Research ArticleSuppression of Th17 Cell Response in theAlleviation of Dextran Sulfate Sodium-Induced Colitis byGanoderma lucidum Polysaccharides

Bing Wei , Ran Zhang, Jingbo Zhai, Junfeng Zhu , Fangli Yang, Dan Yue, Xiaoyi Liu,Changlong Lu , and Xun Sun

Department of Immunology, China Medical University, Shenyang, China

Correspondence should be addressed to Changlong Lu; cllu@mail.cmu.edu.cn

Received 12 December 2017; Revised 19 February 2018; Accepted 7 March 2018; Published 20 May 2018

Academic Editor: Benoit Stijlemans

Copyright © 2018 BingWei et al. This is an open access article distributed under the Creative Commons Attribution License, whichpermits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background. Ganoderma lucidum polysaccharides (GLP) has anti-inflammatory and immunomodulatory effects. Dysregulatedimmune responses are involved in the pathogenesis of dextran sulfate sodium (DSS)-induced colitis. The aim of this study wasto assess the therapeutic potential of GLP to alleviate DSS-induced colitis. Methods. The mice were administered with GLP byintragastric gavage daily for two weeks prior to the DSS treatment. Mice were orally administered with 2.5% DSS dissolved indrinking water with GLP or water treatment for 6 days. The mice were killed on day 7 after induction of colitis. Survival rates,body weight loss, colon lengths, histological changes, and disease activity index scores (DAI) were evaluated. Results. GLPsignificantly improved survival rates, colon length shortening, body weight loss, histopathological score, and DAI scores in micewith DSS-induced colitis. GLP markedly suppressed the secretions of TNF-α, IL-1β, IL-6, IL-17A, and IL-4 and significantlyaffected populations of Th17 cells, B cells, NK cells, and NKT cells in the lamina propria lymphocytes. Conclusions. GLPprevented inflammation, maintained intestinal homeostasis, and regulated the intestinal immunological barrier functions inmice with DSS-induced colitis.

1. Introduction

Inflammatory bowel disease (IBD) consists of two majorphenotypes, ulcerative colitis (UC) and Crohn’s disease(CD). IBD is a chronic disorder caused by dysregulatedimmune responses to intestinal microorganisms that occurswithin all or parts of the intestinal tract. The prevalence ofIBD continues to increase steadily in the Western countries,and even the newly industrialized countries have a rapidlyincreasing incidence [1]. Although the complex etiology ofboth CD and UC has not been definitively elucidated, imbal-anced cytokine production and T cell dysfunction areresponsible for the pathogenesis of IBD [2, 3]. Particularly,increased secretion of proinflammatory cytokines is consid-ered as the key factor in the pathophysiology of IBD. In thecolonic mucosa of UC patients, proinflammatory cytokines,such as tumor necrosis factor-α (TNF-α), interleukin-1β(IL-1β), and interleukin-6 (IL-6), are increased [4–6].

Furthermore, complements play a prominent role in IBDpathogenesis. Increased expression of the complementsystem gene has been found in IBD patients [7, 8]. Besides,L-selectin is closely associated with colitis [9, 10]. In theexperimental studies, dextran sulfate sodium (DSS)-inducedacute or chronic colitis is a standard model that is widelyused to test the efficacy of therapeutic approaches forIBD [11, 12]. Th1 and Th2 cytokines, such as interferon-γ(IFN-γ), interleukin-4 (IL-4), and interleukin-5 (IL-5), areclosely associated with the pathogenesis of colitis inducedby DSS [13]. Recently, it has been reported that Th17 cells,which mainly produce IL-17A, are also involved in theprogression of DSS-induced colitis [14–16].

Ganoderma lucidum, which is also called lingzhi inChinese and reishi in Japanese, is a well-known traditionalChinese medicinal mushroom. It has been widely usedfor the prevention and treatment of various diseases asan immunomodulating agent, including gastric cancer

HindawiJournal of Immunology ResearchVolume 2018, Article ID 2906494, 10 pageshttps://doi.org/10.1155/2018/2906494

[17], hypertension [18], arthritis [19], chronic hepatitis [20],diabetes [21], asthma [22], nephritis [23], arteriosclerosis[24], and immunological disorders [25]. Interestingly, it hasbeen reported that G. lucidum grown on germinated brownrice (GLBR) attenuated colitis by DSS induction via inhibi-tion of MAPK phosphorylation and NF-κB activation [26].Several classes of bioactive substances have been isolatedand identified from G. lucidum, which include polysaccha-rides, triterpenoids, nucleosides, sterols, and alkaloids.Notably, Ganoderma lucidum polysaccharide (GLP) is themajor biologically active component in G. lucidum [27],having anti-inflammatory and immunomodulatory effects.GLP can affect immune cells and immune-related cellsincluding T lymphocytes [28], B lymphocytes [29], macro-phages [30], dendritic cells [31], and natural killer (NK) cells[32]. Recent results indicated that GLP suppresses not onlythe complement- and cytokine-mediated inflammation butalso the L-selectin-mediated inflammation both in vitro andin vivo [33]. Polysaccharides from the mycelia of G. lucidumcould improve the intestinal mechanical barrier function andregulate the intestinal immunological barrier functions in theileum [34]. Furthermore, the LZ-8 protein of G. lucidum alle-viated acute intestinal inflammation in mice by inducing theexpansion of Foxp3+ regulatory T (Treg) cells [35]. Polysac-charides from Ganoderma lucidum mycelia (MAK) hadpreventive effects against the development of chemicalcarcinogen-induced aberrant crypt foci (ACF), colonadenoma, colon adenocarcinoma, and pulmonary adenocar-cinoma in rats [36]. However, there is no direct study regard-ing the efficacy of GLP on colitis and the mechanism ofimmune regulation.

In the present study, we investigated the protective roleand the immunomodulatory effects of GLP on DSS-inducedcolitis in mice and explore the underlying mechanisms ofthese effects.

