2013

Ophthalmic Genetics, 2013; 34(3): 140–145

! Informa Healthcare USA, Inc.

ISSN: 1381-6810 print / 1744-5094 online

DOI: 10.3109/13816810.2012.746377

RESEARCH REPORT

Superoxide Dismutase Gene Polymorphisms inPatients with Age-related Cataract

Dragana Celojevic1, Staffan Nilsson2, Anders Behndig3, Gunnar Tasa4, Erkki Juronen4,Jan-Olof Karlsson5, Henrik Zetterberg6,7, Anne Petersen1 and Madeleine Zetterberg1

1Department of Clinical Neuroscience and Rehabilitation/Ophthalmology, Institute of Neuroscience andPhysiology, The Sahlgrenska Academy at University of Gothenburg, Gothenburg, Sweden, 2Department of

Mathematical Statistics, Institute of Mathematical Sciences, Chalmers University of Technology, Gothenburg,Sweden, 3Department of Clinical Sciences/Ophthalmology, Umea University, Umea, Sweden, 4Department of

Human Biology and Genetics, Institute of General and Molecular Pathology, University of Tartu, Tartu, Estonia,5Department of Medical Chemistry and Cell Biology, Institute of Biomedicine, The Sahlgrenska Academy at

University of Gothenburg, Gothenburg, Sweden, 6Department of Psychiatry and Neurochemistry, Institute ofNeuroscience and Physiology, The Sahlgrenska Academy at University of Gothenburg, Molndal, Sweden, and

7UCL Institute of Neurology, Queen Square, London, UK

ABSTRACT

Background: Functional polymorphisms in genes encoding antioxidant enzymes may result in reduced enzymeactivity and increased levels of reactive oxygen species, such as superoxide radicals, which in turn maycontribute to increased risk of age-related disorders. Copper–zinc superoxide dismutases, SOD-1 and SOD-3,and manganese superoxide dismutase, SOD-2, are enzymes involved in the protection against oxidative stressand detoxification of superoxide. In this study, we investigated a number of disease-associated singlenucleotide polymorphisms (SNPs) of SOD1, SOD2 and SOD3, in patients with age-related cataract.

Materials and methods: The study included an Estonian sample of 492 patients with age-related cataract,subgrouped into nuclear, cortical, posterior subcapsular and mixed cataract, and 185 controls. Twelve SNPs inSOD1, SOD2 and SOD3 were genotyped using TaqMan Allelic Discrimination. Haplotype analysis wasperformed on the SNPs in SOD2.

Results: None of the studied SNPs showed an association with risk of cataract. These results were consistentafter adding known risk factors (age, sex and smoking) as covariates in the multivariate analyses and afterstratification by cataract subtype. Analysis of SOD2 haplotypes did not show any associations with risk ofcataract.

Conclusions: If genetic variation in genes encoding SOD-1, SOD-2 and SOD-3 contributes to cataract formation,there is no major contribution of the SNPs analyzed in the present study.

Keywords: Cataract; oxidative stress; single nucleotide polymorphisms; SOD genes

INTRODUCTION

Normal cell metabolism generates reactive oxygenspecies (ROS). Protective antioxidative systems areessential to detoxify ROS and to maintain normalphysiological conditions in the cell. Imbalance due toendogenous or exogenous toxicity or reduced antiox-idants may lead to accumulation of ROS, causing

oxidative stress, which is known to play a major role inseveral pathological processes.1 Oxidative stress is acrucial part of cataract pathogenesis, which has beenshown in experimental as well as in epidemiologicalstudies. Exposure to UV light and smoking, bothcausing oxidative stress, are associated with increasedrisk of cataract.2 Further, elevated levels of hydrogenperoxide in aqueous humor have been detected in

Correspondence: Madeleine Zetterberg, Department of Clinical Neuroscience and Rehabilitation/Ophthalmology, The Sahlgrenska Academyat University of Gothenburg, PO Box 440, SE-405 30 Gothenburg, Sweden. Tel: þ46 31 786 33 94. E-mail: madeleine.zetterberg@gu.se

Received 28 June 2012; revised 11 September 2012; accepted 26 October 2012; published online 3 January 2013

140

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.

cataract patients as compared to individuals with clearlenses.3 Consequently, it has been studied whether ornot intake of antioxidants can protect against cataractformation by maintaining the antioxidative balance.However, results are inconsistent.4,5

