1

Supporting Information

Photo zipper locked DNA nanomachine with internal standard for precise miRNA imaging in living cells

Yue Zhang,a Yue Zhang,a Xiaobo Zhang,a Yuyi Li,a Yuling He,a Ying Liu,*a,b Huangxian Jua

a.State Key Laboratory of Analytical Chemistry for Life Science, School of

Chemistry and Chemical Engineering, Nanjing University, Nanjing 210023, China

b.Chemistry and Biomedicine Innovation Center, Nanjing University, Nanjing

210023, China.

E-mail: yingliu@nju.edu.cn

(First author Yue Zhang is MS candidate, second author Yue Zhang is PhD candidate)

Electronic Supplementary Material (ESI) for Chemical Science.This journal is © The Royal Society of Chemistry 2020

2

Experimental Section

Materials and Reagents.

Anhydrous yttrium chloride (YCl3) (99.9%), anhydrous gadolinium chloride

(GdCl3) (99.9%), anhydrous ytterbium chloride (YbCl3) (99.9%), anhydrous erbium

chloride (ErCl3) (99.9%), oleic acid (OA), 1-octadecene (ODE), sodium hydroxide

(NaOH), ammonium fluoride (NH4F), methanol (MeOH), cyclohexene, acetone,

trichloromethane (CHCl3), dimethyl sulfoxide (DMSO), alendronic acid (ADA) were

purchased from Aladin Ltd. (Shanghai, China). Tris-(2-carboxyethyl)-phosphine

hydrochloride (TCEP), glycerol phosphate disodium salt hydrate (GDSH) were

purchased from Sangon Biotech Co. Ltd. (Shanghai, China). NHS-Cy3 was purchased

from Fanbo Biochemicals (Beijing, China). Maleimide-polyethylene glycol-N-

hydroxy succinimide ester (Mal-PEG-NHS) was obtained from Toyongbio Inc.

(Shanghai, China). RNAiso Plus Trizol reagent (TaKaRa), SYBR® Premix Ex TaqTM

Ⅱ (Tli RNaseH Plus), Lipofectanmine™ 2000 (Lipo-2000) transfection reagent were

purchased from Thermo Fisher Scientific Inc. (Rockford, USA). MTT cell

proliferation and cytotoxicity assay kit and all cell lines (HeLa, MCF-7, HEK-293,

MDA-MB-231) were obtained from KeyGen Biotech. Co. Ltd. (Nanjing, China). The

miRNAs were purchased from GenePharma Co. Ltd. (Shanghai, China). All of the

DNA oligonucleotides were synthesized and purified by Sangon Biotech Co. Ltd.

(Shanghai, China) with sequences listed below:

Name Sequence(5'to 3')

S-DNA-BHQ2

HS-

TTTTTTCCACCACATTGAAATTGCACTATrAGGA

AGAGATTTACGAGGCGGTGGTGG-BHQ2

S-DNA

HS-

TTTTTTCCACCACATTGAAATTGCACTATrAGGA

3

AGAGATTTACGAGGCGGTGGTGG

S-DNA-BHQ1

HS-

TTTTTTCCACCACATTGAAATTGCACTATrAGGA

AGAGATTTACGAGGCGGTGGTGG-BHQ1

S-DNA-FAM

HS-

TTTTTTCCACCACATTGAAATTGCACTATrAGGA

AGAGATTTACGAGGCGGTGGTGG-FAM

F1 GGAAGAGATTTACGAGGCGGTGGTGG

F2 TTTTTTCCACCACATTGAAATTGCACTATA

DNAzyme walker

HS-

(T)40TCAGACTGATGTTGATCTCTTCTCCGAGCC

GGTCGAAATAGT

photo zipperAAGAGATCAACATCAGTCTGATAAGCTAPC-

LinkerGGGCAGACTAGCTTA

photo zipper-FAM

FAM-

AAGAGATCAACATCAGTCTGATAAGCTAPC-

LinkerGGGCAGACTAGCTTA

AL AAGAGATCAACATCAGTCTGATAAGCTA

miRNA 21 UAGCUUAUCAGACUGAUGUUGA

miRNA 141 UAACACUGUCUGGUAAAGAUGG

MiRNA 199-a ACAGUAGUCUGCACAUUGGUUA

1-mismatchated miRNA 21 UAGCUUAUCAGACCGAUGUUGA

3-mismatchated miRNA 21 UAGCUAAUCAGACCGAUGUAGA

4

Apparatus.

