Studies in Zingiber Officinale Roscoeshodhganga.inflibnet.ac.in/bitstream/10603/4030/12/12...STUDIES IN ZINGIBER OFFICINALE ROSCOE Laboratory of Cytogenetics and Plant Breeding Table:

STUDIES IN ZINGIBER OFFICINALE ROSCOE Chapter IV: Results and Discussions

Laboratory of Cytogenetics and Plant Breeding | Page No.: 48

Results and discussions

4.1: Germplasm collections of ginger in India:

Considering importance of germplasm conservation, total 12 cultivars of

ginger were collected from India for the present study (Plate: III) and well

maintained in botanical garden of Department of Botany, Shivaji University,

Kolhapur. In India about 900 accessions of ginger are conserved in different

places. Majority of ginger cultivars are conserved in Indian Institute of Spices

Research, Calicut followed by Orissa University of Agriculture and Technology,

Pottangi, Orissa.

In India, ginger has rich cultivar diversity, and major growing cultivars that

are specific to the area are mostly known by place names. Kerala has the more

diversity followed by northeastern region of India. At present, more than 70

ginger cultivars possessing varying quality attributes and yield potential are being

cultivated in India (Ravindran and Nirmal Babu, 2004). There are 15 agroclimatic

zones in India, in present work attempts have been made to collect germplasm

from maximum agroclimatic zones and total 12 cultivars from 10 agroclimatic

zones were collected. Rio de Janeiro cultivar was introduced into India from

Brazil and has become very popular in Kerala.

4.2: HPLC analysis of 6-gingerol from different cultivars of ginger:

According to Leverington, (1975) and Connell and Sutherland, (1969) the

main pungent principles extracted from the rhizomes were 6-gingerol, 8-gingerol,

and 10-gingerol, and in terms of pungency 6-gingerol was the most pungent

compounds, (Govindarajan, 1979 and 1982) Hence, 6-gingerol was chosen for

the present study.

Calibration Curve:

The linearity of the proposed analytical method for determination of the 6-

gingerol was evaluated by analyzing four concentration levels of standard solution.

Each concentration was repeated three times. The calibration curve of the standard

was constructed with the correlation coefficients (R2) above 0.9975. The results of

the regression equations were y = 3.65e+004 X +3.44e+004.

STUDIES IN ZINGIBER OFFICINALE ROSCOE

Laboratory of Cytogenetics and Plant Breeding

The calibration graph for 6

result by linear regression analysis showed a very good linear relationship between

peak area and concentration.

Figure: 4.1 a - d: Chromatogramgingerol and e: Calibration graph of standard solution of 6

OFFICINALE ROSCOE Chapter IV: Results and Discussions

Laboratory of Cytogenetics and Plant Breeding | Page No.:

The calibration graph for 6-gingerol, was shown in (Figure:


peak area and concentration.

d: Chromatogram of different concentration of standard 6Calibration graph of standard solution of 6-gingerol

(a)

(e)

(c)

Results and Discussions

Page No.: 49

4.1 a - e). The


standard 6- gingerol

(b)

(e)

(d)



6- Gingerol content by HPLC:

The 6-gingerol contents, calculated using the standard calibration curve

(R2 = 0.998), were varied from 0.1% to 0.2 % (Table 4.1). The 6-gingerol content

for the ginger cultivars ranged from 0.2% in Rajasthan to 0.1% in Udaipur which

was shown in fig. 4.2 a to l.

The results perfectly matched with the observations made by Nybe and

coworkers (1982), which determined gingerol content in different ginger cultivars

and found to be highest in Rio De Janero and lowest in Wynad. Xiang et al.

(2008) analysed 6-gingerol content from ginger by HPLC, which showed 6-

gingerol content was 0.39% in dried ginger, 0.10% in baked ginger and 0.19% in

fresh ginger. Using different drying methods, Hawlader et al. (2006) determined

6-gingerol content and it was 0.6% in normal air drying. Determination of

gingerol by LC-MS from raw herb and dried aqueous extract was done by

Samiuela et al. (2007). During determination of 6-gingerol, extraction by

sonication and methanol solvent showed maximum yield. 6-gingerol content in

dried aqueous extract was 0.18% while raw herb extract had 0.93%. Zachariah et

al. (1993) evaluated germplasm for oleoresin content and found range for 6-

gingerol content in between 0.3% to 0.7%. Ravindran and Nirmal Babu, (2004)

recorded many ginger cultivars with high oleoresin, such as Rio de Janeiro, Ernad

Chernad, Wynad, Kunnamangalam, and Meppayyur.



Figure: 4.2 Chromat

Himachal Pradesh, d:

Rio-de-Janero, i:



4.2 Chromatograms of different varieties a: Satara, b:

: Rajasthan, e: Chattisgarh, f: Udaipur, g:

Assam, j: Uttar Pradesh, k: Nadia and l: Wynad

(a)

(c)

(e)

(g)


Page No.: 51

, b: Sagar c:

: Maran, h:

Wynad

(b)

(d)

(f)

(h)



Table: 4.1 6-gingerol content i

Sr. No. Name of Cultivar

1 Satara 2 Sagar 3 Himachal Pradesh4 Rajsthan 5 Chattisgarh 6 Udaipur 7 Maran 8 Rio-de-Janero9 Assam

10 Uttar Pradesh11 Nadia 12 Wynad

4.3: Biochemical studies

Calibration Curve:

Calibration curves were plotted for determination of the total phenolic

content and flavonoid content from ginger while DPPH and FRAP were

evaluated by analyzing four concentration levels of standard solution. Each

concentration was repeated three times. T

were constructed with the correlation coefficients and regression equations



ingerol content in different cultivars of Ginger

Name of Cultivar 6 - gingerol content in ppm % of

66.28 79.07

Himachal Pradesh 50.34 83.38

69.96 47.09 69.46

Janero 83.26 73.75

Uttar Pradesh 69.85 62.34 57.03

Biochemical studies of different ginger varieties:




concentration was repeated three times. The calibration curves of the standards


(i)

(k)


Page No.: 52

n different cultivars of Ginger

% of 6-gingerol

0.1657 0.1976 0.1258 0.2084 0.1749 0.1177 0.1736 0.2081 0.1844 0.1746 0.1558 0.1426




he calibration curves of the standards


(j)

(l)



(Table: 4.2). The calibration graphs of different standard were shown in (Figure:

4 .3 a to d).

Table: 4.2. Values of standards calibration graphs

Name of Standard

Name of quantified compound

Y Value R2

Tannic acid Total phenolic content 0.003x + 0.080 0.999 Quercetin Flavonoid 0.011x - 0.046 0.998 Ascorbic acid DPPH 0.000 x + 0.023 0.978 Ascorbic acid FRAP 0.000 x + 0.057 0.976

Figure: 4.3 a: Quercetin Figure 4.3 b: Tannic acid

Figure 4.3 c and d: Ascorbic acid Figure

y = 0.011x - 0.046R² = 0.998

00.5

11.5

22.5

0 100 200 300

Abb

at 3

67 n

m

Conc. (ug/ml)

Standard plot of Flavonoids

y = 0.003x + 0.080R² = 0.999

00.5

11.5

22.5

3

0 500 1000

Abb

. at 7

60 n

m

Conc. (ug/ml)

Standard plot of Phenolics

R² = 0.976y = 0.000x - 0.057

0

0.1

0.2

0.3

0.4

100 400 700 1000 1300

Abb

at 5

93nm

Conc. µM/ml

Standard plot of FRAP

y = 0.000x + 0.023R² = 0.978

0.020.040.060.08

0.10.120.14

0 300 600 900

Abb

at 5

15 n

m

Conc. uM/ml

Standard plot of DPPH



Total Flavonoid content:

The total flavonoid contents of the samples derived from 14 different

ginger varieties were expressed as Quercetin equivalent per gram, which was

given in Table: 4.3. The total flavonoid contents vary from 0.13 to 0.38gm per

100gm of dry weight. The highest content of flavonoids was observed in cv.

Rajasthan (0.38 gm) while in cv. Udaipur has shown 0.202g per 100 gm of dry

weight. Literatures on phytochemical screenings for flavonoids in different plants

have yielded high values in aerial parts of Cajanus cajan 29.34 g RE/100g dw

(Wu et al., 2009), Voacanga africana 09.00 g RE/100g dw (Ayoola et al., 2008)

and in Aegle marmelos 0.01 g QE/100g dw (Siddique et al., 2010).

Total Phenolic Content:

The antioxidant activity and total phenolic contents vary considerably among

cultivars. Total phenolic contents were determined using the Folin-Ciocalteu

reagent and expressed as Tannic acid equivalent per gram. The total phenolic

contents, calculated using the standard curve of Tannic acid (R2 = 0.999), were

varied from 0.7 to 1.58 gm per 100gm of dry weight. Total phenolic content for

the ginger cultivars were highest in Rajasthan 1.58 gm while 0.886 gm per 100

gm of dry weight in Udaipur (Figure: 4.4). Shamina et al. (1997) determined the

variability in total phenols in ginger using 25 cultivars.



Figure: 4.4. Ginger cultivars showing flavonoid, phenolic content and

DPPH and FRAP activities.

Antioxidant activity:

Natural antioxidants that are present in herbs and spices are responsible

for inhibiting or preventing the deleterious consequences of oxidative stress.

Spices and herbs contain free radical scavengers like polyphenols, flavonoids and

phenolic compounds. In the present work, the free radical scavenger activity of

methanolic extract of ginger varieties was evaluated. It is well known that the

antioxidant activity of plant extracts containing polyphenol components is due to

their capacity to be donors of hydrogen atoms or electrons and to capture the free

radicals. DPPH analysis is one of the tests used to prove the ability of the

components of the ginger extract to act as donors of hydrogen atoms. Unlike

other free radicals such as the hydroxyl radical and superoxide anion, DPPH has

the advantage of being unaffected by certain side reactions, such as metal ion

chelation and enzyme inhibition (Amarowicz et al., 2004). Antioxidants react

with DPPH (a stable free radical) to convert it into 1, 1-diphenyl-2-

picrylhydrazine. The degree of discoloration indicates the radical scavenging

potential of the antioxidants.

0

1

2

3

4

5

6D

PPH

and

FRA

P co

nten

t in

mm

and

Ph

enol

ic a

nd F

lavo

noid

con

tent

in

g/10

0g

Ginger cultivars

Flavonoid Phenolic FRAP DPPH



FRAP:

The antioxidant activity of extracts was investigated using DPPH and

FRAP assays. Table 4.4 represents ferric reducing capacity obtained by using

FRAP assay. The highest ferric reducing capacity was found in cv. Rajasthan

(4816.84 µm) followed by cv. Rio De Janero (4489.93 µm), while among the

remaining cultivars Sagar (4281.21 µm) had significant ferric reducing capacities

as compared to other ginger varieties.

DPPH activity:

The reduction of DPPH by antioxidants in the ginger extracts expressed as

the µm Ascorbic acid equivalent. Total DPPH activity of the ginger cultivars

ranged from 1137 µm to 1827 µm Ascorbic acid equivalent (Table: 4.3). The

highest antioxidant activity was seen in cv. Rio De Janero, while the lowest

activity was seen in cv. Assam. The group of cultivars which had higher phenolic

content had highest antioxidant activity (Figure: 4.4). It has also been noted that

the antioxidant activity, total phenolic, flavonoid, and 6 – gingerol content varied

considerably from cultivar to cultivar. These results are in accordance with

previous reports on antioxidant capacities of medicinal plants which exhibit

polyphenols to play important role in the activity (Kalt et al., 1999 and

Shaharuddin et al., 2008). Moreover, the antioxidants tested by FRAP assay are

limited to water-soluble (i.e. soluble in aqueous alcoholic solution) components

compared to DPPH assay (organic solvents especially alcohols) (Arnao, 2000 and

Pulido et al., 2000).