Many genetic variations in genes encoding antiox-idant enzymes have been suggested to affect enzymeactivity, leading to increased levels of ROS, such assuperoxide radicals, and hence altered risk of disease.Copper–zinc superoxide dismutases, SOD-1 andSOD-3, and manganese superoxide dismutase, SOD-2, are enzymes involved in the protection againstoxidative stress and detoxification of superoxide indifferent compartments of the cell. Polymorphisms oftheir encoding genes have been associated withvarious age-related diseases, including cancer andneurodegenerative conditions such as Alzheimer’sdisease and Parkinson’s disease.6

Cataract is a multifactorial disease, and bothenvironmental factors and heritability are of impor-tance for its pathogenesis. In contrast to congenitalcataract, which is to a large extent inherited in aclassical Mendelian manner, age-related cataract is acomplex disease and the genetic determinants are notfully understood. The aim of the present study was toinvestigate a number of single nucleotide polymor-phisms (SNPs) in the genes encoding SOD-1, SOD-2and SOD-3, in patients with age-related cataract.

MATERIALS AND METHODS

Patients

The studied subjects consisted of 492 patients withage-related cataract and 185 controls (Table 1), allrecruited from two ophthalmic clinics in Tartu and theSouth Estonian area, after informed consent. TheEthical Commission at the University of Tartu inEstonia approved the study and the tenets of theDeclaration of Helsinki were followed. Prior tosurgery, the type of cataract was determined using

biomicroscopy and ophthalmoscopy and classifiedinto the following subtypes; cortical cataract (n¼ 151),posterior subcapsular cataract (n¼ 119), nuclear cata-ract (n¼ 75) and mixed cataract (n¼ 147). Patientswith secondary cataracts were excluded and controlsubjects without cataract, uveitis, and glaucoma wereincluded. The patients’ age was reported at the time ofsurgery and data on smoking habits was obtained forall individuals.

SNPs and Genotyping

In this study, we chose either functional, disease-associated or tag SNPs of the SOD genes. SNP datacovering SOD2 (gene ID: 6648) for the Europeanpopulation CEU (Utah residents with ancestry fromnorthern and western Europe) was downloaded fromthe HapMap Genome Browser (release #24) at theInternational Haplotype Mapping Project web site(www.hapmap.org).7 The data was then processed inthe Haploview 4.1 software,8 where linkage disequi-librium (LD) blocks were constructed according toGabriel et al. and tag SNPs were assigned using theTagger function.9 A minor allele frequency of �5%and pair wise tagging with a minimum r2 of 0.80 wereapplied to capture the common variations within theblock in SOD2 and seven tag SNPs were then selected:rs6917589, rs2842980, rs7855, rs5746151, rs5746136,rs4880 and rs2758352 (Table 2). In SOD1 (gene ID:6647) and SOD3 (gene ID: 6649) no tag SNPs werechosen, since there was no clear LD block structure.In these genes functional or disease-associated SNPswere chosen; rs17881180, rs17880135, rs2234694(SOD1) and rs1799895, rs2536512 (SOD3), seeTable 2. All the SNPs were genotyped using genomicDNA extracted from whole blood samples. TaqMan�

SNP genotyping assays or Custom TaqMan� SNPgenotyping assays (Applied Biosystems, Foster City,CA, USA) were used according to the TaqMan�

Allelic Discrimination Technology,10 on the ABIPRISM 7900HT Sequence Detection System (Applied

TABLE 1. Demographics of patients with cataract and controls.

Cataract

Parameter All cases Cortical Mixed PSC Nuclear Controls p-values*

No. of subjects 492 151 147 119 75 185Age (years) 72� 8.7 72� 8.4 72� 8.7 71� 8.2 74� 9.5 66� 6.9 50.001Sex

Female 343 (69.7) 114 (75.5) 99 (67.3) 83 (69.7) 47 (62.7) 134 (72.4) 0.49Male 149 (30.3) 37 (24.5) 48 (32.7) 36 (30.3) 28 (37.3) 51 (27.6)

SmokingCurrent smoker 71 (14.4) 17 (11.3) 22 (15.0) 14 (11.8) 18 (24.0) 18 (9.7) 0.11Ever smoker 123 (25.0) 31 (20.5) 42 (28.6) 26 (21.8) 24 (32.0) 42 (22.7) 0.54

Data presented as absolute numbers (%) or mean� SD.PSC, posterior subcapsular cataract. Ever smokers include former and current smokers.*p-values were calculated with �2-test for categorical parameters and Student’s t-test for age (all cases versus controls).

