Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
Supplementary Materials for
MET signaling in keratinocytes activates EGFR and initiates squamous
carcinogenesis
Christophe Cataisson, Aleksandra M. Michalowski, Kelly Shibuya, Andrew Ryscavage,
Mary Klosterman, Lisa Wright, Wendy Dubois, Fan Liu, Anne Zhuang,
Kameron B. Rodrigues, Shelley Hoover, Jennifer Dwyer, Mark R. Simpson,
Glenn Merlino, Stuart H. Yuspa*
*Corresponding author. Email: [email protected]
Published 21 June 2016, Sci. Signal. 9, ra62 (2016)
DOI: 10.1126/scisignal.aaf5106
The PDF file includes:
Fig. S1. Malignant conversion rate is increased in MT-HGF compared to DT
animals.
Fig. S2. Ras mutation analysis in DMBA-TPA and MET-generated skin lesions.
Fig. S3. MT-HGF keratinocytes can form squamous papillomas when orthotopically
grafted.
Fig. S4. HGF-MET does not enhance responses to TPA.
Fig. S5. Treatment of MT-HGF keratinocytes with a MET inhibitor (PHA665752)
reverses their phenotype in vitro.
Fig. S6. EGFR dependence of the MET and RAS signatures in keratinocytes.
Fig. S7. Effects of EGFR inhibition on the transcriptional profile of MT-HGF
keratinocytes.
Fig. S8. Activated MET gene signature is not dependent on individual Ras allele
expression.
Fig. S9. TGF and AREG neutralizing antibody activities reduce the activation of
EGFR in MT-HGF keratinocytes.
Fig. S10. Both iRhom1 and iRhom2 contribute to the release of AREG upon MET
activation.
Fig. S11. Gefitinib treatment reduces proliferation and microvessel density in MT-
HGF squamous papillomas.
Fig. S12. MET activation causes EGFR ligand, cytokine, and chemokine mRNA up-
regulation in human keratinocytes.
www.sciencesignaling.org/cgi/content/full/9/433/ra62/DC1
Fig. S13. Quantification for immunoblots represented in Figs. 2 and 3.
Fig. S14. Quantification for immunoblots represented in Figs. 4 and 5.
Fig. S15. Quantification for immunoblots represented in Figs. 6 and 8.
Legends for tables S1 to S3
Table S4. PCR primers.
Other Supplementary Material for this manuscript includes the following:
(available at www.sciencesignaling.org/cgi/content/full/9/433/ra62/DC1)
Table S1 (Microsoft Excel format). The list of 5812 significant genes concordantly
up-regulated or down-regulated in the wild-type RAS and MT-HGF keratinocytes.
Table S2 (Microsoft Excel format). GO functions enriched in the RAS/MET 372-
gene signature.
Table S3 (Microsoft Excel format). Upstream regulators predicted by IPA to be
responsible for expression changes in the RAS/MET 372-gene signature.
Fig. S1: Malignant conversion rate is increased in MT-HGF compared to DT animals. The malignant conversion rate
(% squamous carcinoma among all squamous lesions) was determined at week 20 among the three tumor bearing groups
(50% for K5-PKCa, 73% for MT-HGF, and 23% for DT mice). K5-PKC n=4, MT-HGF n=11 and DT n=30, with n
representing the number of squamous lesions analyzed. A two-sample t-test between proportions was performed to
determine whether there was a significant difference between MT-HGF and DT groups with respect to the % conversion.
The t-statistic was significant, *p= 0.0056.
Fig. S2: Ras mutation analysis in DMBA-TPA and MET-generated skin lesions. (A) Frequency of mutations in Hras
and Kras in mouse skin tumors from DMBA-TPA experiments. (No tumors formed in WT animals). (B) Absence of
mutations in Hras1, Kras and Nras in DT squamous papillomas harvested from study shown in Fig. 1 D-F.
Fig. S3: MT-HGF keratinocytes can form squamous papillomas when orthotopically grafted. (A) Representative
photographs of syngeneic orthotopic grafts at the interscapular site. Six million wild-type (left) or MT-HGF (right)
keratinocytes were mixed respectively with 6 million wild-type or MT-HGF primary dermal fibroblasts prior to grafting.