Table: 4.3. Ginger cultivars showing flavonoid, phenolic content and DPPH and FRAP activities.

Varieties Flavonoida ±sd Phenolicb ±sd FRAPc ±sd DPPHd ±sd Satara 0.334 0.000 1.240 0.002 2730.92 3.77 1493.12 3.08 Sagar 0.350 0.001 1.264 0.004 4281.21 0.00 1503.80 3.08 Himachal Pradesh 0.261 0.000 1.056 0.001 3236.37 0.00 1137.19 0.00 Rajsthan 0.382 0.000 1.588 0.007 4816.84 0.00 1788.55 0.00 Chattisgarh 0.342 0.000 1.215 0.000 3906.53 2.18 1452.19 0.00 Udaipur 0.202 0.000 0.886 0.001 3160.93 3.77 1193.25 295.9 Maran 0.309 0.001 1.199 0.002 3730.50 0.00 1390.26 142.4 Rio 0.384 0.000 1.344 0.004 4489.93 17.0 1827.52 219.1 Assam 0.340 0.001 1.249 0.003 4212.06 2.18 1526.23 58.94 Uttar Pradesh 0.333 0.000 1.151 0.001 3729.24 2.18 1489.57 124.8 Nadia 0.294 0.000 1.078 0.002 3217.51 3.77 1403.61 216.4 Wynad 0.219 0.000 1.021 0.001 3090.52 4.36 1425.68 231.4

a:g/100g Quercetin equivalent dry weight; b: g/100g Tannic acid equivalent dry weight, c: µm Ascorbic acid equivalent dry weight and

d: µm Ascorbic acid equivalent dry weight.



4.4: Multivariate Analysis:

A multivariate Bray Curtis Cluster analysis (complete link) was applied to

the means of different biochemical parameters to produce a similarity matrix

(Table: 4.4). Analysis showed two major clusters (Figure: 4.5) among which

cluster I comprises 7 cultivars viz. Rio, Rajasthan, Uttar Pradesh, Maran,

Chattisgad, Assam and Sagar and cluster II has 5 cultivars (Wynad, Nadia,

Udaipur, H.P. and Satara). Cluster I was formed from three subclusters while

cluster II was from two sublcuster. It can be seen that Uttar Pradesh, Maran,

Chattisgad, Assam and Sagar forms two subclusters and subcluster of Rio,

Rajasthan, forms an outgroup in cluster I. In cluster II Wynad, Nadia, H.P. and

Udaipur forms one subcluster for which cultivar ‘Satara’ forms an out group.

Multivariate analysis showed that Cluster I was comprise of cultivars with

high biochemical content while cluster II with low biochemical contents. Satara

cultivar found to be intermediate for biochemical content.



Table: 4.4 Similarity Matrix of ginger cultivars

Cultivars Satara Sagar H.P. Rajasthan Chattisgad Udaipur Maran Rio Assam U. P. Nadia Wynad

Satara 100.00 87.96 90.17 80.88 90.36 89.03 90.79 83.89 88.51 91.43 93.49 93.39

Sagar 87.96 100.00 86.73 92.75 96.55 84.52 94.48 95.86 99.14 95.03 89.47 87.42

H.P. 90.17 86.73 100.00 79.68 90.13 96.76 92.19 82.68 87.28 91.64 96.91 95.49

Rajasthan 80.88 92.75 79.68 100.00 89.33 77.52 87.29 96.41 92.19 87.83 82.36 80.35

Chattisgad 90.36 96.55 90.13 89.33 100.00 87.90 97.93 92.42 97.09 97.94 92.89 90.82

Udaipur 89.03 84.52 96.76 77.52 87.90 100.00 89.95 80.50 85.07 89.41 94.97 95.81

Maran 90.79 94.48 92.19 87.29 97.93 89.95 100.00 90.36 95.05 98.73 94.75 92.33

Rio 83.89 95.86 82.68 96.41 92.42 80.50 90.36 100.00 95.29 90.91 85.39 83.36

Assam 88.51 99.14 87.28 92.19 97.09 85.07 95.05 95.29 100.00 95.59 90.02 87.97

U.P. 91.43 95.03 91.64 87.83 97.94 89.41 98.73 90.91 95.59 100.00 94.41 92.34

Nadia 93.49 89.47 96.91 82.36 92.89 94.97 94.75 85.39 90.02 94.41 100.00 97.56

Wynad 93.39 87.42 95.49 80.35 90.82 95.81 92.33 83.36 87.97 92.34 97.56 100.00

Colour Index

Range

100

<100 - 95

<95 - 90

<90 – 85

<85 - 80

<80



Figure: 4.5 Dendrogram of ginger cultivars

1

2

3

4

5

I

II



4.5: Correlations between biochemical parameters:

Statistical analysis for all biochemical parameters showed positive

correlations (Figure: 4.6 a to j). DPPH activity and phenolic content were

significantly correlated (R2 = 0.449). Thus, the three cultivars Rajasthan, Rio De

Janero and Sagar (Table: 4.3), that ranked highest for antioxidant activity also

ranked within the top four for phenolic content. Because phenolic compounds are

some of the most important water soluble antioxidants and can be present at high

concentrations in plants, the correlation between these two traits was expected.

Antioxidant activity increased proportionally to the phenolic content and a linear

relationship between DPPH-radical scavenging activity and total phenolic was

established. In case of flavonoid and phenolic there was also strong correlation

(R2 = 0.880) but p value is not significant (Table: 4.5). All the ginger cultivars

which contained high phenolic compounds exhibited high antioxidant activity

when determined by DPPH and FRAP assays. It, thus, confirms that phenolic

compounds have an important role in antioxidant activities (Harborne, 1998).

Correlation between antioxidant activity and phenolic compounds were

significant in Bulgarian medicinal plants (Ivanova, et al. 2005), Chinese

medicinal plants (Zheng and Wang, 2001), some fruits, vegetables and grain

products (Velioglu et al. 1998). The phenolic hydroxyl groups present in plant

antioxidants have redox properties (Shahidi and Wanasundara, 1992 and Pietta,

2000) allowing them to act as a reducing agent and a hydrogen donator in the two

assays. Thus, phenolic compounds could be the major antioxidant in these ginger

cultivars.



Table 4.5: ANOVA of the correlations between different traits

Correlations P value Remark R2 value Flavonoid vs Phenolics >0.05 Not significant 0.880 Flavonoid vs FRAP <0.001 Extremely significant 0.301 Flavonoid vs DPPH <0.001 Extremely significant 0.589 Phenolics vs DPPH <0.001 Extremely significant 0.449 DPPH vs FRAP <0.001 Extremely significant 0.330 Gingerol vs Flavonoid >0.05 Not significant 0.898 Gingerol vs FRAP <0.001 Extremely significant 0.731 Gingerol vs Phenolics >0.05 Not significant 0.872 Gingerol vs DPPH <0.001 Extremely significant 0.850 Phenolics vs FRAP <0.001 Extremely significant 0.433

Repeated measures analysis of variance

Tukey – Kramer multiple comparisons tests

Figure: 4.6 Correlations between biochemical parameters

R² = 0.880

0.5

0.7

0.9

1.1

1.3

1.5

1.7

0.1 0.2 0.3 0.4

g/10

0g T

anni

c ac

id e

q.

Flavonoid g/100g Quercetin eq.

(a) Correlation between Flavonoid and Phenolics

R² = 0.301

350

1350

2350

3350

4350

5350

0.1 0.15 0.2 0.25 0.3 0.35 0.4

µM A

scor

bic

eq.


(b) Correlation between Flavonoid and Antioxidant (FRAP)

R² = 0.589

500700900

110013001500170019002100

0.1 0.15 0.2 0.25 0.3 0.35 0.4

µM A

scor

bic

eq.


(c) Correlation between Flavonoid and Antioxidant (DPPH)

R² = 0.449

500700900

110013001500170019002100

0.6 0.8 1 1.2 1.4 1.6 1.8

µM A

scor

bic

eq.

Phenolic g/100g Tannic acid eq.

(d) Correlation between Phenolics and Antioxidant (DPPH)

R² = 0.330

500700900

110013001500170019002100

500 1500 2500 3500 4500 5500

µM A

scor

bic

eq.

FRAP µM Ascorbic eq.

(e) Correlation between Antioxidant tests: FRAP and DPPH

R² = 0.898

0.000.050.100.150.200.250.300.350.400.45

0.1 0.12 0.14 0.16 0.18 0.2 0.22

g/10

0g Q

uerc

etin

eq.

% Gingerol

(f) Correlation between Gingerol and Flavonoid content



4.6: Morphological mutations induced by EMS and Gamma rays in Ginger

cv. Satara:

VM1 Generation:

The parameters selected for morphological mutants in VM1 and VM2

generation comprised:

• Germination percentage

• Chlorophyll mutant percentage

• Height of shoot/tiller per rhizome

• Number of shoots/tillers per rhizome

• Number of leaves per shoot/tiller of rhizome

• Weight of rhizome

4.6a: Germination studies:

Rhizome germination was studied in EMS treated and gamma irradiated

rhizomes of ginger and results are depicted in Table.4.6.

Germination percentage:

Various physical and chemical mutagens are known to affect germination

of seed. Seed germination in M1 is one of the parameters and used as an index in

determining the effects of mutagens on plants (Konzak et al., 1972).

R² = 0.731

0

1000

2000

3000

4000

5000

6000

0.1 0.12 0.14 0.16 0.18 0.2 0.22

µM A

scor

bic

acid

eq.

% Gingerol

(g) Correlation between Gingerol and Antioxidant activity (FRAP)

R² = 0.872

0.50

0.70

0.90

1.10

1.30

1.50

1.70

0.1 0.12 0.14 0.16 0.18 0.2 0.22

g/10

0g T

anni

c ac

id e

q.

% Gingerol

(h) Correlation between Gingerol and Phenolic content

R² = 0.850

750

950

1150

1350

1550

1750

1950

0.1 0.12 0.14 0.16 0.18 0.2 0.22

µM A

scor

bic

acid

eq.

% Gingerol

(i) Correlation between Gingerol and Antioxidant activity (DPPH)

R² = 0.433

350

1350

2350

3350

4350

5350

6350

0.6 0.8 1 1.2 1.4 1.6 1.8

µM A

scor

bic

eq.


(j) Correlation between Phenolics and Antioxidant (FRAP)



The effects of mutagens on seed germination are depicted in Table 4.6. It

has been observed that germination percentage in control is 100% (Table 4.6).

Both the mutagens used in present study had inhibitory effects on seed

germination. The reduction in germination of seed was also expressed as percent

lethality. The germination percentage ranged from 80% to 96% in case of EMS

(0.10% to 0.25%) 8 hrs treatments (Figure: 4.7), while for EMS (0.30% t0

0.60%) 4 hrs treatment germination was in the range of 64% to 96% (Figure:

4.8). The germination percentage ranged from 4% to 88% for gamma rays

treatments (Figure: 4.9). In general germination was decreased with increase in

gamma rays dose over control. Jayachandran (1989) treated the cv. Rio de

Janeiro with gamma rays at 0.5 to 1.5 KRAD and Ethylmethane sulfonate (EMS)

at 2.0 to 10.0 mM. In his study the LD50 i for sprouting and survival was

between 0.5 and 1.0 KR of gamma rays. However, in present study the LD 50

was 0.500KRAD.

The impact and the tolerance level of the biological material to a mutagen

are manifested in M1 generation itself in terms of germination and lethality

(Gaul, 1957). In the present investigation germination and survival percentage

decreased with increasing dose/ concentration. Similar results were observed by

Ghanavat (2000) in Psophocarpus, Gaikwad (2002) in Lentil, Dhanavel et al.