2. Method and Material

2.1. Chemicals and Reagents. Fcγ receptor-blocking mAb(CD16/32; 2.4G2), anti-Gr-1 (RB6-8C5), anti-CD3ε (145-2C11), anti-CD4 (RM4-5), anti-CD44 (IM7), anti-IFN-γ(XMG1.2), anti-IL-17A (TC11-18H10.1), purified anti-CD3, and anti-CD28 were purchased from BD Biosciences(San Diego, CA, USA). Anti-F4/80 (BM8), anti-CD25(PC61), anti-B220 (RA3-6B2), anti-TCRβ (H57-597), anti-TCRγδ (GL3), and anti-NK1.1 (PK136) were purchasedfrom BioLegend (San Diego, CA, USA). GLP was obtainedfrom Johncan Mushroom (Hangzhou, China). The polysac-charide was extracted and isolated according to the previousreport [37]. Briefly, the G. lucidum mycelia were broken bymicrowave, defatted with alcohol, and extracted with 10volume of double-distilled water for 4 h at 95–100°C. Thesolution was centrifuged to remove the insoluble materials.The supernatant was collected and evaporated under reducedpressure and precipitated upon addition of 3 volume of anhy-drous ethanol. The resulting precipitates were collected, dis-solved in distilled water, and treated with Sevag reagent[38] to remove protein and then dialyzed against distilledwater for 48h at 4°C to remove the low-molecular-weight

materials. The solution was again evaporated and precipi-tated with an equal volume of cold anhydrous ethanol at4°C overnight. The precipitates were collected by centrifuga-tion and then lyophilized to obtain GLP. The content of poly-saccharide in GLP determined using the phenol-sulfuric acidmethod [39] was 95%.

2.2. Animal and Grouping. Male C57BL/6 mice aged6–8 weeks weighing 20± 1 g were purchased from BeijingHFK Bioscience Company (Beijing, China). The mice werehoused in individually ventilated cages at a temperature of20± 1°C and light-controlled cycle (12 hours) with free accessto standard laboratory chow and tap water under a specificpathogen-free (SPF) environment. After one week, the micewere used in the study experiment. This study was approvedby the Committee of Ethics on Animal Experiment of ChinaMedical University. Experiments were carried out in accor-dance with the Guidelines of Animal Experiments.

The mice were randomly distributed into two groupscontaining ten animals each. The mice were administeredwith GLP (100mg/kg body weight; dissolved in 0.2mLwater) by intragastric gavage every day for two weeks priorto the DSS treatment. Water (0.2mL) was administered as acontrol. Mice were orally administered with 2.5% DSS(MW 36,000–50,000, MP Biomedicals, USA) dissolved indrinking water with GLP or water treatment for 6 days. Themice were killed on day 7 after induction of colitis. The colontissue was removed and cut into pieces for histological anal-yses, cell culture, flow cytometry, and ELISA.

2.3. Evaluation of Colitis Progression. Body weights wererecorded daily. Severity of colitis was assessed by the diseaseactivity index (DAI) based on weight loss, trait of stool, andstool bleeding or hematochezia according to the classic scor-ing system by Cooper et al. [40]. The scoring process wasgiven as follows: body weight loss (0, none; 1, 1%–5%; 2,5%–10%; 3, 10%- 20%; 4, >20%), stool consistency (0, nor-mal; 2, loose stool; 4, diarrhea), and stool blood (0, negative;2, fecal occult blood test positive; 4, gross bleeding).

2.4. Histology Assessment of Colitis. The middle parts of thecolon were removed and fixed with 4% paraformaldehydeand embedded in paraffin. Five mm tissue sections werestained with hematoxylin and eosin (HE). Histology wasscored as follows: epithelium (E), 0 =normal morphology,1 = loss of goblet cells, 2 = loss of goblet cells in large areas,3 = loss of crypts, and 4= loss of crypts in large areas; andinfiltration (I), 0 = no infiltrate, 1 = infiltrate around the cryptbasis, 2 = infiltrate reaching the L. muscularis mucosae,3 = extensive infiltration reaching the L. muscularis mucosaeand thickening of the mucosa with abundant edema, and4= infiltration of the L. submucosa. The total histologicalscore was calculated as E+ I [41].

2.5. Cell Preparation. Lamina propria (LP) cells in the colonwere isolated by modifying the method described previously[42]. In brief, colon was cut into 1–2mm pieces. The pieceswere stirred in PBS containing 3mM EDTA for 15min twiceand in RPMI 1640 (HyClone) containing 1mM EGTA for20min twice at 37°C to eliminate the epithelium and then

2 Journal of Immunology Research

stirred at 37°C in RPMI 1640 containing 20% fetal bovineserum, 1mM EGTA, and 1.5mM MgCl2 for 15min twice.The pieces were collected and stirred at 37°C in RPMI 1640containing 20% FBS, 100U/mL collagenase (Sigma-AldrichCorp, USA), and 5U/mL DNase 1 (Sigma-Aldrich Corp,USA) for 90min. Halfway through the incubation and atthe end of the incubation, the suspension was dissociatedby multiple aspirations for 2min through a syringe. The sus-pensions were centrifuged, and then the pellets were washed.Lamina propria lymphocytes (LPL) were purified from theLP cell preparations through a 45–66.6% discontinuous Per-coll (Solarbio) gradient by centrifugation at 2500 rpm for20min at 25°C. The number of viable LPLs was counted afterstaining with trypan blue.

2.6. Flow Cytometry. Briefly, 1× 106 cells isolated from thecolon of each mouse were incubated with an FcγR-blockingmAb and stained with mAbs against Gr-1, F4/80, CD3,B220, αβTCR, γδTCR, NK1.1, CD4, CD44, and CD25 for30min at 4°C. For intracellular cytokine staining, LPLs werestimulated with ionomycin (1μg/mL, Sigma-Aldrich) andPMA (25ng/mL, Sigma-Aldrich) for 5 h at 37°C with Brefel-din A (10mg/mL, Sigma-Aldrich) added after 1 h. These cellswere harvested, washed, and stained with mAbs against IFN-γ and IL-17A for 30min at 4°C. The cells were analyzed byintracellular cytokine FACS using a Cytofix/Cytoperm KitPlus (BD Biosciences, San Jose, CA, USA) according to themanufacturer’s instructions.