The upper panels show grafts forming on either wild-type or MT-HGF recipients. The lower panel shows a tumor forming
from wild-type keratinocytes grafted onto MT-HGF recipients. (B) Representative H&E micrograph of a squamous
papilloma arising from MT-HGF keratinocyte combined with MT-HGF primary dermal fibroblasts grafted onto a MT-
HGF recipient mouse. Scale bar, 25m.
Fig. S4: HGF-MET does not enhance responses to TPA. (A) A single dose of TPA (1 μg) in acetone was applied to the
shaved backs of WT, K5-PKCα, MT-HGF and DT littermates, and samples of treated skin were collected at various times
and stained with H&E. Asterisk marks typical microabcesses. Scale bar, 50m. (B) Neutrophilic infiltration in the
epidermis of the mice treated as in (A) was quantified using leukocyte myeloperoxidase activity (MPO). Bars represent
the mean ± SEM of four independent animals and results are representative of two independent experiments. P-value was
calculated using two-sided student’s t-test. *P < 0.05 vs. WT. **P < 0.01 vs. WT. (C) Epidermal hyperplasia was
quantified in randomly selected regions on H&E stains (presented on panel A) of skin biopsies taken from mice 3 days
after TPA treatment. *P < 0.05 vs. WT. (D and E) Real-time PCR analysis of Cxcl1 (CXCL1 mRNA) and Areg
(amphiregulin mRNA) expression in control (acetone) and TPA treated mice 1 and 3 days after topical treatment. *P <
0.05 vs. WT TPA. **P < 0.01 vs. WT TPA. ***P < 0.01 vs. WT TPA, n=3 mice per genotype for the acetone groups and
n=4 mice per genotype for the TPA groups. (F) Tissue lysates were prepared from full-thickness skin biopsies of all four
genotypes collected 1 day post TPA treatment. Immunoblots were performed for COX-2 and GAPDH for loading control.
Each lane represents an individual animal.
Fig. S5: Treatment of MT-HGF keratinocytes with a MET inhibitor (PHA665752) reverses their phenotype in
vitro. (A) MT-HGF keratinocytes developed a more elongated morphology in the absence of RAS transduction that can
be reverted upon treatment with the MET pharmacological inhibitor PHA-665752. Scale bar, 100m. (B) real-time PCR
analysis of amphiregulin (Areg) mRNA expression in wild-type and MT-HGF keratinocytes treated for 48 hours with the
MET inhibitor PHA665752. Data are mean ± SEM of three biological replicates. #P < 0.001 vs. WT DMSO; ***P <
0.001 vs. MT-HGF DMSO, by a two-sided student’s t-test. (C) MT-HGF primary keratinocytes were cultured in 0.05 mM
Ca++ medium to confluence and treated for 48 hours with the MET inhibitor PHA665752. Total cell extract from primary
keratinocytes was analyzed by immunoblotting for phosphorylated (p-) and total EGFR and HSP90. (D) EGFR inhibition
does not decrease phospho-MET levels in DT keratinocytes. Primary keratinocytes from wild-type (WT) and DT
newborns were cultured in 0.05 mM Ca2+. When confluent, cultures were treated with AG1478 for 24 hours and with a
final concentration of 1µM. Total cell extract from primary keratinocytes were analyzed by immunoblotting for
phosphorylated (p-) and total MET, and HSP90.
Fig. S6: EGFR dependence of the MET and RAS signature in keratinocytes. (A and B) Real-time PCR analysis of
CXCL1 (Cxcl1), IL-1a (Il1a), keratin1 (Krt1), keratin10 (Krt10), amphiregulin (Areg), betacellulin (Btc), heparin-binding
EGF-like growth factor (Hbegf) and transforming growth factor α (Tgfa) mRNA expression in (A) wild-type and EGFR-
deficient primary keratinocytes were cultured in 0.05 mM Ca2+ medium to confluence and treated for 18 hours with
recombinant HGF (40ng/ml) or (B) control or v-rasHa transduced wild-type and EGFR-/- keratinocytes. (C) Real-time PCR
analysis of IL-1a (Il1a), K1 (Krt1), K10 (Krt10) and CXCL1 (Cxcl1) mRNA expression in wild-type and MT-HGF
keratinocytes treated for 24 hours with the EGFR inhibitor AG1478 or PD168393. Data are means ± SEM of three
biological replicates. P-values were calculated using two-sided student’s t-test. A, *P < 0.05 vs WT-HGF, **P < 0.01 vs
WT-HGF. B, **P < 0.01 vs WT-RAS, ***P < 0.001 vs. WT-RAS, ****P < 0.0001 vs WT-RAS. C, **P < 0.01 vs. MT-
HGF DMSO ***P < 0.001 vs. MT-HGF DMSO, #P < 0.001 vs.WT DMSO.