SOD Polymorphisms in Cataract 141

! 2013 Informa Healthcare USA, Inc.

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.

Biosystems, Foster City, CA, USA) using the SDS 2.3software supplied with the instrument. Custom madeSNPs (rs2234694 and rs7855) were designed using theCustom TaqMan� Assay Design Tool (AppliedBiosystems, Foster City, CA, USA).

Statistical Analyses

Differences between cataract patients and controlsubjects regarding age, sex, smoking habits andallele frequencies were studied using Student’s t-testand Pearson’s chi-square test (and Fisher’s exact testwhen needed). One-way ANOVA was used whencomparing age between the different subtypes ofcataract. Single marker associations were performedusing binary logistic regression including relevant riskfactors for age-related cataract; age, sex and smokingas covariates in an additive model (homozygote formajor allele¼ 0, heterozygote¼ 1 and homozygote forminor allele¼ 2).11–14 IBM� SPSS� Statistics 20.0 (IBMCorp., Armonk, NY, USA) was used for statisticalanalyses and a p-value of �0.05 was consideredstatistically significant. Power analysis was performedfor several of the present SNPs, based on previouslypublished association studies – if existing – on theseSNPs, as described in Altman.15 All SNPs wereanalyzed for deviation from Hardy-Weinberg equilib-rium and haplotype analysis of SNPs in SOD2 wasperformed with the �2-test using Haploview 4.2.16,17

RESULTS

There was no difference in gender distributionbetween the cataract and control group. However,

mean age was significantly lower in the control group(Table 1). While there was no significant difference insmoking habits in the overall cataract group com-pared to controls (Table 1), the nuclear cataractsubtype had a higher frequency of current smokers;24% of patients with nuclear cataract were currentsmokers as opposed to 9.7% of controls (p¼ 0.003).All the SNPs in the three SOD genes (Table 2) had aHardy-Weinberg equilibrium p-value of40.01 and thegenotyping call rate was499% for all the SNPs. Allelefrequencies for the examined SNPs corresponded wellto previously reported frequencies in European pop-ulations according to the NCBI SNP database, exceptfor rs4880 and rs2536512 (Table 3). In univariateanalyses none of the studied SNPs showed significantassociations with risk of cataract. These results wereconsistent also when having the known risk factors(age, sex and smoking) as covariates in the analyses(Table 3) and after stratification by cataract subtype(data not shown). Analysis of SOD2 haplotypes didnot show any associations with risk of cataract (datanot shown). Correction for multiple testing was notdone since no statistically significant results werefound.

DISCUSSION

Superoxide dismutase enzymes are ubiquitouslyexpressed throughout the body, although the differentisoenzymes SOD-1, SOD-2 and SOD-3 are located indistinct compartments of the cells; the cytosol, themitochondria and the extracellular space respec-tively.18–20 Given the composition of the eye lens,which is largely built up of tightly stacked lens fiberscontaining cytoplasm devoid of organelles, it is not

TABLE 2. Overview of the SNPs studied in SOD1, SOD2 and SOD3.

Gene rs-ID Genome position major4minor* Gene location SNP type TaqMan assay

SOD1 Chr: 21rs17881180 31954158 C4T Intron 1 – C__61101320_10rs2234694 31960736 A4C Intron 3 – Customa

rs17880135 31963874 T4G 30-region – C__61101393_10SOD2 Chr: 6

rs6917589 160019250 T4C 30-region – C__1362065_10rs2842980 160020106 T4A 30-region – C__11414443_10rs7855 160020292 A4G 30 UTR – Customb

rs5746151 160021310 C4T 30 UTR – C__34211821_10rs5746136 160023074 C4T 30 UTR – C__29322854_10rs4880 160033862 G4A Exon 2 missense C__8709053_10rs2758352 160042911 G4A 50-region – C__16288779_10

SOD3 Chr: 4rs2536512 24410413 A4G Exon 3 missense C__2668728_10rs1799895 24410932 C4G Exon 3 missense C__2307506_10

*Major and minor alleles in our studied population.aPrimers and probe were designed according to sense strand of the gene; forward primer: GTAACAAGATGCTTAACTCTTGT, reverseprimer: ACGGAATTATCTTAGCACATATTTACAAGTAGTATAC, probe: ATGGCG[A/C]TAGCTTT.bPrimers and probe were designed according to antisense strand of the gene; forward primer: CTGTTTCTCACTTTCAGTCATACCCTAA, reverse primer: GTACCAGGCTTGATGCACATCTTA, probe: AAGACAGGAC[A/G]TTATCT.

