of Phrynobatrachus Gunther, 1862, ren-ders Phrynobatrachus africanus (Hallowell, 1858‘‘1857’’) new combination. Placing PhrynodonParker, 1935, into the synonymy of Phrynobatra-chus Gunther, 1862, renders Phrynobatrachussandersoni (Parker, 1935) new combination.

PYXICEPHALIDAE

(1) Amietia Dubois, 1987 ‘‘1986’’. Placing Af-rana Dubois, 1992, into the synonymy of AmietiaDubois, 1987 ‘‘1986’’, results in the followingname changes: Amietia amieti (Laurent, 1976)new combination; A. angolensis (Bocage, 1866)new combination; A. desaegeri (Laurent, 1972)new combination; A. dracomontana (Channing,1978) new combination; A. fuscigula (Dumeril


and Bibron, 1841) new combination; A. inyangae(Poynton, 1966) new combination; A. johnstoni(Gunther, 1894 ‘‘1893’’) new combination; A. ru-wenzorica (Laurent, 1972) new combination; A.vandijki (Visser and Channing, 1997) new com-bination.

DICROGLOSSIDAE: DICROGLOSSINAE

(1) Annandia Dubois, 1992. Treatment as a ge-nus produces a single new combination: Annandiadelacouri (Angel, 1928) new combination. (Thiscombination was implied by Dubois, 2005.)

(2) Eripaa Dubois, 1992. Treatment as a genusproduces a single new combination: Eripaa fas-ciculispina (Inger, 1970) new combination.

(3) Nanorana Gunther, 1896. Placement ofChaparana Bourret, 1939, and Paa Dubois, 1975,into the synonymy of Nanorana Gunther, 1896,provides the following name changes: Nanoranaaenea (Smith, 1922) new combination; N. annan-dalii (Boulenger, 1920) new combination; N. ar-noldi (Dubois, 1975) new combination; N. bar-moachensis (Khan and Tasnim, 1989) new com-bination; N. blanfordii (Boulenger, 1882) newcombination; N. bourreti (Dubois, 1987 ‘‘1986’’)new combination; N. chayuensis (Ye, 1977) newcombination; N. conaensis (Fei and Huang, 1981)new combination; N. ercepeae (Dubois, 1974‘‘1973’’) new combination; N. fansipani (Bourret,1939) new combination; N. feae (Boulenger,1887) new combination; N. hazarensis (Duboisand Khan, 1979) new combination; N. liebigii(Gunther, 1860) new combination; N. liui (Du-bois, 1987 ‘‘1986’’) new combination; N. macu-losa (Liu, Hu, and Yang, 1960) new combination;N. medogensis (Fei and Ye, 1999) new combina-tion; N. minica (Dubois, 1975) new combination;N. mokokchungensis (Das and Chanda, 2000) newcombination; N. polunini (Smith, 1951) new com-bination; N. quadranus (Liu, Hu, and Yang, 1960)new combination; N. rarica (Dubois, Matsui, andOhler, 2001) new combination; N. robertingeri(Wu and Zhao, 1995) new combination; N. ros-tandi (Dubois, 1974 ‘‘1973’’) new combination;N. sternosignata (Murray, 1885) new combina-tion; N. taihangnica (Chen and Jiang, 2002) newcombination; N. unculuanus (Liu, Hu, and Yang,1960) new combination; N. vicina (Stoliczka,1872) new combination; N. yunnanensis (Ander-son, 1879 ‘‘1878’’) new combination.

(4) Ombrana Dubois, 1992. Treatment as a ge-nus produces a single new combination: Ombranasikimensis (Jerdon, 1870) new combination.

DICROGLOSSIDAE: OCCIDOZYGINAE

(1) Occidozyga Kuhl and Van Hasselt, 1822.Replacement of Phrynoglossus Peters, 1867, into

the synonymy of Occidozyga Kuhl and Van Has-selt, 1822, presents the following revived combi-nations: Occidozyga baluensis (Boulenger, 1896);O. borealis (Annandale, 1912); O. celebensisSmith, 1927; O. diminutivus (Taylor, 1922); O.floresianus Mertens, 1927; O. laevis (Gunther,1858); O. magnapustulosus (Taylor and Elbel,1958); O. martensii (Peters, 1867); O. semipal-matus Smith, 1927; O. sumatrana (Peters, 1877);O. vittatus (Andersson, 1942).

