62
1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly, VA 20151 Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

  • Upload
    others

  • View
    6

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

1

Taxonomic Identification of Traces using Non-human DNA

David A. StoneyStoney Forensic, Inc.

14101-G Willard Road, Chantilly, VA 20151

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 2: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

2

• Differences from human DNA

identification applications

• Overview of the approach

• Examples of applications to

predictive source attribution cases

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Taxonomic Identification of Traces using Non-human DNA

Page 3: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

3

DNA

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 4: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Mutations

4Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 5: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

More Mutations

5Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 6: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

The Role of Mutation and

Inheritance in DNA Identification

• Mutations arise in individuals

• Mutations spread through populations

• Mutations may become fixed or polymorphic in:

– Populations

– Varieties

– Species

– Genera, etc.

6Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 7: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Fragment Length vs. Specific

SequenceExample of Fragment Length Polymorphism:

ATATATA

AATATAAT

AATATAAAT

AAATATAAAATA

Example of Specific Sequence Comparison:

ATAGATACATTCCATATCCGG

ATAGATTCATACCTTAGGCGG

7Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 8: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Types of Molecular Markers

• Variable Number Tandem Repeats (VNTR)

• Restriction Fragment Length Polymorphism (RFLP)

• Amplified Fragment Length Polymorphism (AFLP)

• Short Tandem Repeat (STR)

• Single Nucleotide Polymorphism (SNP)

• DNA Sequence Data

8Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 9: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Choosing a Molecular Marker

• What is the required level of identification?

– Family vs Genus and Species

– Species vs Population

– Population vs Individual

• What reference data are available?

9Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 10: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Traditional DNA Applications

• Forensic

– Human Identification

• Human

– Medical Genotyping Applications

• Non-Human

– Evolutionary and Developmental Biology

10Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 11: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Identification at the Population

or Individual Level

• Requires Population Frequency Data

– Combined DNA Index System (CODIS) uses Short

Tandem Repeats or STRs

11Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 12: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Human Identification Markers

• STR Profile, i.e. CODIS

• Mitochondrial Sequence

• Y-STR Profile

• Region of Origin (Population Level)

– Alu Repeats

– Y-STRs

– SNPs

12Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 13: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Human Identification Markers

• STR Profile, i.e. CODIS

• Mitochondrial Sequence

• Y-STR Profile

• Region of Origin (Population Level)

– Alu Repeats

– Y-STRs

– SNPs

13

All within one species

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 14: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Non-Human Identification Markers

• DNA Sequence Data

– Plants: rbcL, trnL, ITS

– Vertebrates: Cytochrome B

– Arthropods: 16S, Cytochrome Oxidase

– Fungi: ITS, 18S

– Bacteria: 16S

• Population Level Data

14Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 15: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Non-Human Identification Markers

• DNA Sequence Data

– Plants: rbcL, trnL, ITS

– Vertebrates: Cytochrome B

– Arthropods: 16S, Cytochrome Oxidase

– Fungi: ITS, 18S

– Bacteria: 16S

• Population Level Data

15

Among 300,000 species

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 16: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Available Reference Data

• Published and Unpublished Gene

Frequency Data for Populations

• GenBank DNA Sequence Database

– National Center for Biotechnology Information

(NCBI)

16Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 17: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Available Reference Data

• Published and Unpublished Gene

Frequency Data for Populations

• GenBank DNA Sequence Database

– National Center for Biotechnology Information

(NCBI)

References are abundant for species with

economic, medical, or academic interest

17Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 18: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

18

DNA Extraction

PCR Amplification of

Selected Markers

Obtain Sequence

BLAST Inquiry

Phylogenetic Analysis

Sample Processing Overview

Develop Inferences

from DNA Analyses

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 19: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

19Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Single Elements vs. Mixtures