2.7. Cytokine Enzyme-Linked Immunosorbent Assay (ELISA).Supernatants of cell cultures were collected after centrifuga-tion at 1000 rpm for 10min, and cytokine concentrationswere measured using mouse immunoassay kits (R&D Sys-tems Inc., Minneapolis, MN, United States) according tothe manufacturer’s protocol. The levels of TNF-α, IL-6, IL-1β, and IL-23 were measured in the supernatants withoutanti-CD28 (1μg/mL)/anti-CD3 (10μg/mL) mAbs stimula-tions. The levels of IFN-γ, IL-17A, IL-4, and IL-10 were mea-sured in the culture supernatants with or without anti-CD28(1μg/mL)/anti-CD3 (10μg/mL) mAbs stimulations for 48 h.

2.8. Real-Time Quantitative Polymerase Chain Reaction (RTPCR). Total RNA was extracted from colon tissue using theRNAiso Plus (Takara, Dalian, China), according to the man-ufacturer’s protocol. RNA was reverse transcribed to cDNAusing PrimeScript™ RT Reagent Kit with gDNA Eraser (Per-fect Real Time, Takara). The PCR mixture was preparedusing SYBR® Premix Ex Taq™ (Tli RNase H Plus, Takara)and one of the primers listed in Table 1. The amplificationprotocol consisted of the following steps: 95°C for 30 s and40 cycles of 95°C for 15 s and 60°C for 34 s on an ABI PRISM7500 Sequence Detection System (Applied Biosystems, Fos-ter City, CA). The level of each gene was normalized withβ-actin mRNA content.

2.9. Statistical Analysis. All data are expressed as mean ± standard deviation (SD) and analyzed by one-way ANOVA orStudent’s t-test. All statistical analyses were performed usingGraphPad Prism 6.0, with statistical significance at P < 0 05.

3. Results

3.1. GLP Attenuates Symptoms of DSS-Induced Acute Colitis.All mice orally administered with 2.5% DSS for 6 daysshowed symptoms of colitis, including diarrhea, loss of bodyweight, and rectal bleeding. Pretreatment with GLP pre-vented the development of DSS-induced acute colitis, reflect-ing better survival, loss of body weight, shortened colonlength, histological changes of colon tissues, and DAI score.Compared with control mice, GLP-treated mice exhibitedobviously enhanced survival rates (Figure 1(a)), lower lossof body weight (Figure 1(b)), decreased DAI score initiallyon day 7 (Figure 1(c)), less colon shortening (Figures 1(d)and 1(e)), and decreased histological scores (Figures 1(f)and 1(g)). Thus, these results suggested that GLP treatmenthad beneficial effects on acute colitis of DSS induced in mice.

3.2. Cell Accumulation in LPL of Colon in GLP-Treated Miceduring DSS-Induced Acute Colitis. No significant differencesin the percentages and absolute numbers of neutrophils(CD11b+ Gr1+ F4/80−), macrophages (CD11b+ F4/80+

Gr1−), and γδT cells in LPL of colons in control and GLPgroup mice were observed. In the GLP-treated acute colitisgroup, the percentage of B220+CD3− cells in LPL significantlyincreased inGLP-treatedmice, while CD3+ B220− cells in LPLsignificantly decreased compared with control mice, but theabsolute number of B220+CD3− cells and CD3+ B220− cellsshowed no differences in the two groups. The percentagesand absolute numbers of CD4+ CD44+ in LPL were signif-icantly lower in the GLP-treated acute colitis group thanin the control group. The percentages and absolute num-bers of CD4+ CD25+ T cells demonstrated no significantdifferences in the two groups. The percentage of NK cell(NK1.1+ CD3−) and NKT cells (NK1.1+ CD3+) in LPL ofGLP-treated mice significantly reduced compared tountreated mice (Figure 2(a)), while the absolute numbers ofonlyNKTcells (NK1.1+CD3+)ofLPL in theGLP-treatedmicesignificantly decreased compared with controls (Figure 2).

Furthermore, we detected IFN-γ- or IL-17A-producingCD4+ T cells in the lamina propria lymphocytes (T-LPLs) inGLP-treated and untreated acute colitis mice. There was a sig-nificant decrease in the percentage and absolute number of IL-17A-producing CD4+ T-LPLs in GLP-treatedmice comparedwith control mice after phorbol 12-myristate 13-acetate(PMA)/ionomycin stimulations. The percentages and abso-lute numbers of IFN-γ-producing CD4+ T-LPLs showed nomarked differences between these two groups (Figure 3).These results suggested that the effect of GLP may promotethe proliferation of B cells, regulate Th1, Th17, and Th2 cellresponses, and inhibit the proliferation NK cell and NKT cellsin LPL of colon in DSS-induced acute colitis mice.

3.3. GLP Treatment Decreases Expression of Cytokines andTranscription Factor in the Intestine of Mice with DSS-Induced Acute Colitis. Measurement of cytokine concentra-tions in the culture supernatants of unstimulated LPL mani-fested that the levels of TNF-α, IL-1β, and IL-6 weresignificantly decreased in the GLP-treated acute colitis groupcompared with the control group. The level of IL-23 showed

3Journal of Immunology Research

no significant difference between these two groups. The levelof IL-17A with anti-CD3 and anti-CD28 mAbs stimulationand without any stimulation was significantly reduced inthe GLP-treated acute colitis group compared with the con-trol group. The levels of IL-4 were significantly decreasedwith anti-CD3 and anti-CD28 mAbs stimulation, and similarresults were observed without any stimulation in the super-natants of LPL of the GLP-treated acute colitis group com-pared with the control group. However, a similarconcentration of IFN-γ and IL-10 was observed with or with-out anti-CD3 and anti-CD28 mAbs stimulation betweenthese two groups (Figure 4). Also, GLP treatment led to areduction in the mRNA expression of ROR-γt. (Figure 5).

However, it did not lead to any change in the mRNA expres-sion of Foxp3, T-bet, and GATA-3 (Figure 5).