RHACOPHORIDAE

(1) Chiromantis Peters, 1854. The synonymy ofChirixalus Boulenger, 1893, with Chiromantis Pe-ters, 1854, presents the following new combina-tions: Chiromantis cherrapunjiae (Roonwal andKripalani, 1966 ‘‘1961’’) new combination; C.doriae (Boulenger, 1893) new combination; C.dudhwaensis (Ray, 1992) new combination; C.hansenae (Cochran, 1927) new combination; C.laevis (Smith, 1924); C. nongkhorensis (Cochran,1927) new combination; C. punctatus (Wilkinson,Win, Thin, Lwin, Shein, and Tun, 2003) newcombination; C. shyamrupus (Chanda and Ghosh,1989) new combination; C. simus (Annandale,1915) new combination; C. vittatus (Boulenger,1887) new combination.

(2) Feihyla new genus. We place only Philau-tus palpebralis Smith, 1924, into Feihyla, as Feih-yla palpebralis (Smith, 1924), although we expectother species to be placed in this genus as dataemerge.

(3) Kurixalus Ye, Fei, and Dubois, 1999. Be-cause the content of Kurixalus is controversial(see Delorme et al., 2005), we list the species weregard as being in this monophyletic group: Ku-rixalus eiffingeri (Boettger, 1895); K. idiootocus(Kuramoto and Wang, 1987) new combination;and provisionally Kurixalus verrucosus (Boulen-ger, 1893) new combination (based on the tree,data undisclosed, presented by Delorme et al.,2005).

RANIDAE

Because of the extensive changes in ranid tax-onomy, we provide a listing of all recognized gen-era and species, noting new combinations.

(1) Amolops Cope, 1865. Amolops bellulus Liu,Yang, Ferraris, and Matsui, 2000; A. chakrataen-sis Ray, 1992; A. chunganensis (Pope, 1929); A.cremnobatus Inger and Kottelat, 1998; A. daiyu-nensis (Liu and Hu, 1975); A. formosus (Gunther,1876 ‘‘1875’’); A. gerbillus (Annandale, 1912); A.granulosus (Liu and Hu, 1961); A. hainanensis(Boulenger, 1900 ‘‘1899’’); A. himalayanus (Bou-lenger, 1888); A. hongkongensis (Pope and Rom-er, 1951); A. jaunsari Ray, 1992; A. jinjiangensis


Su, Yang, and Li, 1986; A. kangtingensis (Liu,1950); A. kaulbacki (Smith, 1940); A. larutensis(Boulenger, 1899); A. liangshanensis (Wu andZhao, 1984); A. lifanensis (Liu, 1945); A. loloen-sis (Liu, 1950); A. longimanus (Andersson, 1939‘‘1938’’); A. mantzorum (David, 1872 ‘‘1871’’);A. marmoratus (Blyth, 1855); A. mengyangensisWu and Tian, 1995; A. monticola (Anderson,1871); A. nepalicus Yang, 1991; A. ricketti (Bou-lenger, 1899); A. spinapectoralis Inger, Orlov, andDarevsky, 1999; A. tormotus (Wu, 1977); A. tor-rentis (Smith, 1923); A. tuberodepressus Liu andYang, 2000; A. viridimaculatus (Jiang, 1983); A.wuyiensis (Liu and Hu, 1975).

(2) Babina Thompson, 1912. Babina adeno-pleura (Boulenger, 1909) new combination; B.caldwelli (Schmidt, 1925) new combination; B.chapaensis (Bourret, 1937) new combination; B.daunchina (Chang, 1933) new combination; B.holsti (Boulenger, 1892) new combination; B. lini(Chou, 1999) new combination; B. pleuraden(Boulenger, 1904) new combination; B. psaltes(Kuramoto, 1985) new combination; B. subaspera(Barbour, 1908).

