Synergistic targeting of the regulatory and catalytic · 2017. 12. 15. · evidence that phosphodiesterase 4 (PDE4) inhibition also suppresses BCR signals. We show that combination

1

Synergistic targeting of the regulatory and catalytic

subunits of PI3Kδ in mature B cell malignancies

Jeffrey D. Cooney1*, An-Ping Lin1*, Daifeng Jiang1, Long Wang1, Avvaru N.

Suhasini1, Jamie Myers1, ZhiJun Qiu1, Albert Wölfler2, Heinz Sill2

and Ricardo C.T. Aguiar1,3,4

1. Division of Hematology and Medical Oncology, Department of Medicine, University of Texas

Health Science Center at San Antonio, San Antonio, TX 78229, USA;

2. Division of Hematology, Medical University of Graz, Graz A-8036, Austria;

3. Greehey Children's Cancer Research Institute, University of Texas Health Sciences Center at

San Antonio, San Antonio, TX 78229;

4. South Texas Veterans Health Care System, Audie Murphy VA Hospital, San Antonio, San

Antonio, TX 78229.

* Equal contribution

Running Title: basis for the synergism between PDE4 and PI3Kδ inhibitors

Keywords: Lymphoma, phosphodiesterase 4, cyclic-AMP, PI3K

Grant support: This work was supported by CPRIT awards RP150277 and RP170146, and LLS-

6524-17 (to RCTA); JDC was supported by F30 CA206343 (NCI/NIH); Core Facilities supported

by P30 CA054174.

The authors declare no potential conflicts of interest

Word count: 4777; Figures 5

Correspondence to:

Ricardo Aguiar, MD PhD

Department of Medicine

University of Texas Health Science Center at San Antonio

7703 Floyd Curl Drive, San Antonio, TX, 78229

Phone: 1-210-567-4860

Email: [email protected]

Research. on March 13, 2021. © 2017 American Association for Cancerclincancerres.aacrjournals.org Downloaded from

Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on December 15, 2017; DOI: 10.1158/1078-0432.CCR-17-2218

http://clincancerres.aacrjournals.org/

2

Translational Relevance

The pharmacological inhibition of B cell receptor (BCR) signaling has changed the treatment of

mature B cell malignancies. The clinical success of these agents has been somewhat tempered

by the emergence of clinical resistance, incomplete responses, and toxicity. We provide

evidence that phosphodiesterase 4 (PDE4) inhibition also suppresses BCR signals. We show

that combination of the FDA-approved PDE4 inhibitor roflumilast with the PI3Kδ inhibitor

idelalisib is synergistic against diffuse large B cell lymphoma, in vitro and in vivo. At the basis of

this synergism is the effect of roflumilast towards the P85 regulatory subunit, in parallel with the

inhibition of catalytic P110 by idelalisib. These data support the repurposing of roflumilast for the

treatment of mature B cell malignancies in combination with immune-chemotherapy or other

biological agents that target the BCR signals.




3

Abstract

Purpose: Aberrant activation of the B cell receptor (BCR) is implicated in the pathogenesis of

mature B-cell tumors, a concept validated in part by the clinical success of inhibitors of the BCR-

related kinases BTK (Bruton's tyrosine kinase) and PI3Kδ (Phosphatidylinositol-4,5-

bisphosphate 3-kinase delta). These inhibitors have limitations, including the paucity of

complete responses, acquired resistance, and toxicity. Here we examined the mechanism by

which the cyclic-AMP/PDE4 signaling axis suppresses PI3K, towards identifying a novel

mechanism-based combinatorial strategy to attack BCR-dependency in mature B-cell

malignancies.

Experimental Design: We used in vitro and in vivo diffuse large B-cell lymphoma (DLBCL) cell

lines and primary chronic lymphocytic leukemia (CLL) samples to pre-clinically evaluate the

effects of the combination of the FDA-approved phosphodiesterase 4 (PDE4) inhibitor

roflumilast and idelalisib on cell survival and tumor growth. Genetic models of gain- and loss-of-

function were employed to map multiple signaling intermediaries downstream of the BCR.

Results: Roflumilast elevates the intracellular levels of cyclic-AMP and synergizes with

idelalisib in suppressing tumor growth and PI3K activity. Mechanistically, we show that

roflumilast suppresses PI3K by inhibiting BCR-mediated activation of the P85 regulatory

subunit, distinguishing itself from idelalisib, an ATP-competitive inhibitor of the catalytic P110

subunit. Using genetic models, we linked the PDE4-regulated modulation of P85 activation to

the oncogenic kinase SYK.

Conclusions: These data demonstrate that roflumilast and idelalisib suppress PI3K by distinct

mechanisms, explaining the basis for their synergism, and suggest that the repurposing of

PDE4 inhibitors to treat BCR-dependent malignancies is warranted.




4

Introduction

In mature B lymphocytes, the signals relayed by engagement of the B cell receptor

(BCR) stimulate proliferation and are pro-survival. Unsurprisingly, malignant B cells seize on

these signals for their own benefit, at the same time establishing a BCR-dependency that

exposes a potential vulnerability (1). Exploiting this vulnerability, with BTK and PI3Kδ inhibitors,

has become an important strategy for the treatment of mature B cell malignancies, perhaps

most notably in non-Hodgkin’s lymphomas (NHL) and chronic lymphocytic leukemia (CLL)(2).

Although successful in many instances, the use of ibrutinib (BTK inhibitor) and idelalisib

(PI3Kδ inhibitor) has not been devoid of limitations. Ibrutinib displays off-target activity that may

undermine its therapeutic indexes, it only rarely induces complete remissions, and the

emergence of mutant clones raise concerns about acquired resistance(3). Some of these

concerns are being addressed with second generation BTK inhibitors (4). Conversely, further

clinical development of idelalisib has been limited by toxicity (5,6). Serious adverse events have

been noted when idelalisib is used as a single agent and in particular when in combination with

other biological agents (7,8). These limitations are of consequence given the essential role of

PI3K in transducing the tonic and the pathological BCR signals, and, hence, the already

demonstrated potential for its targeted inhibition in the treatment of mature B cell malignancies.

Thus, the identification of alternative approaches to suppress the aberrant PI3K activity,

especially those with a concrete path for clinical development, is an important task.

The second messenger 3’,5’-cyclic adenosine monophosphate (cyclic-AMP) delivers

inhibitory signals to cells of the innate and adaptive immune system(9). In B lymphocytes, the

intra-cellular levels of cyclic-AMP are controlled by phosphodiesterase 4 (PDE4)(9). We have

recently explored the role of the cyclic-AMP/PDE signaling axis in mature B cell malignancies, in

particular diffuse large B-cell lymphoma (DLBCL). We correlated high PDE4 expression/activity

with poor outcome in DLBCL(10,11), linked the growth suppressive effects of cyclic-AMP in

malignant B cells to the inhibition of BCR-related signals(10,12,13), and demonstrated pre-

clinically and clinically the safety and activity of the FDA-approved PDE4 inhibitor roflumilast for

the treatment of mature B cell tumors(13-15). A common theme of these investigations was the

consistent suppression of PI3K activity upon genetic or pharmacological depletion of PDE4.