(2008) in Vigna and Kavithamani et al. (2008) in Glycine. The decreased

percentage of germination might be due to drastic injury implicated upon the

cellular system at the molecular level which resulted in either lowering down or

completely inhibiting the physiology of germination (Gustaffson, 1944; Bilquiz

and Martin, 1961; Raghuvanshi and Singh, 1976; Tarar and Dnyansagar, 1983

and Chandra and Tarar, 1987). The decrease in germination percentage has been

attributed mainly to the interference by the mutagen with metabolic activities of

the seed (Micke, 1958 and 1961, Gottschalk and Schieb, 1960 and Sjodin 1962).

The general inhibition of germination and increased lethality could be due to the

lowering of the rate of mitotic proliferation and the consequent delay in cell

division and repair of damaged DNA (Hutterman et al., 1978).



Table: 4.6: -Effects of different mutagens on germination percentage of

Ginger in VM1

Treatment Concentration Germination % Lethality% Control Control 100 --

EMS 8 hrs

0.10% 84 16 0.15% 96 04 0.20% 88 12 0.25% 80 20

EMS 4hrs

0.30% 88 12 0.40% 96 04 0.50% 92 08 0.60% 64 36

Gamma Rays (KR)

0.125 84 16 0.250 88 12 0.375 64 36 0.500 28 72 0.750 16 84 1.000 04 96

Figure: 4.7 Germination % in EMS 8 hrs treatments.

Figure: 4.8 Germination % in EMS 4 hrs treatments.

5060708090

100110120

0.05 0.1 0.15 0.2 0.25 0.3

Ger

min

atio

n %

EMS 8 hrs treatment in %

0

50

100

150

0.2 0.3 0.4 0.5 0.6

Ger

min

atio

n %

EMS 4 hrs treatment in %

Germination % in EMS 4 hrs



Figure: 4.9 Germination % in Gamma rays treatments.

4.6b: Chlorophyll mutations percentage:

Almost all the mutagenic treatments showed different degree of mutations

with respect to dose. In the present investigation, some of the chlorophyll mutants

were observed in the different dose/concentrations of gamma rays and EMS.

They were chlorina, albino and xantha. Different chlorotic abnormalities were

scored in VM1 (Plate: IV a to h) and VM2 (Plate V a to h): and results of the

same are depicted in Table: 4.7. The correlation of chlorotic mutants’ percentage

in VM1 and VM2 showed good corelation which was R2 = 0.801 (Figure: 4.10).

The percentage of xantha mutants was highest in both the generations VM1 and

VM2 followed by chlorina while percentage of albino was lowest. The trend of

the mutation percentage was not correlated with increase or decrease in dose of

EMS 4 hrs (VM1) and EMS 8 hrs (VM1and VM2) treatments. The percentage of

chlorotic abnormalities per plant showed gradual decrease with increasing EMS 4

hrs treatments while in EMS 8 hrs treatment highest mutation percentage was

recorded in 0.15% dose treatment (16.66%) and lowest in 0.25% dose treatment

(10%). In case of gamma rays treatment the percentage of mutants increased

initially (0.250 KR) and then decreased with increase in dose.

0

50

100

150

0 0.125 0.25 0.375 0.5 0.625 0.75 0.875 1

Ger

min

atio

n %

Doses of Gamma rays in KR

Germination % in Gamma rays treatment



Table: 4.7 Frequency of chlorophyll mutants in ginger after mutagenic treatments:

Treatment Concentration mutation (%) in VM1

mutants (%) in VM1 mutation (%) in VM2

mutants (%) in VM2 Albino Xantha Chlorina Albino Xantha Chlorina

Control -- -- -- -- -- -- -- -- --

EMS 8 hrs.

0.10% 19.04 4.76 9.52 4.76 14.28 4.76 4.76 4.76 0.15% 20.83 8.33 8.33 4.16 16.66 4.16 8.33 4.16 0.20% 18.18 4.54 13.63 -- 13.63 4.54 9.09 -- 0.25% 15.00 5.00 5.00 5.00 10.00 5.00 5.00 --

EMS 4hrs

0.30% 22.72 9.09 9.09 4.54 16.66 4.16 8.33 -- 0.40% 16.66 4.16 8.33 4.16 12.50 4.16 4.16 4.16

0.50% 13.04 4.34 4.34 4.34 08.69 4.34 4.34 -- 0.60% 12.5 6.25 6.25 -- 06.25 6.25 -- --

Gamma Rays (K RAD)

0.125 19.04 4.76 9.52 4.76 14.28 4.76 4.76 4.76 0.250 19.04 4.76 9.52 4.76 14.28 4.76 9.52 -- 0.375 12.5 -- 6.25 -- 06.25 -- 6.25 -- 0.500 14.28 -- 14.28 -- 14.28 -- 14.28 -- 0.750 -- -- -- -- -- -- -- -- 1.000 -- -- -- -- -- -- -- --



Figure: 4.10 Correlation in chlorophyll mutation % between VM1 and VM2

The phenomenon of albinism is rarely exhibited by plants, one of the

characteristic deficiency of chlorophyll and subsequent whitish-yellow colour of

entire seedling (Hooda et al., 2004). These types of mutations were observed in

mungbean (Singh and Singh, 1989), in chickpea (Kharkwal, 1998) and in grass

pea (Waghmare and Mehra, 2000). Chlorophyll development seems to be

controlled by many genes located on several chromosomes, which could be

adjacent to centromere and proximal segment of chromosomes (Swaminathan,

1964). In present work, EMS was found to be a superior mutagen than gamma

rays in induction of higher chlorophyll mutations in VM2 generation; this is in

agreement with the observations made by Swaminathan et al. (1970).

The comparative superiority of chemical mutagens over gamma rays

producing a higher frequency and spectrum of chlorophyll mutations suggest that

the chemical mutagens are more efficient in inducing mutations of genes needed

for chlorophyll development. Swaminathan et al. (1962) proposed that such high

frequency is due to the preferential action of EMS on chlorophyll development

genes located near centromere. The present finding of differential effect of

physical and chemical mutagens in inducing chlorophyll mutations also supports

this view.

R² = 0.801

5

7

9

11

13

15

17

19

10 12 14 16 18 20 22 24

VM

2

VM1



4.6c: Height of shoot/tiller per rhizome:

The effects of different mutagens on plant height are depicted in Table:

4.8. Present study revealed that average mean height of plants was more than the

control plants in obtained through EMS 4 hrs treatment (0.40%) and gamma rays

treatments viz. 0.125 KR, 0.250KR, 0. 500KR and 1 KR in VM2. The correlation

between VM1 and VM2 was R2 = 0.232 (Figure: 4.11). The ANOVA of the VM1

was done by using Dunnett compares all vs control. The p values were significant

in VM1 for all EMS 8 hrs treatment except 0.15%, whereas for EMS 4 hrs

treatment it was significant for 0.30% and 0.60% (Table: 4.8). In case of gamma

rays treatment 0.125 KR and 0.250 KR dose had significant p values. VM2

generation showed significant p values for all the treatments of EMS 8 hrs except

0.15% and of gamma rays 0.375KR.

Figure: 4.11 Correlation of plant height between VM1 and VM2

R² = 0.232

25

27

29

31

33

35

15 20 25 30

VM

2

VM 1



Table: 4.8 Effects of different mutagens on plant height (in cm) in VM1 and VM2 generations of Ginger

Treatment Concentration Mean ± S.D. COV SEM P value Mean ± S.D. COV SEM P values

Control - 27.47 03.84 0.139 0.517 * * * 31.69 3.63 0.114 0.330 * * *

EMS 8 hrs.

0.10% 17.72 06.50 0.366 1.133 * * 27.14 5.45 0.200 0.515 * * 0.15% 23.78 10.21 0.429 1.506 ns 30.18 5.78 0.191 0.501 n s 0.20% 20.14 07.30 0.362 1.248 * * 29.30 6.53 0.222 0.631 * * 0.25% 22.36 09.30 0.415 1.492 * 29.10 6.18 0.212 0.588 * *

EMS 4hrs

0.30% 21.30 08.30 0.389 1.248 * * 31.25 5.66 0.181 0.534 n s 0.40% 23.95 09.60 0.400 1.104 ns 32.05 5.64 0.175 0.461 n s 0.50% 23.54 10.31 0.437 1.349 ns 31.04 4.73 0.152 0.473 n s 0.60% 18.76 08.41 0.448 1.684 * * 30.24 4.24 0.140 0.526 n s

Gamma Rays (KR)

0.125 22.29 10.43 0.467 1.279 * * 32.11 3.83 0.119 0.381 n s 0.250 21.73 07.91 0.364 0.938 * * 32.05 4.53 0.141 0.401 n s 0.375 25.10 09.22 0.367 1.198 ns 25.5 7.57 0.296 1.094 * * 0.500 23.50 08.41 0.357 1.344 ns 32.87 4.40 0.133 0.697 n s 0.750 22.42 13.04 0.581 4.932 ns 31.33 4.27 0.136 1.103 n s 1.000 25.66 07.76 0.302 4.485 ns 32.27 4.60 0.142 1.913 n s

COV: Coefficient of Variation; SEM: Standard Error of Mean *** extremely significant (P<0.001), * * Good significant (P< 0.01), * fairly significant (P<0.05) and ns - Not

significant - Dunnett compares all vs control



Jayachandran (1989) analyzed the VM2 generation of ginger and found a

significant reduction in plant height as the dose increased. Pelc and Howard

(1955) and Gorden (1957) have suggested that the possible interference of

irradiation with synthesis of new DNA may lead to inhibition of growth. Evans

(1965), while studying the effects of radiation on meristematic cells considered

growth reduction was to be due to cumulative expression of mitotic cycle delay.

4.6d: Number of shoots/tillers per rhizome:

The effects of different mutagens on number of tillers per plant are

depicted in Table: 4.9. The average tiller number in control was 2.2 in VM1 and

5.04 in VM2 generation (Table: 4.9). The treatments of EMS 8 hrs viz. 0.10%,

0.15% and 0.20%, 0.40% in EMS 4 hrs treatment and 0.250 KR and 0.500 KR of

gamma rays treatment showed average shoot number more than control in VM2.

P values significant only at 0.375 KR gamma rays treatment otherwise it was not

significant for all other remaining treatments in VM2. The correlation between

VM1 and VM2 shows R2 = 0.279 (Figure: 4.12).

It is revealed from the present studies that the mean tiller number in the

VM2 showed shifts in both the directions. These results has also are in agreement

with the observations reported by Jaychandran (1989) in ginger.



Table: 4.9 Effects of different mutagens concentration on number of shoot per plant in VM1 and VM2 generations of Ginger

VM1 VM2

Treatment Concentration Mean ± S.D. COV SEM P

values Mean ± S.D. COV SEM P

values Control - 2.2 0.912 0.414 0.182 *** 5.04 1.366 0.271 0.279 *

EMS 8 hrs.