Transmission electron microscopic (TEM) images were carried out on JEM-2800

transmission electron microscope (JEOL Ltd., Japan). Absorption spectra were

measured with an UV-3600 UV-vis-NIR spectrophotometer (Shimadzu Company,

Japan). Fluorescence spectra were recorded on FluoroMax-4 spectrofluorophotometer

(HITACHI, Japan) equipped with an external continuous-wave laser (980 nm) as the

excitation source. FTIR spectra were measured with a Magan-IR spectrometer 500

(Nicolet) with the KBr pellet technique. Zeta potential analysis was performed on

Nano-Z Zetasizer (Malvern, UK). The gel electrophoresis was conducted on

PowerPac™ Basic electrophoresis analyzer (Bio-Rad, USA) and imaged with Biorad

ChemDoc XRS (Bio-Rad, USA). Unlocking of the photo-zipper was achieved via a

UV lamp (LUYOR-365, China). The cell images were recorded on TCS SP5 confocal

laser scanning microscope (CLSM) (Leica, Germany). Numbers of cells were

determined with Countess® II FL Automated Cell Counter (Thermo Fisher Scientific,

USA). Real-time reverse transcription polymerase chain reaction was carried out

using a CFX96 touch qRT-PCR detection system (Bio-Rad, USA).

Synthesis of core-shell UCNPs NaYF4:Yb,Er,Gd@NaYF4

To prepare the UCNPs shell precursor NaYF4, YCl3 (0.20 mmol, 0.0392 g) was

mixed with 2 mL OA and 6 mL ODE, degassed in vacuum at 150 oC for 1 h and

cooled down to 45 oC. 2 mL methanol containing NH4F (1.00 mmol, 0.0371g) and

NaOH (0.63 mmol, 0.0248 g) were dropwisely added in the above prepared solution,

stirred at 45 oC for 0.5 h, and heated to 110 oC for complete remove of methanol.

Core UCNPs NaYF4:Yb,Er,Gd was prepared by mixing YCl3 (0.70 mmol, 0.1367

g), YbCl3 (0.18 mmol, 0.0503 g), ErCl3 (0.02 mmol, 0.0055 g), and GdCl3 (0.10 mmol,

0.0264 g) in a three-necked flask with subsequent addition of 15 mL ODE and 6 mL

5

OA. The mixture was degassed in vacuum at 150 oC for 1 h, cooled down to 45 oC,

dropwisely added with 10 mL methanol containing NH4F (4.00 mmol, 0.1482 g) and

NaOH (2.50 mmol, 0.0992 g) and stirred at 45 oC for 1 h. After complete evaporation

of methanol at 110 oC, the reaction mixture was heated to 300 oC gradually and kept

under nitrogen atmosphere for 90 min. The above prepared shell precursor NaYF4 was

then hot injected into the core NaYF4:Yb,Er,Gd and stirred at 300 oC for 0.5 h. After

naturally cooled down to room temperature, the resulted NaYF4:Yb,Er,Gd@NaYF4

(UCNPs) was precipitated with acetone, washed with cyclohexane, and redispersed in

trichloromethane or cyclohexane for future use.

Modification of UCNPs with ADA

UCNPs (200 mg) dispersed trichloromethane solution (10 mL) was mixed with 4

mL ethanol and 6 mL ADA aqueous solution (0.1 M), and pH of mixture solution was

adjusted to 2~3 with 1 M HCl. After 2 hours stirring reaction for ADA ligand

exchange with UCNPs surface OA, the upper layer fluid containing prepared ADA

functionalized UCNPs (UCNPs-ADA) was transferred to a new centrifuge tube,

washed twice with water, and re-dispersed in aqueous solution. Aqueous solution

containing 100 μM GDSH was then reacted with as-prepared UCNPs-ADA for 12 h

to prevent DNA strand nonspecific adsorption in following surface functionalization

step.

Preparation of UCNPs-Cy3/PEG-Mal

NHS-Cy3 and NHS-PEG-Mal were covalently conjugated to UCNPs-ADA via

amidation with their surface NH2 groups. NHS-Cy3 and NHS-PEG-Mal were mixed

in various molar ratios (0, 1:20, 1:15, 1:10, 1:7, 1:5), dispersed in DMSO with total

molar concentration of 300 μM, and added into 2.5 mL DMSO containing UCNPs-

ADA (2.0 mg/mL) respectively. After 24 h stirring, the as-obtained UCNPs-

Cy3/PEG-Mal were centrifuged, washed with 0.01M PBS for three times, and

redispersed in 5 mL 0.01M PBS.