These data were also of interest because the mechanism by which PDE4 inhibitors suppress

PI3K activity is likely to be distinct from that of ATP-competitor kinase inhibitor Idelalisib,

highlighting the potential for synergism and clinical applicability of the combination of PDE4 and

PI3Kδ inhibitors.

In this report, we show that cyclic-AMP, in a PDE4-dependent manner suppresses

PI3Kδ lipid kinase activity by inhibiting the BCR-mediated phosphorylation of the P85 regulatory

subunit. Further, using genetic models, we show that the cyclic-AMP/PDE4 effects on P85 are

controlled by SYK. Importantly, owing in part to their distinct mechanism of action, we

demonstrate in vitro, in vivo and in primary human tumors that the combination of idelalisib with

roflumilast synergistically inhibits the growth of DLBCL and CLL. Lastly, we demonstrate that the




5

benefits of PDE4 inhibition on BCR-dependent tumors extend beyond PI3K suppression and

include also down-modulation of BTK activity, predominantly SYK/BLNK-associated manner.




6

Materials and Methods

Cell lines and primary tumors

Human DLBCL cell lines (SU-DHL4, SU-DHL6, SU-DHL10, WSU-NHL, OCI-Ly3, OCI-Ly7, OCI-

Ly10, OCI-Ly18, HBL-1) and primary chronic lymphocytic leukemia (CLL) cells were cultured at

37°C, 5% CO2 in RPMI-1640 medium supplemented with either 10% fetal bovine serum (FBS)

or 20% FBS (OCI-Ly3, OCI-Ly10), 100 U/mL penicillin, 100 g/mL streptomycin, 2 mM L-

glutamine, and 10 mM N-2-hydroxyethylpiperazine-N -2-ethanesulfonic acid (HEPES) buffer, as

we described(16). Cell lines were defined as either PDE4B-low/null or PDE4-high using western

blotting (Supplementary Figure 1). All DLBLC cell lines were preexistent in our group and were

obtained earlier from ATCC, DSMZ cell bank, Margaret Shipp (OCI-Ly10) (Dana-Farber Cancer

Institute), or Sandeep Dave (HBL-1) (Duke University). The cell lines identity was confirmed by

variable number tandem repeat analysis and tested for Mycoplasma contamination (by PCR)

before the project started, and within the past 6 months. We strived to keep the cell lines in

continuous culture for only ~15 days, except for when this was incompatible with the

experimental design (e.g., generation of CRISPR KO clones by limiting dilution). Primary CLL

cells were obtained from ten adult patients diagnosed at the Division of Hematology, Medical

University of Graz, Austria. Biobanking was performed in accordance with institutional

guidelines and written informed consent was obtained from each subject. Use of anonymized

samples was approved by Review Boards of the participating Institutions, and the study

performed in accordance to the Declaration of Helsinki. Clinical, cytogenetics and immune

phenotypic characteristics of the CLL cases are described in Supplementary Table 1. Cell lines

authenticity was determined by STR profiling and Mycoplasma contamination excluded by a

highly sensitive PCR testing, as we reported (17).

Reagents and antibodies

Roflumilast was purchased from Santa Cruz Biotechnology (Dallas, TX), idelalisib was

purchased from MedChem Express (Monmouth Junction, NJ) or Selleckchem (Houston, TX),

and forskolin was from LC Laboratories (Woburn, MA). Antibodies utilized included: total and

phospho-PI3K p85/p55 subunit (Tyr458/Tyr199) (#4292 and #4228, respectively), total and

phospho-BTK (Tyr223) (#56044 and #5082, respectively), total and phospho-AKT (Thr308)

(#9275 and #9272, respectively), all from Cell Signaling (Beverly, MA), PDE4B and SYK (H-56 -

sc-25812 and 4D10 - sc-1240, respectively, from Santa Cruz Biotechnology), β-actin and FLAG

(#A-5316 and #F1804, respectively, from Sigma Aldrich, St Louis, MO).

Genetic models of PDE4B and SYK expression

The generation of SU-DHL6 cells expressing PDE4B wild-type (WT) or PDE4B-

phosphodiesterase inactive (PI) mutant was reported earlier (10). The PDE4B-PI sequence

contains a single amino acid substitution (H234S) in the catalytic domain that abolishes the

enzyme’s activity. Generation of the SU-DHL6 cells stably expressing a SYK constitutive-active

(CA) mutant has also been described (12). This SYK isoform contains three amino acid




7

substitutions (Y629-631F); these three C-terminal tyrosil residues are responsible for

phosphorylation-dependent inhibitory conformational changes, and their mutation constitutively

activates SYK kinase function (12). To generate PDE4B knockout (KO) cells, guideRNA (gRNA)

sequences mapping to first coding exon that is common to all PDE4B isoforms were designed

(CATCTCACTGACAGACCGGT//AGG and ATTAGCAATGGAAACGCTGG//AGG) using the

CRISPR Design Tool (http://crispr.mit.edu/), and cloned into the lentivirus vector CRISPRv2-

puromycin, as we reported(18). Following lentivirus particles generation, the DLBCL cell lines

OCI-Ly18 and HBL-1 were transduced by spinoculation, selected with puromycin and clonal

population derived by limiting dilution. Control cells were generated with empty lentiCRISPR v2-

puromycin. Efficacy of knockout was determined by western blotting.

Immunoblotting

Relevant cell lysates were isolated and subjected to electrophoresis in sodium dodecyl sulfate

polyacrylamide gel electrophoresis (SDS-PAGE) as described (19). For detection of phospho-

BTK and phospho-P85/P55 DLBCL cell lines were cultured overnight with medium

supplemented with 2% FBS, pretreated with DMSO, roflumilast or idelalisib, followed by BCR

activation with 20 μg/ml of a goat anti-human IgG + IgM antibody for 5 minutes (#109-006-127,

Jackson ImmunoResearch Laboratories, West Grove, PA). The densitometric quantification of

the relevant WB signals was performed with the ImageJ software.

PI3K assay

Whole-cell lysates from PDE4-low DLBCL cell lines exposed to vehicle control or forskolin, or

from PDE4-high cell lines exposed to roflumilast and/or idelalisib (all for 6h) were used for

quantification of PI3K activity with an ELISA-based assay (Echelon Biosciences, Salt Lake City,

UT), as we described earlier(13). In brief, whole-cell extracts (50μg) were added to a mixture of

PI(4,5)P2 substrate and reaction buffer and incubated at room temperature for 2-3 hours. The

reaction was stopped by adding PI(3,4,5)P3 detector, transferred to a PI3K ELISA plate and

incubated with secondary detector. Plates were read at 450 nm on a FLUOStar OPTIMA

instrument. To calculate the PI3K activity we used nonlinear regression to construct a

PI(3,4,5)P3 standard sigmoidal curve with variable slope. Subsequently, we interpolated the

absorbance values from each sample thus defining the amount of PI(3,4,5)P3 generated (i.e.,

PI3K activity).

