Embed Size (px)
Citation preview
Wong et al Supplementary Material
Supplementary Figures and Legends
Supplementary Figure 1. Related to Figure 2
Supplementary Figure 2. Related to Figure 2
Supplementary Figure 3. Related to Figure 3
Supplementary Figure 4. Related to Figure 4
Supplementary Figure 5. Related to Figure 5
Supplementary Figure 6. Related to Figure 5
Supplementary Figure 7. Related to Figure 5
Supplementary Figure 8. Related to Figure 6!
Supplementary Table 1. Related to Figure 1
Supplementary Table 2. Related to Figure 1
Supplementary Table 3. Related to Figure 2
Supplementary Table 4. Related to Figure 5
Supplementary Table 5. Related to Figure 5
Supplementary Materials and Methods
Supplementary Figure 1. CD34 expression in Class A and Class B
carcinomas Immunofluorescence using an antibody against CD34 (bar =
100µm). Red indicates CD34; blue indicates nucleus (DAPI). Class A carcinomas
are depicted on the top row; Class B carcinomas are depicted on the bottom row.
Supplementary Figure 2. Class B carcinomas have a very similar molecular
profile to “claudin-low” breast cancers Unsupervised hierarchical clustering of
skin carcinoma gene expression levels using a published gene signature for
“claudin low” breast cancers (Prat et al., 2010). Red indicates higher expression;
green indicates lower expression.
Supplementary Figure 3. Validation of ErbB2 and Lrig1 array expression
results by immunostaining on mouse skin carcinoma sections (A, B) IHC
using an antibody against ErbB2 (bar = 100µm). (C, D) Immunofluorescence
using an antibody against Lrig1 (bar = 100µm). Red indicates Lrig1; blue
indicates nucleus (DAPI). Class A carcinomas are depicted on the left; Class B
carcinomas are depicted on the right.
Supplementary Figure 4. Gene expression of p15 and p19/Arf in skin
carcinomas (A) qRT-PCR for p15 in Class A and Class B carcinomas. (B) qRT-
PCR for p19/Arf in Class A and Class B carcinomas. Error bars represent
standard deviation from three replicate measurements.
Supplementary Figure 5. Expression of inflammatory markers in skin
carcinomas Heatmap of expression levels of inflammatory markers in Class A
and Class B carcinomas using data from our previously published study (Quigley
et al., 2011). Red indicates higher expression; blue indicates lower expression.
Supplementary Figure 6. Gene copy number of p16/p19 and p15 in skin
carcinomas from Hras WT and Hras -/- mice (A) Gene copy number analysis
of p16/p19 (top row) and p15 (bottom row) on SCCs and spindle cell carcinomas
from FVB Hras WT mice treated with TPA for 5 weeks, 10 weeks and 20 weeks.
(B) Gene copy number analysis of p16 (top row) and p15 (bottom row) on SCCs
and spindle cell carcinomas from FVB Hras -/- mice treated with TPA for 10
weeks and 20 weeks. Amplifications of the gene are marked with blue, deletions
with red, and two copies with white boxes.
Supplementary Figure 7. Histological and immunophenotypic features of
skin carcinomas from Hras null mice (A) Hras null mice developed both Class
A (squamous) and Class B (spindle) skin carcinomas. (B) IHC using antibodies
against E-cadherin and Vimentin. Class A carcinomas are depicted on the top
row; Class B carcinomas on the bottom row (bar = 200µm).
Supplementary Figure 8. Comparison of the p16 gene expression levels in
normal skin, papillomas, Class A and Class B carcinomas Box plots for p16
gene expression levels as determined by microarray. The Y-axis shows log2
expression. The horizontal line indicates estimated level of background
expression.
Supplementary Table 1. Snai1 is positively correlated with many genes
known to be involved in invasion and the EMT Table was generated by
calculating Spearman Rank Correlation between Log2 gene expression of Snai1
(Snail) and all other genes using the 60 carcinomas, reporting those where r ! +/-
0.8. Positive values of Fold change indicate higher expression in Class A than
Class B carcinomas. To calculate fold change, where DIFF = mean(values in
Class A)-mean(values in Class B), fold-change = 2^DIFF if DIFF>0 and -1*(2^(-
1*DIFF)) where DIFF<0.