142 D. Celojevic et al.

Ophthalmic Genetics

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.

surprising that SOD-1 is the predominant isoenzyme.The amount of SOD-2, which is likely confined to thelens epithelium, is relatively low in the human eyelens and the content of SOD-3 is negligible.21 Studieshave shown varying levels of total SOD activity inpatients with cataract depending on morphologic typeand it has also been shown that activity of SODdeclines with age.22 Although SOD activity is rela-tively low in the human lens as compared to othertissues, the role of SOD in the lens and in thepathogenesis of cataract may still be of importance.The lens is subjected to oxidative stress through life-long exposure to light, including UV-light of lowerwavelengths.23,24 Protective effects of SOD-1 andSOD-2 against oxidative stress have been demon-strated in whole rat lenses and in human lensepithelial cells when these enzymes were overex-pressed.25,26 Also, lenses from SOD1-knockout micedeveloped lens opacities earlier than wild-typemice.27

Our results did not show any associations of theselected SNPs in the SOD genes (Table 2) with risk ofcataract in the Estonian population studied. Thepresent study shows that the nuclear cataract subtypehad a higher frequency of current smokers. Smokingis a known risk factor for cataract, in particularnuclear cataract.13 To date, the only polymorphismstudied in age-related cataract in any of the SODgenes, is a polymorphism (rs2070424) in SOD1,which has been shown to be associated with alteredrisk of cortical and mixed cataract in a Chinesepopulation.28 The SOD1 gene is located on chromo-some 21q22.1 and several mutations have beendescribed in individuals with familial amyotrophiclateral sclerosis.29,30 In Down syndrome, triplication ofchromosome 21 includes the SOD1 gene, resulting inelevated levels of SOD-1 activity.31 Paradoxically, thisSOD-1 overexpression does not increase the antiox-idative capacity of the cells, but instead appears to

generate more oxidative stress. Several explanationshave been proposed for this, such as SOD-1-catalyzedhydroxyl radical formation, superoxide-mediatedinhibition of membrane peroxidation and short cir-cuiting of the SOD-1-redox cycle.32 Interestingly,congenital cataract or early-onset adult cataract arecommon ocular manifestations of Down syndrome.33

We studied three SNPs in SOD1, two of which,rs17881180 and rs17880135, are in strong linkagedisequilibrium with each other. Also rs17881180,rs17880135 and rs2234694 are associated with diabeticnephropathy.34–36

The two SNPs studied in SOD3 are both missensepolymorphisms; rs2536512 resulting in the aminoacid change Thr58Ala, and rs1799895 generatingthe change Arg213Gly. Both SNPs are found withinexon 3 in SOD3, which is located on chromosome4pter-q21.37 Subjects heterozygote for Arg231Gly(rs1799895), have reduced heparin affinity, a propertythat is important for localization of the enzyme in thebody.38

The mitochondrion is the primary source of ROSand the manganese-containing superoxide dismutase,SOD-2, is an important part of the antioxidativedefense in this compartment. The most studiedpolymorphism, rs4880 (Ala16Val), results in the sub-stitution of alanine to valine, which is located atposition 16 in the mitochondrial targeting sequence ofSOD2 on chromosome 6q25.3.39,40 It has been sug-gested that this SNP leads to altered expression ofSOD2 and that different variants are counteractingeach other; the valine variant has been associated withcardiomyopathy and lung cancer, whereas G homo-zygosity, the alanine variant, has been associated withincreased risk of diseases such as Alzheimer’s disease,Parkinson’s disease, prostate and breast cancer.41–46

Interestingly, the alanine variant of rs4880 has beenassociated with longevity.47 The functional effects ofAla16Val are not entirely known, but it has been

TABLE 3. Minor allele frequencies of SNPs in SOD1, SOD2 and SOD3.