Cell proliferation, viability and apoptosis

Proliferation of DLBCL cell lines in response to increasing doses of the PDE4 inhibitor

roflumilast (1.25 to 10µM) and the PI3Kδ inhibitor idelalisib (0.03 to 0.6µM), used as single

agents or in combination, was measured using the CellTiter Proliferation assay (MTS; Promega,

Madison, WI). Dosages of idelalisib were optimized for each cell line using published data(20)

as an initial guide, while doses of roflumilast were optimized based on our previous

experience(10,12-14). Growth inhibition was determined at 48h or 72h and normalized to data

obtained from vehicle control exposed cells. All assays were performed in triplicate and at least



http://crispr.mit.edu/


8

3 independent biological replicates were completed for each DLBCL cell line. The viability of the

DLBCL cell lines in response to these compounds was assessed using dual-fluorescence

staining with acridine orange (AO) and propidium iodide (PI) (ViaStain dye, Nexcelom

Bioscience, Lawrence, MA) and counted on the Cellometer Vision CBA Image Cytometer

(Nexcelom Biosciences, Lawrence, MA).

The inhibitory effects of these agents were also examined in primary CLL cells following

exposure to vehicle control (DMSO), roflumilast (10µM) and/or idelalisib (0.5µM). In these

instances, after 72h of incubation cell viability was determined using the acridine orange (AO)

and propidium iodide (PI) dyes in the automated Cellometer Vision CBA Image Cytometer

(Nexcelom Biosciences, Lawrence, MA), and at 96h by PE-conjugated Annexin V (BD

BioSciences) staining followed by fluorescence activated cell sorting (FACS) analysis on a BD

LSR II Flow Cytometer.

Xenograft model of human DLBCL

Two independent cohorts of 6-week-old nude mice were investigated (n=47). Mice were sub-

lethally irradiated (400 cGy) and inoculated with 5 x106 cells (OCI-Ly7) in the right flank,

followed by daily monitoring and tumor measurement using an electronic caliper. When the

tumor volume reached approximately 100mm3, the mice were randomized into four treatment

arms: 1) vehicle control (dimethyl sulfoxide, DMSO, in distilled water, intra-peritoneal, I.P.), 2)

roflumilast (5mg/kg I.P.), 3) idelalisib (30 mg/kg I.P.), 4) roflumilast (5mg/kg I.P.) + idelalisib

(30mg/kg I.P.). Mice were dosed daily and treatment efficacy was monitored with bi-weekly

measurement of tumor size. Mice were sacrificed on treatment day 14, and tumors collected for

further analysis. For toxicity analysis, mice (n=20) were treated as above and tail vein blood

collected before treatment strated (day 0) and every five days thereafter for red and white blood

cell counting with the Cellometer Vision CBA Image Cytometer. In addition, serum levels of

alanine transaminase (ALT) were quantified on treatment day 15 using an ALT Assay Kit

(Abcam, ab105134, Cambridge, MA) and according to the manufacturer's instructions. These

studies were approved by the Institutional Animal Care and Use Committee of the UTHSCSA.

Statistics

The statistical significance was determined with two-tailed Student’s t-test, one-way or two-way

ANOVA tests with Bonferroni post- tests. In all instances, P < 0.05 was considered significant.

Data analyses were perfomed in Prism software (version 5.0; GraphPad) and Excel software

(Microsoft). Dose–effect curves were calculated with the CompuSyn software (ComboSyn, Inc.)

and used to generate the combination index (CI), reflecting the synergistic activity of the drugs

tested - CI= <0.1 very strong synergism; CI=0.1-0.3 strong synergism; CI=0.3-0.85 synergism;

CI=1.45-3.33 antagonism, as we described (14).




9

Results

Dual PDE4 and PI3Kδ inhibition synergistically suppresses DLBCL growth in vitro

Six PDE4B-expressing DLBCL cell lines representative of the molecular heterogeneity of this

disease [3 germinal center B cell (GCB), and 3 activated B cell-like, (ABC) DLBCL] were

exposed to increasing doses of the FDA-approved PDE4 inhibitor roflumilast and the PI3Kδ

inhibitor idelalisib, as single agents or in combination. While the growth inhibition with single

agents was in most instances modest, combining PDE4 and PI3Kδ inhibitors markedly

suppressed the growth and diminished the viability of both GCB- and ABC-DLBCL cell lines with

very strong synergism (CI<0.1) (Figure 1A, Supplementary Figures 1 and 2). We validated the

role of PDE4B and the specificity of roflumilast effects with CRISPR-based PDE4B KO in the

cell lines HBL1 and OCI-Ly18. In brief, deletion of PDE4B rendered these cells significantly

more sensitive to idelalisib than their isogenic control expressing PDE4B, thus fully

recapitulating the effects of roflumilast (Supplementary Figure 3). The effects of drug

combination PDE4 inhibition, with its consequent increase in intra-cellular levels of cyclic-AMP,

is believed to suppress multiple pro-growth signaling nodes in malignant mature B lymphocytes

(see Cooney & Aguiar for review(9)). Prominent amongst these targets is the PDE4-dependent

cyclic-AMP-mediated suppression of PI3K activity that we reported earlier (10). Thus, we

reasoned that at least part of the synergism between roflumilast and idelalisib relates to a

deeper PI3Kδ suppression. To test this idea, we quantified PI3K activity in this DLBCL cell line

panel following exposure to vehicle control, roflumilast and/or idelalisib. In all cases, we

detected a significantly more pronounced suppression of PI3K activity in cells treated with the

combination of these two classes of inhibitors than with each agent alone (Figure 1B). Further,

we showed that these effects were transduced downstream, and that AKT phosphorylation was

more deeply suppressed in cells exposed to the roflumilast/idelalisib combination

(Supplementary Figure 4). We concluded that PDE4 and PI3Kδ inhibition synergistically

suppress DLBCL growth and PI3K activity in vitro.

The combination of roflumilast and idelalisib is active in vivo

To expand on these in vitro observations, we generated xenograft models of human DLBCL

(OCI-Ly7). In these assays, following subcutaneous tumor engraftment, the mice were

randomized into four treatment arms: 1) vehicle control, 2) the PDE4 inhibitor roflumilast as

single agent, 3) the PI3Kδ inhibitor idelalisib as single agent, and 4) the combination of

roflumilast and idelalisib, using doses commensurate to those approved for human use (based

on normalization to body surface area). The mice were dosed daily for 14 days and, in

agreement with the in vitro data, those treated with the combination of roflumilast and idelalisib

displayed significantly reduced tumor growth relative to that of those treated with single agents

(p<0.05, two-sided Student’s t-test) (Figure 2A). Of interest, no overt clinical signs of acute

toxicity (decrease in body weight and food intake or signs of dehydration) were observed in

mice treated with the combination of roflumilast and idelalisib. We also monitored hematological

and liver toxicity in this context. The number of erythrocytes and leukocytes in the peripheral




10

blood did not change significantly across the four treatment arms (Supplementary Figure 5).