Page 20: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

20

DNA Extraction

PCR Amplification of

Selected Markers

Obtain Sequence

BLAST Inquiry

Phylogenetic Analysis

Sample Processing Overview

Direct

Amplification

Develop Inferences

from DNA Analyses

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 21: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

21

DNA Extraction

PCR Amplification of

Selected Markers

Obtain Sequence

BLAST Inquiry

Phylogenetic Analysis

Sample Processing Overview

Direct

Amplification

Develop Inferences

from DNA Analyses

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Mixture

Page 22: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

22

DNA Extraction

PCR Amplification of

Selected Markers

Obtain Sequence

BLAST Inquiry

Phylogenetic Analysis

Ligation

Transformation

Screening of Clones

Sample Processing Overview

Direct

Amplification

Develop Inferences

from DNA Analyses

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Mixture

Page 23: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Extraction

23Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 24: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Quantification

• Standard protocol in many procedures

– UV absorption at specific wavelengths

– Comparison to standards of known

concentration

• Trace samples can often be assumed to

have a minimal DNA concentration

24Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 25: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

25

PCR Target

Areas of interest (high variability

among different species)

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 26: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

26

PCR Target

Areas of interest (high variability

among different species)

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Flanking regions that have negligible variability

among species of interest

Page 27: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Polymerase Chain Reaction (PCR)

27Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 28: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Amplification of Target DNA

28Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 29: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Electrophoresis of Products

29Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 30: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

30

DNA Mixture Separation via Ligation and Transformation

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 31: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

31

Restriction Digest of Cloned Mixtures

to Identify Different Elements

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 32: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

32

En mass Sequencing of Clones

Dye Terminator Cycle Sequencing Reaction

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 33: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence Interpretation

Identification of the Closest Relative

– Evaluate DNA Sequence Variation

33Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 34: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

34

En mass Sequencing of Clones

Dye Terminator Cycle Sequencing Reaction

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 35: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence Interpretation

Identification of the Closest Relative

– Evaluate DNA Sequence Variation

– Comparisons to Reference Data Sequences

• Basic Local Alignment Search Tool

35Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 36: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

36

Example of a Partial Lonicera rbcL Alignment

>emb|X87389.1|LORBCLGEN L.orientalis chloroplast DNA rbcL gene Length = 1402

Unknown: 1 gttggattcaaagcgggtgttaaagattacaaattgacttattatactcctgactatgaa 60

||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||

Match: 5 gttggattcaaagcgggtgttaaagattacaaattgacttattatactcctgaatatgaa 64

Unknown: 61 accaaagatactgatatcttggcagcattccgagtaactcctcaacccggagttccgcct 120

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Match: 65 accaaagatactgatatcttggcagcattccgagtaactcctcaacccggagttccgcct 124

Unknown: 121 gaagaagcgggggccgcggtagctgctgaatcttcaaccggtacatggacaactgtgtgg 180

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Match: 125 gaagaagcgggggccgcggtagctgctgaatcttcaaccggtacatggacaactgtgtgg 184