Cataract ControlsGene rs-ID Minor allelea (n¼ 2� 492) (n¼ 2� 185) OR (95% CI)b p-valuesc

SOD1 rs17881180 T 5.5% 5.1% 0.82 (0.46–1.47) 0.51rs2234694 C 6.7% 5.1% 1.35 (0.76–2.40) 0.31rs17880135 G 6.3% 5.7% 0.82 (0.47–1.42) 0.47

SOD2 rs6917589 C 23.6% 26.5% 0.81 (0.60–1.09) 0.16rs2842980 A 16.4% 16.8% 1.09 (0.77–1.56) 0.62rs7855 G 6.5% 5.9% 1.33 (0.77–2.30) 0.31rs5746151 T 3.5% 3.2% 1.01 (0.50–2.03) 0.98rs5746136 T 27.0% 29.7% 0.82 (0.61–1.09) 0.17rs4880 A 43.4% 46.5% 0.89 (0.68–1.16) 0.39rs2758352 A 16.7% 16.5% 1.14 (0.80–1.63) 0.47

SOD3 rs2536512 G 32.6% 32.2% 0.99 (0.74–1.31) 0.92rs1799895 G 0.3% 0.8% 0.82 (0.15–4.45) 0.82

aMinor allele in our studied population.bOdds ratio (OR) adjusted for age, sex and smoking. 95% CI: confidence interval.cp-values were calculated using logistic regression with age, sex and smoking as covariates in an additive model.

SOD Polymorphisms in Cataract 143

! 2013 Informa Healthcare USA, Inc.

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.

suggested that the polymorphism leads to a confor-mational change in the helical structure of the protein,which may decrease the efficiency of its transport intomitochondria, altering enzyme activity.44

This study does not show any associationsbetween the studied SNPs and risk of age-relatedcataract, neither in the single SNP analyses, nor inthe haplotype analysis of SNPs in SOD2. Includingknown risk factors for cataract – age, sex andsmoking – as covariates in multivariate analyses ofSOD1, SOD2 and SOD3, or stratifying for cataractsubtype, did not alter the results. In this study oddsratios (OR) were between 0.81 and 1.35 with 95%confidence interval (CI) of 0.46–2.40, except forrs1799895, which had a wider CI due to rare allelefrequencies. Previous reports on these SNPs haveobtained higher ORs when studying conditions suchas diabetic nephropathy, cardiomyopathy, cancer,and neurodegenerative disease, as previously men-tioned. Based on a standardized difference derivedfrom Mohammedi et al., a relatively low power (62%)was calculated for rs17880135 in SOD1, which is alimitation of the study.35 However, for rs2234694(SOD1) and rs4880 (SOD2) a high power wasobtained; 86% and 99% respectively, as calculatedfrom similar studies on these SNPs, indicating thatresults were not falsely negative.36,45 In summary,although oxidative stress has been implied in thepathogenesis of cataract, this study does not supportany major role for genetic variation in SOD1, SOD2or SOD3 in this context.

ACKNOWLEDGMENTS

The authors are grateful for the technical assistanceand advice of Mrs Mona Seibt Palmer.

Declaration of interest: The authors report no con-flicts of interest. The authors alone are responsible forthe content and writing of the paper.This work was supported by grants from the SwedishResearch Council (#2011-3132), Swedish government(‘‘Agreement concerning research and education ofdoctors’’; ALF17 GBG-145921), Goteborg MedicalSociety, Marianne and Marcus WallenbergFoundation, Stiftelsen Handlanden HjalmarSvenssons forskningsfond, Stiftelsen HandlandenHerman Svenssons fond for blinda och synsvaga,Ogonfonden and Kronprinsessan MargaretasArbetsnamnd for Synskadade.

REFERENCES

1. Davies KJ. Oxidative stress, antioxidant defenses, anddamage removal, repair, and replacement systems. IUBMBLife 2000;50:279–289.

2. Hodge WG, Whitcher JP, Satariano W. Risk factors for age-related cataracts. Epidemiol Rev 1995;17:336–346.

3. Spector A, Garner WH. Hydrogen peroxide and humancataract. Experiment Eye Res 1981;33:673–681.

4. Age-Related Eye Disease Study Research Group. A ran-domized, placebo-controlled, clinical trial of high-dosesupplementation with vitamins C and E and beta carotenefor age-related cataract and vision loss: AREDS reportno. 9. Arch Ophthalmol 2001;119:1439–1452.

5. Chylack Jr. LT, Brown NP, Bron A, et al. The RocheEuropean American Cataract Trial (REACT): a randomizedclinical trial to investigate the efficacy of an oral antioxi-dant micronutrient mixture to slow progression of age-related cataract. Ophthalmic Epidemiol 2002;9:49–80.