Likewise, serum levels of ALT were similar among distinct treatment cohorts (Supplementary

Figure 5). However, these data should be interpreted with caution because the hepatotoxicity

associated with idelalisib dosing is immune-mediated (6) and the DLBCL xenograft model that

we develop demands an immunedeficient mouse. Thus, future work will be necessary to define

the impact of roflumilast on idelalisib’s immune-mediated toxicity.

Our hypothesis is that at least part of the clinical activity associated with the roflumilast and

idelalisib combination relates to a deeper suppression of PI3K activity. To validate this concept

in vivo, we quantified the PI3K activity in a total of 24 xenografted tumors (6 tumors/treatment

arm) and detected a significantly more pronounced suppression of PI3K function in isogenic

tumors from mice treated with the roflumilast + idelalisib vs. single agents (p<0.001, two-sided

Student’s t-test) (Figure 2B). We concluded that the combination of PDE4 and PI3Kδ inhibitors

is clinically active in DLBCL in vivo.

Beneficial combination of PDE4 and PI3Kδ inhibitors in primary mature B cell

malignancies

Our earlier data(9,10,12,14), as well as result from other groups(21,22) suggested that PDE4

inhibition may be effective in a broad array of mature B cell malignancies, including CLL. Thus,

when seeking to test the activity of the combination of roflumilast and idelalisib in primary

tumors, we used samples collected from patients with CLL, a disease also known to rely on

aberrant BCR signaling and that responds to idelalisib(23,24). In these assays, CLL cells from a

heterogeneous cohort of 10 patients (Supplementary Table 1) were exposed in vitro to vehicle

control, roflumilast and/or idelalisib and the rate of apoptosis determined at 96h post-drug

exposure using Annexin V staining and FACS analysis. In all 10 cases, the induction of

apoptosis was significantly higher in cells exposed to the combination of roflumilast and

idelalisib, than to each agent alone (p<0.0001, two-way ANOVA, p<0.001 Bonferroni post-test)

(Figure 3A). In agreement with earlier reports(25,26), there was a variability in the responses to

PDE4(25) and PI3Kδ(26) inhibitors when used as single agents, likely a reflection of the genetic

heterogeneity that typifies CLL. Nonetheless, in each case the combination was superior to

either agent alone. For a subset of these samples with sufficient starting material (n=8), we also

measured cell viability at 72h post-exposure. In agreement with the apoptosis data, we found

that the combination of roflumilast and idelalisib suppressed cell viability more effectively than

each agent alone (Supplementary Figure 6). Lastly, sufficient materials were available from

three patients to quantify PI3K activity; we found that the superior induction of apoptosis noted

in CLL cells exposed to the combination of PDE4 and PI3Kδ inhibitors associated with a more

pronounced suppression of PI3K (p<0.05, two-sided Student’s t-test) (Figure 3B), as noted in

DLBCL cell lines in vitro and in vivo. From these assays, we concluded that the benefit of

combining roflumilast with idelalisib can be captured in primary tumors, and that the clinical

activity of this combinatorial approach is not limited to DLBCL.




11

PDE4 controls the phosphorylation levels of P85 to regulate PI3K activity

We reported earlier on the ability of PDE4 inhibitors to suppress PI3K activity in mature B cell

tumors, in vitro and in vivo(10,13). However, the mechanistic basis for these effects has

remained elusive. As PI3K does not contain a cyclic-AMP binding site, we hypothesized that the

increase in intra-cellular cyclic-AMP associated with PDE4 inhibition indirectly suppresses

PI3K’s P110 catalytic activity, possibly by modulating PI3K’s P85/P55 regulatory subunit. The

rationale to consider P85/P55 a putative cyclic-AMP/PDE4 target is strengthened by the known

interplay between P85/P55 and SYK(27-29), a BCR-related kinase that we showed earlier to be

inhibited by cyclic-AMP(12). To test this concept, we examined whether PDE4 inhibition

suppresses the phosphorylation level of P85/55’s tyrosine 458/199 (Y458/Y199), residues that

when phosphorylated release the inhibitory effect of P85/55 on P110, thus inducing PI3K’s

activity downstream to the BCR(30). First, using three PDE4B-low/null DLBCL cell lines, we

showed that increasing the intracellular levels of cyclic-AMP markedly decreased the phospho-

levels of Y458/Y199 in P85/P55, which expectedly led to a significant suppression in PI3K

activity (Figure 4A, Supplementary Figure 7). Next, using a set of PDE4B-high DLBCL cell

lines, we confirmed that the PDE4 inhibitor roflumilast suppressed P85/P55 phosphorylation and

consequently PI3K activity (Figure 4B). We validated the role of PDE4B in this setting, and the

specificity of roflumilast effects, by showing that in PDE4B KO DLBCL cell lines, but not in

PDE4B-competent isogenic controls, cAMP significantly suppressed phosphorylation of

P85/P55 (Supplementary Figure 3).

To corroborate the essential role of PDE4B in controlling the cyclic-AMP-mediated suppression

of P85/P55 phosphorylation, we stably expressed PDE4B-WT or a PDE4B-phosphodiesterase-

inactive (-PI) variant in the PDE4B-null DLBCL cell line SU-DHL6. Next, we induced intracellular

cyclic-AMP in these models and showed that the phosphorylation of P85/P55 (and secondary to

it, PI3K activity) was suppressed in PDE4B-PI-expressing cells. Conversely, expression of

PDE4B-WT rapidly hydrolyzed cyclic-AMP and the phosphorylation of P85/P55 remained

unchanged (Figure 4C, Supplementary Figure 7). We speculate that SYK mediates at least part

of the suppressive effects of cyclic-AMP towards P85/P55 phosphorylation and PI3K activity. To

test this proposition, we stably expressed a SYK constitutively active variant (SYK-CA, Y629-

31F) in the PDE4B-null DLBCL cell line SU-DHL6; we posited that if SYK is upstream to

P85/P55, then, even in the absence of PDE4B, cyclic-AMP will have a limited impact on

P85/P55 phosphorylation and PI3K activity. Indeed, in cells expressing SYK-CA, P85/P55

phosphorylation and PI3K activity were unchanged following elevation of intracellular cyclic-

AMP levels (Figure 4D, Supplementary Figure 7). This behavior mimics that of the isogenic cells

ectopically expressing PDE4B-WT, in which cyclic-AMP is promptly hydrolyzed to the inactive

5’AMP (Figure 4D, Supplementary Figure 7). Notably, expression of the SYK-CA mutant did not

elevate the baseline P85/P55 phospho-levels or PI3K activity, supporting the robustness of this

model to determine the role of SYK in transducing cyclic-AMP effects towards P85/55.