0.10% 1.61 0.920 0.571 0.200 n s 5.38 1.716 0.319 0.374 n s 0.15% 1.91 0.928 0.485 0.189 n s 5.29 1.573 0.297 0.321 n s 0.20% 1.86 0.833 0.447 0.177 n s 5.35 1.531 0.286 0.342 n s 0.25% 1.80 0.894 0.496 0.200 n s 5.00 1.511 0.302 0.322 n s

EMS 4hrs

0.30% 2.22 0.812 0.365 0.173 n s 5.04 1.132 0.224 0.241 n s 0.40% 2.83 1.20 0.424 0.245 n s 5.79 1.503 0.259 0.306 n s 0.50% 2.21 0.998 0.451 0.208 n s 4.34 1.300 0.299 0.271 n s 0.60% 1.68 0.793 0.472 0.198 n s 4.12 1.310 0.317 0.327 n s

Gamma Rays (KR)

0.125 2.57 0.870 0.338 0.189 n s 4.80 1.120 0.233 0.263 n s 0.250 3.09 0.889 0.287 0.194 * 5.61 1.160 0.206 0.253 n s 0.375 3.00 1.095 0.365 0.273 n s 3.00 1.095 0.365 0.273 * * 0.500 3.71 1.603 0.432 0.606 * * 5.85 1.573 0.268 0.594 n s 0.750 1.75 0.957 0.546 0.478 n s 3.75 0.957 0.255 0.478 n s 1.000 3.00 0.000 0.000 0.000 n s 5.00 0.000 0.000 0.000 n s

COV: Coefficient of Variation; SEM: Standard Error of Mean *** Extremely significant (P<0.001), * * Good significant (P< 0.01), * fairly significant (P<0.05) and ns -

Not significant - Dunnett compares all vs control



Figure: 4.12 Correlation of number of shoots in VM1 and VM2

4.6e: Number of leaves per shoot/tiller of rhizome:

The correlation between VM1 and VM2 was R2 = 0.021 (Figure: 4.13), it

was very low as compared to other traits. The average number of leaves in

control was 10.52 in VM1and 11.79 in VM2 generation (Table: 4.10). The

treatments which showed mean number of leaves more than that of control were

the 0.40% of EMS 4 hrs treatment and 0.250 KR, 500 KR and 1KR of gamma

rays. The p values are significant for all EMS 8 hrs treatments and gamma rays

0.375KR treatment in VM2.

R² = 0.279

2

3

4

5

6

7

1 1.5 2 2.5 3 3.5 4

VM

2

VM 1



Table: 4.10: Effects of different mutagens concentration on number of leaves per plant in VM1and VM2 generations of Ginger

Treatment Concentration Mean ± S.D.

COV SEM P values

Mean ± S.D.

COV SEM P value

Control -- 10.52 2.68 0.257 0.361 ** 11.79 2.42 0.205 0.220 **

EMS 8 hrs.

0.10% 6.9 4.38 0.641 0.763 ** 9.58 2.60 0.271 0.245 ** 0.15% 8.39 5.23 0.623 0.771 n s 10.78 3.13 0.290 0.266 * 0.20% 7.04 3.98 0.565 0.672 ** 10.63 3.29 0.309 0.318 * 0.25% 7.63 4.00 0.524 0.643 * 10.56 2.93 0.277 0.278 **

EMS 4hrs

0.30% 6.53 4.89 0.748 0.688 ** 11.15 2.60 0.233 0.248 n s 0.40% 6.55 4.62 0.705 0.562 ** 11.97 2.74 0.228 0.230 n s 0.50% 7.24 4.71 0.650 0.668 ** 11.52 2.52 0.218 0.252 n s 0.60% 6.76 3.59 0.539 0.719 ** 10.67 2.59 0.242 0.322 n s

Gamma Rays (KR)

0.125 6.72 4.72 0.702 0.607 ** 11.68 2.45 0.209 0.245 n s 0.250 7.21 4.64 0.643 0.510 ** 12.04 2.91 0.241 0.260 n s 0.375 7.89 3.44 0.435 0.541 * 08.27 3.68 0.444 0.531 ** 0.500 7.84 3.59 0.457 0.774 n s 12.25 2.93 0.239 0.463 n s 0.750 8.42 2.99 0.355 1.131 n s 11.20 2.11 0.188 0.545 n s 1.000 8.33 5.04 0.605 2.906 n s 12.00 3.39 0.282 1.517 n s

COV: Coefficient of Variation; SEM: Standard Error of Mean * * Good significant (P< 0.01), * fairly significant (P<0.05) and ns - Not significant



Figure: 4.13 Correlation of leaf number in VM1 and VM2

4.6f: Weight of rhizome:

The effects of different mutagens on rhizome weight are reported in Table

4.11. The average weight of rhizome of control was 235.54 gm in VM2. The

concentration of (0.20%) EMS 4 hrs treatment, (0.40%) EMS 8 hrs treatment and

gamma rays 0.250 KR and 0.500 KR had shown average weight than the control

(Table: 4.11). The correlation between VM1 and VM2 was R2 = 0.275 (Figure:

4.14). The highest average weight of rhizome was found in 0.40% EMS 8 hrs

treatment (284.41 gm) followed by Gamma rays 0.500 KR treatment (275.14

gm). The weight of rhizome was increased about ten times in VM2 as compared

to VM1. Findings in the present studies are in agreement with the observations

reported by Jaychandran (1989) in ginger.

R² = 0.021

7

8

9

10

11

12

13

5 6 7 8 9 10 11 12

VM

2

VM1



Table: 4.11 Effects of different mutagens concentration on weight of rhizome per plant in VM1 and VM2 generations of Ginger

VM1 VM2

Treatment Concentration Mean ± S.D. COV SEM P value Mean ± S.D. COV SEM P values

Control -- 29.72 10.22 0.343 2.04 ** 235.54 61.61 0.261 12.57 n s

EMS 8

hrs.

0.10% 26.00 11.43 0.439 2.55 n s 219.95 99.30 0.451 21.67 n s

0.15% 32.18 13.07 0.406 2.78 n s 261.45 89.42 0.342 18.25 n s

0.20% 27.27 10.22 0.374 2.17 n s 240.95 40.19 0.166 19.27 n s

0.25% 23.95 9.50 0.396 2.12 n s 225.40 77.19 0.342 16.50 n s

EMS 4hrs

0.30% 23.63 7.66 0.324 1.63 n s 236.68 37.97 0.160 14.49 n s

0.40% 37.54 18.40 0.490 3.92 n s 284.41 103.27 0.363 21.08 n s

0.50% 36.22 16.24 0.448 3.46 n s 198.00 66.95 0.338 13.96 n s

0.60% 18.30 5.73 0.313 1.59 * 196.87 69.57 0.353 17.39 n s

Gamma

Rays (KR)

0.125 25.31 8.51 0.336 1.95 n s 226.90 66.27 0.292 14.46 n s

0.250 23.76 11.01 0.463 2.40 n s 273.00 84.53 0.309 18.44 n s

0.375 21.93 8.24 0.375 2.06 n s 108.25 41.27 0.381 10.31 **

0.500 36.28 11.20 0.308 4.23 n s 275.14 97.05 0.352 36.68 n s

0.750 23.25 4.99 0.214 2.49 n s 179.75 69.00 0.383 34.50 n s

1.000 30.00 0.00 0.000 0.00 n s 231.00 00.00 0.000 00.00 n s

COV: Coefficient of Variation; SEM: Standard Error of Mean * * Good significant (P< 0.01), * fairly significant (P<0.05) and ns - Not significant



Figure: 4.14 Correlation of Rhizome weight in VM1 and VM2

The results obtained in the present investigation showed a shieft of mean

on positive and negative direction in almost all the characters studied compared

to the control. The data on quantitative characters revealed that mutagens not

only altered the mean values but also created genetic variability for polygenic

traits. The increase in induced variations and decreased mean values were

observed by Brock (1965), Goud et al., (1969 and 1971), Perssons and Hagberg

(1969), Singh et al. (1977), Reddy (1991) and Bale (1999). It should be

concluded that mutagenic treatments are capable of inducing polygenic

variability and this feature can be exploited by the plant breeders for the genetic

improvement of desirable traits through proper selection.

R² = 0.275

100

150

200

250

300

15 20 25 30 35 40

VM

2

VM1



4.7: Biochemical studies in EMS 4 hrs treatment:

Analysis of 6-gingerol:

The 6 – gingerol content of the control and irradiated material

were determined by using HPLC

0.16% of 6-gingerol in control

it was 0.18%. As the dose increased the 6

Lowest 6- gingerol content

plants.

Figure: 4.15: Chromatograms0.40%, d: EMS 4hrs 0.50% and e



studies in EMS 4 hrs treatment:

gingerol content of the control and irradiated material

were determined by using HPLC (Figure: 4.15 a - e). The HPLC result shows

gingerol in control (Table 4.12) while for 0.30% EMS 4 hrs treatment

it was 0.18%. As the dose increased the 6-gingerol content was decreased.

gingerol content (0.09%) was observed in 60%EMS 4hrs treat

: Chromatograms, a: Control, b: EMS 4hrs 0.30%, c: EMS EMS 4hrs 0.50% and e: EMS 4hrs 0.60%.

(a)

(c)

(e)


Page No.: 78

gingerol content of the control and irradiated materials of ginger

The HPLC result shows

EMS 4 hrs treatment

gingerol content was decreased.

EMS 4hrs treated

c: EMS 4hrs EMS 4hrs 0.60%.

(b)

(d)



Total Phenolic content:

Phenolic content of the ginger treated with different concentrations of

EMS 4 hrs treatments were determined using Folin Ciocalteu method and the

results were expressed in Tannic acid equivalent. Phenolic content found to be

decreased as concentration increased. Highest phenolic content (1.266 gm/100gm

dry weight of ginger) was recorded for 0.30% EMS 4 hrs treatments, which was

twofold more than 0.60% EMS, 4 hrs treatment.


Flavonoid content was expressed in quercetin equivalent which was

highest in 0.30% EMS 4 hrs treatment. The flavonoid content also decreased with

increasing EMS 4 hrs concentrations. Lowest amount of flavonoid (0.197

gm/100gm dry weight of ginger) was recorded in 0.60% EMS 4 hrs treated

plants.


Antioxidant activities were measured by DPPH and FRAP method and

expressed in terms of Ascorbic acid equivalent. The highest activity was recorded

in 0.30 % EMS 4 hrs treated plants for both DPPH and FRAP (Table 4.12). The

trend of decrease in activity as increase in dose of mutagen was observed for both

DPPH and FRAP (Figure: 4.16).



Table: 4.12: Effects of various concentrations of EMS 4 hrs treatments on 6 - gingerol, Flavonoid and Phenolic contents and DPPH and FRAP activity in ginger

EMS 4 hrs treatment 6 - gingerol % Flavonoida ±sd Phenolicb ±sd FRAPc ±sd DPPHd ±sd

Control 0.1657 0.334 0.000394 1.240 0.002 2.731 0.0038 1.493 0.0031

0.30% 0.18 0.319 0.000473 1.266 0.002 3.072 0.0022 1.513 0.0031

0.40% 0.15 0.318 0.000394 0.918 0.001 2.406 0.0022 1.333 0.0163

0.50% 0.14 0.239 0.000347 0.957 0.000 1.646 0.0022 1.242 0.0031

0.60% 0.09 0.197 0.000347 0.639 0.003 1.113 0.0000 0.838 0.0000


d:µm Ascorbic acid equivalent dry weight.



Figure: 4.16 Effects of various concentrations of EMS 4 hrs treatments on 6 - gingerol, Flavonoid and Phenolic contents in gm/100gm of dry wt eq. and

DPPH and FRAP activity in mM

4.8: Correlations between biochemical parameters in various concentrations

of EMS 4 hrs treatmets:

All the correlations were of positive R values (Figure 4.17: a to j), which

are depicted in Table 4.13. Strong correlations were found between Gingerol and

DPPH (R2 = 0.911) followed by Phenolics and DPPH (R2 = 0.910). The lowest

correlation was recorded between flavonoid and FRAP (R2 = 0.301).