(3) Clinotarsus Mivart, 1869. Clinotarsus cur-tipes (Jerdon, 1854 ‘‘1853’’).

(4) Glandirana Fei, Ye, and Huang, 1991‘‘1990’’. Glandirana emeljanovi (Nikolskii, 1913)new combination; G. minima (Ting and T’sai,1979); G. rugosa (Temminck and Schlegel, 1838)new combination; R. tientaiensis (Chang, 1933‘‘1933–1934’’) new combination.

(5) Huia Yang, 1991. Huia absita Stuart andChan-ard, 2005; H. amamiensis (Matsui, 1994)new combination; H. andersonii (Boulenger,1882) new combination; H. anlungensis (Liu andHu, 1973) new combination; H. archotaphus (In-ger and Chan-ard, 1997) new combination; H.bacboensis (Bain, Lathrop, Murphy, Orlov, andHo, 2003) new combination; H. banaorum (Bain,Lathrop, Murphy, Orlov, and Ho, 2003) new com-bination; H. cavitympanum (Boulenger, 1893);Huia chapaensis (Bourret, 1937) new combina-tion; H. chloronota (Gunther, 1876 ‘‘1875’’) newcombination; H. daorum (Bain, Lathrop, Murphy,Orlov, and Ho, 2003) new combination; H. exiliv-ersabilis (Li, Ye, and Fei, 2001) new combination;H. grahami (Boulenger, 1917) new combination;H. graminea (Boulenger, 1900 ‘‘1899’’) new com-bination; H. hainanensis (Fei, Ye, and Li, 2001)new combination; H. hejiangensis (Deng and Yu,1992) new combination; H. hmongorum (Bain,Lathrop, Murphy, Orlov, and Ho, 2003) new com-bination; H. hosii (Boulenger, 1891) new combi-nation; H. iriodes (Bain and Nguyen, 2004) newcombination; H. ishikawae (Stejneger, 1901) newcombination; H. jingdongensis (Fei, Ye, and Li,2001) new combination; H. junlianensis (Huang,

Fei, and Ye, 2001) new combination; H. khalam(Stuart, Orlov, and Chan-ard, 2005) new combi-nation; H. kuangwuensis (Liu and Hu, 1966) newcombination; H. leporipes (Werner, 1930) newcombination; H. livida (Blyth, 1856 ‘‘1855’’) newcombination; H. lungshengensis (Liu and Hu,1962) new combination; H. margaretae (Liu,1950) new combination; H. masonii (Boulenger,1884); H. megatympanum (Bain, Lathrop, Mur-phy, Orlov, and Ho, 2003) new combination; H.melasma Stuart and Chan-ard, 2005; H. modigli-anii (Doria, Salvidio, and Tavano, 1999); H. mor-afkai (Bain, Lathrop, Murphy, Orlov, and Ho,2003) new combination; H. narina (Stejneger,1901) new combination; H. nasica (Boulenger,1903); H. nasuta Li, Ye, and Fei, 2001 new com-bination; H. schmackeri (Boettger, 1892) newcombination; H. sinica (Ahl, 1927 ‘‘1925’’) newcombination; H. sumatrana Yang, 1991; H. su-pranarina (Matsui, 1994) new combination; H.swinhoana (Boulenger, 1903) new combination;H. tabaca (Bain and Nguyen, 2004) new combi-nation; H. tiannanensis (Yang and Li, 1980) newcombination; H. trankieni (Orlov, Ngat, and Ho,2003) new combination; H. utsunomiyaorum(Matsui, 1994) new combination; H. versabilis(Liu and Hu, 1962) new combination; H. wuch-uanensis (Xu, 1983) new combination.

(6) Humerana Dubois, 1992. Humerana hu-meralis (Boulenger, 1887) new combination; Hu-merana miopus (Boulenger, 1918) new combina-tion; Humerana oatesii (Boulenger, 1892) newcombination.