Preparation of PZ-DNA nanomachine

6

DNAzyme walker was silenced with photo zipper firstly. To make sure complete

blocking, 6 μL DNAzyme walkers (100 μM) were added with three times molar

excess of photo zipper and diluted with 0.01M PBS buffer (pH=7.4) to make total

volume of 30 μL. The mixture solution was annealed by heating to 75 oC with

subsequent cooling down to 4 oC at a rate of 1.2 oC/min. 20 μM BHQ2 labelled

hairpin structured substrate DNA strand (S-DNA-BHQ2) was also annealed by

heating to 95 oC for 5 min with subsequent cooling down to 25 oC a rate of 1.0 oC/min.

P-DNA walker (10 μM) and S-DNA-BHQ2 (10 μM) were mixed at different molar

ratios with total volume of 200 μL, added with 30 μL above-prepared UCNPs-

Cy3/PEG-Mal (1.0 mg/mL) and 70 μL 0.01 M PBS to make final volume of 300 μL

and reacted for 24 h, the as-obtained PZ-DNA nanomachines were centrifuged,

washed with 0.01 M PBS for three times and re-dispersed in 300 μL 0.01 M PBS and

stored at 4 oC.

To measure the number of S-DNA-BHQ2 and P-DNA walker in each UCNPs,

FAM labelled S-DNA (S-DNA-FAM) and P-DNA walker were reacted with UCNPs-

Cy3/PEG-Mal according to the same procedure, and the fluorescence intensities of

FAM was recorded at 519 nm, the concentration of S-DNA-FAM on UCNPs could be

calculated according to the standard curve. Combined with the concentration of

UCNPs, the average number of S-DNA-BHQ2 per UCNP was derived to 133. Based

on the molar ratio of 10:1 for S-DNA-BHQ2 and P-DNA walker in the reaction, the

number of P-DNA walker per UCNP was calculated as 13.

Polyacrylamide Gel Electrophoresis (PAGE) analysis

10% native polyacrylamide gel was prepared using 1×TBE buffer. The loading

sample was prepared by mixing 7 μL DNA sample, 1.5 μL 6×loading buffer and 1.5

μL UltraPowerTM dye, and placed for 3 min before injected into polyacrylamide gel.

To verify the activation of miRNA 21 responsive a*+b on P-DNA walker, 2 μL P-

DNA walker (10 μM) was irradiated with UV lamp (7 mW/cm2) for 5min, then mixed

with 1.5 μL miRNA 21 (10 μM), diluted with 0.01 M PBS to make total volume of 20

μL, and incubated at 37 oC for 30 min reaction. The gel electrophoresis was run at 80

7

V for 115 min in 1×TBE buffer, and scanned with a Molecular Imager Gel Doc XR.

To verify the reaction feasibility of DNAzyme, 30 μL S-DNA (10 μM) and 15 μL

DNAzyme walker (10 μM) were diluted with 25 mM Tris-acetate buffer (pH=8.0, 200

mM NaCl) to total volume of 190 μL, incubated at 37 oC for 10 min, and added with

10 μL Mn2+ (10 mM) for 30 min reaction. The gel electrophoresis was run at 100 V

for 95 min in 1×TBE buffer, and scanned with a Molecular Imager Gel Doc XR.

In Vitro Detection of miRNA 21

5 μL miRNA 21 of various concentrations were mixed with 100 μL PZ-DNA

nanomachine (50 μg/mL), and diluted with 25 mM Tris-acetate buffer (pH=8.0, 200

mM NaCl) to total volume of 190 μL. After irradiated with UV lamp (7 mW/cm2) for

5min, the reaction mixture was incubated at 37 oC for 20 min, added with 10 μL Mn2+

(10 mM) and incubated for another 1.5 h. The intensities of Cy3 fluorescence

recovery was measured at 580 nm and compared with internal standard luminance

intensity measured at 658 nm with an excitation wavelength of 980 nm. To verify the

protection of photo zipper DNA strand, control experiment was also performed with

the same procedure in the absence of UV irradiation.

