Upload
hugo-hunter
View
222
Download
1
Embed Size (px)
Citation preview
Text Classification
Eric Doi
Harvey Mudd College
November 20th, 2008
Kinds of Classification
Language Hello. My name is Eric. Hola. Mi nombre es Eric. こんにちは。 私の名前はエリックである . 你好。 我叫 Eric 。
Kinds of Classification Type
“approaches based on n-grams obtain generalization by concatenating”*
Subject: McCain and Obama use it tooYou have received this message because you opted in to receives Sund Design pecial offers via email. Login to your member account to edit your email subscription . Click here to unsubscribe.
ACAAGATGCCATTGTCCCCCGGCCTCCTG
*(Bengio)
Difficulties
Dictionary? Generalization? Over 500,000 words in English language
(and over one million if counting scientific words)
Typos/OCR errors Loan words
We practice ballet at the café. Nous pratiquons le ballet au café.
Approaches
Unique letter combinationsLanguage String
English “ery”
French “eux”
Gaelic “mh”
Italian “cchi“
Dunning, Statistical Identification of Language
Approaches
“Unique” letter combinationsLanguage String
English “ery”
French “milieux”
Gaelic “farmhand”
Italian “zucchini“
Dunning, Statistical Identification of Language
Approaches
“Unique” letter combinationsLanguage String
English “ery”
French “milieux”
Gaelic “farmhand”
Italian “zucchini“ Requires hand-coding; what about other
languages (6000+)?
Dunning, Statistical Identification of Language
Approaches
Try to minimize: Hand-coded knowledge Training data Input data (isolating phrases?)
Dunning, “Statistical Identification of Language.” 1994.
Bengio, “A Neural Probabilistic Language Model.” 2003.
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams: (Professor, Keller)
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams: (Keller, is)
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams: (is, not)
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams: (not, a)
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams: (a, goth)
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams:
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams: (P, r, o)
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams: (r, o, f)
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams: (o, f, e)
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams: (f, e, s)
Statistical Approach: N-Grams
N-grams are sequences of n elements
Professor Keller is not a goth.
Word-level bigrams:
Char-level trigrams:
Statistical Approach: N-Grams
Mined from 1,024,908,267,229 words Sample 4-grams
serve as the infrastructure 500
serve as the initial 5331
serve as the injector 56
Statistical Approach: N-Grams Informs some notion of probability
Normalize frequencies P(serve as the initial) > P(serve as the injector) Classification
P(English | serve as the initial) >P(Spanish | serve as the initial)
P(Spam | serve as the injector) <P(!Spam | serve as the injector)
Statistical Approach: N-Grams
But what about P(serve as the ink)? = 0? P(serve as the ink) = P(vxvw aooa *%^$) = 0? How about P(sevre as the initial)?
Statistical Approach: N-Grams
How do we smooth out sparse data? Additive smoothing Interpolation Good-Turing estimate Backoff Witten-Bell smoothing Absolute discounting Kneser-Key smoothing
MacCartney
Statistical Approach: N-Grams
Additive smoothing
Interpolation- consider smaller n-grams as well, e.g. (serve as the), (serve)
Backoff- use interpolation only if necessary
MacCartney
Statistical Approach: Results
Dunning: Compared parallel translated texts in English and Spanish 20 char input, 50K training: 92% accurate 500 char input, 50K training: 99.9%
Modified for comparing DNA sequences of Humans, E-Coli, and Yeast
Neural Network Approach
Bengio et. al, “A Neural Probabilistic Language Model.” 2003:
N-gram does handle sparse data well However, there are problems:
Narrow consideration of context (~1–2 words) Does not consider semantic/grammatical
similarity:“A cat is walking in the bedroom”“A dog was running in a room”
Neural Network Approach
The general idea:1. Associate with each word in the vocabulary
(e.g. size 17,000) a feature vector (30–100 features)
2. Express the joint probability function of word sequences in terms of feature vectors
3. Learn simultaneously the word feature vectors and the parameters of the probability function
References Dunning, “Statistical Identification of Language.”
1994. Bengio, “A Neural Probabilistic Language Model.”
2003. MacCartney, “NLP Lunch Tutorial: Smoothing.”
2005.