-
Supporting InformationTorrente et al. 10.1073/pnas.1505670112SI
MethodsGeneration of Atrial-Specific NCX KO Mice. We have
previously de-scribed the generation of atrial specific NCX1
knockout (KO)mice (2). Briefly, we produced the mice by crossing
NCX1 exon11 floxed mice (16) with sarcolipin Cre mice (2). NCX1
KOmice(referred to throughout this paper as NCX KO mice) are
viableinto adulthood. The animals used in this study were between
10and 16 wk of age and were healthy. We used males and femalesin
the ratio 70% to 30% but did not observe any
sex-specificdifferences in rhythm. All animal procedures were
reviewed andapproved by the Institutional Animal Care and Use
Committeeof the Cedars-SinaiMedical Center. Animals were housed
understandard conditions and allowed access to food and water
adlibitum.
Intact SAN/Atrial Preparation.We removed hearts via
thoracotomyfrom heparinized (300 U i.p.) NCX KO mice or NCX
floxedlittermates (referred to throughout the paper as WT)
anes-thetized with isoflurane. We then separated the atria from
theventricles leaving the sinoatrial node (SAN) intact. The
entireSAN/atrial explanted tissue was placed in heparinized (10
U/mL)modified Tyrodes solution heated to 36 °C. The Tyrodes
solutioncontained 140 mM NaCl, 5.4 mM KCl, 5 mM Hepes, 5.5
mMglucose, 1 mM MgCl2, and 1.8 mM CaCl2 (pH adjusted to 7.4with
NaOH) and served as the control solution for all experi-ments. We
used a stereomicroscope (SZX16; Olympus) with lowmagnification (7×)
to transilluminate and visualize directly theisolated SAN/atrial
preparation. We identified the SAN regionusing the borders of the
superior and inferior vena cava, thecrista terminalis, and the
interatrial septum as landmarks (14).The SAN/atrial preparation
including right and left atria (RAand LA) was pinned to the bottom
of an optical chamber(Fluorodish, FD35PDL-100; WPI) coated with ∼2
mm of clearSylgard (Sylgard 184 Silicone elastomer kit; Dow
Corning). Tomaintain the SAN in a flat plane, we pinned the atrial
prepa-ration as shown in Movies S1 and S2. To avoid any
interferencefrom secondary pacemaker tissue, we removed the AV node
fromthe preparation.
Voltage Mapping. To analyze voltage changes in the
SAN/atrialtissue, the entire preparation, including SAN, LA, and
RA, wasloaded by immersing the tissue in a Tyrodes solution
containingthe voltage-sensitive indicator RH237 (10 μM; Biotium)
for atleast 30 min at room temperature (20–22 °C). To
maintainproper oxygenation of the tissue, a micromagnet agitated
thesolution during loading. After the loading step, the tissue
waswashed in dye-free Tyrodes for 15 min. During this step,
thetemperature was slowly increased to 34–36 °C. The SAN/atrial
tissue was then constantly perfused at 34–36 °C and imaged
byhigh speed optical voltage mapping (1 or 2 ms per frame) on
aMiCAM Ultima-L complementary metal oxide semiconductor(CMOS)
camera (100 × 100-pixel CMOS sensor, 10 × 10 mm)(SciMedia). This
camera was mounted on a THT microscope,with two objectives (2× and
1.6×) that generated a field of viewof 12.5 × 12.5 mm. A 150-W
halogen light system with built-inshutter (SciMedia) was used as an
excitation light source for thevoltage dye. The filter set included
a 531/50-nm excitation filter,580-nm dichroic mirror, and 580
long-pass emission filter. Toavoid motion artifacts, we blocked
mechanical activity usingblebbistatin (1.5–5 μM; Tocris
Bioscience). We usually limitedour recording times to 32.768 s
(16,384 frames at 2 ms per frame)to avoid phototoxic effects of the
dyes. Optical raw data wereanalyzed using dedicated software from
the camera developer,BVAna Analysis Software (Brainvision). We used
the back-ground picture of the SAN/atrial preparation obtained with
theCMOS camera to measure the SAN area (bounded by the
cristaterminalis and interatrial septum) in mm2. Measurements
wereobtained by three independent observers, blinded to
genotype,using ImageJ software (NIH image).