4. Discussion

In this study, we investigated the protection mechanism ofGLP on acute colitis induced by DSS in mice. IBD is consid-ered as Th1- or Th2-mediated inflammatory disease [2, 3].Th17 was recently reported to play a pivotal role in the path-ogenesis of DSS-induced colitis and human IBD [14, 43].GLP has strong immunomodulatory activity, especially oninnate and adaptive immune responses [29, 44]. However,

(Days)

Surv

ival

(%)

0 3 6 9 12 150

255075

100

P = 0.0036

DSSGLP + DSS

(a)

(Days)

Body

wei

ght (

%)

0 2 4 6 860

80

100

120

⁎ ⁎⁎⁎⁎⁎

DSSGLP + DSS

(b)

DSSGLP + DSS

0 2 4 6 8 10012345

(Days)

Dise

ase a

ctiv

ity in

dex ⁎

⁎

(c)

(d)

Col

on le

ngth

(cm

)

0

2

4

6

8

10

DSSGLP + DSS

⁎

(e)

DSS

GLP+ DSS

(f)

DSSGLP + DSS

0

2

4

6

8

Hist

olog

ical

scor

e

⁎

(g)

Figure 1: GLP attenuated DSS-induced acute colitis. Mice were orally treated with 2.5%DSS in drinking water to induce colitis as described inthe Methods. On day 7 after induction of colitis, changes were observed in (a) survival rate (n = 10); (b) body weight (%); (c) disease activityindex (DAI); (d–e) colon length; (f–g) colon histopathological damage scores. The data are presented as mean ± SD (GLP +DSS-inducedacute colitis versus DSS-induced acute colitis, ∗P < 0 05; ∗∗P < 0 01; and ∗∗∗P < 0 001) (n = 10). DSS: dextran sulfate sodium; GLP:Ganoderma lucidum polysaccharides.

Table 1: Primer sequences for real-time PCR.

Gene Forward Reverse

T-bet CCAGGGAACCGCTTATATGT CTGGGTCACATTGTTGGAAG

GATA-3 ACAGCTCTGGACTCTTCCCA GTTCACACACTCCCTGCCTT

ROR-γt CCACTGCATTCCCAGTTTCT CGTAGAAGGTCCTCCAGTCG

Foxp3 GGCCCTTCTCCAGGACAGA GCTGATCATGGCTGGGTTGT

β-Actin TTCCAGCGTTCCTTCTTGGGT GTTGGCATAGAGGTGTTTACG

4 Journal of Immunology Research

the ability of GLP to suppress DSS-induced acute colitis by itsimmunomodulatory effect has not been confirmed.

Our results proved the beneficial effects of GLP on thesymptoms of colitis, which were depicted when assessingthe survival rate, body weight loss, colon length, histopatho-logical scores, and DAI score (Figure 1). Recent resultsshowed that polysaccharides derived from G. lucidum fungusmycelia ameliorate indomethacin-induced small intestinal

injury by induction of granulocyte macrophage colony-stimulating factor (GM-CSF) from macrophages [45]. How-ever, the result of our study showed that GLP had no effectson the populations of macrophage and the neutrophils incolonic LP in mice with DSS-induced acute colitis (Figure 2).

The protective effects of GLP on colitis induced by DSSwere associated with an increase in B cells but a decrease inT cells, mainly a decrease in 17A-producing CD4+ T-LPLs,

DSS9.1 ±

0.2

40.2 ±1.8

48.2± 1.4

14.3± 0.3

12.6± 1.6

Gr-

1

10.0± 0.2

2.9 ± 0.14 2.8 ± 0.0

45.0± 2.7

F4/80Gated onCD11b+

41.1± 2.8

35 ± 0.4⁎

4.9 ± 0.6

2.8 ± 0.0

NK1.1

53.9± 0.5⁎

32.1 ±1.9⁎⁎

2.3 ± 0.1⁎⁎

2.5 ± 0.1⁎

45.8± 2.1

GLP + DSS DSS GLP + DSS

CD3

𝛾𝛿TCRGated onlymphocytes

CD3

Gated onlymphocytes

CD3

CD25

CD44

B220Gated on

lymphocytes

CD4

CD4Gated on𝛼𝛽TCR+

Gated on𝛼𝛽TCR+

(a)

0

1

2

4

6

8

Abso

lute

num

ber (

106 )

DSSGLP + DSS

⁎⁎

Tota

l LPL

NKT

CD4+

CD4+ CD

44+

CD4+ CD

25+

CD3+ B2

20−

B220

+ CD3−

𝛾𝛿T

NK1

.1+

CD11

b+ Gr1

+ F4/8

0−

CD11

b+ F4/8

0+ Gr1

−

(b)

Figure 2: Flow cytometry analysis of the populations of LPL in the colon of mice. (a) The frequencies of neutrophils (CD11b+ Gr1+ F4/80−),macrophages (CD11b+ F4/80+ Gr1−), γδT cells (γδTCR+), NK cells (NK1.1+ CD3−), NKT cells (NK1.1+ CD3+), CD4+, CD4+ CD44+ (effectorT cells), CD4+ CD25+ (regulatory T cells), CD3+ B220− (T cells), and B220+ CD3− (B cells) in the LPL of colon on day 7 after administrationwith DSS-only or GLP+DSS. (b) The absolute cell numbers of all kinds of cells were calculated. Data indicated mean ± SD of three mice ofeach group were obtained from a representative of three independent experiments (∗P < 0 05 and ∗∗P < 0 01).

5Journal of Immunology Research

and a decrease in the production of IL-17A and IL-4 in LP(Figures 2, 3, and 4). Recently, it has been reported that anovel subset of helper CD4+ T cells producing IL-17A,namely, Th17 cells, was involved in the progression of DSS-induced colitis [46]. Also, we showed that the mRNA expres-sion levels of ROR-γt, which is the principal regulator forTh17 differentiation [47], decreased in the colon tissue ofGLP treated mice (Figure 5). IL-23 has been shown to be animportant modifier of Th17 cell phenotype in the intestine[48]. However, GLP administration showed no improvement

in the production of IL-23 in the colon of DSS mice, indicat-ing that the administration of GLP probably alleviated theextent of acute intestinal inflammation via downregulationof Th17 cell responses independent of IL-23. Otherwise, ithas been reported that GLP produce immune responses withan overall Th1 bias, with high levels of IFN-γ and IL-2, aswell as IL-10 and IL-17 [49, 50], but there are still differentviews regarding the effect of GLP on IL-4 [34, 49, 50]. Theseresults suggested that GLP exerted immunomodulatingresponses on colitis possibly through altering the balance of

