Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Supplementary Materials for
The transcription factor ATF2 promotes melanoma metastasis by
suppressing protein fucosylation
Eric Lau,* Yongmei Feng, Giuseppina Claps, Michiko N. Fukuda, Ally Perlina,
Dylan Donn, Lucia Jilaveanu, Harriet Kluger, Hudson H. Freeze, Ze’ev A. Ronai*
*Corresponding author. E-mail: [email protected] (E.L.); [email protected] (Z.A.R.)
Published 8 December 2015, Sci. Signal. 8, ra124 (2015)
DOI: 10.1126/scisignal.aac6479
The PDF file includes:
Methods
Fig. S1. Transcriptional regulation of FUK by ATF2 and L-fucose uptake in
melanoma cells.
Fig. S2. Increasing melanoma fucosylation slows motility and invasiveness.
Fig. S3. Increasing melanoma tumor fucosylation increases intratumoral CD45+ and
NKp46+ immune cell infiltrates.
Table S1. Primers.
www.sciencesignaling.org/cgi/content/full/8/406/ra124/DC1
Supplementary Methods: FUK and ATF2 expression correlation analysis of TCGA
cutaneous melanoma
Briefly, using Illumina HiSeq data from a TCGA cutaneous melanoma study (473
samples), we computed the correlation between FUK and ATF2 and visualized
expression patterns in the UCSC Cancer Genome browser (https://genome-
cancer.ucsc.edu/proj/site/hgHeatmap/; filename: TCGA_SKCM_exp_HiSeqV2-2015-02-
24.tgz; version: 2015-02-24). The data were acquired from the UCSC Genome browser
and analyzed as follows:
1. Follow this link:
https://genome-cancer.ucsc.edu/proj/site/hgHeatmap
2. Close out of the dataset displayed by default by hitting the blue “X” on the right side
3. Click “Add Dataset” gray button on the left
4. In the search window type SKCM and click to expand the folder called “SKCM skin
cutaneous melanoma.”
5. Hover over the dataset as shown below to see the download button and to also be
able to add the dataset to the browser, get more info, and perform analyses through
the browser web portal by clicking on the file itself:
when hovering over the file, clicking “i” will bring up the dataset info:
About Dataset: SKCM gene expression (IlluminaHiSeq)
TCGA skin cutaneous melanoma (SKCM) gene expression by RNAseq.
The gene expression profile was measured experimentally using the Illumina HiSeq
2000 RNA Sequencing platform by the University of North Carolina TCGA genome
characterization center. Level 3 interpreted level data was downloaded from TCGA data
coordination center. This dataset shows the gene-level transcription estimates, as in
RSEM normalized count. Genes are mapped onto the human genome coordinates using
UCSC cgData HUGO probeMap. Reference to method description from University of
North Carolina TCGA genome characterization center: DCC description
In order to more easily view the differential expression between samples, we set the
default view to center each gene or exon to zero by independently subtracting the mean
of the genomic location on the fly. Users can view the original non-normalized values by
uncheck the "Normalize" option. For more information on how to use the cancer
browser, please refer to the help page.
Processed
Data Download version: 2015-02-24
Label TCGA skin cutaneous melanoma (SKCM) gene expression by RNAseq
(IlluminaHiSeq)
Authors University of North Carolina TCGA genome characterization center
Raw Data
https://tcga-
data.nci.nih.gov/tcgafiles/ftp_auth/distro_ftpusers/anonymous/tumor/skcm/cgcc/
unc.edu/illuminahiseq_rnaseqv2/rnaseqv2/
# Samples 473
Dataset ID TCGA_SKCM_exp_HiSeqV2
Authorized
Project Public data
Wrangler cgData TCGAscript RNAseq processed on 2015-01-27
Wrangling
Procedure
Level_3 Data (file names: *.rsem.genes.normalized_results) download from
TCGA DCC, log2(x+1) transformed, and processed at UCSC into cgData
repository
Clinical
Fields
age at initial pathologic diagnosis
bcr_followup_barcode
breslow depth value
days to birth
days to collection
days to death
days to initial pathologic diagnosis
days to last followup