These observations suggested a mechanistic explanation for the superior PI3Kδ suppression

found with the combination of roflumilast and idelalisib, when compared to each agent alone




12

(Figures 1B, 2B and 3B). Our data indicate that roflumilast suppresses PI3K activity by blocking

the activating phosphorylation of the P85/P55 regulatory subunits downstream to the BCR,

while idelalisib functions as an ATP-competitive inhibitor of P110 catalytic sub-unit(31). To

further support this assertion, we confirmed that differently from roflumilast, idelalisib does not

elevate cAMP levels (Supplementary Figure 7) or modify P85/P55 phosphorylation (Figure 4E).

We concluded that PDE4 inhibition suppresses PI3K activity via a SYK-dependent down-

regulation of P85/P55 phosphorylation, which reestablishes the inhibitory effects of the

regulatory P85 subunit on the catalytic P110(30). The synergism between roflumilast and

idelalisib may at least in part reflect their distinct model of PI3Kδ inhibition.

BTK inhibition may contribute to the synergism between roflumilast and idelalisib.

Our earlier studies showed that PDE4 inhibition down-modulates SYK activity in malignant

mature B cells(12). In support of these data, we showed here that the expression of a

constitutively active SYK variant blunted the effect of PDE4 inhibition towards P85/P55

phosphorylation and PI3K activity (Figure 4D). SYK, at least in part via phosphorylation of the

adaptor protein BLNK, is also critical for the activation of the lymphomagenic BTK

signals(29,32). Thus, we considered the possibility that the benefit of combining roflumilast to

idelalisib derived not only from a deeper PI3Kδ inhibition, but also from a PDE4-dependent and

SYK-mediated suppression of BTK. To test this idea, we first determined whether exposure to

roflumilast modified the phosphorylation of tyrosine 223 (Y223), a site for auto-phosphorylation

and a surrogate marker for BTK activity, in a panel of DLBCL cell lines that represent the

molecular heterogeneity of this disease. Remarkably, treatment with roflumilast led to a marked

suppression of phospho-BTK levels in all six cell lines examined (Figure 5A). Further supporting

the role of the cyclic-AMP/PDE4 axis in modulating BTK in DLBCL, as well as highlighting the

specificity of the effects of roflumilast, elevating intra-cellular cyclic-AMP in PDE4-low/null

DLBCL cell lines also resulted in a major suppression of BTK activity (Figure 5B). Since BTK

activity can also positively regulated by PI3Kδ-generated PIP3 (33,34), it became important to

determine whether the inhibition of BTK noted with roflumilast treatment was simply a

consequence of PI3Kδ suppression (Figures 1-4). We reasoned that if that was the case, then

exposure of DLBCL cell lines to idelalisib would result in comparable suppression of phospho-

BTK levels. Instead, in our DLBCL cell line model idelalisib had no effect on BTK

phosphorylation (Figure 5C), suggesting that roflumilast suppression of BTK phosphorylation

downstream to the BCR may be primarily mediated by the SYK/BLNK axis, not by its effect on

PI3K. To address this possibility, we used the PDE4-null cell line model with stable ectopic

expression of the PDE4B-WT, -PI or SYK-CA. Expression of PDE4B-WT or SYK-CA, but not

PDE4B-PI, blocked the suppressive effects of cAMP towards BTK (Figure 5D). We thus

concluded that PDE4 inhibition in DLBCL suppress BTK activity in a SYK-dependent manner.

Therefore, the growth inhibitory effects of roflumilast in mature B cell malignancies may be

mediated by dual suppression of PI3Kδ and BTK.




13

Discussion

In this work, we described a combinatorial approach that synergistically suppresses PI3Kδ

activity in mature B cell malignancies. The differential targeting of P85 phosphorylation by the

PDE4 inhibitor roflumilast and of P110 catalytic activity by idelalisib provide a mechanistic

understanding for the observed in vitro and in vivo benefit of combining these two drug classes.

These preclinical observations are particularly encouraging because both agents are FDA

approved, allowing for rapid implementation of clinical initiatives. Furthermore, our in vitro and in

vivo data support the premise that when used together with roflumilast, idelalisib dosing could

be reduced to limit toxicity and improve its therapeutic index. In addition, PDE4 inhibition is

known to suppress the secretion of many of the cytokines implicated in the immune-mediated

adverse events associated with idelalisib toxicity (6,7,9). Thus, determining with confidence the

ability of PDE4 inhibitors to reduce the pro-inflammatory/auto-immune profile associated with

idelalisib administration should be one of the main end-points of an early phase clinical trial.

However, the benefit derived from repurposing roflumilast for the treatment of mature B cell

malignancies is probably not limited to suppression of PI3Kδ activity. In the present report, we

demonstrate that PDE4 inhibition also suppresses BTK activity. The data obtained from genetic

models allowed us to suggest that cyclic-AMP/PDE4 regulation of BTK may be primarily

mediated by SYK and, as we have shown before (12), BLNK, an adaptor protein that when

phosphorylated promotes the recruitment of BTK to the cell membrane for its full activation. In

the cell membrane, BTK binds to PIP3 to further activate downstream signals. Thus, the

decrease in PIP3 production that follows PI3Kδ inhibition is also known to indirectly

downmodulate BTK (35). However, in our models, idelalisib as single agent had limited/no effect

on BTK activity suggesting that roflumilast induced suppression of BTK is not simply secondary

to PI3Kδ blockade. These observations give further support to the pleiotropic benefits

associated with PDE4 inhibition in B cell tumors, perhaps in particular towards malignancies that

rely of the BCR signals for survival. These data are also relevant because a recent pre-clinical

report suggested that the combination of the dual-PI3K inhibitor copanlisib with ibrutinib in

DLBCL was more efficacious than each agent alone (36). Thus, given the demonstrated

inhibitory effect of roflumilast towards SYK, BTK and PI3K/AKT, PDE4 inhibition may improve

the efficacy of multiple therapeutic strategies that include BCR-related kinase inhibitors. Lastly,

highlighting the relevance of the cyclic-AMP/PDE4 axis to B lymphocyte function and survival,

its coordinated inhibition of P85 and BTK that we described here is reminiscent of related

immunodeficiency syndromes that can associated with inactivation of either BTK or the P85α

regulatory subunit of PI3K(37,38).

For the past several years, we have made strides in defining how the cyclic-AMP/PDE4 axis

controls the growth and survival of malignant mature B lymphocytes (reviewed in(9)). The

available evidence places the physiologic, inhibitory, cyclic-AMP input as an important

counterpoint to the pro-proliferation/survival derived from BCR activation (constitutive or

following antigen engagement). Together with the data from this report, we have demonstrated

that PDE4 inhibition, by blocking cyclic-AMP hydrolysis and elevating its intracellular




14

concentration, suppresses multiple BCR-related proteins (SYK, BTK and AKT(10,12-14)) and

lipid kinases (PI3Kδ(10,13)). We are cognizant that each single kinase inhibitor (e.g. SYK, BTK,

PI3Kδ) will be more potent towards its target than a PDE4 inhibitor, but also more narrow, while

a PDE4 blockade will act on several nodes downstream to the BCR all at once. These

observations inform clinical translation, and we envision two possible scenarios: a PDE4

inhibitor is in combination with a classical immune-chemotherapy regimen (e.g., roflumilast + R-

CHOP in BCR-dependent DLBCL) or, a PDE4 inhibitor is dosed in combination with another

biological agent (e.g., idelalisib + roflumilast), which could be tested at lower doses potentially

limiting their intrinsic toxicity. Noticeably, these are concrete goals, especially considering the

good safety profile of roflumilast in patients with B cell tumors that we reported recently (15).