Cell Culture

HeLa cells, MDA-MB-231 cells, HEK-293 cells and MCF-7 cells (KeyGEN

Biotech, Nanjing, China) were cultured in Dulbecco's modified Eagle's medium

(DMEM) supplemented with 10 % fetal bovine serum (FBS), 100 μg/mL

streptomycin and 100 U/mL penicillin-streptomycin. All cells were maintained at 37

oC in a humidified incubator containing 5 % CO2 and 95 % air. Cell numbers were

determined with Countess® II FL Automated Cell Counter (Thermo Fisher Scientific,

USA.).

Confocal Fluorescence Imaging

HeLa Cells (~1x104) were seeded in a confocal dish for 24 h incubation at 37 oC

and washed twice with PBS. 200 μL opti-MEM containing PZ-DNA nanomachine

8

(50 μg/mL) was added to each well with 9 h incubation at 37 oC to allow cell uptake

of the DNA nanomachine. After washed with 25 mM Tris-acetate buffer (pH=8.0,

125 mM NaCl) for three times to remove excess nanomachine. Cells were

subsequently treated with 25 mM Tris-acetate buffer (pH=8.0) containing 125 mM

NaCl and 5 mM MnCl2, irradiated with UV lamp for 5 min and incubated at 37 oC in

5% CO2 for 2 h. After washed twice with PBS, cells were imaged by TCS SP5

confocal laser scanning microscope CLSM with 63x oil objective. Cy3 fluorescence

recovery was visualized from 555 to 605 nm and UCNP luminance as internal

standard was visualized from 640 nm to 670 nm under 980 nm excitation. All images

were digitized and analyzed with Leica Application Suite Advanced Fluorescence

(LAS-AF) software package, which integrates intracellular fluorescence intensities of

Cy3 and UCNPs at 580 nm and 658 nm respectively, and averages the resulted

intensities from 20 randomly selected cells. For the intracellular imaging of HEK-293,

MDA-MB-231 and MCF-7 cells, the cells were treated according to the same

procedure above, Cy3 fluorescence and UCNPs fluorescence were collected

according to the same intensity extraction procedure above.

To modulate intracellular expression of miRNA 21, HeLa cells were incubated with

opti-MEM containing Lipofectanmine® 2000 and 300 nM synthetic miRNA 21 mimic

or miRNA 21 inhibitor respectively for 24 h, and imaged with CLSM according to the

same procedure as above described. The transfection process was operated according

to Lipofectanmine® 2000 DNA Transfection Reagent Protocol.

qRT-PCR quantification of intracellular miRNA 21

Total miRNAs were extracted from HeLa, MCF-7, MDA-MB-231 and HEK-293

cells respectively using RNAiso Plus Trizol reagent (TaKaRa, China). cDNA was

prepared following operation instrument, which was detected with real time PCR to

calculate intracellular miRNA 21 level. Standard curve was constructed with cycle

threshold (Ct) values for synthetic miRNA 21 of various concentrations, and the

expression levels of cellular extracted miRNA 21 were calculated from standard curve.

9

MTT Assay

MTT assays were performed to investigate the cytotoxicity of PZ-DNA

nanomachine. HeLa cells (200 μL medium/1x104 cells/well) were seeded in a 96-well

plate and maintained at 37 oC for 24 h. After removed the medium and washed HeLa

cells twice with PBS, series concentrations of PZ-DNA nanomachine were incubated

with HeLa cells for 24 h. The cells were then washed twice with PBS, mixed with 50

μL MTT solution (5 mg/mL) and cultured for 4 h. After removing the remained MTT

solution, 150 μL DMSO was added to dissolve the formazan crystal precipitates, and

the 96-well plate was vibrated slightly for 30 min. The optical density (OD) was

measured at wavelength of 490 nm via Bio-Rad microplate reader.

HeLa cells were exposed under UV irradiation (7 mW/cm2) for 5 min, incubated at

37 oC for 3h, and MTT assay was performed according to above procedure to test the

phototoxicity of UV irradiation to cells.