days to new tumor event additional surgery procedure
days to new tumor event after initial treatment
days to submitted specimen diagnosis
distant metastasis anatomic site
followup case report form submission reason
form_completion_date
gender
height
history of neoadjuvant treatment
ICD-O-3 histology
ICD-O-3 site
informed consent verified
initial weight
interferon 90 day prior excision admin indicator
International Classification of Diseases, tenth revision (ICD-10)
is_ffpe
lactate dehydrogenase result
lost follow up
malignant neoplasm mitotic count rate
melanoma clark level value
melanoma origin skin anatomic site
melanoma ulceration indicator
new neoplasm event occurrence anatomic site
new neoplasm event type
new non melanoma event histologic type text
new primary melanoma anatomic site
new tumor additional drug treatment
new tumor additional radiation treatment
new tumor diagnosis prior submitted specimen dx
new tumor event additional surgery procedure
new tumor event after initial treatment
new tumor metastasis anatomic site
new tumor metastasis anatomic site other text
OCT embedded (OCT is an embedding medium used for frozen tissue)
pathologic_M
pathologic_N
pathologic_stage
pathologic_T
pathology_report_file_name
percent_lymphocyte_infiltration_TOP
percent_monocyte_infiltration_TOP
percent_necrosis_TOP
percent_neutrophil_infiltration_TOP
percent_normal_cells_TOP
percent_stromal_cells_TOP
percent_tumor_cells_TOP
percent_tumor_nuclei_TOP
person neoplasm cancer status
postoperative drug treatment
primary anatomic site count
primary melanoma at diagnosis count
primary neoplasm melanoma diagnosis
primary tumor multiple present indicator
prior diagnosis
prior systemic therapy type
radiation therapy
sample type
sample type id
subsequent primary melanoma during followup
system_version
tissue prospective collection indicator
tissue retrospective collection indicator
tissue source site
tumor tissue site
vial number
vital status
weight
year of initial pathologic diagnosis
_anatomical_origin
_cohort
_EVENT overall survival indicator 1=death 0=censor
_GENOMIC_ID
_GENOMIC_ID_TCGA_SKCM_exp_HiSeqV2
_GENOMIC_ID_TCGA_SKCM_exp_HiSeqV2_exon
_GENOMIC_ID_TCGA_SKCM_exp_HiSeqV2_PANCAN
_GENOMIC_ID_TCGA_SKCM_exp_HiSeqV2_percentile
_GENOMIC_ID_TCGA_SKCM_gistic2
_GENOMIC_ID_TCGA_SKCM_gistic2thd
_GENOMIC_ID_TCGA_SKCM_GSNP6noCNV
_GENOMIC_ID_TCGA_SKCM_GSNP6raw
_GENOMIC_ID_TCGA_SKCM_hMethyl450
_GENOMIC_ID_TCGA_SKCM_miRNA_HiSeq
_GENOMIC_ID_TCGA_SKCM_mutation
_GENOMIC_ID_TCGA_SKCM_mutation_bcm_gene
_GENOMIC_ID_TCGA_SKCM_mutation_broad_gene
_GENOMIC_ID_TCGA_SKCM_mutation_ucsc_maf_gene
_GENOMIC_ID_TCGA_SKCM_mutation_ucsc_vcf_gene
_GENOMIC_ID_TCGA_SKCM_RPPA
_OS overall survival in days
_OS_IND overall survival indicator 1=death 0=censor
_PATIENT_ID
_primary_disease
_RFS recurrence free survival in days
_RFS_IND recurrence free survival indicator 1=new tumor; 0=otherwise
_SAMPLE_ID
_TIME_TO_EVENT overall survival in days
Following dataset info, more description was available from the following location:
https://tcga-
data.nci.nih.gov/tcgafiles/ftp_auth/distro_ftpusers/anonymous/tumor/skcm/cgcc/unc.edu/i
lluminahiseq_rnaseqv2/rnaseqv2/unc.edu_SKCM.IlluminaHiSeq_RNASeqV2.Level_3.1.
13.0/DESCRIPTION.txt:
V1_BWAtoTranscriptome, V1_RNASeqQuantification: UNC V1 RNA-Seq Workflow -
BWA Alignment to Transcriptome
Date: 20101108 Authors: * Sara Grimm <[email protected]> * Brian O'Connor
Versions: This analysis was carried out using the SeqWare Pipeline project, version
0.7.0. The workflow was "RNASeqAlignmentBWA" version 0.7.x. UNC provides all our
analysis software through this open source project. Users can download this software to
run the identical RNA-Seq analysis described in the steps below. See the project
website at http://seqware.sf.net for more information. The UNCIDs provided in file names
are identifiers unique to UNC and can be used to provide data/analysis provenance
tracking.