Fibrosis Quantification. To quantify the amount of fibrosis in
theSAN, RA, and LA, the atrial region of the heart was
fixedovernight in phosphate-buffered 10% (wt/vol) formaldehyde
(pH7.4), and embedded in paraffin. Then 5-μm sections were
cutparallel to the epicardial surface and stained for Masson’s
tri-chrome as previously described (10). Briefly, we scanned
eachtissue preparation with a Leica SCN400 Slide Scanner.
Digitalimages of whole cross-sections of the sample were saved
foranalysis. Between 10 and 15 random fields from each
histologicalarea (i.e., SAN, RA, LA) were analyzed at 400×
magnification.The number of fields studied was enough to include
the vastmajority of the tissue. We used ImageJ with a custom
thresh-olding macro to determine the ratio of fibrosis (blue) to
cardiactissue (red). Average results were expressed as percentage
offibrosis area per total tissue area.
RNA Preparation and qPCR.Atrial cardiomyocytes were isolated
byenzymatic digestion with Langendorff perfusion, using our
ven-tricular myocyte protocol (18). Total RNA from two pools of
fivemice each was isolated and DNase-treated using an RNeasyFibrous
Tissue Mini Kit (Qiagen). The first strand cDNA wassynthesized from
1 μg of the total RNA using an RT2 First StrandKit (Qiagen). PCR
reactions were then mixed with RT2 SYBRGreen ROX qPCR Mastermix
(Qiagen) and carried out in a 96-well plate using the 7900 HT
Fast-Time PCR system (Applied
Name Amplicon size Primer Sequence (5′ → 3′) Length Location
Annealing temperature
Cx40 136 Forward GGTCCACAAGCACTCCACAG 20 39–58 58.3
Reverse CTGAATGGTATCGCACCGGAA 21 174–154 57.3
Cx43 176 Forward TCTGTGCCCACACTCCTGTA 20 256–275 58
Reverse TTGCCGTGTTCTTCAATCCCA 21 431–411 57.2
Cx45 245 Forward AGATCCACAACCATTCGACAT 21 35–57 54.8
Reverse TCCCAGGTACATCACAGAGGG 21 279–259 58.1
GAPDH 169 Forward TCACCACCATGGAGAAGGC 19 539–557 57.3
Reverse GCTAAGCAGTTGGTGGTGCA 20 688–707 58.3
Torrente et al. www.pnas.org/cgi/content/short/1505670112 1 of
8
www.pnas.org/cgi/content/short/1505670112
-
Biosystems, Life Technologies brand). The gene primers used(IDT)
are listed above. Data were collected by SDS 2.3 software(Applied
Biosystems, Life Technologies brand) and analyzed usingthe
threshold cycle (Ct) relative quantification method.
Glyc-eraldehyde 3-phosphate dehydrogenase (GAPDH) referencegene was
used for normalizing the data. The expression 2-ΔCt
corresponds to the ratio of each gene expression versus
GAPDH.
Ca Imaging of the SAN. To record cellular Ca, we immersed
theSAN/atrial tissue in Tyrodes containing the Ca-sensitive
indicatorCal-520/AM (10 μM; AAT Bioquest) (13) and Pluronic
F-127(0.13%; Invitrogen) for 30–45 min at 20–22 °C. To
maintainproper oxygenation of the tissue, a micromagnet agitated
thesolution during loading. We chose Cal-520 because its
signal-to-noise ratio is much higher than the more commonly used
fluo-4(13), allowing lower doses of the indicator to avoid Ca
buffering.After the loading step, we washed the tissue with
dye-free Ty-rodes for 15 min before imaging while also increasing
the tem-perature to 34–36 °C. We used the xyt mode (2D) of a
LeicaTCS-SP5-II (Leica Microsystems Inc.) to image intra- and
in-tercellular Ca dynamics in the SAN region (14). We used
488-nmexcitation and >505-nm emission with a 10× objective (N
PLAN10×/0.25; Leica) and scan speeds ranging from 36 to 5 ms
perframe depending on the field size. The fluorescence intensity(F)
proportional to Ca concentration was analyzed after back-ground
subtraction and normalized to baseline fluorescence,F0 (F/F0). To
maintain a bath temperature of 34–36 °C, we useda
temperature-controlled perfusion system (SHM-8, WarnerInstruments),
together with a warming chamber (QE-1; WarnerInstruments).