Table: 4.13 Correlations between different biochemical traits in various

concentrations of EMS 4 hrs treated plants

Correlations P value Remark R2 value Flavonoid vs Phenolics >0.05 Not significant 0.880 Flavonoid vs FRAP <0.001 Extremely significant 0.301 Flavonoid vs DPPH <0.001 Extremely significant 0.589 Phenolics vs DPPH <0.001 Extremely significant 0.910 DPPH vs FRAP <0.01 Significant 0.859 6-gingerol vs Flavonoid >0.05 Not significant 0.773 6-gingerol vs FRAP <0.001 Extremely significant 0.856 6-gingerol vs Phenolics >0.05 Not significant 0.911 6-gingerol vs DPPH <0.001 Extremely significant 0.985 Phenolics vs FRAP <0.001 Extremely significant 0.433

0

0.5

1

1.5

2

2.5

3

3.5

Control 0.3 0.4 0.5 0.6

EMS 4 hrs treatments

Gingerol % Flavonoid Phenolic FRAP DPPH



Figure: 4.17 Correlations between different biochemical traits in various concentrations of EMS 4 hrs treated plants

R² = 0.880

0.60.70.80.9

11.11.21.31.4

0.15 0.2 0.25 0.3 0.35

g/10

0g T

anni

c ac

id e

q.



R² = 0.301

500

1000

1500

2000

2500

3000

3500

0.15 0.2 0.25 0.3 0.35

µM A

scor

bic

eq.



R² = 0.433

500

1000

1500

2000

2500

3000

3500

0.4 0.6 0.8 1 1.2 1.4

µM A

scor

bic

eq.


(c) Correlation between Phenolics and Antioxidant (FRAP)

R² = 0.589

500

700

900

1100

1300

1500

1700

0.15 0.2 0.25 0.3 0.35

µM A

scor

bic

eq.


(d) Correlation between Flavonoid and Antioxidant (DPPH)

R² = 0.910

500

700

900

1100

1300

1500

1700

0.4 0.6 0.8 1 1.2 1.4

µM A

scor

bic

eq.


(e) Correlation between Phenolics and Antioxidant (DPPH)

R² = 0.891

500

700

900

1100

1300

1500

1700

500 1000 1500 2000 2500 3000 3500

µM A

scor

bic

eq.


(f) Correlation between Antioxidant tests: FRAP and DPPH

R² = 0.773

0.000.050.100.150.200.250.300.350.40

0.08 0.1 0.12 0.14 0.16 0.18 0.2

g/10

0g Q

uerc

etin

eq.

% Gingerol

(g) Correlation between 6- gingerol and Flavonoid content

R² = 0.911

0.00

0.20

0.40

0.60

0.80

1.00

1.20

1.40

0.08 0.1 0.12 0.14 0.16 0.18 0.2

g/10

0g T

anni

c ac

id e

q.

% Gingerol

(h) Correlation between 6-gingerol and Phenolic content

R² = 0.856

0500

100015002000250030003500

0.08 0.1 0.12 0.14 0.16 0.18 0.2

µM A

scor

bic

acid

eq.

% Gingerol

(i) Correlation between 6-gingerol and Antioxidant activity (FRAP)

R² = 0.985

0200400600800

10001200140016001800

0.08 0.1 0.12 0.14 0.16 0.18 0.2

µM A

scor

bic

acid

eq.

% Gingerol

(j) Correlation between 6-gingerol and Antioxidant activity (DPPH)

STUDIES IN ZINGIBER OFFICINALE


4.9: Biochemical studies in EMS 8 hrs treatment:


The HPLC analysis was done for the quantification of

content of the control and irradiated material

highest 6-gingerol content (0.175%)

while lowest (0.16%) for

4.14). There was no definite trend observed

increase or decrease the concentrations.

Figure: 4.18: Chromatogram

0.15%, d:

ZINGIBER OFFICINALE ROSCOE Chapter IV: Results and Discussions


Biochemical studies in EMS 8 hrs treatment:

HPLC analysis was done for the quantification of 6

content of the control and irradiated materials of ginger (Figure: 4.1

gingerol content (0.175%) was detected in 0.10% EMS 8 hrs

for 0.15% and 0.25% EMS 8 hrs treated plants (Table

ere was no definite trend observed in content of 6-gingerol

increase or decrease the concentrations.

: Chromatogram, a: Control, b: EMS 8hrs 0.10%, c

EMS 8hrs 0.20% and e: EMS 8hrs 0.25%

(a)

(c)

(e)


Page No.: 83

6 – gingerol

18 a - e). The

EMS 8 hrs treatment

ed plants (Table

gingerol during

: EMS 8hrs

(b)

(d)




Flavonoid content was expressed in quercetin equivalent which was

highest (0.440gm/100gm dry weight equivalent) in 0.10% EMS 8 hrs treatment.

The range of flavonoid content varies from 0.255 gm/100gm dry weight of ginger

(0.25% EMS 8 hrs treatment) to 0.440 gm/100gm dry weight of ginger (0.10%

EMS 8 hrs treatment).


Phenolic content of the ginger treated with different concentrations of

EMS 8 hrs treatments were determined using Folin Ciocalteu method and the

results were expressed in tannic acid equivalent. Highest phenolic content (1.407

gm/100gm dry weight of ginger) was recorded for 0.10% EMS 8 hrs treatment

and lowest content (1.106 gm/100gm dry weight of ginger) was recorded in

0.25% EMS 8 hrs treatment (Figure: 4.19).


DPPH and FRAP method was used to measure antioxidant activity. The

highest activity was recorded in 0.10 % EMS 8 hrs treatment for both DPPH and

FRAPS (Table 4.14) while lowest in 0.25 % EMS 8 hrs treatment.



Table: 4.14 Effects of various concentrations of EMS 8 hrs treatments on 6 - gingerol, Flavonoid and Phenolic contents and DPPH and FRAP activity in ginger

EMS 8 hrs in % 6 - gingerol %

Flavonoida ±sd Phenolicb ±sd FRAPc ±sd DPPHd ±sd

Control 0.1657 0.323 0.000394 1.240 0.002 2.731 0.00377 1.493 0.00302

0.10 0.1775 0.440 0.001312 1.407 0.000 4.345 0.00000 2.045 0.00000

0.15 0.1600 0.291 0.000131 1.168 0.000 3.345 0.00436 1.862 0.00308

0.20 0.1700 0.297 0.000262 1.330 0.003 3.747 0.00436 2.013 0.00534

0.25 0.1600 0.255 0.000131 1.106 0.002 1.573 0.00000 1.372 0.00000





Figure: 4.19 Effects of various concentrations of EMS 8 hrs treatments on 6 - gingerol, Flavonoid and Phenolic contents in gm/100 gm of dry weight and

DPPH and FRAP activity in Mm.

4.10: Correlations between biochemical parameters in various

concentrations of EMS 8 hrs treatments:

All the correlations were of positive R values (Figure 4.20 a to j), which

are depicted in Table 4.15. Strong correlations were found between Gingerol and

Flavonoid (R2 = 0.982) followed by FRAP and DPPH (R2 = 0.901). The lowest

activity was recorded between flavonoid and FRAP (R2 = 0.301).

Table: 4.15 Correlations between different biochemical traits in various

concentrations of EMS 8 hrs treated plants

Correlations P value Remark R2 value Flavonoid vs Phenolics >0.05 Not significant 0.880 Flavonoid vs FRAP <0.001 Extremely significant 0.301 Flavonoid vs DPPH <0.001 Extremely significant 0.589 Phenolics vs DPPH <0.001 Extremely significant 0.599 DPPH vs FRAP <0.01 Significant 0.901 6 -gingerol vs Flavonoid >0.05 Not significant 0.982 6- gingerol vs FRAP <0.001 Extremely significant 0.731 6 -gingerol vs Phenolics >0.05 Not significant 0.755 6- gingerol vs DPPH <0.001 Extremely significant 0.457 Phenolics vs FRAP <0.001 Extremely significant 0.689

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

Control 0.1 0.15 0.2 0.25

EMS 8 hrs treatments




Figure: 4.20 Correlations between biochemical parameters in various

concentrations of EMS 8 hrs treatments

R² = 0.880

0.60.70.80.9

11.11.21.31.41.5

0.2 0.25 0.3 0.35 0.4 0.45 0.5

g/10

0g T

anni

c ac

id e

q.



R² = 0.301

500100015002000250030003500400045005000

0.2 0.25 0.3 0.35 0.4 0.45 0.5

µM A

scor

bic

eq.



R² = 0.433

500100015002000250030003500400045005000

1 1.1 1.2 1.3 1.4 1.5

µM A

scor

bic

eq.


(c) Correlation between Phenolics and Antioxidant (FRAP)

R² = 0.589

500700900

1100130015001700190021002300

0.2 0.25 0.3 0.35 0.4 0.45 0.5

µM A

scor

bic

eq.


(d) Correlation between Flavonoid and Antioxidant (DPPH)

R² = 0.599

500700900

1100130015001700190021002300

1 1.1 1.2 1.3 1.4 1.5

µM A

scor

bic

eq.


(e) Correlation between Phenolics and Antioxidant (DPPH)

R² = 0.901

500700900

1100130015001700190021002300

750 1750 2750 3750 4750

µM A

scor

bic

eq.


(f) Correlation between Antioxidant tests: FRAP and DPPH

R² = 0.982

0.00

0.10

0.20

0.30

0.40

0.50

0.15 0.155 0.16 0.165 0.17 0.175 0.18

g/10

0g Q

uerc

etin

eq.

% Gingerol

(g) Correlation between 6-gingerol and Flavonoid content

R² = 0.755

0.80

0.90

1.00

1.10

1.20

1.30

1.40

1.50

0.15 0.155 0.16 0.165 0.17 0.175 0.18

g/10

0g T

anni

c ac

id e

q.

% Gingerol

(h) Correlation between 6 -ingerol and Phenolic content

R² = 0.689

0

1000

2000

3000

4000

5000

0.15 0.155 0.16 0.165 0.17 0.175 0.18

µM A

scor

bic

acid

eq.

% Gingerol

(i) Correlation between 6 -gingerol and Antioxidant activity (FRAP)

R² = 0.457

1000120014001600180020002200

0.15 0.155 0.16 0.165 0.17 0.175 0.18

µM A

scor

bic

acid

eq.

% Gingerol

(j) Correlation between 6 -gingerol and Antioxidant activity (DPPH)



4.11: Biochemical studies in Gamma rays


Evaluation of 6

materials of ginger was done by HPLC.

gingerol content (pungent principle) of ginger

(Figure: 4.21 a-g). The concentration of 6

doses increased. The highest 6

KR Gamma rays treatment

treated plants (Table 4.16)

Figure: 4.21 Chromatograms: a

Gamma rays 0.250 KR d

f: Gamma rays 0.750


Cytogenetics and Plant Breeding | Page No.:

Biochemical studies in Gamma rays induced mutations:

Evaluation of 6 – gingerol content of the control and gamma

of ginger was done by HPLC. The effect of gamma radiation on the 6

gingerol content (pungent principle) of ginger was shown in Chromatograms

. The concentration of 6-gingerol continued to decrease as the

doses increased. The highest 6-gingerol content (0.19%) was detected in

treatment while lowest (0.12%) was in 1 KR gamma rays

(Table 4.16).

Chromatograms: a: Control, b: Gamma rays 0.125

KR d: Gamma rays 0.375KR, e: Gamma rays 0.500

amma rays 0.750 KR and g: Gamma rays 1 KR

(a)

(c)


Page No.: 88

gamma irradiated

of gamma radiation on the 6-

Chromatograms

gingerol continued to decrease as the

was detected in 0.250

while lowest (0.12%) was in 1 KR gamma rays

amma rays 0.125 KR c:

amma rays 0.500 KR,

(b)

(d)




Flavonoid content was expressed in Quercetin equivalent

0.334gm/100gm dry weight equivalent in control. The range of flavonoid content

of gamma rays doses varies from 0.197 to 0.311 gm/100gm of dry weight of

ginger which was low as compare to control. The content of flavonoid decreases

as dose increases (Figure:


The total phenolic content of irradiated and non

ginger was determined using the Folin

expressed as mg equivalents of

Table – 4.16. The phenolic content of the control (non

found to be 1.240 gm/100gm of dry weight.

total phenolic content showed

the dose increases. The highest total phenolic content (1.303 gm/100gm of dry

weight) found in 0.250KR treatment while lowest (0.853 gm/100gm of dry

weight) was in 1KR treatment.

from either the synthesis of new aromatic compounds (Nagieb, 1979) and/or the

acceleration of the accumulative phenol from the neighboring cells (Tomiyama,

1963).