Conventions: Please note our spljxn.quantification.txt, exon.quantification.txt, and the
GAF file above use the convention of chr:smaller_int-larger_int:+ for plus strand features
and chr:larger_int-smaller_int:- for negative strand features. Carefully examine future
versions of these annotation and quantification files since this convension is subject to
change.
Column Headers: These are just brief descriptions of the column headers you will find in
the various level 3 files. See the DESCRIPTION.txt file in the mage-tab bunlde for more
detailed methods on how each of these files were created. File:
*.trimmed.annotated.gene.quantification.txt * gene: This is the Entrez/LocusLink gene
symbol followed by the Entrez/LocusLink gene ID. * raw_counts: The number of reads
mapping to this gene. * median_length_normalized: This is the total aligned bases to all
transcript models associated with this gene divided by the mean transcript length. *
RPKM: See the DESCRIPTION.txt file in the mage-tab bunlde for information on how
this is calculated. File: *.trimmed.annotated.exon.quantification.txt * exon: This is the
location of the exon in hg19 (GRCh37) based on the UCSC Gene standard track
(December 2009 version). * raw_counts: The number of reads mapping to this exon. *
median_length_normalized: This is the total aligned bases to this exon divided by the
exon length. * RPKM: See the DESCRIPTION.txt file in the mage-tab bunlde for
information on how this is calculated. File: *.trimmed.annotated.spljxn.quantification.txt
This file does not include normalized counts since splice junctions are a fixed size. *
junction: This is the location of the splice junction in hg19 (GRCh37) based on the
UCSC Gene standard track (December 2009 version). * raw_counts: The number of
reads mapping to this splice junction. File: *.wig This is a WIG file format that
represents coverage, see http://genome.ucsc.edu/FAQ/FAQformat.html#format6 for
more information.
V2_MapSpliceRSEM: UNC V2 RNA-Seq Workflow - MapSplice genome alignment and
RSEM estimation of GAF 2.1 Date: 05-10-2012 Contacts: * Lisle Mose
<[email protected]> * Joel Parker <[email protected]> Versions: This
analysis was carried out using the SeqWare Pipeline project, version 0.7.0. The
workflow was "MapspliceRSEM" version 0.7.x. UNC provides all our analysis software
through this open source project.
Conventions: Please note our junction_quantification.txt, exon_quantification.txt, and
the GAF file above use the convention of chr:smaller_int-larger_int:+ for plus strand
features and chr:larger_int-smaller_int:- for negative strand features. Carefully examine
future versions of these annotation and quantification files since this convension is
subject to change. Column Headers: RSEM abundance estimation results in two files,
gene and isoform level quantification. More information regarding the content of these
output files can be found on the RSEM website
(http://deweylab.biostat.wisc.edu/rsem/rsem-calculate-expression.html#output). In short,
the format indicates the feature name in column 1, esimated count in colum 2, scaled
estimate in column 3, and contributing isoforms in column 4 (gene level only). These
files will have the following extensions: rsem.genes.results rsem.isoforms.results
RSEM expression estimates are normalized to set the upper quartile count at 1000 for
gene level and 300 for isoform level estimates. These files have two columns, feature
name and normalized count, and correspond to the following extensions:
rsem.genes.normalized_results rsem.isoforms.normalized_results Exon and junction
level quantification are provided in a similar format as described for V1, although the
Mapsplice genome alignments are used for overlap counting in V2. The exon counts are
formatted as exon location in column 1 (hg19 based on the UCSC Gene standard track,
December 2009 version), number of reads in column 2, fraction of bases covered in
column 3, and RPKM (calculated as described for V1) in column 4. The exon count files
have the extension: bt.exon_quantification.txt The file format for junction counts is
identical to V1 and has the extension: junction_quantification.txt
6. After clicking on the file name, the dataset thumbnail will appear on the left and the
current info window can be closed. Click on the thumbnail to start exploring the
dataset and switch from “chromosome” to “gene” view
7. Click “Advanced Genes” and type in FUK, then ATF2
8. Click on gene signatures to set FUK as a gene signature containing FUK and ATF2
as the gene signature containing ATF2
9. To visualize differential expression between samples, the default view was set to
center each gene at zero by independently subtracting the mean of the genomic
location. The gene signatures feature was used to create two custom gene
signatures one each exclusively for FUK and for ATF2, where the FUK expression
signature was mobilized to the leftmost column and sorted from lowest to highest
expression on the final display. The range of values was set from -1 (lowest, green)
to 1 (highest, red).