IFN-𝛾Gated on

CD4+

1.8 ± 0.4 0.02 ± 0.0

0.5 ± 0.1

IL-1

7A11.7 ± 0.74 0.81 ± 0.27

4.7 ± 0.9 5.6 ± 1.1

0.83 ± 0.095

PMA+

IONO

5.1 ± 0.16⁎⁎

0.5 ± 0.0

(−)

1.6 ± 0.3 0.04 ± 0.0

(a)

PMA/IONO (−)0

5

10

15

20

25CD4+IFN-𝛾+

Abso

lute

num

ber (

103 )

PMA/IONO (−)0

10

20

30

40CD4+IL-17A+

Abso

lute

num

ber (

103 )

⁎⁎

PMA/IONO (−)0

1

2

3

4CD4+IL-17A+IFN-𝛾+

Abso

lute

num

ber (

103 )

GLP + DSSDSS

(b)

Figure 3: Cytokine-producing T cells in the LPL of colon in mice. (a) The frequencies of CD4+ IL-17A+, CD4+ IFN-γ+, and CD4+ IL-17A+

IFN-γ+ T-LPLs. (b) The absolute number of cytokines producing CD4+ IL-17A+, CD4+ IFN-γ+ T-LPLs, and CD4+ IL-17A+ IFN-γ+ T-LPLswith and without stimulation. Data indicated mean ± SD of three mice of each group were obtained from a representative of threeindependent experiments (∗P < 0 05 and ∗∗P < 0 01).

6 Journal of Immunology Research

Th1/Th2 and Th17/Treg. The mechanism needs furtherinvestigation. In addition, recent study results showed thatthe level of SIgA from B cells in the intestine was significantly

increased in the ileum of rats with oral administration of GLPand was commonly considered as a critical effector moleculeto protect the mucosal surfaces [34].

NK T cells exert an effector function, for instance, expres-sion of IL-17 and IL-22 in the intestine [51]. We showed thatthe percentages and absolute numbers of NKT cells were sig-nificantly reduced in the colonic LP of GLP-treated mice(Figure 2). It may play a significant role in the productionof IL-17 by NKT cells in the induction of IBD, as increasedexpression of IL-17 has been reported in both animalIBD models [52, 53] and patients with IBD [54, 55]. Ourdata demonstrated that the percentage of NK cells wasmarkedly decreased in the colonic LP of mice with GLPadministration. NK cells produce cytokines, includingTNF-α and IFN-γ [56], and probably might be a reasonfor the decrease in TNF-α, which has a key role in IBD.Antibodies against TNF-α were successfully accomplishedin clinical applications [57].

Cytokines play a critical role in the development and pro-gression of inflammatory responses. To assess whether thepositive effects of GLP on colitis were involved in thedeceased secretion of proinflammatory cytokines, expressionlevels of TNF-α, IL-1β, and IL-6 in the colonic LP in colitismice treated with or without GLP were measured. Out resultsdemonstrated that the levels of TNF-α, IL-1β, and IL-6 weremarkedly downregulated in the colonic LP in colitis micewith GLP treatment (Figure 4). These results were consistentwith the findings of the previous report, which showed thatthe GLBR, an extract of G. lucidum grown on brown rice,inhibited the expression of TNF-α, IL-1β, IL-6, and COX-2by inhibition of MAPK and NF-κB pathways in mice withDSS induced colitis [26]. NLRP3 inflammasome is a multi-molecular cytosol complex that, when activated, leads to the

T-bet0.0

0.5

1.0

1.5

Relat

ive m

RNA

leve

l

0.0

0.5

1.0

1.5

Relat

ive m

RNA

leve

l

0.0

0.5

1.0

1.5

Relat

ive m

RNA

leve

l

0.0

0.5

1.0

1.5

Relat

ive m

RNA

leve

l

GATA-3

ROR𝛾t

⁎⁎

DSSDSS + GLP

Foxp3

Figure 5: The mRNA expression of the transcription factor. TotalmRNA was extracted from colonic tissues to analyze the mRNAexpression of ROR-γt, Foxp3, T-bet, and GATA-3 by real-timePCR. The data are presented as mean ± SD of six mice of eachgroup obtained from a representative of three independentexperiments (∗P < 0 05 and ∗∗P < 0 01).

(pg/

mL)

0

50

100

150

200IL-I𝛽

⁎

IL-6

(pg/

mL)

050

100150200250

⁎

(pg/

mL)

0100200300400500

IL-23TNF-𝛼

(pg/

mL)

0

200

400

600

800

⁎⁎

GLP + DSSDSS

(a)

IL-17A(n

g/m

L)

0

2

4

6

8

⁎⁎

⁎

IL-10

(pg/

mL)

0

500

1000

1500

2000

0

200

400

600

800 IL-4

(pg/

mL)

⁎

IFN-𝛾

0

5

10

15

(ng/

mL)

GLP + DSSDSS

(−) CD3/CD28 (−) CD3/CD28 (−) CD3/CD28 (−) CD3/CD28

(b)

Figure 4: Cytokine production in LP of colon as analyzed by ELISA. (a) Unstimulated cells; (b) cells with TCR (anti-CD3 and anti-CD28mAbs) stimulations. Data indicated mean ± SD of three mice of each group were obtained from a representative of three independentexperiments (∗P < 0 05 and ∗∗P < 0 01).

7Journal of Immunology Research

cleavage of pro-IL-1β to IL-1β. In an acute colitis mousemodel induced by DSS, NLRP3 gene knockout and medicalinhibition of the NLRP3 inflammasome activation bothexerted protective effects on mice [58, 59]. Therefore, GLPhad an anti-inflammatory effect on colonic LP in colitis mice,possibly due to the decreasing production of proinflamma-tory cytokines and inhibiting NLRP3 inflammasome signal-ing. The next study needs to confirm it.

In summary, we herein described that polysaccharidesisolated from G. lucidum GLP may ameliorate acute colitisthrough the suppression of the immune responses, includingdecreased secretion of proinflammatory cytokines, such asTNF-α, IL-6, IL-1β, and IL-17A, increased the populationsof B cells and decreased the populations of Th17 cells, NKcells, and NKT cells. There are various pharmaceutical IBDtreatment options available, while they have their own limita-tions of both efficacy and safety [60]. Hence, our results sug-gest that polysaccharides with valuable effects may be used asa novel therapeutic approach to mitigate acute inflammationin IBD individuals. Moreover, detailed research studiesincluding clinical trials are warranted to verify the potentialof these promising immune modulatory agents.