Snail genome-wide correlation at r !! 0.8
symbol probe Rho P value fold-change Efemp2 1417018_at 0.91 1.11E-23 -2.44 Zeb1 1418926_at 0.91 1.13E-23 -4.36 Mxra8 1452330_a_at 0.9 4.08E-23 -4.28 Vim 1438118_x_at 0.89 1.30E-21 -2.51 Pcolce 1448433_a_at 0.88 5.69E-20 -2.8 Ankrd25 1460559_at 0.87 1.10E-19 -3.84 Pcolce 1437165_a_at 0.87 2.18E-19 -3.08 Akap2 1449168_a_at 0.87 2.75E-19 -2.67 2610027C15Rik 1454933_at 0.87 4.86E-19 -2.84 Vim 1450641_at 0.86 8.69E-19 -3.7 Stxbp1 1420505_a_at 0.86 9.36E-19 -4.96 Plekhc1 1434180_at 0.86 1.19E-18 -2.69 Igfbp4 1423756_s_at 0.86 2.83E-18 -4.69 Tspan11 1430310_at 0.86 3.50E-18 -5.53 Hook2 1419350_at -0.85 5.98E-18 3.1 Tspan4 1448276_at 0.85 6.19E-18 -3.09 Vim 1456292_a_at 0.85 6.36E-18 -3.07 Mgrn1 1454645_at 0.85 7.07E-18 -1.74 Zcchc24 1428431_at 0.85 1.08E-17 -3.19 Rab6ip1 1424015_at 0.85 1.58E-17 -2.45 Vcan 1421694_a_at 0.84 2.53E-17 -3.56 Pgcp 1416441_at 0.84 3.23E-17 -5.56 Tgfb1i1 1418136_at 0.84 4.50E-17 -3.21 Lgals1 1455439_a_at 0.84 5.11E-17 -2.15 Cul7 1417039_a_at 0.84 5.27E-17 -2.47 4732435N03Rik 1452366_at 0.84 5.54E-17 -2.36 Lix1l 1433812_at 0.84 6.25E-17 -3.75
BC046404 1436195_at 0.84 6.54E-17 -2.66 Cdgap 1455164_at 0.84 6.93E-17 -2.74 Timp2 1450040_at 0.84 7.01E-17 -4.12 Sec24d 1426972_at 0.84 8.40E-17 -1.91 Mrc2 1421045_at 0.84 8.98E-17 -2.48 Slc39a14 1427035_at 0.84 1.09E-16 -2.54 Nfatc1 1428479_at 0.84 1.11E-16 -2.77 Txndc5 1451091_at 0.83 1.14E-16 -1.68 6330406I15Rik 1452244_at 0.83 1.19E-16 -4.5 Timp2 1454677_at 0.83 1.30E-16 -4.16 Ankrd25 1425991_a_at 0.83 2.04E-16 -2.34 Cdc42bpg 1436197_at -0.83 2.30E-16 3.46 Fgf7 1438405_at 0.83 2.33E-16 -8.46 Vcan 1427256_at 0.83 3.18E-16 -3.65 Pdgfra 1421917_at 0.83 3.57E-16 -4.85 Tgfbr3 1433795_at 0.83 3.75E-16 -3.83 Lhfpl2 1434129_s_at 0.83 4.62E-16 -2.44 Itga5 1423267_s_at 0.83 5.01E-16 -2.08 Sdc2 1417011_at 0.83 5.07E-16 -6.46 Krtcap3 1432474_a_at -0.82 7.15E-16 4.68 Prrx2 1432331_a_at 0.82 7.44E-16 -5.22 Kirrel 1434797_at 0.82 8.68E-16 -2.27 Prrx1 1425526_a_at 0.82 9.56E-16 -4.71 Edg2 1417143_at 0.82 1.12E-15 -3.77 Lhfpl2 1454847_at 0.82 1.32E-15 -1.59 Flnc 1449073_at 0.82 1.47E-15 -2.7 Nfatc1 1425761_a_at 0.82 1.52E-15 -3.24 6330406I15Rik 1426937_at 0.82 1.57E-15 -4.31 Lgals1 1419573_a_at 0.82 1.79E-15 -2.42 Igfbp4 1423757_x_at 0.82 1.80E-15 -4.02 Loxl3 1418269_at 0.82 2.04E-15 -5.2 Tspan11 