6. Forsberg L, de Faire U, Morgenstern R. Oxidative stress,human genetic variation, and disease. Arch BiochemBiophys 2001;389:84–93.

7. HapMap-Consortium. The International HapMap Project.Nature 2003;426:789–796.

8. Barrett JC, Fry B, Maller J, et al. Haploview: analysis andvisualization of LD and haplotype maps. Bioinformatics2005;21:263–265.

9. Gabriel SB, Schaffner SF, Nguyen H, et al. The structure ofhaplotype blocks in the human genome. Science 2002;296:2225–2229.

10. Livak KJ. Allelic discrimination using fluorogenic probesand the 50 nuclease assay. Genet Anal 1999;14:143–149.

11. Kahn HA, Leibowitz HM, Ganley JP, et al. TheFramingham Eye Study. I. Outline and major prevalencefindings. Am J Epidemiol 1977;106:17–32.

12. Klein BE, Klein R, Linton KL. Prevalence of age-relatedlens opacities in a population. The Beaver Dam Eye Study.Ophthalmology 1992;99:546–552.

13. Kelly SP, Thornton J, Edwards R, et al. Smoking andcataract: review of causal association. J Cataract RefractSurg 2005;31:2395–2404.

14. Cumming RG, Mitchell P. Hormone replacement therapy,reproductive factors, and cataract. The Blue Mountains EyeStudy. Am J Epidemiol 1997;145:242–249.

15. Altman DG. Practical statistics for medical research.London, New York: Chapman and Hall; 1991.

16. Wigginton JE, Cutler DJ, Abecasis GR. A note on exact testsof Hardy–Weinberg equilibrium. Am J Human Genet2005;76:887–893.

17. Excoffier L, Slatkin M. Maximum-likelihood estimation ofmolecular haplotype frequencies in a diploid population.Mol Biol Evol 1995;12:921–927.

18. McCord JM, Fridovich I. Superoxide dismutase. An enzy-mic function for erythrocuprein (hemocuprein). J BiologicChem 1969;244:6049–6055.

19. Weisiger RA, Fridovich I. Mitochondrial superoxidedimutase. Site of synthesis and intramitochondrial locali-zation. J Biologic Chem 1973;248:4793–4796.

20. Marklund SL. Human copper-containing superoxide dis-mutase of high molecular weight. Proc Nat Acad Sci USA1982;79:7634–7638.

21. Behndig A, Svensson B, Marklund SL, et al. Superoxidedismutase isoenzymes in the human eye. InvestOphthalmol Vis Sci 1998;39:471–475.

22. Rajkumar S, Praveen MR, Gajjar D, et al. Activity ofsuperoxide dismutase isoenzymes in lens epithelial cellsderived from different types of age-related cataract.J Cataract Refract Surg 2008;34:470–474.

23. Taylor HR, West SK, Rosenthal FS, et al. Effect of ultravioletradiation on cataract formation. N Engl J Med 1988;319:1429–1433.

24. Wang J, Lofgren S, Dong X, et al. Evolution of lightscattering and redox balance in the rat lens after in vivo

144 D. Celojevic et al.

Ophthalmic Genetics

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.

exposure to close-to-threshold dose ultraviolet radiation.Acta Ophthalmol 2010;88:779–785.

25. Lin D, Barnett M, Grauer L, et al. Expression of superoxidedismutase in whole lens prevents cataract formation.Molec Vision 2005;11:853–858.

26. Matsui H, Lin LR, Ho YS, et al. The effect of up- anddownregulation of MnSOD enzyme on oxidative stress inhuman lens epithelial cells. Invest Ophthalmol Visual Sci2003;44:3467–3475.

27. Olofsson EM, Marklund SL, Behndig A. Enhanced age-related cataract in copperzinc superoxide dismutase nullmice. Clin Experiment Ophthalmol 2012;40:813–820.

28. Zhang Y, Zhang L, Sun D, et al. Genetic polymorphismsof superoxide dismutases, catalase, and glutathione per-oxidase in age-related cataract. Molec Vision 2011;17:2325–2332.

29. Huret JL, Delabar JM, Marlhens F, et al. Down syndromewith duplication of a region of chromosome 21 containingthe CuZn superoxide dismutase gene without detectablekaryotypic abnormality. Hum Genet 1987;75:251–257.