(7) Hydrophylax Fitzinger, 1843. Hydrophylaxalbolabris (Hallowell, 1856); H. albotuberculatus(Inger, 1954) new combination; H. amnicola (Per-ret, 1977) new combination; H. asperrima (Perret,1977) new combination; H. chalconotus (Schle-gel, 1837) new combination; H. crassiovis (Bou-lenger, 1920) new combination; H. darlingi (Bou-lenger, 1902) new combination; H. everetti (Bou-lenger, 1882) new combination; H. galamensis(Dumeril and Bibron, 1841); H. igorotus (Taylor,1922) new combination; H. kampeni (Boulenger,1920) new combination; H. lemairei (de Witte,1921) new combination; H. lepus (Andersson,1903) new combination; H. longipes (Perret,1960) new combination; H. luzonensis (Boulen-ger, 1896) new combination; H. macrops (Bou-lenger, 1897) new combination; H. malabaricus(Tschudi, 1838); H. occidentalis (Perret, 1960)new combination; H. parkerianus (Mertens,1938); H. raniceps (Peters, 1871) new combina-tion; H. tipanan (Brown, McGuire, and Diesmos,2000) new combination.

(8) Hylarana Tschudi, 1838. Hylarana ery-thraea (Schlegel, 1837); H. guentheri (Boulenger,1882); H. macrodactyla Gunther, 1858; H. taipe-


hensis (Van Denburgh, 1909) new combination;Hylarana tytleri Theobald, 1868.

(9) Lithobates Fitzinger, 1843. L. areolatus(Baird and Girard, 1852) new combination; Lith-obates berlandieri (Baird, 1859) new combina-tion; Lithobates blairi (Mecham, Littlejohn, Old-ham, Brown, and Brown, 1973) new combination;Lithobates brownorum (Sanders, 1973); L. bwana(Hillis and de Sa, 1988) new combination; L. cap-ito (LeConte, 1855) new combination; L. cates-beianus (Shaw, 1802) new combination; L. chi-chicuahutla (Cuellar, Mendez-De La Cruz, andVillagran-Santa Cruz, 1996) new combination; L.chiricahuensis (Platz and Mecham, 1979) newcombination; L. clamitans (Latreille, 1801) newcombination; L. dunni (Zweifel, 1957) new com-bination; L. fisheri (Stejneger, 1893) new combi-nation; L. forreri (Boulenger, 1883) new combi-nation; L. grylio (Stejneger, 1901) new combina-tion; L. heckscheri (Wright, 1924) new combina-tion; L. johni (Blair, 1965) new combination; L.juliani (Hillis and de Sa, 1988) new combination;L. lemosespinali (Smith and Chiszar, 2003) newcombination; L. macroglossa (Brocchi, 1877) newcombination; L. maculatus (Brocchi, 1877) newcombination; L. magnaocularis (Frost and Bag-nara, 1974) new combination; L. megapoda (Tay-lor, 1942) new combination; L. miadis (Barbourand Loveridge, 1929) new combination; L. mon-tezumae (Baird, 1854) new combination; L. neo-volcanicus (Hillis and Frost, 1985) new combi-nation; L. okaloosae (Moler, 1985) new combi-nation; L. omiltemanus (Gunther, 1900) new com-bination; L. onca (Cope, 1875) new combination;L. palmipes (Spix, 1824); L. palustris (LeConte,1825) new combination; L. pipiens (Schreber,1782) new combination; L. psilonota (Webb,2001) new combination; L. pueblae (Zweifel,1955) new combination; L. pustulosus (Boulenger,1883) new combination; L. septentrionalis (Baird,1854) new combination; L. sevosus (Goin andNetting, 1940) new combination; L. sierramad-rensis (Taylor, 1939 ‘‘1938’’) new combination;L. spectabilis (Hillis and Frost, 1985) new com-bination; L. sphenocephalus (Cope, 1886) newcombination; L. sylvaticus (LeConte, 1825) newcombination; L. tarahumarae (Boulenger, 1917)new combination; L. taylori (Smith, 1959) newcombination; L. tlaloci (Hillis and Frost, 1985)new combination; L. vaillanti (Brocchi, 1877)new combination; L. vibicarius (Cope, 1894) newcombination; L. virgatipes (Cope, 1891) newcombination; L. warszewitschii (Schmidt, 1857)new combination; L. yavapaiensis (Platz andFrost, 1984) new combination; L. zweifeli (Hillis,Frost, and Webb, 1984) new combination.