1436626_at 0.82 2.05E-15 -4.76 Elmo3 1434489_at -0.82 2.15E-15 4.11 Tmem102 1453318_at -0.82 2.16E-15 2.17 Sdc2 1448545_at 0.81 2.29E-15 -5.39 1200009F10Rik 1429219_at 0.81 2.39E-15 -1.92 Lhfp 1433776_at 0.81 2.44E-15 -2.31 Vcan 1427257_at 0.81 2.69E-15 -3.26 Timp2 1433662_s_at 0.81 2.87E-15 -4.02 Ppic 1416498_at 0.81 2.97E-15 -1.77 Wipf1 1436953_at 0.81 3.34E-15 -2.42 Cmtm3 1448316_at 0.81 3.43E-15 -2.14 Morf4l1 1456142_x_at 0.81 3.49E-15 -1.41 Igfbp4 1437405_a_at 0.81 3.57E-15 -3.32 Glipr1 1424927_at 0.81 3.70E-15 -4.05 Sema7a 1459903_at 0.81 4.97E-15 -3.97 Prkacb 1420611_at 0.81 5.89E-15 -2.04 Fxyd5 1418296_at 0.81 6.50E-15 -2.1 Tcf4 1424089_a_at 0.81 6.70E-15 -2.7
Limk2 1452060_a_at -0.81 6.74E-15 3.07 Dbn1 1426024_a_at 0.81 7.17E-15 -2.99 Rbm35a 1454681_at -0.81 8.33E-15 17.03 Scara3 1427020_at 0.81 8.55E-15 -11.84 Ddr2 1455688_at 0.81 8.71E-15 -5.9 Zcchc24 1428432_at 0.8 1.03E-14 -3.64 Glt28d2 1455455_at -0.8 1.13E-14 3.44 Fgf7 1422243_at 0.8 1.19E-14 -6.12 Sipa1 1416206_at 0.8 1.27E-14 -1.78 Pkd2 1441870_s_at 0.8 1.30E-14 -1.87 Igfbp4 1421991_a_at 0.8 1.40E-14 -5.44 Hsd17b11 1434642_at 0.8 1.40E-14 -2.5 Pcdh19 1437360_at 0.8 1.47E-14 -9.81 Chmp1b 1418817_at -0.8 1.48E-14 1.6 Limk2 1418581_a_at -0.8 1.60E-14 3.62 Angptl2 1455090_at 0.8 1.61E-14 -2.22 Ace 1451911_a_at 0.8 1.62E-14 -3.07 Trim35 1454650_at 0.8 1.65E-14 -2.3
Supplementary Table 2. Snai2 is positively correlated in expression with
epithelial markers Table was generated using the procedure described for
Supplementary Table 1, using Snai2 (Slug).
Slug genome-wide correlation at r !! 0.8
Symbol probe rho P value fold-change Jag1 1434070_at 0.86 3.49E-18 3.61 Jag1 1421106_at 0.85 6.57E-18 4.68 Pcgf5 1429564_at -0.85 6.70E-18 -3.01 BC065085 1455872_at 0.85 8.95E-18 5.78 Krt14 1460347_at 0.84 1.04E-16 20.11 Ntf5 1440353_at 0.83 1.24E-16 7.22 Tmc7 1456981_at 0.83 2.73E-16 7.93 Krt14 1423935_x_at 0.82 7.20E-16 13.52 Macf1 1428847_a_at 0.81 2.68E-15 1.44 Trp63 1418158_at 0.81 7.53E-15 22.45 Itgb4 1427387_a_at 0.8 9.43E-15 5.2 9130213B05Rik 1424214_at 0.8 1.17E-14 3.88 Lamb3 1417812_a_at 0.8 1.39E-14 16.44
Supplementary Table 3. Statistical analysis of differential expression
between Class A and Class B tumors for probes associated with skin stem
cells Positive fold-change indicates higher expression in Class A tumors.