Single SAN Cell Isolation. We excised the SAN tissue visually
bycutting along the crista terminalis and the interatrial septum
inprewarmed (36 °C) Tyrodes solution. The tissue obtained
wasimmersed into a “low-Ca-low-Mg2+” solution containing 140
mMNaCl, 5.4 mM KCl, 0.5 mM MgCl2, 0.2 mM CaCl2, 1.2 mMKH2PO4, 50 mM
taurine, 5.5 mM D-glucose, 1 mg/mL BSA, and5 mM Hepes-NaOH
(adjusted to pH 6.9 with NaOH) for 2 min.Then we transferred the
tissue into the low-Ca-low-Mg2+ solutioncontaining a highly
purified form of collagenase (Liberase TM;229 U/mL; Roche), as a
single digestive enzyme. Digestion wascarried out for 15–20 min at
36 °C. To stop the digestion process,the SAN was washed using a
modified “Kraftbrühe” (KB) me-dium containing 70 mM L-glutamic
acid, 20 mM KCl, 80 mMKOH, 10 mM KH2PO4, 10 mM taurine, 1 mg/mL
BSA, and10 mM Hepes-KOH (adjusted to pH 7.4 with KOH). Single
cellswere isolated from the SAN tissue by manual agitation in
KBsolution at 36 °C for 2 min (14). To recover the automaticity of
theSAN cells, Ca was gradually reintroduced to a final
concentrationof 1.8 mM (2).
Electrogram Recording of the SAN/Atrial Tissue.Electrograms
(EGMs)(17) of the SAN/atrial tissue were recorded using three
electrodes(Fig. S3C), immersed in the same bath as the SAN/atrial
tissue andpinned in close proximity to reduce electrical impedance.
Theposition of the electrodes reflects the Einthoven triangle used
forhuman ECG recordings. Therefore, this combination of
electrodesgenerated three bipolar and three unipolar leads (I, II,
and III, andaVR, aVL, and aVF, respectively). For data acquisition,
we usedthe ML870 PowerLab 8/30, connected to two Animal Bio FE
136Amplifiers (ADInstruments Inc.). EGM raw data were analyzedusing
dedicated software (Lab Chart 7 PRO; ADInstruments).
ICa,L Recording on Whole-Cell Patch Configuration.We recorded
ICa,Lusing the whole-cell patch clamp technique. We prepared
elec-trodes from borosilicate pipettes (TW150F-3; WPI) using
aSutter P-97 electrode puller. Experiments were carried out usingan
Axopatch 200B amplifier (Molecular Devices), controlled bypClamp
software (version 10.3; Molecular Devices, Inc.). Theelectrode
resistance was ∼2 MΩ when the pipette was filled with110 mM CsCl,
30 mM TEACl, 10 mM NaCl, 0.5 mM MgCl2,5 mM MgATP, 5 mM creatine
phosphate, and 10 mM Hepes(adjusted to pH 7.2 with KOH). Then 1 mM
or 10 mM BAPTA(A4926; Sigma-Aldrich) was included in the internal
solutionwhen required by the protocol (Fig. 3). The bath solution
con-tained 136 mM NaCl, 5.4 mM CsCl, 0.33 mM NaH2PO4, 10 mMHepes, 1
mM MgCl2, 1.8 mM CaCl2, 10 mM glucose, and 10 μMTTX (pH adjusted to
7.4 with NaOH). The bath temperature was36 °C. Series resistance
and capacitance were compensated. SingleSAN cells were depolarized
from −55 to −40 mV for 50 ms toinactivate Na+ current. Then we
evoked Ca current by applying afamily of depolarizing voltage steps
from −55 to +75 mV in10-mV increments (150 ms). ICa,L was obtained
as the differencecurrent before and after application of 20 μM
nifedipine (N7634;Sigma-Aldrich).