Cytogenetics and Plant Breeding | Page No.:


Flavonoid content was expressed in Quercetin equivalent




ure: 4.22).

henolic content:

The total phenolic content of irradiated and non-irradiated samples of

was determined using the Folin–Ciocalteu phenol reagent. The results are

expressed as mg equivalents of Tannic acid/g dry weight of extract and given in

The phenolic content of the control (non-irradiated) sample was

found to be 1.240 gm/100gm of dry weight. For radiation-processed samples, the

showed initially increased and significantly



weight) was in 1KR treatment. This increase of phenolic compounds may result

m either the synthesis of new aromatic compounds (Nagieb, 1979) and/or the


(e)

(g)


Page No.: 89

Flavonoid content was expressed in Quercetin equivalent which was




irradiated samples of

Ciocalteu phenol reagent. The results are

ic acid/g dry weight of extract and given in

irradiated) sample was

processed samples, the

decreases as



This increase of phenolic compounds may result

m either the synthesis of new aromatic compounds (Nagieb, 1979) and/or the


(f)



Table: 4.16 Effects of various doses of gamma rays treatments on 6 - gingerol, Flavonoid and Phenolic contents and DPPH and FRAP activity in ginger

Dose (KR) 6 - gingerol %

Flavonoida ±sd Phenolicb ±sd FRAPc ±sd DPPHd ±sd

Control 0.17 0.334 0.00039 1.240 0.002 2.73092 0.00377 1.49313 0.00308 0.125 0.18 0.311 0.00035 1.275 0.000 3.00251 0 1.50559 0.00000 0.250 0.19 0.307 0.00035 1.303 0.001 3.69027 0.00218 1.66042 0.00000 0.375 0.18 0.310 0.00000 1.160 0.003 3.07040 0 1.61415 0.00308 0.500 0.18 0.289 0.00035 1.098 0.002 2.86797 0.00218 1.35966 0.00308 0.750 0.16 0.230 0.00013 0.897 0.001 2.97233 0 1.34008 0.00534 1.000 0.12 0.197 0.00023 0.853 0.001 2.24182 0.00218 1.28847 0.00308



STUDIES IN ZINGIBER OFFICINALE ROSCOE ChapterIV: Results and Discussions



The radical-scavenging activity of the irradiated and control ginger

samples were analyzed in methanol, using 1, 1-diphenyl-2-picrylhydrazyl radical

(DPPH) and FRAP. The reduction in the DPPH concentration is a measure of

scavenging activity. The highest activity was recorded in 0.250 KR of gamma

rays dose (Table 4.16) for both DPPH and FRAP while lowest in 1 KR of gamma

rays dose.

Figure: 4. 22 Effects of various doses of gamma rays treatments on 6 - gingerol, Flavonoid and Phenolic contents in gm/100gm of dry weight eq.

and DPPH and FRAP activity in Mm of ginger

4.12: Correlations between biochemical parameters in gamma rays

treatments:

Correlations between all the traits were positive (Figure 4.23 a to j) which

was depicted in table 4.17. Strong correlations was found between Phenolic and

Flavonoid (R2 = 0.880) followed by phenolic and DPPH (R2 = 0.703). The lowest

activity was recorded between flavonoid and FRAP (R2 = 0.301).

0

0.5

1

1.5

2

2.5

3

3.5

4

Control 0.125 0.25 0.375 0.5 0.75 1

Gamma rays in KR




Table: 4.17 Correlation between biochemical parameters of different gamma

rays treatments

Correlations P value Remark R2 value Flavonoid vs Phenolics >0.05 Not significant 0.880 Flavonoid vs FRAP <0.001 Extremely significant 0.301 Flavonoid vs DPPH <0.001 Extremely significant 0.589 Phenolics vs DPPH <0.001 Extremely significant 0.703 DPPH vs FRAP <0.001 Extremely significant 0.619 6-gingerol vs Flavonoid >0.05 Not significant 0.687 6-gingerol vs FRAP <0.001 Extremely significant 0.673 6-gingerol vs Phenolics >0.05 Not significant 0.684 6-gingerol vs DPPH <0.001 Extremely significant 0.545 Phenolics vs FRAP <0.001 Extremely significant 0.433

Figure: 4.23 Correlations between biochemical parameters in gamma rays

treatments:

R² = 0.880

0.600.700.800.901.001.101.201.301.40

0.15 0.2 0.25 0.3 0.35

g/10

0g T

anni

c ac

id e

q.



R² = 0.301

1100

1600

2100

2600

3100

3600

4100

0.15 0.2 0.25 0.3 0.35

µM A

scor

bic

eq.



R² = 0.589

1100

1200

1300

1400

1500

1600

1700

0.15 0.2 0.25 0.3 0.35

µM A

scor

bic

eq.

Flavonoids g/100g Quercetin eq.

(c) Correlation between Flavonoid and Antioxidant (DPPH)

R² = 0.703

1100

1200

1300

1400

1500

1600

1700

0.700 0.900 1.100 1.300 1.500

µM A

scor

bic

eq.


(d) Correlation between Phenolics and Antioxidant (DPPH)



There is no information available in the literature on the effects of

ionizing radiations and chemical mutagens on the phenolic content of ginger.

However, for other plant materials, diverse effects of radiation on the phenolic

content have been reported. Variyar et al. (1998) found increased amounts of

phenolic acids in irradiated cloves and nutmeg. The difference in the effect of

radiation on total phenolic content may be due to plant type, geographical and

environmental conditions, state of the sample (solid or dry), phenolic content

composition, extraction solvent, extraction procedures, temperature, dose of

gamma irradiation, etc.

The results obtained in the present investigations are in agreement with

the results observed by Sadowska (1975) in Peppermint. The results are in

conformity with Hegnauer (1975) and Levy (1982). They reported induced

mutations have resulted in significant changes in secondary metabolite. There is

evidence that mutagens (radiations) stimulate the metabolic activity of plants

R² = 0.619

1100

1200

1300

1400

1500

1600

1700

2000 2500 3000 3500 4000

µM A

scor

bic

eq.


(e) Correlation between Antioxidant tests: FRAP and DPPH

R² = 0.687

0.000.050.100.150.200.250.300.350.40

0.10 0.12 0.14 0.16 0.18 0.20

g/10

0g Q

uerc

etin

eq.

% Gingerol

(f) Correlation between 6-gingerol and Flavonoid content

R² = 0.673

0500

1000150020002500300035004000

0.10 0.12 0.14 0.16 0.18 0.20

µM A

scor

bic

acid

eq.

% Gingerol

(g) Correlation between 6-gingerol and Antioxidant activity (FRAP)

R² = 0.684

0.0000.2000.4000.6000.8001.0001.2001.400

0.10 0.12 0.14 0.16 0.18 0.20

Phe

nolic

g/1

00g

Tan

nic

acid

eq

.

% Gingerol

(h )Correlation between 6-gingerol and Phenolic content

R² = 0.545

0200400600800

10001200140016001800

0.10 0.12 0.14 0.16 0.18 0.20

µM A

scor

bic

acid

eq.

% Gingerol

(i) Correlation between 6-gingerol and Antioxidant activity (DPPH)

R² = 0.433

1100120013001400150016001700

0.700 0.900 1.100 1.300 1.500FR

AP

µM

Asc

orbi

c eq

.


(j) Correlation between Phenolics and Antioxidant (FRAP)



such as respiration (Romani, 1966), glycolysis and oxidative phosphorylation

(Mergen and Johnson, 1964) and cytochrome oxidase and catalase activity

(Goldon, 1957) which may ultimately influence and enhance synthesis of plant

products (Kaul et al., 1973).

4.13: Callus induction studies:

Callus induction was observed in the three explants viz. leaf, rhizome and

pseudostem (Plate: VI a to c respectively) on MS basal medium supplemented

with various concentrations and combinations of 2, 4-D and NAA. There was a

wide range of variation in percentage of callus induction (Table 4.18). 2, 4-D

alone in all the concentrations tried (1.5 – 3.5 mg/l), was effective in inducing

callus from rhizome explant and (2 - 3.5 mg/l) from pseudo stem and leaf. The

positive response for rhizome explant was recorded on MS medium

supplemented with 2, 4-D (2.5 mg/l) with 60 % callusing. For the leaf and pseudo

stem explant 2, 4-D (2.5 mg/l) induced callus 30% and 35% respectively.

However, 2, 4-D had no effect on callus induction when used in concentration

above 3.5 mg/l (Table 4.18) NAA 2.5 mg/l had an average callusing 35% for

rhizome explant and 25% for leaf and pseudo stem explant. NAA had no effect

on callus induction when used in concentrations below 1.5 mg/l but induced

callus when used in concentrations above 2 mg/l. Of the different growth

regulator tested, 2, 4-D was found to give good callus growth in ginger. This is in

agreement with observations reported by Nirmal Babu et al. (1992) and Kacker et

al. (1993). Application of different media such as MS, ½ MS, 1/3 MS and ¼ MS

with different concentrations of IAA, IBA and NAA did not produce satisfactory

results (Jabbarzadeh and Khosh-Khui, 2005). Callus induction in ginger was

reported by various workers (Pillai and Kumar, 1982, Sakamura and Suga, 1989,

Choi, 1991, Malamug, et al. 1991, Kacker, et al. 1993, Ilahi and Jabeen, 1992

and Samsudeen, 1996). Nirmal Babu (1997) revealed that callus can be

successfully grown from vegetative bud, young leaf, ovary, and anther tissues.



Table: 4.18 Effects of different concentrations of growth regulators on induction of callus in Ginger

Sr. No. Medium combination

Percentage of Callus for

rhizome (After 45

days)

Percentage of Callus for Leaf (After

45 days)

Percentage of Callus for pseudo-stem

(After 45 days)

1 M. S. + 2, 4- D 1 mg/l Nil Nil Nil 2 M. S. + 2, 4- D 1.5 mg/l 15% Nil Nil 3 M. S. + 2, 4- D 2 mg/l 45% 15% 15% 4 M. S. + 2, 4- D 2.5 mg/l 60% 30% 35% 5 M. S. + 2, 4- D 3 mg/l 40% 15% 25% 6 M. S. + 2, 4- D 3.5 mg/l 10% 5% 15% 7 M. S. + 2, 4- D 4 mg/l Nil Nil Nil 8 M. S. + 2, 4- D 4.5 mg/l Nil Nil Nil 9 M. S. + NAA 1 mg/l Nil Nil Nil

10 M. S. + NAA 1.5 mg/l Nil 5% Nil 11 M. S. + NAA 2 mg/l 25% 10% 15% 12 M. S. + NAA 2.5 mg/l 35% 25% 25% 13 M. S.+ NAA 3 mg/l 30% 20% 20% 14 M. S.+ NAA 3.5mg/l 15% Nil 10% 15 M. S.+ NAA 4 mg/l Nil Nil Nil

Figures in table indicate response of 20 replicates

4.14: Micropropagation studies :

One of the main objectives of micropropagation is the establishment of

plants or clones that are uniform and predictable of selected qualities.

Sterilization efficiency:

Since the explants were taken from underground rhizomes, establishment

of aseptic culture was a major task. High rate of contamination in cultures was

reported when rhizomes or vegetative buds are used for micropropagation.

Standard methods of aseptic culture of plant tissues and organs were

followed in the present studies. Mercuric chloride (0.1%) solution a commonly

used sterilizing agent was tried in present study. The efficiency of this sterilizing

agent was obtained for axillary buds of rhizome (9 minutes of exposed period);

for leaves (2 minutes of exposed period) and pseudo stem (4 minutes of exposed

period). It was observed that rainy season favors the increased rate of

contamination.