Fig. S7: Effects of EGFR inhibition on the transcriptional profile of MT-HGF keratinocytes. Heatmap visualization
of relative expression of 372 genes selected for the model RAS/MET signature in untreated keratinocytes (MT-HGF) and
treated with the EGFR inhibitor AG1478 (MT-HGF-AG); genes (columns) and samples (rows) are ordered by hierarchical
clustering using Euclidean distance and complete linkage; expression levels are mean centered by columns (genes); 329
genes are significantly affected by AG1478 and their names on the right side of the heatmap are proceeded by an asterisk;
in addition grey bars on the left side of the heatmap indicate genes that do not reach significance; see table S1 for
estimates of statistical significance of gene expression changes upon administration of AG1478.
Fig. S8: Activated MET gene signature is not dependent on individual Ras allele expression. Primary keratinocytes
from wild-type or MT-HGF mice were cultured in 0.05 mM Ca2+ medium to confluence and transduced with siRNA
against Hras, Kras or Nras. Cultures were harvested 48 and 72 hours after transduction and analyzed for (A) HRAS,
KRAS and HSP90 expression by immunoblot or (B) for NRAS (Nras), IL-1a (Il1a), keratin1 (Krt1) and CXCL1 (Cxcl1)
mRNA expression by real-time PCR analysis at the same time points. Data are means ± SEM of three biological
replicates. P-values were calculated using two-sided student’s t-test: *P < 0.05 vs MT-HGF control, **P < 0.01 vs. MT-
HGF control.
HSP90
48h 72h
HRAS
siRNA
targetC
ontr
ol
HSP90
KRAS
BA
0.0
0.2
0.4
0.6
0.8
1.0
WT
MT-HGF
48h 72h
Nras
0
5
10
15
20 Il1a
0.01
0.1
1
10
Krt1
Cxcl1
0
10
20
30
40
50
Cont. Cont. Hras Kras Nras Cont. Cont. Hras Kras Nras siRNA
target
Norm
aliz
ed e
xpre
ssio
nCont. Cont. Hras Kras Nras Cont. Cont. Hras Kras Nras siRNA
target
Cont. Cont. Hras Kras Nras Cont. Cont. Hras Kras Nras siRNA
target
Cont. Cont. Hras Kras Nras Cont. Cont. Hras Kras Nras siRNA
target
Hra
s
Kra
s
Nra
s
Contr
ol
Hra
s
Kra
s
Nra
s
****
* *
***
Fig. S9: TGF and AREG neutralizing antibody activities reduce the activation of EGFR in MT-HGF
keratinocytes. (A) Wild-type primary keratinocytes were cultured in 0.05 mM Ca2+ medium to confluence and treated for
30 min with recombinant TGFα (10ng/ml) or AREG (100ng/ml) in the presence of control IgG or TGF or AREG
antibodies to confirm neutralizing activity. (B) Primary keratinocytes from MT-HGF mice were cultured in 0.05 mM Ca2+
medium to confluence and treated for 24 hours in the presence of neutralizing antibodies against TGFα and Amphiregulin.
Total cell extract from primary keratinocytes were analyzed by immunoblotting for phosphorylated (p-) and total EGFR
and HSP90. Values below the p-EGFR blot are representative p-EGFR:total EGFR ratios after normalization with HSP90
expression for input relative to control set as 1; n=3 experiments.