Electrical Stimulation of the SAN/Atrial Tissue. To stimulate
the SAN/atrial tissue, we used two electrodes located close to, but
not incontact with, the superior and inferior vena cava regions
(Fig. S3C).These electrodes were connected to a MyoPacer Field
Stimulator(IonOptix). A 20-s train of pulses at different
frequencies was ap-plied. We used bipolar stimulation with 40-V
output and 0.2-mspulse width.
Data Analysis and Statistics. To analyze the burst-firing
pattern ofthe NCX KO SAN, we defined pauses as any absence of
activitybetween two transients (or APs) that was longer than twice
theaverage cycle length (CL) (14) and/or three times the first
quartileCL. CLs longer than 1 s were considered pauses without
furtherconsideration (37). To calculate the extent of spike
adaptation, wecompared the first and last cycle length (CL) of each
burst (23).We reported the change as percent increase of CL.To
quantify the diastolic Ca increase during spontaneous
bursts, we took the diastolic fluorescence at the end (Fend) and
atthe beginning (F0) of the spontaneous burst to obtain the
am-plitude increase of the diastolic Ca [e.g., (Fend − F0)/F0].
Thenwe normalized it to the average amplitude of spontaneous
Catransients during the preceding recording [(Fpeak − F0)/F0].
Weused the same strategy to quantify the diastolic Ca
increaseduring rapid electrical stimulation.All data were expressed
as mean ± SEM, unless otherwise
indicated. Student’s t test (paired or unpaired) and
two-wayANOVA with Bonferroni’s multicomparison test were used
forstatistical analysis where appropriate, as indicated in each
ex-periment. Prism 6 (GraphPad Software, Inc.) was used for
allstatistical analysis. *P < 0.05 was considered statistically
signifi-cant; NS stands for nonsignificant.
Reagents. Unless otherwise specified, all chemicals and
reagentsindicated in the text are from Sigma-Aldrich or Fisher.
Ivabradine(IVA, SML0281-10MG), isoproterenol (ISO, I5627-5G),
andBayK8644 (BayK; B133-1MG) were purchased from Sigma-Aldrich
whereas BAPTA AM (B-6769) was purchased fromInvitrogen.
Torrente et al. www.pnas.org/cgi/content/short/1505670112 2 of
8
www.pnas.org/cgi/content/short/1505670112
-
Fig. S1. Leading region of pacemaker activity recorded with
voltage mapping (colored dots) marked on an example of sinoatrial
node (SAN) tissue in (A) WT(n = 8) and (B) NCX KO (n = 6). Although
the anatomical features of the KO SAN are clear and suggest that
their spontaneous activity originates in the SAN, wecannot
absolutely exclude the presence of intermittent latent pacemaker
foci outside the classical confines of the SAN in NCX KO. CT,
crista terminalis; IAS,interatrial septum; IVC, inferior vena cava;
LA, left atrium; RA, right atrium; SVC, superior vena cava.
Torrente et al. www.pnas.org/cgi/content/short/1505670112 3 of
8
www.pnas.org/cgi/content/short/1505670112
-
Fig. S2. Fibrosis and connexin expression in the NCX KO SAN and
atria. (A) Representative light micrographs of Masson’s trichrome
staining of the sinoatrialnode (SAN), right atrium (RA), and left
atrium (LA) in WT (Upper) and KO (Lower). Blue areas correspond to
fibrosis. (B) Summary plots of percent area withfibrosis in six WT
and four NCX KO tissues. (C) Expression level of Cx40, Cx43, and
Cx45 measured by qPCR, relative to the housekeeping gene GAPDH. *P
<0.05, **P < 0.01, ***P < 0.001 by unpaired t test.
Torrente et al. www.pnas.org/cgi/content/short/1505670112 4 of
8
www.pnas.org/cgi/content/short/1505670112
-
Fig. S3. Simultaneous recordings of Ca and voltage in WT and NCX
KO SAN/atrial tissue. (A) Ca transients recorded using rapid 2D
confocal microscopy (Upper)and simultaneous recordings of EGMs
(Lower) using external electrodes in a WT SAN/atrial preparation.
Recordings are presented with standard (Left) andexpanded (Right)
time scales. (B) Ca (Upper) and voltage (Lower) recordings from a
NCX KO, where the EGM signals are generated only by SAN
activity.(C) Electrode placement surrounding the ex vivo SAN/atrial
tissue. The position of these electrodes reflects the Einthoven
triangle used for human ECG. Onlylead I is reported in A and B. SVC
and IVC stand for superior and inferior vena cava,
respectively.