10. This data was also downloaded and used for heatmap generation outside of the
cancer browser for extra confirmation purposes, and the same results were
achieved.
Specifically for the generation of fig. S1C, which used the dataset from above: the
correlation coefficient calculation was derived from Pearson Product-Moment Correlation
formula. The gene expression profile was measured experimentally using the Illumina
HiSeq 2000 RNA Sequencing platform by the University of North Carolina TCGA
genome characterization center. Level 3 interpreted level data was downloaded from
TCGA data coordination center. This dataset shows the gene-level transcription
estimates as RSEM normalized counts. Genes are mapped onto the human genome
coordinates using UCSC cgData HUGO probeMap. Method description available here:
https://tcga-
data.nci.nih.gov/tcgafiles/ftp_auth/distro_ftpusers/anonymous/tumor/skcm/cgcc/unc.edu/i
lluminahiseq_rnaseqv2/rnaseqv2/unc.edu_SKCM.IlluminaHiSeq_RNASeqV2.Level_3.1.
13.0/DESCRIPTION.txt
Figure S1. Transcriptional regulation of FUK by ATF2 and L-fucose uptake in
melanoma cells. (A) Upper: (left) qRT-PCR analysis of ATF2 knockdown using shATF2
in WM793 cells. These knockdown cells were used for reconstitution transfection with
ATF2 WT and T52 mutants as shown in the immunoblot analysis (right) of WM793 cells
transfected with HA-tagged ATF2WT, ATF2T52A, and ATF2T52E using the indicated
antibodies. Lower: FUK mRNA expression were quantitated by qRT-PCR in WM1346
(left) and WM1366 (right) melanoma cells that were infected either with control shRNA
(EV) or endogenous ATF2-targeted shRNA (shATF2), or shATF2 and reconstituted with
ATF2WT, ATF2T52A, or ATF2T52E. (B) qRT-PCR analysis of FX, FPGT (isoforms 1, 2, and
3), and GMD (isoforms 1, 2) in WM793 cells that were depleted of endogenous ATF2
and reconstituted with ATF2WT (black), ATF2T52A (dark grey) or ATF2T52E (light grey). No
significant variation in expression was observed. (C) The heatmap shows gene-level
RNA-Seq expression values for 473 melanoma samples from a study obtained from
TCGA. The samples were ordered according to FUK expression, lowest (green) to
highest (red). Each horizontal line corresponds to a sample. ATF2 gene-level data is
displayed side-by-side with that of FUK, but was not used for ranking or sorting the
samples. This visually recapitulates the inverse correlation calculated for these genes (-
0.36). (D) Left: Immunoblot analysis of WM793 cells transfected with empty vector (EV),
HA-tagged ATFT52E, or caPKC using the indicated antibodies. Right: qRT-PCR analysis
of FUK mRNA expression in the presence or absence of shFUK-A3 or shFUK-B3.
shFUK-B3 was used in all other experiments and referred to as “shFUK”. (E) WM1346
(upper) and WM1366 (lower) were transfected with either empty vector (EV), ATF2T52E,
or caPKC for 48 hours, and subjected to immunoblot analysis with indicated antibodies
(left) or probed with either UEA1, LCA, or PSA lectins, and subjected to FACS analysis
(right). (F) UEA1 FACS analysis was performed to measure fucosylated protein
abundance in 501Mel (left) or LU1205 (right) cells transfected with empty vector (EV) or
FUK. (G) FACS analysis of UEA1 signal in the presence of the indicated concentrations
of supplemented L-fucose for a 36-hour treatment period in WM793 (left) and WM1346
(center), or WM1366 (right) cells. (H) Left: Soluble [H3]-L-fucose uptake assessment of
WM793, WM1346, HEK293, and 501Mel cells after 1 hour of labeling followed by
scintillation counts of soluble fractions. No significant variation in uptake was observed.
Right: Quantitation of phosphorylated (fucose-1-phosphate) by QAE binding and
scintillation counting of soluble [H3]-L-fucose fractions from WM793, WM1346, 501Mel,
and HEK293 cells. Data are means ± SD from 3 biological replicates. * p < 0.05. • p <
0.005 by a standard t-test of individual conditions or time points compared to either EV,
shCTL, or to 0 hour time point.