Fig. S10: Both iRhom1 and iRhom2 contribute to the release of AREG upon MET activation. (A to D) Primary
keratinocytes were cultured in 0.05 mM Ca2+ medium to confluence and treated for 6 hours with HGF in the presence of
siRNAs targeting the mRNA encoding iRhom1 (Rhbdf1; A and B) or iRhom2 (Rhbdf2; C and D). Cells were harvested
and mRNAs were quantified by real-time PCR (A and C) and AREG concentrations in the culture supernatants were
determined by ELISA (B and D). Data are means ± SEM of four biological replicates. **P < 0.01, ***P < 0.001, ****P <
0.0001 vs control siRNA treated with HGF, by a two-sided student’s t-test.
Fig. S11: Gefitinib treatment reduces proliferation and microvessel density in MT-HGF squamous papillomas. Six
million MT-HGF keratinocytes were mixed respectively with 6 million MT-HGF primary dermal fibroblasts prior to
grafting to a skin graft site in the interscapular region of syngeneic hosts. Once squamous papillomas were clearly
established mice were orally treated by gavage daily with vehicle control or Gefitinib at 100mg/kg for two weeks. (A)
Ki67-labeled nuclei in tumors were counted in five to seven randomly selected regions. Columns, mean; bars, SEM. **, P
< 0.01 compared with Control. (B) Quantification of the number of stromal CD31-positive vessels used the Aperio
software ImageScope according to treatment group. Microvessel density was calculated by dividing the number of vessels
counted by the surface area analyzed (squamous portion of papilloma was not included in surface area determination).
Columns, mean; bars, SEM. P-values were calculated using two-sided student’s t-test. * P < 0.05 compared with Control.
Control, n=5; gefitinib, n=6 squamous papillomas analyzed.
Fig. S12: MET activation causes EGFR ligand, cytokine, and chemokine mRNA up-regulation in human
keratinocytes. Human primary keratinocytes were grown to sub-confluence in Epilife media with S7 supplement
(Invitrogen) and starved overnight prior to treatment with recombinant HGF (40 ng/ml) or PBS for 3 hours. AREG
(amphiregulin), TGFA, IL1A and CXCL8 mRNA expression were analyzed by real-time PCR. Data are means ± SEM of
three biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 vs control by a two-sided student’s t-test.
Fig. S13: Quantification for immunoblots represented in Figs. 2 and 3. (A) Quantification of p-EGFR, p-ERK and p-
MET. Data are means ± SEM of five biological replicates. *P < 0.05 vs wild-type control. (B) Quantification of cyclin
D1. Data are means ± SEM of four biological replicates. *P < 0.05, **P < 0.01, ***P < 0.001 vs respective wild-type
control. (C) Quantification of K8, K1 and K10. Data are means ± SEM of four biological replicates*P < 0.05, **P < 0.01,
****P < 0.0001 vs wild-type control. P-values were calculated using two-sided student’s t-test.
Fig. S14: Quantification for immunoblots represented in Figs. 4 and 5. (A) Quantification of phosphorylated (p-)
EGFR represented in Fig.4B. Data are means ± SEM of three biological replicates. *P < 0.05 vs untreated control by a
two-sided student’s t-test. (B) Quantification of ADAM17 and p-EGFR represented in Fig.4C, Data are means ± SEM of
three biological replicates. ***P < 0.001 vs control siRNA. (C) Quantification of ADAM17 represented in Fig.4D insert.
Data are means ± SEM of three biological replicates. *P < 0.05 vs control treated with HGF. (D) Quantification of p-
EGFR and ADAM17 represented in Fig.4E. Data are means ± SEM of three biological replicates. *P < 0.05 vs control
adenovirus. (E) Quantification of p-EGFR and ADAM17 represented in Fig.4F. Data are means ± SEM of four biological
replicates. *P < 0.05, **P < 0.01 vs RAS treated with control siRNA. (F) Quantification of p-SRC represented in Fig.5A.
Data are means ± SEM of four biological replicates. *P < 0.05, **P < 0.01 vs control. (G) Quantification of SRC
represented in Fig.5B insert. Data are means ± SEM of three biological replicates *P < 0.05, **P < 0.01. P-values were
calculated using two-sided student’s t-tests.