(10) Meristogenys Yang, 1991: Meristogenysamoropalamus (Matsui, 1986); M. jerboa (Gun-

ther, 1872); M. kinabaluensis (Inger, 1966); M.macrophthalmus (Matsui, 1986); M. orphnocnem-is (Matsui, 1986); M. phaeomerus (Inger and Gri-tis, 1983); M. poecilus (Inger and Gritis, 1983);M. whiteheadi (Boulenger, 1887).

(11) Nasirana Dubois, 1992. Nasirana alticola(Boulenger, 1882) new combination.

(12) Pelophylax Fitzinger, 1843.37 Pelophylaxbedriagae (Camerano, 1882 ‘‘1881’’) new com-bination; P. bergeri (Gunther, 1986) new combi-nation; P. cerigensis (Beerli, Hotz, Tunner, Hep-pich, and Uzzell, 1994) new combination; P. cho-senicus (Okada, 1931) new combination; P. cre-tensis (Beerli, Hotz, Tunner, Heppich, and Uzzell,1994) new combination; P. demarchii (Scortecci,1929) new combination; P. epeiroticus (Schnei-der, Sofianidou, and Kyriakopoulou-Sklavounou,1984) new combination; P. fukienensis (Pope,1929) new combination; P. hubeiensis (Fei andYe, 1982); P. kurtmuelleri (Gayda, 1940‘‘1939’’); P. lateralis (Boulenger, 1887) new com-bination; P. lessonae (Camerano, 1882 ‘‘1881’’)new combination; P. nigrolineatus (Liu and Hu,1960 ‘‘1959’’); P. nigromaculatus (Hallowell,1861 ‘‘1860’’); P. perezi (Seoane, 1885); P. plan-cyi (Lataste, 1880) new combination; P. porosus(Cope, 1868) new combination; P. ridibundus(Pallas, 1771); P. saharicus (Boulenger, 1913)new combination; P. shqipericus (Hotz, Uzzell,Gunther, Tunner, and Heppich, 1987) new com-bination; P. shuchinae (Liu, 1950); P. tengger-ensis (Zhao, Macey, and Papenfuss, 1988) newcombination; P. terentievi (Mezhzherin, 1992)new combination.

(13) Pterorana Kiyasetuo and Khare, 1986.Pterorana khare Kiyasetuo and Khare, 1986.

(14) Pulchrana Dubois, 1992. P. banjarana(Leong and Lim, 2003) new combination; P. bar-amica (Boettger, 1900) new combination; P. de-bussyi (van Kampen, 1910) new combination; P.glandulosa (Boulenger, 1882) new combination;P. grandocula (Taylor, 1920) new combination; P.laterimaculata (Barbour and Noble, 1916) newcombination; P. luctuosa (Peters, 1871) new com-bination; P. mangyanum (Brown and Guttman,2002) new combination; P. melanomenta (Taylor,1920) new combination; P. moellendorffi (Boett-ger, 1893) new combination; P. picturata (Bou-lenger, 1920) new combination; P. siberu (Dring,

37 We concur with Bogart (2003) that named hybri-dogens/kleptons are composed of hybrids, not coveredby regulated Linnaean nomenclature. This does notmean that we reject the utilitarian naming conventionssuggested by Dubois (1982: e.g., Pelophylax kl. escu-lentus, Pelophylax kl. grafi), for denoting kinds of frog,only that these names do not represent taxa in any evo-lutionary/phylogenetic sense, but instead are ‘‘kinds’’ offrogs.


McCarthy, and Whitten, 1990) new combination;P. signata (Gunther, 1872) new combination; P.similis (Gunther, 1873) new combination.