Unknown: 181 accgatggacttaccagccttgatcgttacaaagggcgatgctaccacatcgagcccgtt 240

||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||

Match: 185 accgatggacttaccagccttgatcgttacaaagggcgatgctacggcatcgagcccgtt 244

Unknown: 241 gctggagaagaaaatcaatttattgcttatgtagcttacccattagacctttttgaagaa 300

||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||

Match: 245 gctggagaagaaaatcaatatattgcttatgtagcttacccattagacctttttgaagaa 304

Unknown: 301 ggttctgttactaacatgtttacttctattgagggtaatgtatttgggttcaaagccctg 360

||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||

Match: 305 ggttctgttactaacatgtttacttctattgtgggtaatgtatttgggttcaaagccctg 364

Unknown: 361 cgcgctctacgtctggaagatctgcgaatccctgtctcttatgttaaaactttccaaggc 420

|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||

Match: 365 cgcgctctacgtctggaagatctgcgaatccctgctgcttatgttaaaactttccaaggc 424

Page 37: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

37

Score EAccession Number Top 20 Sequence Alignments: (bits) Value

emb|X87389.1|LORBCLGEN L.orientalis chloroplast DNA rbcL gene 1631 0.0

emb|Z29672.1|DSCLRUBI3 D.sessifolia chloroplast rbcL gene f... 1588 0.0

emb|Y10704.1|PRY10704 P.rupestris chloroplast rbcL gene, pa... 1564 0.0

emb|Y10706.1|MCY10706 M.coulteriana chloroplast rbcL gene, ... 1556 0.0

emb|Y10700.1|TGY10700 T.glandulifera chloroplast rbcL gene,... 1503 0.0

emb|Y10705.1|NJY10705 N.jatamansii chloroplast rbcL gene, p... 1501 0.0

gb |AF156734.1|AF156734 Scabiosa sp. Albach 39 ribulose 1,5-... 1493 0.0

gb |L11202.2|PUQCPRBCL Pittosporum japonicum ribulose 1,5-bi... 1489 0.0

emb|AJ235794.1|SPR235794 Stachyurus praecox chloroplast atp... 1489 0.0

gb |L13864.1|DIZCHLORO Dipsacus sativus chloroplast ribulose... 1487 0.0

emb|X87394.1|QVRBCLGEN Q.verdonii chloroplast DNA rbcL gene 1483 0.0

emb|Z29670.1|DSCLRUBI1 D.spinosa chloroplast rbcL gene for ... 1483 0.0

gb |U50261.1|PTU50261 Pittosporum tobira ribulose-1,5-bispho... 1477 0.0

emb|Y10698.1|KIY10698 K.intermedia chloroplast rbcL gene, p... 1477 0.0

emb|AJ403005.1|SLO403005 Sphenostemon lobosporus partial ch... 1473 0.0

emb|X87398.1|VRRBCLGEE V.rhytidophyllum chloroplast DNA rbc... 1469 0.0

gb |L11682.1|SMHCPRBCL Symphoricarpos albus chloroplast rubi... 1467 0.0

gb |L11177.1|CPJCPRBCL Carpenteria californica chloroplast r... 1465 0.0

gb |U50254.1|MAU50254 Melanophylla alnifolia ribulose-1,5-bi... 1465 0.0

dbj |D44582.1|PUQCPRC31 Pittosporum tobira chloroplast DNA f... 1463 0.0

emb|Y10703.1|PBY10703 P.bracteata chloroplast rbcL gene, pa... 1461 0.0

BLAST Results for Lonicera

Page 38: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Alignments

Ulmus_americana GGCGTCACACGCCGTTG::CCCCCCCAACCCCGTCGGGGCAAGCGGG

Ulmus_crassifolia GGCGTCACACACCGTTGCCCCCCCCAAACCCCGTCGGGGCAGAAGGG

Ulmus_rubra GGCGTCACACACCGTTG:CCCCCCCAAACCCCGTCGGGGAAGAAGGG

Ulmus_crassifolia GGCGTCACACACCGTTG:CCCCCCCAAACCCCGTCGGGGCAAAAGGG

SS1-6 Clothing 67 GGCGTCACACACCATTG:CCCCCCCAAACCCCGTCGGGGAAGAAGGG

38Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 39: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence InterpretationIdentification of the Closest Relative

– Evaluate DNA Sequence Variation

– Comparisons to Reference Data Sequences

• Basic Local Alignment Search Tool

– Phylogenetic Analysis

39Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 40: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

Phylogenetic Methods

• Models of Sequence Evolution

– Maximum Likelihood

– Parsimony

– Distance

• Bootstrapping

40Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 41: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