Certainly, there are still knowledge gaps to be filled in our understanding of how cyclic-AMP

suppresses BCR-related signals. For example, it remains unclear if cyclic-AMP simply blocks

the phosphorylation/activation of BCR-related kinases or if also promotes the active termination

of these signals, a provoking possibility given the reported role of cyclic-AMP in activating

protein and lipid phosphatases (39,40). Likewise, the BCR-related kinases that we have shown

to be suppressed by PDE4 inhibition do not encode a canonical cyclic-AMP binding domain.

Thus, either a still to be defined non-canonical binding site is present in these proteins, or a still

undefined upstream regulator is the direct target of cyclic-AMP. Further, the regulatory P85

subunit, which we showed here is suppressed by cyclic-AMP, can form heterodimers with three

P110 isoforms (p110α, p110β and p110δ)(30), thus suggesting that the cAMP/PDE4 axis

modulates the activity of all class IA PI3Ks. Therefore, we speculate that in this context PDE4

inhibitors mimic the pan(or dual)-PI3K inhibitors, a class of agents that was recently showed to

have marked pre-clinical activity in DLBCL cell lines (36). Future work that addresses all these

issues will improve our understanding of the physiologic termination of BCR signaling and

improve clinical translation.

In summary, in this report we preclinically validated the feasibility of repurposing the PDE4

inhibitor roflumilast in combination with the PI3Kδ inhibitor idelalisib. We demonstrated that the

synergistic nature of this novel combinatorial strategy derives from distinct mechanism for

suppression of PI3K activity downstream to the BCR: down-modulation of the activating

phosphorylation of P85 by roflumilast, and the previously defined catalytic inhibition of P110 by

idelalisib. Clinical translation of these data may help mitigate the limitations encountered with

the deployment of idelalisib as a single agent or in biological combination (5-8), and bring to

fruition the full potential of PI3K inhibition in the treatment of mature B cell malignancies.




15

Acknowledgements: This work was supported by CPRIT awards RP150277 and RP170146,

and LLS-6524-17 (to RCTA); JDC was supported by 1F30CA206343-01 (NCI/NIH); Core

Facilities supported by P30 CA054174.

Authorship Contributions: J.D.C. conducted experiments, analyzed the data and wrote the

first draft of the manuscript; A-P.L, D.J., S.N.A and J.M., conducted experiments and analyzed

the data, L.W. and Z.Q. conducted animal experiments; A.W. and S.H. provided essential

reagents; R.C.T.A designed and coordinated the study, analyzed data and wrote the

manuscript, which was reviewed by all authors.




16

References: 1. Rickert RC. New insights into pre-BCR and BCR signalling with relevance to B cell

malignancies. Nature reviews Immunology 2013;13(8):578-91 doi 10.1038/nri3487. 2. Young RM, Staudt LM. Targeting pathological B cell receptor signalling in lymphoid

malignancies. Nature reviews Drug discovery 2013;12(3):229-43 doi 10.1038/nrd3937. 3. Woyach JA, Johnson AJ. Targeted therapies in CLL: mechanisms of resistance and

strategies for management. Blood 2015;126(4):471-7 doi 10.1182/blood-2015-03-585075.

4. Byrd JC, Harrington B, O'Brien S, Jones JA, Schuh A, Devereux S, et al. Acalabrutinib (ACP-196) in Relapsed Chronic Lymphocytic Leukemia. N Engl J Med 2016;374(4):323-32 doi 10.1056/NEJMoa1509981.

5. Cheah CY, Fowler NH. Idelalisib in the management of lymphoma. Blood 2016;128(3):331-6 doi 10.1182/blood-2016-02-702761.

6. Lampson BL, Kasar SN, Matos TR, Morgan EA, Rassenti L, Davids MS, et al. Idelalisib given front-line for treatment of chronic lymphocytic leukemia causes frequent immune-mediated hepatotoxicity. Blood 2016;128(2):195-203 doi 10.1182/blood-2016-03-707133.

7. Barr PM, Saylors GB, Spurgeon SE, Cheson BD, Greenwald DR, O'Brien SM, et al. Phase 2 study of idelalisib and entospletinib: pneumonitis limits combination therapy in relapsed refractory CLL and NHL. Blood 2016;127(20):2411-5 doi 10.1182/blood-2015-12-683516.

8. Cheson BD. Speed bumps on the road to a chemotherapy-free world for lymphoma patients. Blood 2016;128(3):325-30 doi 10.1182/blood-2016-04-709477.

9. Cooney JD, Aguiar RC. Phosphodiesterase 4 inhibitors have wide-ranging activity in B-cell malignancies. Blood 2016;128(25):2886-90 doi 10.1182/blood-2016-09-737676.

10. Smith PG, Wang F, Wilkinson KN, Savage KJ, Klein U, Neuberg DS, et al. The phosphodiesterase PDE4B limits cAMP-associated PI3K/AKT-dependent apoptosis in diffuse large B-cell lymphoma. Blood 2005;105(1):308-16 doi 10.1182/blood-2004-01-0240.

11. Shipp MA, Ross KN, Tamayo P, Weng AP, Kutok JL, Aguiar RC, et al. Diffuse large B-cell lymphoma outcome prediction by gene-expression profiling and supervised machine learning. Nat Med 2002;8(1):68-74 doi 10.1038/nm0102-68.

12. Kim SW, Rai D, McKeller MR, Aguiar RC. Rational combined targeting of phosphodiesterase 4B and SYK in DLBCL. Blood 2009;113(24):6153-60 doi 10.1182/blood-2009-02-206128.

13. Suhasini AN, Wang L, Holder KN, Lin AP, Bhatnagar H, Kim SW, et al. A phosphodiesterase 4B-dependent interplay between tumor cells and the microenvironment regulates angiogenesis in B-cell lymphoma. Leukemia 2016;30(3):617-26 doi 10.1038/leu.2015.302.

14. Kim SW, Rai D, Aguiar RC. Gene set enrichment analysis unveils the mechanism for the phosphodiesterase 4B control of glucocorticoid response in B-cell lymphoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2011;17(21):6723-32 doi 10.1158/1078-0432.CCR-11-0770.

15. Kelly K, Mejia A, Suhasini AN, Lin AP, Kuhn J, Karnad AB, et al. Safety and Pharmacodynamics of the PDE4 Inhibitor Roflumilast in Advanced B-cell Malignancies. Clinical cancer research : an official journal of the American Association for Cancer Research 2017;23(5):1186-92 doi 10.1158/1078-0432.CCR-16-1207.