Fig. S15: Quantification for immunoblots represented in Figs. 6 and 8. (A) Quantification of phosphorylated (p-)
EGFR and ERK represented in Fig.6B. Data are means ± SEM, n=7 for squamous papilloma and n=4 for skin. *P < 0.05
pap vs skin. (B) Quantification of MET represented in Fig.8D. Data are means ± SEM of three to four biological
replicates. *P < 0.05 vs DMSO. P-values were calculated using two-sided student’s t-test.
Table S1: The list of 5812 significant genes concordantly up-regulated or down-regulated in the wild-type RAS and
MT-HGF keratinocytes. Statistical significance was determined with the one-way ANOVA specific contrasts (treatment
versus control) and the false discovery rate threshold of 1%. The gene list is divided into two parts, that is ‘Model’
signature (at least 2-fold change in both MT-HGF and WT-RAS) and ‘Concordant’ signature (the rest of the differentially
expressed genes). The signatures are ordered by the magnitude of differences in WT-RAS keratinocytes. The magnitude
of tested differences is color coded with shades of red and blue, which indicate the level of up-regulation and down-
regulation of gene expression, respectively. Gene expression estimates are given for WT-Control-, WT-RAS-, MT-HGF-,
and in addition for MT-HGF-AG1478- keratinocytes. Gene annotations are imported from the NCI mAdb database
(https://madb.nci.nih.gov/).
Table S2: Gene Ontology (GO) functions enriched in the RAS/MET 372-gene signature.
The table includes the DAVID GO_FAT terms (Biological Process, Molecular Function, and Cellular Component)
identified with the Gene Set Enrichment Analysis (GSEA) at the 5% false discovery rate. Positive (red) and negative
(blue) enrichment scores indicate up- and down-regulation of the enriched gene sets, respectively. The GSEA core genes
(‘leading edge’) are listed for each GO function and members of the top RAS/MET signature are annotated with an
asterisk (*). In addition, the representative terms are shown for GO functions classified as semantically redundant with the
REVIGO’s elimination algorithm.
Table S3: Upstream regulators predicted by IPA to be responsible for expression changes in the RAS/MET 372-
gene signature. The list of transcriptional regulators was determined with two metrics, namely the overlap P-value
(Fisher’s exact test) less than 0.01 and the bias corrected activation z-score ± 1.96. The bias correction of a z-score
accounts for unbalanced number of up- and down-regulated target genes. Positive (red) and negative (blue) z-scores
indicate the likely activated and inhibited state of an upstream regulator, respectively.
Gene Primer Sequence
Kras (Codon 12+13) External-Forward* ACACACAAAGGTGAGTGTTAAA
External-Reverse GCAGCGTTACCTCTATCGTA
Internal-Forward TTATTGTAAGGCCTGCTGAA
Internal-Reverse TCATACTCATCCACAAAGTG
Kras (Codon 61) External-Forward TTCTCAGGACTCCTACAGGA
External-Reverse ACCCACCTATAATGGTGAAT
Internal-Forward TACAGGAAACAAGTAGTAATTGATGGAGA
Internal-Reverse ATAATGGTGAATATCTTCAAATGATTTAGT
Hras1 (Codon 12+13) External-Forward* GGTGATCAACTGGGCCACTG
External-Reverse CCTCTGGCAGGTAGGCAGAG
Internal-Forward CTAAGTGTGCTTCTCATTGGCAGGT
Internal-Reverse CTCTATAGTGGGATCATACTCGTCC
Hras1 (Codon 61) External-Forward CCACTAAGCCGTGTTGTTTTGCA
External-Reverse CTGTACTGATGGATGTCCTCGAAGGA
Internal-Forward GGACTCCTACCGGAAACAGG
Internal-Reverse GGTGTTGTTGATGGCAAATACA
Nras (Codon 12+13) Forward GACTGAGTACAAACTGGTGG
Reverse GGGCCTCACCTCTATGGTG
Nras (Codon 61) Forward GGTGAGACCTGCCTGCTGGA
Reverse ATACACAGAGGAACCCTTCG
Table S4: PCR primers. Primers specific for mouse Kras, Hras1, and Nras were purchased from Invitrogen and are
listed in the table. Primers marked with * were designed for this experiment, all non-marked primers were previously
reported (54).