30. Krawczak M, Cooper DN. The human gene mutationdatabase. Trends Genet 1997;13:121–122.

31. Pagano G, Castello G. Oxidative stress and mitochondrialdysfunction in Down syndrome. Adv Experiment MedBiol 2012;724:291–299.

32. Kowald A, Klipp E. Alternative pathways might mediatetoxicity of high concentrations of superoxide dismutase.Ann NY Acad Sci 2004;1019:370–374.

33. Creavin AL, Brown RD. Ophthalmic abnormalities inchildren with Down syndrome. J Pediatr OphthalmolStrabismus 2009;46:76–82.

34. Al-Kateb H, Boright AP, Mirea L, et al. Multiple superoxidedismutase 1/splicing factor serine alanine 15 variants areassociated with the development and progression ofdiabetic nephropathy: the Diabetes Control andComplications Trial/Epidemiology of DiabetesInterventions and Complications Genetics study. Diabetes2008;57:218–228.

35. Mohammedi K, Maimaitiming S, Emery N, et al. Allelicvariations in superoxide dismutase-1 (SOD1) gene areassociated with increased risk of diabetic nephropathyin type 1 diabetic subjects. Mol Genet Metab 2011;104:654–660.

36. Panduru NM, Cimponeriu D, Cruce M, et al. Associationof þ35A/C (intron3/exon3) polymorphism in SOD1-genewith diabetic nephropathy in type 1 diabetes. Rom JMorphol Embryol 2010;51:37–41.

37. Hendrickson DJ, Fisher JH, Jones C, et al. Regionallocalization of human extracellular superoxide dismutasegene to 4pter-q21. Genomics 1990;8:736–738.

38. Sandstrom J, Nilsson P, Karlsson K, et al. 10-fold increasein human plasma extracellular superoxide dismutasecontent caused by a mutation in heparin-bindingdomain. J Biologic Chem 1994;269:19163–19166.

39. Rosenblum JS, Gilula NB, Lerner RA. On signal sequencepolymorphisms and diseases of distribution. Proc NatAcad Sci USA 1996;93:4471–4473.

40. Church SL, Grant JW, Meese EU, et al. Sublocalization ofthe gene encoding manganese superoxide dismutase(MnSOD/SOD2) to 6q25 by fluorescence in situ hybridi-zation and somatic cell hybrid mapping. Genomics1992;14:823–825.

41. Hiroi S, Harada H, Nishi H, et al. Polymorphisms in theSOD2 and HLA-DRB1 genes are associated with nonfami-lial idiopathic dilated cardiomyopathy in Japanese.Biochem Bioph Res Co 1999;261:332–339.

42. Wang LI, Miller DP, Sai Y, et al. Manganese superoxidedismutase alanine-tovaline polymorphism at codon 16 andlung cancer risk. J Nat Cancer Institute 2001;93:1818–1821.

43. Wiener HW, Perry RT, Chen Z, et al. A polymorphism inSOD2 is associated with development of Alzheimer’sdisease. Genes Brain Behav 2007;6:770–775.

44. Shimoda-Matsubayashi S, Matsumine H, Kobayashi T,et al. Structural dimorphism in the mitochondrial targetingsequence in the human manganese superoxide dismutasegene. A predictive evidence for conformational change toinfluence mitochondrial transport and a study of allelicassociation in Parkinson’s disease. Biochem Bioph Res Co1996;226:561–565.

45. Ergen HA, Narter F, Timirci O, et al. Effects of manganesesuperoxide dismutase Ala-9Val polymorphism on pros-tate cancer: a case-control study. Anticancer Res 2007;27:1227–1230.

46. Ambrosone CB, Freudenheim JL, Thompson PA, et al.Manganese superoxide dismutase (MnSOD) genetic poly-morphisms, dietary antioxidants, and risk of breast cancer.Cancer Res 1999;59:602–606.

47. Soerensen M, Christensen K, Stevnsner T, et al. The Mn-superoxide dismutase single nucleotide polymorphismrs4880 and the glutathione peroxidase 1 single nucleotidepolymorphism rs1050450 are associated with aging andlongevity in the oldest old. Mech Ageing Dev 2009;130:308–314.

SOD Polymorphisms in Cataract 145

! 2013 Informa Healthcare USA, Inc.

Oph

thal

mic

Gen

et D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y U

nive

rsity

of

Suss

ex L

ibra

ry o

n 07

/17/

13Fo

r pe

rson

al u

se o

nly.