Conflicts of Interest

The authors declared no conflict of interest.

Acknowledgments

This work was supported financially by the grant from theNational Natural Science Foundation of China (no.31370921) and Natural Science Foundation of LiaoningProvince of China (no. 2011415052-1).

References

[1] G. G. Kaplan and S. C. Ng, “Understanding and preventing theglobal increase of inflammatory bowel disease,” Gastroenterol-ogy, vol. 152, no. 2, pp. 313–321.e2, 2017.

[2] A. Geremia, P. Biancheri, P. Allan, G. R. Corazza, and A. DiSabatino, “Innate and adaptive immunity in inflammatorybowel disease,” Autoimmunity Reviews, vol. 13, no. 1,pp. 3–10, 2014.

[3] M. F. Neurath, “Cytokines in inflammatory bowel disease,”Nature Reviews Immunology, vol. 14, no. 5, pp. 329–342, 2014.

[4] K. J. Maloy and F. Powrie, “Intestinal homeostasis and itsbreakdown in inflammatory bowel disease,” Nature, vol. 474,no. 7351, pp. 298–306, 2011.

[5] C. C. Bain, C. L. Scott, H. Uronen-Hansson et al., “Residentand pro-inflammatory macrophages in the colon representalternative context-dependent fates of the same Ly6Chi mono-cyte precursors,” Mucosal Immunology, vol. 6, no. 3, pp. 498–510, 2013.

[6] G. Bouguen, J. B. Chevaux, and L. Peyrin-Biroulet, “Recentadvances in cytokines: therapeutic implications for inflamma-tory bowel diseases,” World Journal of Gastroenterology,vol. 17, no. 5, pp. 547–556, 2011.

[7] E. Nissilä, K. Korpela, A. I. Lokki et al., “C4B gene influencesintestinal microbiota through complement activation inpatients with paediatric-onset inflammatory bowel disease,”

Clinical and Experimental Immunology, vol. 190, no. 3,pp. 394–405, 2017.

[8] A. E. Østvik, A. vB Granlund, B. I. Gustafsson et al., “Mucosaltoll-like receptor 3-dependent synthesis of complement factorB and systemic complement activation in inflammatory boweldisease,” Inflammatory Bowel Diseases, vol. 20, no. 6, pp. 995–1003, 2014.

[9] E. Kurmaeva, M. Boktor, S. Zhang, R. Bao, S. Berney, and D. V.Ostanin, “Roles of T cell–associated L-selectin and β7 integ-rins during induction and regulation of chronic colitis,”Inflammatory Bowel Diseases, vol. 19, no. 12, pp. 2547–2559,2013.

[10] M. Kobayashi, H. Hoshino, J. Masumoto et al., “GlcNAc6ST-1-mediated decoration of MAdCAM-1 protein with L-selectin ligand carbohydrates directs disease activity ofulcerative colitis,” Inflammatory Bowel Diseases, vol. 15,no. 5, pp. 697–706, 2009.

[11] A. R. Jurjus, N. N. Khoury, and J.M. Reimund, “Animalmodelsof inflammatory bowel disease,” Journal of Pharmacologicaland Toxicological Methods, vol. 50, no. 2, pp. 81–92, 2004.

[12] M. Perse and A. Cerar, “Dextran sodium sulphate colitismouse model: traps and tricks,” Journal of Biomedicine andBiotechnology, vol. 2012, article 718617, 13 pages, 2012.

[13] L. A. Dieleman, M. J. Palmen, H. Akol et al., “Chronic experi-mental colitis induced by dextran sulphate sodium (DSS) ischaracterized by Th1 and Th2 cytokines,” Clinical & Experi-mental Immunology, vol. 114, no. 3, pp. 385–391, 1998.

[14] S. Wang, Y. Zhang, P. Saas et al., “Oridonin’s therapeuticeffect: suppressing Th1/Th17 simultaneously in a mousemodel of Crohn's disease,” Journal of Gastroenterology andHepatology, vol. 30, no. 3, pp. 504–512, 2015.

[15] E. C. Steinbach, T. Kobayashi, S. M. Russo et al., “Innate PI3Kp110δ regulates Th1/Th17 development and microbiota-dependent colitis,” The Journal of Immunology, vol. 192,no. 8, pp. 3958–3968, 2014.

[16] J. Zhu, Y. Wang, F. Yang et al., “IL-33 alleviates DSS-inducedchronic colitis in C57BL/6 mice colon lamina propria by sup-pressing Th17 cell response as well as Th1 cell response,” Inter-national Immunopharmacology, vol. 29, no. 2, pp. 846–853,2015.

[17] S. P. Wasser, “Medicinal mushrooms as a source of antitumorand immunomodulating polysaccharides,” Applied Microbiol-ogy and Biotechnology, vol. 60, no. 3, pp. 258–274, 2002.

[18] T. T. W. Chu, I. F. F. Benzie, C. W. K. Lam, B. S. P. Fok, K. K.C. Lee, and B. Tomlinson, “Study of potential cardioprotectiveeffects of Ganoderma lucidum (Lingzhi): results of a controlledhuman intervention trial,” British Journal of Nutrition,vol. 107, no. 7, pp. 1017–1027, 2012.

[19] E. K. Li, L. S. Tam, C. K. Wong et al., “Safety and efficacy ofGanoderma lucidum (lingzhi) and SanMiao San supplementa-tion in patients with rheumatoid arthritis: a double-blind,randomized, placebo-controlled pilot trial,” Arthritis andRheumatism, vol. 57, no. 7, pp. 1143–1150, 2007.

[20] H. Jin, F. Jin, J. X. Jin et al., “Protective effects of Ganodermalucidum spore on cadmium hepatotoxicity in mice,” Foodand Chemical Toxicology, vol. 52, pp. 171–175, 2013.

[21] H. T. Ma, J. F. Hsieh, and S. T. Chen, “Anti-diabetic effects ofGanoderma lucidum,” Phytochemistry, vol. 114, pp. 109–113,2015.