Abbreviations: n.s. indicates not significant. Calculated using Significance
Analysis of Microarrays (SAM). The q.value.percent column indicates the False
Discovery Rate q value; a value of 1.0 indicates an expected 1% false discovery
rate. The score column indicates the SAM statistic.
symbol probe score fold-change Q value percent
Lrig1 1434210_s_at -9.568 -3.44 < 0.01 Nfatc1 1428479_at -8.539 -2.76 < 0.01 Cd47 1419554_at -6.435 -1.94 < 0.01 Cd34 1416072_at -3.85 -1.81 < 0.01 Sox2 1416967_at -1.37 -1.81 3.67 Nes 1449022_at -3.312 -1.44 0.008 Tcf3 1427764_a_at -3.364 -1.42 0.008 Itga1 1455251_at -1.133 -1.24 6.512 Itgb1 1426918_at NA -1.01 n.s. Cd44 1423760_at 1.65 1.12 6.512 Prdm1 1420425_at 2.731 1.39 0.308 Lgr6 1427028_at 2.506 1.45 0.308 Lgr5 1450988_at 3.373 1.65 0.024 Sox9 1451538_at 3.071 1.68 0.105 Ly6a 1417185_at 3.904 1.84 < 0.01 Lgr4 1433891_at 5.228 2.13 < 0.01 Krt15 1422667_at 5.071 5.88 < 0.01 Prom1 1419700_a_at 6.212 7.57 < 0.01
!!!!!!!
Supplementary Table 4. Status of Ras mutations in skin tumors Table
shows a subset of skin carcinomas analyzed for mutations in Hras and Kras.
!!Carcinoma Mouse Genotype Mutation
46C WT Hras (Codon 61) CAA>CTA 49C WT Hras (Codon 61) CAA>CTA 55C WT Hras (Codon 61) CAA>CTA 69C1 WT Hras (Codon 61) CAA>CTA 69C2 WT Hras (Codon 61) CAA>CTA 85C WT Hras (Codon 61) CAA>CTA 88C WT Hras (Codon 61) CAA>CTA 89C WT Hras (Codon 61) CAA>CTA 115C WT Hras (Codon 61) CAA>CTA 116C WT Hras (Codon 61) CAA>CTA 118C1 WT Hras (Codon 61) CAA>CTA 118C2 WT Hras (Codon 61) CAA>CTA 132C WT Hras (Codon 61) CAA>CTA 143C WT Hras (Codon 61) CAA>CTA 151C WT Hras (Codon 61) CAA>CTA 154C WT Hras (Codon 61) CAA>CTA 156C WT Hras (Codon 61) CAA>CTA 189C WT Hras (Codon 61) CAA>CTA 200C WT Hras (Codon 61) CAA>CTA 202C WT Hras (Codon 61) CAA>CTA 2039C1 WT Hras (Codon 61) CAA>CTA 2039C2 WT TBD 2013C1 WT Hras (Codon 61) CAA>CTA 2013C2 WT Hras (Codon 61) CAA>CTA 2018C1 WT Hras (Codon 61) CAA>CTA 2035C1 WT Hras (Codon 61) CAA>CTA 2035C2 WT Hras (Codon 61) CAA>CTA 2035C3 WT Hras (Codon 61) CAA>CTA 2040C1 WT Hras (Codon 61) CAA>CTA 2040C2 WT TBD 2040C3 WT TBD 2041C1 WT Hras (Codon 61) CAA>CTA 2047C1 WT Hras (Codon 61) CAA>CTA 2047C2 WT TBD 2047C3 WT Hras (Codon 61) CAA>CTA 2044C1 WT Hras (Codon 61) CAA>CTA 2044C2 WT Hras (Codon 61) CAA>CTA 2012C1 WT Hras (Codon 61) CAA>CTA 2012C2 WT Hras (Codon 61) CAA>CTA 2012C3 WT Hras (Codon 61) CAA>CTA 2016C1 WT Hras (Codon 61) CAA>CTA 2016C2 WT Hras (Codon 61) CAA>CTA