41

Cupressus arizonica

Cupressus montana

Juniperus navicularis

Juniperus communis

Juniperus ashei

Juniperus ashei

Juniperus ashei

Juniperus ashei

SS1-6 Clothing ITS 119

Juniperus badia

Juniperus oxycedrus

Juniperus macrocarpa

Juniperus drupacea

Juniperus virginiana

0.005 substitutions/site

Maximum Likelihood

Juniperus ITS

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 42: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

42

Cupressus arizonica

Cupressus montana

Juniperus navicularis

Juniperus ashei

Juniperus ashei

Juniperus ashei

SS1-6 Clothing ITS 119

Juniperus ashei

Juniperus badia

Juniperus oxycedrus

Juniperus macrocarpa

Juniperus drupacea

Juniperus communis

Juniperus virginiana

100

73

57

81

54

70

99

Bootstrap

Bootstrap Analysis

Juniperus ITS

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 43: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence InterpretationIdentification of the Closest Relative

– Evaluate DNA Sequence Variation

– Comparisons to Reference Data Sequences

• Basic Local Alignment Search Tool

– Phylogenetic Analysis

43Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 44: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence InterpretationIdentification of the Closest Relative

– Evaluate DNA Sequence Variation

– Comparisons to Reference Data Sequences

• Basic Local Alignment Search Tool

– Phylogenetic Analysis

– Specificity influenced by

• Quality of DNA

• Variability among close relatives

• Available reference data

44Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 45: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

DNA Sequence InterpretationIdentification of the Closest Relative

– Evaluate DNA Sequence Variation

– Comparisons to Reference Data Sequences

• Basic Local Alignment Search Tool

– Phylogenetic Analysis

– Specificity influenced by

• Quality of DNA

• Variability among close relatives

• Available reference data

– Additional Reference Data as Needed

• Type your own nearest relatives

45Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 46: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

46

• Use the results of analyses on one sample

for inference of origin from, or exposures to

geographical areas, environments,

activities and processes.

Predictive Source Attribution

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 47: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

47

• Use the results of analyses on one sample

for inference of origin from, or exposures to

geographical areas, environments,

activities and processes.

Predictive Source Attribution

• Use the results of analyses on two samples

to infer the strength of association based

on their degree of correspondence, relative

to other possible sources.

Comparative Source Attribution

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 48: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

48

Examples (non-mixtures)

• Thorn from shoe– fungal sequence

• Tiny stain on letter– Citrus reticulata (mandarin orange)

750 mm

• Red-brown stain on clothing– Cyamopsis tetragonoloba (guar, cluster bean)

commercial emulsifier (e.g. ice cream)

– Theobroma cacao (cocoa)

source of cocoa, and chocolate

Page 49: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

49

Genus-Level IdentificationsArachis (Fabaceae, peanut)

Camellia (Theaceae) This genus includes tea.

Cicer (Fabaceae, chick-pea)

Cucurbita (Curcurbitaceae, pumpkins and gourds)

Cucumis (Cucurbitaceae, cucumber)

Epilobium (Onagraceae; a weedy genus)

Fortunella (Rutaceae, kumquat)

Juniperus (Cuppresaceae, juniper)

Lactuca (Asteraceae, lettuce)

Lycopersicon (Solanaceae) Includes tomato.

Musa (Musaceae, banana)

Pinus (Pinaceae, Pine)

Pittosporum (Pittosporaceae, ornamental shrub)

Prunus (Rosaceae, Including peaches and cherry)

Rosa (Rosaceae, rose, a large genus)

Species-Level IdentificationsAcer saccharum (Aceraceae, sugar maple)

Allium sativum (Liliaceae, garlic)

Betula alba (Betulaceae, white or paper birch)

Cannabis sativa (Cannabaceae, marijuana, or hemp)

Coriandrum sativum (Apiaceae, coriander)

Ilex cornuta (Aquifoliaceae, Chinese holly)

Juglans regia (Juglandaceae, English walnut)

Medicago sativa (Fabaceae, alfalfa)

Sinapis alba (Brassicaceae, mustard)

Vicia faba (Fabaceae, broad bean)

Family Level IdentificationsAnacardiaceae. Includes pistachio and mango.