10

Fig. S1 (a) TEM image of UCNPs NaYF4:Yb,Er,Gd. (scale bar: 20 nm) (b)

Normalized upconversion luminance spectra and (c) corresponding fluorescence

intensity ratios of Cy3 fluorescence at 580 nm over UCNPs luminance at 658 nm

(I580/U658) for UCNPs-Cy3/PEG-Mal with different modification concentration ratios

of Cy3 over NHS-PEG-Mal from 1:20 to 1:5. (d) Standard calibration curve of Cy3

fluorescence intensity versus concentrations from 0.1 to 1 μM. The error bars indicate

means ± S.D. (n=3). (e) The fluorescence spectrum of UCNPs-Cy3/PEG-Mal (50

μg/mL) under 545 nm excitation. The light gray region indicates the standard

deviation (n=3) (f) UV-Vis spectra of UCNPs-Cy3/PEG-Mal and PZ-DNA

nanomachine.

11

12

Fig. S2 (a) Schematic illustration and (b) Gel electrophoresis assay characterization of

DNAzyme catalytic cleavage reaction. Lane 1: S-DNA, lane 2: DNAzyme walker,

lane3: F2, lane4: F1, lane5: mixture of S-DNA and DNAzyme walker, lane6: 300-bp

DNA ladder markers. (c) Normalized upconversion luminance spectra of UCNPs and

UCNPs-DNA-BHQ1 (d) Normalized fluorescence emission spectra of UCNPs under

980 nm excitation and normalized absorption spectra of BHQ1.

13

Fig. S3 Fluorescence intensity ratio of Cy3 fluorescence at 580 nm over UCNPs

luminance at 658 nm (I580/U658) (a) for UCNPs functionalized with different molar

ratios of S-DNA-BHQ2/DNAzyme walker from 5:1 to 30:1 before (Quenching) and

after (Recovery) DNAzyme catalytic reaction, and (b) for UCNPs functionalized with

10:1 S-DNA-BHQ2/DNAzyme at different poly T length from 20T to 60T after

DNAzyme catalytic reaction. (c) Standard calibration curve of S-DNA-FAM

fluorescence intensity versus concentrations from 0.1 to 1 μM. The error bars indicate

means ± S.D. (n=3). (d) The fluorescence spectrum of UCNPs-Cy3/S-DNA-

FAM/DNAzyme walker (50 μg/mL) under 485 nm excitation. The light gray region

indicates the standard deviation (n=3).

14

Fig. S4 (a) Schematic illustrations and FAM fluorescence spectra in response to 2 nM

miRNA 21 of (b) PF-DNA nanomachine and (c) SF-DNA nanomachine. (d)

Luminance intensities ratio for Cy3 at 580 nm over UCNPs at 658 nm (I580/U658) of

PZ-DNA nanomachine in absence (blank) and present of 2 nM miRNA 21 and

nonspecific miRNAs of miRNA 141, miRNA 199-a, three-base mismatched miRNA

21 (3-mismatched), and single-base mismatched miRNA 21 (1-mismatched). The

error bars indicate means ± S.D. (n=3).

15

Fig. S5 Time-dependent CLSM images of HeLa cells incubated with PZ-DNA

nanomachine (in the absence of quencher BHQ2) and Lysotracker Green. Emission

was collected by green channel (Lysotracker Green) at 505-535 nm with 488 nm

excitation and red channel (Cy3) at 555-605 nm with 980 nm excitation. (scale bar: 20

μm).

Fig. S6 CLSM images of HeLa cells incubated with PZ-DNA nanomachine (S-DNA-

Cy5 as component) for 5 h. Emission was collected by green channel (Lysotracker

Green) at 505-535 nm with 488 nm excitation, red channel (UCNPs) at 520-560 nm

with 980 nm excitation and blue channel (Cy5) at 650-700 nm with 633 nm excitation.

(scale bar: 20 μm).

16

Fig. S7 Cy3 fluorescence recovery in HeLa cells in response to intracellular miRNA

21 at different times after photo activation. (scale bar: 20 μm).

Fig. S8 CLSM images of HeLa cells incubated with (a) PZ-DNA nanomachine, (b)

photo activated PZ-DNA nanomachine, and (c) unprotected PZ-DNA nanomachine.

(scale bar: 20 μm).

17

Fig. S9 (a)Amplification curves of miRNA 21 input ranging from 1 pM to 10 nM in

qRT-PCR. (b) Standard curve of miRNA 21.

Fig. S10 MTT assays of HeLa cells. (a) Cytotoxicity of PZ-DNA nanomachine with

different concentrations. (b) Cell viability of HeLa cells incubated with PBS (control)

and 50 μg/mL PZ-DNA nanomachines with or without 5 min UV (7 mW/cm2)

irradiation. The error bars indicate means ± S.D. (n=3).