17

16. Bouamar H, Abbas S, Lin AP, Wang L, Jiang D, Holder KN, et al. A capture-sequencing strategy identifies IRF8, EBF1, and APRIL as novel IGH fusion partners in B-cell lymphoma. Blood 2013;122(5):726-33 doi 10.1182/blood-2013-04-495804.

17. Lin AP, Abbas S, Kim SW, Ortega M, Bouamar H, Escobedo Y, et al. D2HGDH regulates alpha-ketoglutarate levels and dioxygenase function by modulating IDH2. Nature communications 2015;6:7768 doi 10.1038/ncomms8768.

18. Elkashef SM, Lin AP, Myers J, Sill H, Jiang D, Dahia PLM, et al. IDH Mutation, Competitive Inhibition of FTO, and RNA Methylation. Cancer cell 2017;31(5):619-20 doi 10.1016/j.ccell.2017.04.001.

19. Jiang D, Aguiar RC. MicroRNA-155 controls RB phosphorylation in normal and malignant B lymphocytes via the noncanonical TGF-beta1/SMAD5 signaling module. Blood 2014;123(1):86-93 doi 10.1182/blood-2013-07-515254.

20. Campbell V TR, Villegas V, Proctor J, McGovern K, Kutok JL, Stern HM. . The potent PI3K-δ,γ inhibitor, IPI-145, exhibits differential activity in diffuse large B-cell lymphoma (DLBCL) cell lines. Blood 2013;122:1832.

21. Moon EY, Lerner A. PDE4 inhibitors activate a mitochondrial apoptotic pathway in chronic lymphocytic leukemia cells that is regulated by protein phosphatase 2A. Blood 2003;101(10):4122-30 doi 10.1182/blood-2002-10-3208.

22. Meyers JA, Taverna J, Chaves J, Makkinje A, Lerner A. Phosphodiesterase 4 inhibitors augment levels of glucocorticoid receptor in B cell chronic lymphocytic leukemia but not in normal circulating hematopoietic cells. Clin Cancer Res 2007;13(16):4920-7.

23. Jones JA, Byrd JC. How will B-cell-receptor-targeted therapies change future CLL therapy? Blood 2014;123(10):1455-60 doi 10.1182/blood-2013-09-453092.

24. O'Brien SM, Lamanna N, Kipps TJ, Flinn I, Zelenetz AD, Burger JA, et al. A phase 2 study of idelalisib plus rituximab in treatment-naive older patients with chronic lymphocytic leukemia. Blood 2015;126(25):2686-94 doi 10.1182/blood-2015-03-630947.

25. Tan Y, Watkins AA, Freeman BB, Meyers JA, Rifkin IR, Lerner A. Inhibition of type 4 cyclic nucleotide phosphodiesterase blocks intracellular TLR signaling in chronic lymphocytic leukemia and normal hematopoietic cells. Journal of immunology (Baltimore, Md : 1950) 2015;194(1):101-12 doi 10.4049/jimmunol.1401854.

26. Herman SE, Gordon AL, Wagner AJ, Heerema NA, Zhao W, Flynn JM, et al. Phosphatidylinositol 3-kinase-delta inhibitor CAL-101 shows promising preclinical activity in chronic lymphocytic leukemia by antagonizing intrinsic and extrinsic cellular survival signals. Blood 2010;116(12):2078-88 doi 10.1182/blood-2010-02-271171.

27. Beitz LO, Fruman DA, Kurosaki T, Cantley LC, Scharenberg AM. SYK is upstream of phosphoinositide 3-kinase in B cell receptor signaling. J Biol Chem 1999;274(46):32662-6.

28. Moon KD, Post CB, Durden DL, Zhou Q, De P, Harrison ML, et al. Molecular basis for a direct interaction between the Syk protein-tyrosine kinase and phosphoinositide 3-kinase. J Biol Chem 2005;280(2):1543-51 doi 10.1074/jbc.M407805200.

29. Mocsai A, Ruland J, Tybulewicz VL. The SYK tyrosine kinase: a crucial player in diverse biological functions. Nature reviews Immunology 2010;10(6):387-402 doi 10.1038/nri2765.

30. Mellor P, Furber LA, Nyarko JN, Anderson DH. Multiple roles for the p85alpha isoform in the regulation and function of PI3K signalling and receptor trafficking. Biochem J 2012;441(1):23-37 doi 10.1042/BJ20111164.

31. Yang Q, Modi P, Newcomb T, Queva C, Gandhi V. Idelalisib: First-in-Class PI3K Delta Inhibitor for the Treatment of Chronic Lymphocytic Leukemia, Small Lymphocytic Leukemia, and Follicular Lymphoma. Clin Cancer Res 2015;21(7):1537-42 doi 10.1158/1078-0432.CCR-14-2034.




18

32. Baba Y, Hashimoto S, Matsushita M, Watanabe D, Kishimoto T, Kurosaki T, et al. BLNK mediates Syk-dependent Btk activation. Proc Natl Acad Sci U S A 2001;98(5):2582-6.

33. Saito K, Scharenberg AM, Kinet JP. Interaction between the Btk PH domain and phosphatidylinositol-3,4,5-trisphosphate directly regulates Btk. J Biol Chem 2001;276(19):16201-6 doi 10.1074/jbc.M100873200.

34. Lien EC, Dibble CC, Toker A. PI3K signaling in cancer: beyond AKT. Current opinion in cell biology 2017;45:62-71 doi 10.1016/j.ceb.2017.02.007.

35. Fruman DA, Cantley LC. Idelalisib--a PI3Kdelta inhibitor for B-cell cancers. N Engl J Med 2014;370(11):1061-2 doi 10.1056/NEJMe1400055.

36. Paul J, Soujon M, Wengner AM, Zitzmann-Kolbe S, Sturz A, Haike K, et al. Simultaneous Inhibition of PI3Kdelta and PI3Kalpha Induces ABC-DLBCL Regression by Blocking BCR-Dependent and -Independent Activation of NF-kappaB and AKT. Cancer Cell 2017;31(1):64-78 doi 10.1016/j.ccell.2016.12.003.

37. Conley ME, Dobbs AK, Quintana AM, Bosompem A, Wang YD, Coustan-Smith E, et al. Agammaglobulinemia and absent B lineage cells in a patient lacking the p85alpha subunit of PI3K. J Exp Med 2012;209(3):463-70 doi 10.1084/jem.20112533.

38. de Weers M, Mensink RG, Kraakman ME, Schuurman RK, Hendriks RW. Mutation analysis of the Bruton's tyrosine kinase gene in X-linked agammaglobulinemia: identification of a mutation which affects the same codon as is altered in immunodeficient xid mice. Human molecular genetics 1994;3(1):161-6.

39. Vasudevan KM, Gurumurthy S, Rangnekar VM. Suppression of PTEN expression by NF-kappa B prevents apoptosis. Mol Cell Biol 2004;24(3):1007-21.

40. Zhang J, Walk SF, Ravichandran KS, Garrison JC. Regulation of the Src homology 2 domain-containing inositol 5'-phosphatase (SHIP1) by the cyclic AMP-dependent protein kinase. J Biol Chem 2009;284(30):20070-8 doi 10.1074/jbc.M109.016865.