2019C1 WT Hras (Codon 61) CAA>CTA 2019C2 WT Hras (Codon 61) CAA>CTA 2019C3 WT Hras (Codon 61) CAA>CTA 62C Hras-/- Kras (Codon 13) GGC>CGC 68C Hras-/- Kras (Codon 13) GGC>CGC 87C Hras-/- Kras (Codon 61) CAA>CTT 125C Hras-/- Kras (Codon 61) CAA>CTA 128C Hras-/- Kras (Codon 61) CAA>CAT 152C Hras-/- Kras (Codon 13) GGC>CGC 155C Hras-/- Kras (Codon 61) CAA>CAT 166C Hras-/- Kras (Codon 13) GGC>CGC 168C Hras-/- Kras (Codon 13) GGC>CGC 169C Hras-/- Kras (Codon 13) GGC>CGC 170C Hras-/- Kras (Codon 13) GGC>CGC 193C Hras-/- TBD 1011C Hras-/- TBD 1014C Hras-/- TBD 1017C Hras-/- Kras (Codon 13) GGC>CGC 1035C Hras-/- Kras (Codon 13) GGC>CGC 1037C Hras-/- Kras (Codon 13) GGC>CGC 1038C Hras-/- Kras (Codon 13) GGC>CGC 1040C Hras-/- Kras (Codon 13) GGC>CGC 1041C Hras-/- Kras (Codon 13) GGC>CGC 1046C Hras-/- Kras (Codon 13) GGC>CGC TBD (to be determined)
Supplementary Table 5. Metastasis patterns of primary SCCs and spindle
cell carcinomas from FVB/N WT and Hras-/- mice Table representing the
histology and location of metastases found in FVB/N WT and Hras-/- mice
treated with TPA for 5, 10 or 20 weeks. Hras-/- mice treated with TPA for 5
weeks did not develop any carcinomas. IDs starting with 2 belong to WT mice,
IDs starting with 1 belong to Hras-/- mice. Histology of SCC tumors ranged from
poorly to well differentiated. Spindle/SCC describes a mostly spindle tumor with a
minor component of squamous cells, while SCC/spindle represents an SCC with
a minor spindle component. The number and histology of primary tumors per
individual mouse is shown in the second column from the left. The tumors
shaded in grey were surgically removed when they reached 1.0 to 1.5cm in
diameter.
Mouse ID Primary T
Lymph node Lung Pleural Spleen Liver Renal
Soft tissue
Adrenal cortex
chest wall
5 week TPA
2001 Spindle Spindle/SCC SCC
SCC
SCC/Spindle
2003 SCC SCC SCC Spindle
Spindle/SCC Spindle Spindle
Spindle SCC 10 week TPA
2022 Spindle Spindle
Spindle
Spindle
2023 SCC/Spindle SCC
SCC
Spindle
Spindle
2025 Spindle
SCC
Spindle
Spindle
2026 Spindle
Spindle
SCC
SCC/Spindle
2028 Spindle/SCC Spindle/SCC SCC Spindle
Spindle/SCC
2029 Spindle SCC/Spindle
Spindle Spindle
SCC SCC
2030 SCC SCC
Spindle SCC
SCC
2031 SCC SCC
2033 SCC SCC
Spindle/SCC
Spindle
1021 Spindle SCC SCC Spindle SCC SCC
Spindle Spindle/SCC Spindle
SCC/Spindle
Spindle
1022 SCC SCC SCC SCC
SCC
1023 Spindle Spindle
Spindle Spindle
Spindle
1024 SCC SCC
1029 Spindle Spindle SCC
Spindle
1031 Spindle Spindle Spindle Spindle
Spindle SCC/Spindle
SCC SCC/Spindle
Spindle
Spindle
1033 Spindle Spindle Spindle
Spindle
Spindle
Spindle 20 week TPA
2011 SCC SCC
SCC SCC
SCC SCC
SCC
2012 SCC SCC
SCC/Spindle
SCC
2013 SCC SCC SCC
SCC
2018 SCC Spindle SCC SCC
SCC
SCC
2019 SCC
Spindle
SCC
2034 SCC SCC
SCC SCC
SCC
SCC
2035 Spindle/SCC SCC