(15) Rana Linnaeus, 1758. Rana amurensisBoulenger, 1886; R. arvalis Nilsson, 1842; R.asiatica Bedriaga, 1898; R. aurora Baird and Gi-rard, 1852; R. boylii Baird, 1854; R. cameraniBoulenger, 1886; R. cascadae Slater, 1939; R.chaochiaoensis Liu, 1946; R. chensinensis David,1875; R. chevronta Hu and Ye, 1978; R. dalma-tina Fitzinger In Bonaparte, 1839; R. draytoniiBaird and Girard, 1852; R. dybowskii Gunther,1876; R. graeca Boulenger, 1891; R. holtzi Wer-ner, 1898; R. huanrenensis Fei, Ye, and Huang,1991 ‘‘1990’’; R. iberica Boulenger, 1879; R. it-alica Dubois, 1987 ‘‘1985’’; R. japonica Boulen-ger, 1879; R. johnsi Smith, 1921; R. kukunorisNikolskii, 1918; R. kunyuensis Lu and Li, 2002;R. latastei Boulenger, 1879; R. longicrus Stejne-ger, 1898; R. luteiventris Thompson, 1913; R. ma-crocnemis Boulenger, 1885; R. multidenticulataChou and Lin, 1997; R. muscosa Camp, 1917; R.okinavana Boettger, 1895; R. omeimontis Ye andFei, 1993; R. ornativentris Werner, 1903; R. piricaMatsui, 1991; R. pretiosa Baird and Girard, 1853;R. pyrenaica Serra-Cobo, 1993; Rana sakuraiiMatsui and Matsui, 1990; R. sangzhiensis Shen,1986; R. sauteri Boulenger, 1909; R. tagoi Okada,1928; R. temporaria Linnaeus, 1758; R. tsushi-mensis Stejneger, 1907; R. weiningensis Liu, Hu,and Yang, 1962; R. zhengi Zhao, 1999; R. zhen-haiensis Ye, Fei, and Matsui, 1995.

(16) Sanguirana Dubois, 1992. Sanguiranasanguinea (Boettger, 1893). new combination; S.varians (Boulenger, 1894) new combination.

(17) Staurois Cope, 1865. Staurois latopalma-tus (Boulenger, 1887); S. natator (Gunther, 1858);S. nubilis (Mocquard, 1890); S. tuberilinguis Bou-lenger, 1918.

(18) Sylvirana Dubois, 1992. Sylvirana arfaki(Meyer, 1875 ‘‘1874’’) new combination; S. attig-ua (Inger, Orlov, and Darevsky, 1999) new com-bination; S. aurantiaca (Boulenger, 1904) newcombination; S. aurata (Gunther, 2003) new com-bination; S. bannanica (Rao and Yang, 1997) newcombination; S. celebensis (Peters, 1872) newcombination; S. chitwanensis (Das, 1998) newcombination; S. cubitalis (Smith, 1917) new com-bination; S. daemeli (Steindachner, 1868) newcombination; S. danieli (Pillai and Chanda, 1977)new combination; S. elberti (Roux, 1911) newcombination; S. faber (Ohler, Swan, and Daltry,2002) new combination; S. florensis (Boulenger,1897) new combination; S. garoensis (Boulenger,1920) new combination; S. garritor (Menzies,1987) new combination; S. gracilis (Gravenhorst,1829) new combination; S. grisea (van Kampen,1913) new combination; S. jimiensis (Tyler, 1963)new combination; S. kreffti (Boulenger, 1882)new combination; S. latouchii (Boulenger, 1899)new combination; S. leptoglossa (Cope, 1868)new combination; S. maosonensis (Bourret, 1937)new combination; S. margariana (Anderson, 1879‘‘1878’’) new combination; S. milleti (Smith,1921) new combination; S. moluccana (Boettger,1895) new combination; S. montivaga (Smith,1921) new combination; S. mortenseni (Boulen-ger, 1903) new combination; S. nigrotympanica(Dubois, 1992) new combination; S. nigrovittata(Blyth, 1856 ‘‘1855’’) new combination; S. no-vaeguineae (van Kampen, 1909) new combina-tion; S. papua (Lesson, 1831) new combination;S. persimilis (van Kampen, 1923) new combina-tion; S. spinulosa (Smith, 1923) new combination;S. supragrisea (Menzies, 1987) new combination;S. temporalis (Gunther, 1864) new combination;S. volkerjane (Gunther, 2003) new combination.

Documents

THE AMPHIBIAN TREE OF LIFE