[22] N. Bhardwaj, P. Katyal, and A. Sharma, “Suppression ofinflammatory and allergic responses by pharmacologically

8 Journal of Immunology Research

potent fungus Ganoderma lucidum,” Recent Patents onInflammation & Allergy Drug Discovery, vol. 8, no. 2,pp. 104–117, 2014.

[23] N. Futrakul, T. Panichakul, P. Butthep et al., “Ganoderma luci-dum suppresses endothelial cell cytotoxicity and proteinuria inpersistent proteinuric focal segmental glomerulosclerosis(FSGS) nephrosis,” Clinical Hemorheology and Microcircula-tion, vol. 31, no. 4, pp. 267–272, 2004.

[24] P. Batra, A. K. Sharma, and R. Khajuria, “Probing Lingzhi orReishi medicinal mushroom Ganoderma lucidum (higherbasidiomycetes): a bitter mushroom with amazing healthbenefits,” International Journal of Medicinal Mushrooms,vol. 15, no. 2, pp. 127–143, 2013.

[25] C. J. Liang, C. W. Lee, H. C. Sung, Y. H. Chen, and Y. C.Chiang, “Ganoderma lucidum polysaccharides reducelipopolysaccharide-induced interleukin-1β expression incultured smooth muscle cells and in thoracic aortas in mice,”Evidence-Based Complementary and Alternative Medicinec,vol. 2014, article 305149, 13 pages, 2014.

[26] M. A. Hasnat, M. Pervin, K. M. Cha, S. K. Kim, and B. O. Lim,“Anti-inflammatory activity on mice of extract of Ganodermalucidum grown on rice via modulation of MAPK and NF-κBpathways,” Phytochemistry, vol. 114, pp. 125–136, 2015.

[27] I. C. F. R. Ferreira, S. A. Heleno, F. S. Reis et al., “Chemicalfeatures of Ganoderma polysaccharides with antioxidant, anti-tumor and antimicrobial activities,” Phytochemistry, vol. 114,pp. 38–55, 2015.

[28] S. W. Lai, J. H. Lin, S. S. Lai, and Y. L. Wu, “Influence ofGanoderma lucidum on blood biochemistry and immunocom-petence in horses,” The American Journal of Chinese Medicine,vol. 32, no. 6, pp. 931–940, 2004.

[29] X. F. Bao, X. S. Wang, Q. Dong, J. N. Fang, and X. Y. Li, “Struc-tural features of immunologically active polysaccharides fromGanoderma lucidum,” Phytochemistry, vol. 59, no. 2,pp. 175–181, 2002.

[30] M. T. Wei, K. F. Hua, J. Hsu et al., “The interaction of lipo-polysaccharide with membrane receptors on macrophagespre-treated with extract of Reishi polysaccharides measuredby optical tweezers,” Optics Express, vol. 15, no. 17,pp. 11020–11032, 2007.

[31] Y. L. Lin, Y. C. Liang, S. S. Lee, and B. L. Chiang, “Polysac-charide purified from Ganoderma lucidum induced activa-tion and maturation of human monocyte-derived dendriticcells by the NF-ĸB and p38 mitogen-activated protein kinasepathways,” Journal of Leukocyte Biology, vol. 78, no. 2,pp. 533–543, 2005.

[32] C. M. Chien, J. L. Cheng, W. T. Chang et al., “Polysaccha-rides of Ganoderma lucidum alter cell immunophenotypicexpression and enhance CD56+ NK-cell cytotoxicity in cordblood,” Bioorganic & Medicinal Chemistry, vol. 12, no. 21,pp. 5603–5609, 2004.

[33] K. Zhang, Y. Liu, X. Zhao et al., “Anti-inflammatory propertiesof GLPss58, a sulfated polysaccharide from Ganoderma luci-dum,” International Journal of Biological Macromolecules,vol. 107, Part A, pp. 486–493, 2018.

[34] M. Jin, Y. Zhu, D. Shao et al., “Effects of polysaccharide frommycelia of Ganoderma lucidum on intestinal barrier functionsof rats,” International Journal of Biological Macromolecules,vol. 94, Part A, pp. 1–9, 2017.

[35] H. Y. Hsu, Y. C. Kuan, T. Y. Lin et al., “Reishi proteinLZ-8 induces FOXP3+ Treg expansion via a CD45-dependent signaling pathway and alleviates acute intestinal

inflammation in mice,” Evidence-based Complementaryand Alternative Medicine, vol. 2013, Article ID 513542,11 pages, 2013.

[36] N. Kashimoto, M. Hayama, K. Kamiya, and H. Watanabe,“Inhibitory effect of a water-soluble extract from the culturemedium of Ganoderma lucidum (Rei-shi) mycelia on thedevelopment of pulmonary adenocarcinoma induced by N-nitrosobis (2-hydroxypropyl) amine in Wistar rats,” OncologyReports, vol. 16, no. 6, pp. 1181–1187, 2006.

[37] Y. Peng, L. Zhang, F. Zeng, and J. F. Kennedy, “Structure andantitumor activities of the water-soluble polysaccharides fromGanoderma tsugae mycelium,” Carbohydrate Polymers,vol. 59, no. 3, pp. 385–392, 2005.

[38] A. M. Staub, “Removeal of protein—Sevag method,” Methodsin Carbohydrate Chemistry, vol. 5, pp. 5-6, 1965.

[39] M. DuBois, K. A. Gilles, J. K. Hamilton, P. A. Rebers, andF. Smith, “Colorimetric method for determination of sugarsand related substances,” Analytical Chemistry, vol. 28, no. 3,pp. 350–356, 1956.

[40] H. S. Cooper, S. N. Murthy, R. S. Shah, and D. J. Sedergran,“Clinicopathologic study of dextran sulfate sodium experi-mental murine colitis,” Laboratory Investigation, vol. 69,no. 2, pp. 238–249, 1993.

[41] J. Zhu, F. Yang, L. Sang et al., “IL-33 aggravates DSS-inducedacute colitis in mouse colon lamina propria by enhancingTh2 cell responses,” Mediators of Inflammation, vol. 2015,Article ID 913041, 12 pages, 2015.

[42] W. Strober, I. J. Fuss, and R. S. Blumberg, “The immunology ofmucosal models of inflammation,” Annual Review of Immu-nology, vol. 20, no. 1, pp. 495–549, 2002.