19

Figures legend

Figure 1. PDE4 and PI3Kδ inhibitors synergistically inhibits the growth and suppress

PI3K activity in DLBCL cell lines. (A) Cell proliferation data for six independent DLBCL lines

were accrued following 48h (HBL-1, WSU-NHL, OCI-Ly7,) or 72h (OCI-Ly3, OCI-Ly10, OCI-

Ly18) exposure to the indicated compounds at progressively increasing doses. The combination

of roflumilast and idelalisib synergistically suppressed cell proliferation relative to single-agent

treatments as determined by the combination index (CI) analysis; CI <0.1 very strong

synergism; CI=0.1-0.3 strong synergism; CI=0.3-0.85 synergism. (B) The combination of

roflumilast and idelalisib significantly enhanced the suppression of PI3K activity relative to single

agent treatments (*** p<0.001 ** p<0.01, ANOVA; Bonferroni's multiple comparisons post-test,

single agents relative to combination). Data shown are mean ± SD of experiments completed in

triplicate. At least three biologic replicates were completed to all assays.

Figure 2. The combination of the PI3Kδ inhibitor idelalisib and the PDE4 inhibitor

roflumilast is effective in a xenograft model of DLBCL. (A) Tumor volume in mice inoculated

with OCI-Ly7 and randomized into four treatment arms: 1) vehicle control, 2) roflumilast, 3)

idelalisib 4) idelalisib and roflumilast. The cohort treated with the combination of idelalisib and

roflumilast showed significantly reduced tumor volume relative to the single agent and vehicle

groups at days 10 and 14 of dosing (*p<0.05, two tailed Student’s t-test). (B) All mice were

sacrificed and tumors harvest on treatment day 14. PI3K activity was quantified in all tumors,

and those from mice treated with the combination of PDE4 and PI3Kδ inhibitors showed

significantly more pronounced suppression of PI3K activity relative to single-agent treatments

(p<0.001, two-tailed Student’s t-test). Tumor volume data are mean ± SEM (6 mice/group), and

PI3K activity data are mean ± SD of 24 tumors (6/group), each quantified in triplicate.

Figure 3. The combination of the PI3Kδ inhibitor idelalisib and the PDE4 inhibitor

roflumilast potentiates apoptosis in primary CLL cells. (A) Annexin V data from 10

independent primary CLL samples was obtained by FACS following 96h of exposure to the

indicated compounds either as single agents (10 μM roflumilast, 0.5µM idelalisib) or in

combination. The combination of roflumilast and idelalisib significantly enhanced apoptosis

relative to single-agent treatments (*** p<0.001, ** p<0.01, * P<0.05 – Bonferroni’s post-tests,

single agents relative to combination; Two-way ANOVA P<0.0001). Data shown are mean ± SD

of measurement performed in triplicate. (B) The combination of roflumilast and idelalisib is

significantly more effective in suppression of PI3K activity in primary CLL samples than each

agent used alone (p<0.05, two-sided Student’s t-test). Data are mean ± SD of primary CLL

exposed the indicated agents, each sample quantified in triplicate.

Figure 4. The cyclic-AMP/PDE4 axis controls the phosphorylation levels of P85/P55 to

regulate PI3K activity. (A) Western blot analysis shows that elevation of intracellular cyclic-

AMP levels with forskolin is associated with a decrease in phosphorylation of the P85/P55

subunit of PI3K, with a consequent reduction in phospholipid PI(3,4,5)P3 production by PI3K in

the PDE4-null/low DLBCL cell lines SU-DHL4, SU-DHL6, and SU-DHL10; left and right panels,




20

respectively (*** p<0.001 ** p<0.01, two-tailed Student’s t-test). (B) Western blots show that

roflumilast suppresses P85 phosphorylation, and consequently PI3K activity, in the PDE4-high

cell lines HBL-1, OCI-Ly3, and OCI-Ly10; left and right panels, respectively (***p<0.001, two

tailed Student’s t-test). (C) Western blot analysis shows that expression of wild-type (WT)

PDE4B but not of a phosphodiesterase-inactive (PI) mutant enzyme abrogates cyclic-AMP

inhibitory effects on P85 phosphorylation and PI3K activity, left and right panels, respectively

(*** p<0.001, two-tailed Student’s t-test). (D) Western blot analysis shows that stable expression

of a constitutively active (CA) SYK variant blunts the cyclic-AMP inhibitory effects on P85

phosphorylation and PI3K activity, left and right panels, respectively. (**p<0.01, two- tailed

Student’s t-test). Cell expressing PDE4B-WT and –PI are included as controls. (E) Western blot

analysis shows that roflumilast but not idelalisib suppresses P85 phosphorylation in PDE4B-

high DLBCL cell lines. All data shown are mean ± SD of assays performed in triplicate. A

minimum of three biologic replicates were completed for each assay. Densitometric

quantification of pP85/P55 suppression is shown at the bottom of the western blots.

Figure 5. Cyclic-AMP/PDE4 controls the phosphorylation of BTK in an SYK-dependent

manner. (A) Western blot analysis shows that roflumilast suppresses BTK phosphorylation in

multiple PDE4-high DLBCL cell lines (B) Western blots show that elevation of intracellular

cyclic-AMP levels with forskolin suppresses BTK phosphorylation in multiple PDE4-null/low

DLBCL cell lines (C) Western blot analysis shows that idelalisib does not suppress BTK

phosphorylation at Y223. (D) Western blot shows that expression of PDE4B-WT or SYK-CA, but

not PDE4B-PI, blunts the suppressive cyclic-AMP effects towards BTK phosphorylation. At least

three biologic replicates were completed for each assay. Densitometry with quantification of

pBTK suppression is shown at the bottom of the western blots.



















Published OnlineFirst December 15, 2017.Clin Cancer Res Jeffrey Cooney, An-Ping Lin, Daifeng Jiang, et al.

in mature B cell malignanciesδPI3KSynergistic targeting of the regulatory and catalytic subunits of

Updated version

10.1158/1078-0432.CCR-17-2218doi:

Access the most recent version of this article at:

Material

Supplementary

http://clincancerres.aacrjournals.org/content/suppl/2017/12/15/1078-0432.CCR-17-2218.DC1

Access the most recent supplemental material at:

Manuscript

Authoredited. Author manuscripts have been peer reviewed and accepted for publication but have not yet been

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://clincancerres.aacrjournals.org/content/early/2017/12/15/1078-0432.CCR-17-2218To request permission to re-use all or part of this article, use this link



http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-17-2218

http://clincancerres.aacrjournals.org/content/suppl/2017/12/15/1078-0432.CCR-17-2218.DC1

http://clincancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://clincancerres.aacrjournals.org/content/early/2017/12/15/1078-0432.CCR-17-2218


Documents

Synergistic targeting of the regulatory and catalytic · 2017. 12. 15. · evidence that phosphodiesterase 4 (PDE4) inhibition also suppresses BCR signals. We show that combination