Torrente et al. www.pnas.org/cgi/content/short/1505670112 5 of
8
www.pnas.org/cgi/content/short/1505670112
-
Fig. S4. Early aftertransients (EATs) and early
afterdepolarizations (EADs) in the NCX KO SAN. (A) Simultaneous
recording of Ca fluorescence (Upper) andEGMs (Lower) using the same
methods as Fig. S3, showing irregular spontaneous activity of an
NCX KO SAN that exhibited frequent EATs (red arrows). Insets(Right)
show expanded views of the simultaneous recordings. Inset 1 shows a
normal Ca transient and depolarization whereas Inset 2 shows a Ca
transient withan EAT. (B) Optical voltage recording of NCX KO SAN
activity showing EADs (red arrows).
Fig. S5. Ca waves in NCX KO SAN tissue. (Left) A still frame
from a 2D confocal image of Ca fluorescence in a wide field of the
explanted NCX KO SAN tissue,showing two selected cells (marked by
red dashed lines) intersected by the scanning line (white dashed
line). Bright areas represent waves. (Right) Confocal linescan
showing a burst of Ca transients followed by a pause. During the
pause, numerous Ca waves were generated. Ca waves are not apparent
during the rapidburst of Ca transients. The green fluorescence
intensity indicates Ca concentration in arbitrary units (a.u.).
Table S1. Ca transient parameters recorded in WT and NCX KO
Parameter WT NCX KO Unpaired t test
Time to peak, ms 13.3 ± 0.4 (n = 23) 22.1 ± 1.0 (n = 20) p <
0.001ΔF/F0 1.2 ± 0.1 (n = 23) 1.0 ± 0.1 (n = 20) NSTau, ms 33 ± 2
(n = 13) 29 ± 2 (n = 14) NS
Torrente et al. www.pnas.org/cgi/content/short/1505670112 6 of
8
www.pnas.org/cgi/content/short/1505670112
-
Movie S1. Contractile activity in the explanted WT sinoatrial
node (SAN) preparation, including the right atrium (RA) and left
atrium (LA), pinned onto a glassbottom Petri dish coated with
sylgard. Note that the RA (Right) and LA (Left) visibly contracted
in synchrony with the SAN (Center). (Scale bar: 10 mm.)
Movie S1
Movie S2. Contractile activity in the explanted NCX KO SAN
preparation, including the right atrium (RA) and left atrium (LA),
pinned onto a glass bottomPetri dish coated with sylgard. Unlike
WT, in the NCX KO the SAN (Center) had brief bursts of contraction
whereas atria were quiescent. (Scale bar: 10 mm.)
Movie S2
Movie S3. Laser scanning confocal microscopy 2D movie (19 ms per
frame) of intracellular Ca release recorded in the SAN region of
the explanted WT SAN/atrial preparation. Note the rhythmic
synchronized Ca release involving all of the cells in the focal
plane. The movie is shown at half speed for improvedvisualization.
The green fluorescence indicates the release of Ca in arbitrary
units using the Ca indicator Cal-520. (Scale bar: 100 μm.)
Movie S3
Torrente et al. www.pnas.org/cgi/content/short/1505670112 7 of
8
http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1505670112/video-1http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1505670112/video-2http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1505670112/video-3www.pnas.org/cgi/content/short/1505670112
-
Movie S4. Laser scanning confocal microscopy 2D movie (19 ms per
frame) of intracellular Ca release recorded in the SAN region of
the explanted NCX KOSAN/atrial preparation. Note the bursts of
synchronous Ca release separated by long pauses characterized by
numerous intracellular Ca waves. The movieis shown at half speed
for improved visualization. The green fluorescence indicates the
release of Ca in arbitrary units using the Ca indicator
Cal-520.(Scale bar: 100 μm.)
Movie S4
Torrente et al. www.pnas.org/cgi/content/short/1505670112 8 of
8
http://movie-usa.glencoesoftware.com/video/10.1073/pnas.1505670112/video-4www.pnas.org/cgi/content/short/1505670112