Spindle/SCC Spindle
SCC Spindle
2039 SCC SCC
SCC SCC
SCC/Spindle
SCC
SCC/Spindle
2041 Spindle Spindle
Spindle
Spindle
2044 SCC/Spindle SCC
SCC SCC
2047 SCC/Spindle SCC SCC
SCC Spindle
SCC Spindle
1014 Spindle/SCC SCC SCC SCC SCC
SCC
SCC
1017 SCC SCC
SCC
1035 Spindle Spindle Spindle Spindle
Spindle
Spindle
Spindle
Spindle
1041 SCC SCC SCC SCC
SCC
SCC
1042 Spindle Spindle SCC Spindle Spindle Spindle Spindle
Spindle Spindle Spindle
Spindle
Spindle
1046 Spindle Spindle
Spindle
Supplementary Materials and Methods Immunohistochemistry
Antigen retrieval was performed in 10mM sodium citrate solution (pH 6) and
endogenous peroxidase was quenched with a 3% H2O2 solution (Sigma) for 10
min at room temperature. Blocking was performed with 5% goat serum (Zymed)
diluted in PBS containing 0.1% Tween-20 for 1h at room temperature before
overnight incubation with the primary antibodies at 4 °C. After washing in PBS
containing 0.1% Tween-20 (PBS-T) for 3x 5min, sections were incubated with a
biotinylated secondary antibody anti rabbit (Vector) or anti mouse (Vector) at a
dilution of 1:400 for 1h at room temperature. Sections were washed with PBS-T,
incubated in ABC reagent (Vectastain Elite Kit, Vector) according to the
manufacturer’s instructions, and developed using DAB (Sigma). The following
primary antibodies were used for the immunostainings shown in the
supplementary figures: anti ErbB2 (rabbit, Cell Signaling Technology), anti Lrig1
(goat, R&D), anti CD34 (rat, eBiosciences). The following secondary antibodies
were used: biotinylated anti rabbit (Vector) and Alexa 555 donkey anti goat
(Invitrogen).
Gene expression and gene copy number assays
Gene expression p16: forward primer: CGCCCCGAACTCTTTCG; reverse
primer CGTGAACGTTGCC CATCAT; probe: CCCCGATTCAGGTGAT. p19:
forward primer: GCTCTGGCTT TCGTGAACATG reverse primer:
TGCGGCCCTCTTCTCAAG; probe: TGTTGAG GCTAGAGAGGA. p15: assay
on demand: Mm00483241_m1. !-actin: assay on demand: 4352933E. Gene
copy number p15: forward primer: CAGAGACCAGG CTGTAGCAATCT;
reverse primer: CGGTCTGTGGCAGAAATGG; probe: ACGG CCGGCGAAG.
p16: forward primer: CGCCGCTGAGGGAGTACA; reverse primer:
AATCCTCACAGTGACCAAGAACCT; probe: CAGCGGGAGCATGG RORI:
forward primer: GGTCCAAGAACCTCGGAGAATC; reverse primer: CGC
AGCCGAGAGCCATAG; probe: CCTTCCGGGCAACCA.
Hras and Kras mutation analysis
Hras forward primer: AAGCCTGTTGTTTTGCAGGA; reverse primer:
GGTGGCTCACCTGTACTGATG. Kras codon 12/13 forward primer:
GAAGATGAAAGTACTGGTTTCCA; codon 12/13 reverse primer:
GCACCTATGGTTCCCTAACAC; codon 61 forward primer:
CCAGACTGTGTTTCTCCCTTC; codon 61 reverse primer:
GGTCATTGGAGTAACACCATCTC.