Figure S2. Increasing melanoma fucosylation slows motility and invasiveness. (A)
FACS analysis of UEA1 on 501Mel cells treated with control (5 µl water) or 25 µM ac-
GDP-L-fucose. (B) WM1346 (left) or WM1366 (right) cells were transfected with empty
vector (EV), ATF2T52E, or shFUK and subjected to a scratch assay over a 6-hour period.
(C) UEA1 FACS analysis of HEK293 cells transfected with empty vector (EV) or FUK.
(D) Empty vector (EV)- or FUK-expressing LU1205 spheroid invasion into Matrigel plugs
was quantitated over the indicated time points. (E) Empty vector (EV)- or FUK-
expressing HEK293 spheroid invasion into Matrigel plugs over the indicated time points
(left and center), as well as migration through transwells (right) was assessed.
Representative spheroid images (left) and quantitation of invasion (center) are shown.
Red dashed lines indicate invaded boundaries of spheroids. Data are means ± SD from
3 biological replicates for UEA1 and wound healing assays; spheroid invasion assay
results were derived from 5 spheroids per condition. * p < 0.05; • p < 0.005 by a standard
t-test of individual time points compared to 0 hour time point. Scale bars, 100 µm.
Figure S3. Increasing melanoma tumor fucosylation increases intratumoral CD45+
and NKp46+ immune cell infiltrates. (A) Quantitation of protein fucosylation as a
measure of UEA1 staining (within DAPI area) of tumor sections from 3 representative
tumors of control or 100 mM L-fucose-supplemented mice. Fluorescence is relative to
that in the representative control, tumor #1. (B) qRT-PCR analysis of mFuk mRNA
expression of 3 representative EV- and mFuk-expressing tumors. mFuk expression
shown is relative to representative EV tumor #1. (C) Quantitation of UEA1 staining
(within DAPI area) of tumor sections from 3 representative EV- or mFuk-expressing
tumors from mice provided control water or 100 mM L-fucose (Fucose)-supplemented
water. (D and E) Representative CD45-positive (D) or NKp46-positive (E) tumor sections
[counter stained with 4',6-diamidino-2-phenylindole (DAPI)] from control or 100 mM
fucose-supplemented mice. (F and G) Quantitation of CD45-positive (F) or NKp46-
positive (G) cells in 3 representative EV- or mFuk-expressing tumors from control water-
or 100mM L-fucose (Fucose)-supplemented water mice. • p < 0.005; # p <0.0005 by a
standard t-test of individual conditions compared to control or EV samples. Scale bars,
100 µm. Insets are magnified 3-fold from the original image.
Primer Sequence (5’-3’)
FUK promoter
Wild-type, full-length f: CGCGGAATTCATGCAGTTCTCAGCTTGACTTTTCCC r: CGCGAAGCTTCAGCTGCCAGCAGGTCCG
E1 site mutant f: CTTTTCCCTTCACCTTAGTGACTTTGGG r: TCAAGCTGAGAACTGCATAG
E2 site mutant f: GGCAGGTACGGAGGTCCGCGAGGGTCGCCG r: GTCGCCCGGCGCTCGGCG
E3 site mutant f: GCACCCTCCCCACCTGGGAGCACC r: ACCGGAAAGCTGAGGGGG
qRT-PCR
H3A (human and mouse)
f: AAGCAGACTGCCCGCAAAT
r: GGCCTGTAACGATGAGGTTTC
FUK (human) f: CAGATTGTGCACTCCCAGGT
r: CTGTATCCAGGCCAGTCACC
Fuk (mouse) f: ACTTCCGCCGAGATCTGTTC
r: GGATCAGTGGACGTAGGCAG
PRKCE (human,
encodes PKCε)
f: TGACGTGGACTGCACAATGA
r: CCATGCTGGTGGAGGAACAT
Prkce (mouse) f: CTCTCCAGTCTTGGTCCCAT
r: CGAACGTTTCAAACCACAAC
FUK promoter, E1 site f: TTCCCAAAAGGTCCGCAGAT
r: GGTTTGCGCTGGTTTCATCA
FUK promoter, E2/3 site f: ATCTCCCTTCTGGATTGCAGC
r: CGGACTGACGTACCTGCC
Expression vector
mouse Fuk construct
(mFuk)
f: CGCGCGTCTAGAATGGAGCAGTCAGAGGGAGTCAATTG r:
CGCGCGGCTAGCCTAGGTGGTGCCCACTTCAGAG
Table S1: Primers. Sequences (shown 5’ to 3’) for the primers used in this study. f, forward; r, reverse.