Among the different cytokinins used, BA was found to be most effective

for shoot induction and subsequent shoot multiplication, as compared with

kinetin. BA at the concentrations used (0.5 mg/l to 3.5 mg/l) exhibited 65-90%

frequency of shoot induction (Table 4.19). The frequency of response increased

to 90% with an average of 6.35 shoots per shoot explant when BA (2 mg/l) was

used. As the concentration of BA increased, it was found that the average

number of shoots also increased. The optimum shoot number recorded was 6.35

in the concentration of MS + BA2.0 mg/l (Plate: VI- e), which was found to

decrease further, when still higher concentrations of BA were used. The mean

root number ranged from 1.61 to 2.94 per shoot explant. The highest average root

number (2.94) was recorded in the 2 mg/l of BA concentration. In case of Kn it

was maximum (2.72) for 2.5mg/l concentration.

The percent shoot induction range for different concentrations of Kn (1mg

to 3.5mg/l) was 70 to 85%. Average shoots number was highest (5.44) for Kn

2.5mg/l concentration (Plate: VI - f). With increase in concentrations of Kn but

below the optimum level i.e. 2.5 mg/l the number of shoot increased. Present

investigation indicated that increasing concentrations of BA from 0.5 to a

maximum level of 3.5mg/l was responsible for shoot multiplication (Figure;

4.24). Bhagyalakshmi and singh (1988) obtained 4.0 shoots/explant of ginger on

MS medium fortified with BA at 1 mg/l. Such type of simultaneous production of

shoot and roots were reported earlier for a few species of Zingiberaceae by

Kuruvinashetty et al. (1982); Balachandran et al. (1990) and Borthakur and

Bordoloi (1992). Establishment of aseptic cultures was difficult in ginger, but

once a healthy culture was established, there was no further contamination.

Similar findings were observed by earlier investigators with ginger (Hosoki and

Sagava, 1977 and Inden and Ashira, 1988).



Table: 4.19 Effects of different individual concentrations of growth

regulators on induction of shoots and roots in Ginger

Sr. No.

Medium combination

Percent response

Mean No. of shoots

Mean No. of roots

1. M. S. + BA 0.5mg/l 65 3.07 ±0.64 1.61 ±0.65 2. M. S. + BA 1mg/l 80 4.33 ±0.61 2.20 ±0.67 3. M. S. + BA 1.5mg/l 85 4.75 ±0.93 2.87 ±0.88 4. M. S. + BA 2mg/l 90 6.35 ±0.78 2.94 ±0.74 5. M. S. + BA 2.5mg/l 80 4.93 ±0.77 2.43 ±0.72 6. M. S. + BA 3mg/l 75 4.73 ±0.88 2.26 ±0.70 7. M. S. + BA 3.5mg/l 65 3.92 ±0.73 2.07 ±0.61 8. M. S. + Kin. 1mg/l 75 2.46 ±0.96 1.76 ±0.72 9. M. S. + Kin. 1.5mg/l 80 3.12 ±0.61 2.12 ±0.88 10. M. S. + Kin. 2mg/l 85 3.82 ±0.80 2.41 ±0.87 11. M. S. + Kin. 2.5mg/l 80 5.44 ±0.98 2.72 ±0.66 12. M. S. + Kin. 3mg/l 75 4.68 ±0.79 2.31 ±0.94 13. M. S. + Kin. 3.5mg/l 70 3.73 ±0.70 1.60 ±0.73


Figure: 4.24 Effects of different individual concentration of growth

regulators on induction of shoots and roots in Ginger

0102030405060708090100

012345678

1 2 3 4 5 6 7 8 9 10 11 12 13

Num

ber

Medium + PGR Sr. No. From Table 4.19Mean No. of shoots Mean No. of roots Percent response



The shoot and root response of the vegetative buds of ginger to various

concentrations and combinations of cytokinin and auxin is presented in Table

4.20. Shoot and root response were recorded after 45 days of culture on MS

supplemented with BAP, Kn and NAA at different concentrations. The highest %

response was noticed on M. S. + BA 2 + NAA 2.5 mg/l (90%) (Plate: VI- d and

g) and lowest on M. S. + Kn 2 + NAA 1mg/l (65%). The highest mean number of

shoots per explant was observed on MS supplemented with BA 2 + IAA 2.5 mg/l

which was 6.62 (Figure: 4.25) while lowest mean number of shoot on BA 2 +

IAA 1mg/l (3.62). During micropropagation, induction of both roots and shoots

in the same medium minimize the time taken for cloning considerably, which

eliminates the step of in vitro rooting and reduces the overall cost of

micropropagation. The highest mean number of roots per explant was observed

on M. S. + BA 2 + IAA 2.5 mg/l (5.06) and lowest was on M. S. + Kn 2 + NAA

1mg/l (2.38).

Our observations made in present studies are in agreement with the results

obtained by Nirmal Babu (1997), who tried MS basal medium supplemented with

auxin (NAA 0–4 mg/l) and cytokinin (BA 0–4 mg/1). Sakamura et al. (1986);

Charlwood et al. (1988) and Sakamura and Suga (1989) reported that BAP and

NAA combinations were best for shoot multiplication in ginger. The presence of

NAA at low concentrations resulted in good growth of culture, root induction,

and shoot multiplication and addition of BA at 2.5mg/l increased the multiple

shoot induction. BA alone at higher concentration (2.5mg/l) induced only

multiple shoots and rarely roots.



Table: 4.20 Effect of different combinations of growth regulators on

induction of shoots and roots in Ginger

Sr. No. Medium combination Percent

response Mean No. of

shoots Mean No. of roots

1 M. S. + BA 2 + IAA 1mg/l 70 3.64 ±0.92 2.85 ±0.66 2 M. S. + BA 2 + IAA 1.5 mg/l 75 4.86 ±0.74 3.80 ±0.67 3 M. S. + BA 2 + IAA 2 mg/l 85 5.70 ±0.98 4.64 ±0.86 4 M. S. + BA 2 + IAA 2.5 mg/l 80 6.62 ±0.80 5.06 ±0.77 5 M. S. + BA 2 + IAA 3 mg/l 70 5.07 ±0.73 3.28 ±0.72 6 M. S. + Kn 2 + IAA 1mg/l 75 4.00 ±0.75 2.53 ±0.63 7 M. S. + Kn 2 + IAA 1.5 mg/l 80 4.56 ±0.72 3.18 ±0.75 8 M. S. + Kn 2 + IAA 2 mg/l 80 5.06 ±0.77 4.06 ±0.68 9 M. S. + Kn 2 + IAA 2.5 mg/l 85 6.29 ±0.77 5.05 ±0.74

10 M. S. + Kn 2 + IAA 3 mg/l 80 5.00 ±0.73 3.43 ±0.72 11 M. S. + BA 2 + NAA 1mg/l 80 4.06 ±0.85 2.31 ±0.60 12 M. S. + BA 2 + NAA 1.5 mg/l 75 4.53 ±0.51 3.06 ±0.59 13 M. S. + BA 2 + NAA 2 mg/l 85 5.76 ±0.83 4.35 ±0.86 14 M. S. + BA 2 + NAA 2.5 mg/l 90 6.61 ±0.77 4.83 ±0.92 15 M. S. + BA 2 + NAA 3 mg/l 85 5.64 ±0.86 3.35 ±0.86 16 M. S. + BA 2 + NAA 3.5 mg/l 70 4.57 ±0.64 2.92 ±0.73 17 M. S. + Kn 2 + NAA 1mg/l 65 4.38 ±0.65 2.38 ±0.50 18 M. S. + Kn 2 + NAA 1.5 mg/l 80 4.68 ±0.60 3.06 ±0.68 19 M. S. + Kn 2 + NAA 2 mg/l 85 5.23 ±0.75 4.11 ±0.69 20 M. S. + Kn 2 + NAA 2.5 mg/l 85 6.47 ±0.87 4.41 ±0.87 21 M. S. + Kn 2 + NAA 3 mg/l 75 5.23 ±0.83 3.41 ±0.87




Figure: 4.25 Effect of different combination of growth regulator on

induction of shoots and roots in Ginger

4.15: Hardening and Acclimatization in Ginger:

Hardening and acclimatization are the crucial stages of tissue culture. In

the process of hardening, three different kinds of potting mixtures were tested for

the survival of the plants. During acclimatization, high relative humidity (85 –

90%) was maintained for the initial 20 to 30 days, and a single spray of a

commercial fungicide Bavistin (0.2 % w/v) was found effective for plantlets.

However, the humidity was reduced gradually for hardening and establishment of

plantlets. The survival rate of transplanted plantlets ranged from 70 to 95 percent

and the time taken for hardening was about 25 days in direct regenerated plants.

The different potting mixtures such as autoclaved garden soil, compost and sand

were used in variable proportions. In the present study, it was observed that the

potting mixture composing soil: sand: compost; (1:2:1) showed good response to

survival rate of the in vitro derived plants. This may probably be due to high sand

content in the mixture which favors the adequate aeration and growth of roots.

Furthermore, increasing the composition of sand (i.e. 1:3:1, 1:4:1 and 1:5:1) in

the potting mixture did not work in a positive way in terms of enhancement of

survival rate. The low survival percentage (55%) was observed in the mixture of

0102030405060708090100

0

1

2

3

4

5

6

7

8

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21

Num

ber

Medium + PGR Sr. No. From Table 4.20Mean No. of shoots Mean No. of roots Percent response



soil: sand: compost (2:1:1). This indicated that raising soil component in mixture

does not allow efficient plant survival. In the soil: sand: compost mixtures (2:2:1

and 1:1:1), the percent survival rate of in vitro derived plants was 75% and 60%

respectively. Micropropagated plants established ex vitro were uniform and

identical to donor plants with respect to growth characteristics and vegetative

morphology (Plate: VII).

Efficiency of high sand content for acclimatization was reported by Arya

et al. (2003) in Leptadenia reticulata, where they found that plants were well

established within 60 days of transplanting in the potting mixture of sand:

farmyard manure: soilrite (2:1:1). Similarly role of high humidity in course of

acclimatization was well documented in Eucalyptus camaldulensis (Kirdmanee et

al., 1996), where it has been observed that the plantlets favoured high humidity

during acclimatization as compared with low humidity exposure. Genetic nature

of the zingiberaceous crops that are conventionally propagated through vegetative

means was useful for in vitro grown plants of ginger for the hardening and

acclimatizing to the field conditions. Earlier studies in ginger and other

zingiberaceous crops like turmeric, cardamom, and Kaempferia support this view

(Hosoki and Sagawa, 1977; Nadgauda et al., 1980; Bhagyalakshmi and Singh,

1988 and Vincent et al., 1992). Nirmal Babu and coworker (1997, 1998 and

2000) mentioned that minimum three years was required for the in vitro grown

plant to develop into normal size rhizome comparable to that of mother plants.

This indicates that tissue-cultured plantlets cannot be directly used for

commercial cultivation.

4.16: Biochemical studies in tissue culture plants:


Using HPLC, callus, micropropagated rhizome and conventionally grown

rhizome were analysed for 6- gingerol content (Figure: 4.26 a - c). Which

revealed that concentration of 6-gingerol was three fold more (0.16%) in

conventionally grown ginger rhizome than callus (0.056) and about half (0.078)

in micropropagated plant rhizome (Table 4.21). Results are in accordance with

tissue cultural studies in Camptotheca acuminata by Sakato and Misawa (1974)

which yielded very less amount of Camptothecin from the suspension cultures.



Similarly, Wiedenfield et al. (

(2008) in shoot cultures of

Camptothecin. The in vitro

because, developing normal size

requires three year (Nirmal babu, 1997).