[43] R. Wang, S. Z. Hasnain, H. Tong et al., “Neutralizing IL-23 issuperior to blocking IL-17 in suppressing intestinal inflamma-tion in a spontaneous murine colitis model,” InflammatoryBowel Diseases, vol. 21, no. 5, pp. 973–984, 2015.

[44] J. Wang, Y. Wang, X. Liu, Y. Yuan, and T. Yue, “Free radicalscavenging and immunomodulatory activities of Ganodermalucidum polysaccharides derivatives,” Carbohydrate Polymers,vol. 91, no. 1, pp. 33–38, 2013.

[45] K. Nagai, Y. Ueno, S. Tanaka, R. Hayashi, K. Shinagawa, andK. Chayama, “Polysaccharides derived from Ganoderma luci-dum fungus mycelia ameliorate indomethacin-induced smallintestinal injury via induction of GM-CSF frommacrophages,”Cellular Immunology, vol. 320, pp. 20–28, 2017.

[46] D. Fina, M. Sarra, M. C. Fantini et al., “Regulation of gutinflammation and th17 cell response by interleukin-21,” Gas-troenterology, vol. 134, no. 4, pp. 1038–1048.e2, 2008.

[47] I. I. Ivanov, B. S. McKenzie, L. Zhou et al., “The orphan nuclearreceptor RORγt directs the differentiation program of proin-flammatory IL-17+ T helper cells,” Cell, vol. 126, no. 6,pp. 1121–1133, 2006.

[48] P. J. Morrison, S. J. Ballantyne, and M. C. Kullberg, “Interleu-kin-23 and T helper 17-type responses in intestinal inflamma-tion: from cytokines to T-cell plasticity,” Immunology, vol. 133,no. 4, pp. 397–408, 2011.

[49] Z. Liu, J. Xing, S. Zheng et al., “Ganoderma lucidum polysac-charides encapsulated in liposome as an adjuvant to promoteTh1-bias immune response,” Carbohydrate Polymers,vol. 142, pp. 141–148, 2016.

[50] J. Habijanic, M. Berovic, B. Boh, M. Plankl, and B. Wraber,“Submerged cultivation of Ganoderma lucidum and the effectsof its polysaccharides on the production of human cytokines

9Journal of Immunology Research

TNF-α, IL-12, IFN-γ, IL-2, IL-4, IL-10 and IL-17,” NewBiotechnology, vol. 32, no. 1, pp. 85–95, 2015.

[51] S. Middendorp and E. E. S. Nieuwenhuis, “NKT cells in muco-sal immunity,”Mucosal Immunology, vol. 2, no. 5, pp. 393–402,2009.

[52] X. Sun, S. Somada, K. Shibata et al., “A critical role ofCD30 ligand/CD30 in controlling inflammatory bowel diseasesin mice,” Gastroenterology, vol. 134, no. 2, pp. 447–458.e3,2008.

[53] R. Lopez-Posadas, C. Mascaraque, R. Gonzalez et al., “Thebisphosphonate pamidronate is an intestinal antiinflammatoryagent in rat and mouse experimental colitis,” InflammatoryBowel Diseases, vol. 22, no. 11, pp. 2549–2561, 2016.

[54] E. Calderon-Gomez, H. Bassolas-Molina, R. Mora-Buch et al.,“Commensal-specific CD4+ cells from patients with Crohn’sdisease have a T-helper 17 inflammatory profile,” Gastroenter-ology, vol. 151, no. 3, pp. 489–500.e3, 2016.

[55] K. Chao, S. Zhang, J. Yao et al., “Imbalances of CD4+ T-cellsubgroups in Crohn’s disease and their relationship withdisease activity and prognosis,” Journal of Gastroenterologyand Hepatology, vol. 29, no. 10, pp. 1808–1814, 2014.

[56] E. Vivier, D. H. Raulet, A. Moretta et al., “Innate or adaptiveimmunity? The example of natural killer cells,” Science,vol. 331, no. 6013, pp. 44–49, 2011.

[57] S. Ben-Horin and Y. Chowers, “Tailoring anti-TNF therapy inIBD: drug levels and disease activity,” Nature Reviews Gastro-enterology & Hepatology, vol. 11, no. 4, pp. 243–255, 2014.

[58] J. Liang, S. Chen, J. Chen et al., “Therapeutic roles of poly-saccharides from Dendrobium Officinaleon colitis and itsunderlying mechanisms,” Carbohydrate Polymers, vol. 185,pp. 159–168, 2018.

[59] C. Bauer, P. Duewell, C. Mayer et al., “Colitis induced in micewith dextran sulfate sodium (DSS) is mediated by the NLRP3inflammasome,” Gut, vol. 59, no. 9, pp. 1192–1199, 2010.

[60] S. Danese, “New therapies for inflammatory bowel disease:from the bench to the bedside,” Gut, vol. 61, no. 6,pp. 918–932, 2012.

10 Journal of Immunology Research

Stem Cells International

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

MEDIATORSINFLAMMATION

of

EndocrinologyInternational Journal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Disease Markers

Hindawiwww.hindawi.com Volume 2018

BioMed Research International

OncologyJournal of

Hindawiwww.hindawi.com Volume 2013

Hindawiwww.hindawi.com Volume 2018

Oxidative Medicine and Cellular Longevity

Hindawiwww.hindawi.com Volume 2018

PPAR Research

Hindawi Publishing Corporation http://www.hindawi.com Volume 2013Hindawiwww.hindawi.com

The Scientific World Journal

Volume 2018

Immunology ResearchHindawiwww.hindawi.com Volume 2018

Journal of

ObesityJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Computational and Mathematical Methods in Medicine

Hindawiwww.hindawi.com Volume 2018

Behavioural Neurology

OphthalmologyJournal of

Hindawiwww.hindawi.com Volume 2018

Diabetes ResearchJournal of

Hindawiwww.hindawi.com Volume 2018

Hindawiwww.hindawi.com Volume 2018

Research and TreatmentAIDS

Hindawiwww.hindawi.com Volume 2018

Gastroenterology Research and Practice

Hindawiwww.hindawi.com Volume 2018

Parkinson’s Disease

Evidence-Based Complementary andAlternative Medicine

Volume 2018Hindawiwww.hindawi.com

Submit your manuscripts atwww.hindawi.com