Betulaceae This family includes birch.

Brassicaceae A large, weedy family

Fagaceae. This family contains the oaks, beeches, and chestnuts.

Juglandaceae This family includes many nut producing species.

Ulmaceae. This family includes elm.

Poaceae Grasses. 5 or 6 different types were detected.

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Example: Vacuumed Dust from

a Set of Clothing

Page 50: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

50

DNA Results from Vacuumed Dusts

36 Taxa identified

– 10 to species level

– 15 to sub-genus or genus level

– 11 to family or sub-family level

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 51: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

51

36 Taxa identified

– 13 correspond to pollen taxa

– 15 new taxa

– 8 can be attributable to foods

DNA Results from Vacuumed Dusts

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 52: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

52

Taxa Reasonably Attributable to Foods

Brassica oleracea: Cabbage, brussel sprouts, broccoli, kohlrabi, cauliflower, or kale

Cucumis: Cantaloupe, melons, gourds, cucumber

Foeniculum or Anethum: Fennel or Dil

Juglans regia: English walnut

Medicago sativa: Alfalfa sprouts

Phaseolus vulgaris: Bean, common bean, caraota, feijao, french bean, kidney bean, haricot bean, field bean, poroto, snap bean, string bean, frijol, wax bean

Ginkgo biloba: Maiden-hair; Dietary supplement, herbal tea

Nicotiana tabacum: Tobacco

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 53: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

53

Soil on Tusks

Photo credit: Les Craven, Medford Tribune

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 54: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

54

Taxa Identified

Plants

Colophospermum mopane (mopane tree)

Flueggea (bushweed)

Bauhinia (orchid tree)

Triticum (wheat genus)

Zea (corn genus)

FABACEAE close to genus Podalyria or Calpurnia

Fungi

Aspergillus penicilloides

Eurotium amstelodami

Malassezia

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 55: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

55

Taxonomic Viability Estimates

(Diospyros mespiliformis)

African ebony or jackal berry

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 56: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

56

Taxonomic Occurrence Estimates

(Colophospermum mopane)

Mopane

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Page 57: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

57

• Botanical DNA is present in trace samples

and useful for taxonomic identification

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Summary Points & Observations

Page 58: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

58

• Botanical DNA is present in trace samples

and useful for taxonomic identification

• Botanical DNA ≠ Pollen– Complementary signals, both extremely useful

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Summary Points & Observations

Page 59: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

59

• Botanical DNA is present in trace samples

and useful for taxonomic identification

• Botanical DNA ≠ Pollen– Complementary signals, both extremely useful

• Dusts are (much) richer in extractable,

useful botanical DNA than is soil

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Summary Points & Observations

Page 60: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

60

• Botanical DNA is present in trace samples

and useful for taxonomic identification

• Botanical DNA ≠ Pollen– Complementary signals, both extremely useful

• Dusts are (much) richer in extractable,

useful botanical DNA than is soil

• Technology is changing rapidly– “Next Generation” methods avoid cloning and

utilizes intense computation

– More amenable to comparative workStoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Summary Points & Observations

Page 61: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

61

Thanks to:Robert Bever & Bode Technology GroupMatthew Cimino

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

Taxonomic Identification of Traces using Non-human DNA

Page 62: Taxonomic Identification of Traces using Non-human DNA · 1 Taxonomic Identification of Traces using Non-human DNA David A. Stoney Stoney Forensic, Inc. 14101-G Willard Road, Chantilly,

62

Taxonomic Identification of Traces using Non-human DNA

David A. StoneyStoney Forensic, Inc.

14101-G Willard Road, Chantilly, VA 20151

Stoney Forensic, Inc. NIJ/FBI 2011 Trace Evidence Symposium 8-11-11

[email protected]