Figure 4.26: Chromatograms: a

OFFICINALE ROSCOE ChapterIV: Results and Discussions

of Cytogenetics and Plant Breeding | Page No.:

et al. (1997) in callus cultures of C. accuminata

hoot cultures of Ophiorrhiza rugosa has reported low amount of

in vitro grown rhizome has lowest 6- gingerol content

normal size of rhizome comparable to that of mother plants

requires three year (Nirmal babu, 1997).

Chromatograms: a: Conventional rhizome, b: Micropropagated

rhizome and c: callus.

(a)

(c)


Page No.: 102

C. accuminata and Roja

has reported low amount of

gingerol content

comparable to that of mother plants

: Micropropagated

(b)



Table 4.21: Activities of DPPH and FRAP and content of Phenolic,

Flavonoid and 6-gingerol

Particulars 6-

gingerol %

Total flavonoids g/100gm

Total phenols g/100gm

FRAP µM

DPPH µM

Conventional rhizome 0.165 1.422 1.578 2732.92 1493.13

sd ±0.003 ± 0.001 ±3.768 ±2.111 Micropropagated rhizome 0.078 0.772 0.790 1901.09 845.34

sd ±0.003 ±0.002 ±3.121 ±3.455 Callus 0.056 0.753 0.648 1680.31 720.76 sd ±0.001 ±0.001 ±2.892 ±1.784


Flavonoid content was expressed in Quercetin equivalent. Highest content

of flavonoid was in conventionally grown rhizome sample (1.44 gm/100gm of

dry weight) followed by micropropagated rhizome sample (0.77 gm/100gm of

dry weight) of plant tissue and lowest was in callus sample (0.75 gm/100gm of

dry weight) of plant tissue


The total phenolic content of conventionally grown rhizome, callus and

micropropagated rhizome of ginger was determined using the Folin–Ciocalteu

phenol reagent. The results are expressed as mg equivalents of Tannic acid/g dry

weight of plant tissue and given in Table – 4.21. The phenolic content of the

conventionally grown rhizome sample was found to be 1.57 gm/100gm of dry

weight. Lowest content was recorded in callus (0.648 gm/100gm of dry weight)

while in micropropagated grown rhizome had 0.79 gm/100gm of dry weight.

.


The radical-scavenging activity of conventionally grown, callus and

micropropagated ginger samples were analyzed in methanol, using 1, 1-diphenyl-

2-picrylhydrazyl radical (DPPH) and FRAP. The highest DPPH and FRAP

activity was recorded in conventionally grown plant while in micropropagated



plant it was 845.335 and 1901.09 µM Ascorbic acid eq. respectively. Lowest

antioxidant activity was recorded in callus sample. It was generally assumed that

dedifferentiated cultures proved to be less active as antioxidants (Grzegorczyk et

al., 2007). However, improved antioxidant activity was also observed in in vitro

cultures of Salvia officinalis and Rosmarinus officinalis compared to its field

grown plant materials by Grzegorczyk et al. (2007); Yesil-Celiktas et al. (2007)

and Shinde et al. (2010).

The trend of increase or decrease of all activities and content was same

for conventionally grown rhizome, micropropagated rhizome and callus (Figure:

4.27).

Figure: 4.27 Activities of DPPH and FRAP in mM and content of Phenol,

Flavonoid and 6- gingerol in %

0

0.5

1

1.5

2

2.5

3

6-gingerol Total Flavonoids

Total phenols FRAP activity DPPH activity

Conventional plant Callus Micropropagated plant



4.17: New Disease report:

Morphological observations:

The infected leaf material (Plate VIII- a to d) was collected from field and

inoculated on CDA and then kept for incubation for a week. The incubated plates

of fungal colonies were colorless to pale on the reverse side and covered with a

dense layer of dark brown-to-black conidial heads (Plate VIII- e and f). Conidia

were globose to subglobose (3.5 to 5.0 µm in diameter), dark brown to black, and

rough walled, when observed under microscope (Plate VIII- g and h).

Morphological characters showed close affinity towards Aspergillus, however,

for species and strain confirmation detailed molecular analysis was performed.

Molecular study:

16S rRNA of isolates was amplified and sequenced. Total number of 996

bases were searched and compared with different known Aspergillus species

obtained from GenBank (Table 4.22). Mismatches of this isolated strain (F. 1R)

showed close affinity towards Aspergillus niger, only base number 26 and 559

was different. On the basis of molecular studies it was confirmed that the newly

isolated strain was of Aspergillus niger.

Table 4.22: Comparison of isolated strain with other species

Sample No. Library Sequence Name %

Match

No. of bases

searched

Total mismatches

F.1R

NCBI Aspergillus niger

99.25 961 2

F.1R

NCBI A. carbonarius NRRL 4849

99.26 961 6

F.1R

NCBI A. carbonarius NRRL 346

99.26 961 8

F.1R

NCBI A. oryzae 99.23 961 8

F.1R NCBI A. heteromorphus 99.27 961 8



Phylogenetic tree:

Phylogenetic tree was generated by considering

Table 4.23. This phylogram showed close affinity (99.27%) of new strain of

Aspergillus niger (F. 1R) isolated from

heteromorphus. Taking consideration of distance matrix, new strain matches with

Aspergillus niger (99.25%), with

Aspergillus oryzae (99.23%).

Note: This phylogram

Table 4.24.

Table 4.2

Aspergillus niger GBD 1.Aspergillus.niger 2.A.carbonarius NRRL 48493.A.carbonarius NRRL 3464.A.oryzae 5.A.heteromorphus



Phylogenetic tree was generated by considering distance m

. This phylogram showed close affinity (99.27%) of new strain of

(F. 1R) isolated from Zingiber officinale

. Taking consideration of distance matrix, new strain matches with

(99.25%), with Aspergillus carbonarius (99.26%) and with

(99.23%).

m is generated from the distance matrix file presented

23: Distance Matrix of Aspergillus species

0.000 0.748 0.737 0.738 0.7660.748 0.000 0.727 0.761 0.778

4849 0.737 0.727 0.000 0.750 0.782346 0.738 0.761 0.750 0.000 0.772

0.766 0.778 0.782 0.772 0.0000.727 0.761 0.725 0.741 0.788


Page No.: 106

matrix file in

. This phylogram showed close affinity (99.27%) of new strain of

officinale with A.

. Taking consideration of distance matrix, new strain matches with

(99.26%) and with

esented in

0.766 0.727 0.778 0.761 0.782 0.725 0.772 0.741 0.000 0.788 0.788 0.000



Deposition of Strain at EMBL:

After confirmation of the strain as Aspergillus niger, sequence of the

linear genomic DNA of the strain was deposited at European Molecular

Biological Laboratory (EMBL). The details of the deposition were depicted

below.

EMBL Nucleotide Sequence Database

General Information

Primary Accession

#

AM941157

Accession # AM941157

SRS Entry ID EMBL:AM941157

Molecule Type linear genomic DNA

Sequence Length 996

Entry Division FUN (Fungi)

Entry Data Class STD (Standard)

Sequence Version AM941157.1

Creation Date 20-AUG-2008

Modification Date 20-AUG-2008

EMBL-SVA AM941157

Description

Description Aspergillus niger partial 16S RNA gene, isolated from

Zingiber officinale Roscoe

Keywords --

Organism Aspergillus niger

Organism

Classification

Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;

Eurotiomycetes; Eurotiomycetidae; Eurotiales;

Trichocomaceae; mitosporic Trichocomaceae; Aspergillus.

References

1. Pawar,N.V.; Submitted (02-FEB-2008) to the

EMBL/GenBank/DDBJ databases. Pawar N.V.,

Department of Botany, Shivaji University, Kolhapur

http://www.ebi.ac.uk/cgi-bin/sva/sva.pl?query=AM941157&search=Go&snapshot=



(M.S.), 416 004, INDIA.

Position 1-996

2. Pawar, N.V.; Patil,V.B.; Dixit,G.B.; Kamble,S.S.;

New report of Aspergillus niger

Unpublished.

Features

Key Location Qualifier Value

source 1..996 organism Aspergillus niger

host Zingiber officinale

Roscoe

mol_type genomic DNA

tissue_type leaf

db_xref taxon:5061

rrna <1..>996 gene 16S rRNA

product 16S ribosomal RNA

Sequence

Characteristics Length: 996 BP, A Count: 205, C Count: 321, G Count:

257, T Count: 213, Others Count:0

Sequence >embl|AM941157|AM941157 Aspergillus niger partial 16S RNA gene, isolated from Zingiber off icinale Roscoe ...aagactccccaccctcccgttcgctttcactgcgcgcacgggtttgacacccgaacactcgcgtagatgttagactccttggtcccgtgtttcaagacgggtcgtttacgaccattatgccagcgtccgtgccgaagcgcgttcctcggtccaggctggccgcattgcacccctggctataaggtgccccggagggcactacattccaggggcctttgaccggccgcccaaaccgacgctggcccgcccacggggaagtacaccggcacgaatgccggctgaaccccgcgggcgagtctggtcgcaagcgcttccctttcaacaatttcacgtgctgtttaactctcttttcaaagtgcttttcatctttcgatcactctacttgtgcgctatcggtctccggccagtatttagctttagatgaaatttaccaccccctttagagctgcattcccaaacaactcgactcgtcgaaggagctttacacgggcacggacaccccgcccaagacgggattctcaccctctctgacggcccgttccagggcacttagacgggggccgcacccaaagcatcctctgcaaattacaatgcggactccgaaggagccagctttcaaatttgagctcttgccgcttcactcgccgttactgaggcaatcccggttggtttcttttcctccgcttattgatatgcttaagttcagcgggtatccctacctgatccgaggtcaacctggaaagaatggttggaaaacgtcggcaggcgccggccaatcctacagagcatgtgacaaagccccatacgctcgaggatcggacgcggtgccgccgctgcctttcgggcccgtccccccggagagggggacggcgacccaacacacaagccgggcttgagggcagcaatgacgctcggacaggcatgccccccggaataccagggggcgcaatgtgcgttcaaagactcgatgatcactgaatctcatccgctaaaggg

http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-id+tL8s1a46vx+-e+%5bEMBL_features:AM941157_1%5d

http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-id+tL8s1a46vx+%5btaxonomy-ID:5061%5d+-e

http://srs.ebi.ac.uk/srsbin/cgi-bin/wgetz?-id+tL8s1a46vx+-e+%5bEMBL_features:AM941157_2%5d



The deposited sequence and other relevant sequence from NCBI were

used for the construction of phylogenetic tree, which was constructed by the

Neighbor-Joining method; the sequences have been retrieved from NCBI

database, showing the phylogenetic relationships of Aspergillus niger strain GBD

and other species of genus Aspergillus. Numbers at nodes shows the level of

bootstrap support based on data for 1000 replication. Bar, 0.01 substitutions per

nucleotide position and numbers in bracket represent GenBank accession

numbers.

The evolutionary history was inferred using the Neighbor-Joining method

(Saitou and Nei, 1987). The bootstrap consensus tree inferred from 1000

replicates was taken to represent the evolutionary history of the taxa analyzed

(Felsenstein, 1985). Branches corresponding to partitions reproduced in less than

50% bootstrap replicates are collapsed. The percentage of replicate trees in which

Aspergillus nomius strain NRRL 6552



Aspergillus nomius








Aspergillus nomius strain NRRL 3353 (AF338643)

Aspergillus heteromorphus

Aspergillus carbonarius

Aspergillus bombycis strain NRRL 29253

Aspergillus niger CBS 513.88 (NW

Aspergillus carbonarius NRRL 346

Aspergillus oryzae RIB40

Aspergillus niger CBS 513.88 (NW

Aspergillus niger strain GBD

Aspergillus carbonarius NRRL 4849

4

3

2

1

3

3

5

0.01



the associated taxa clustered together in the bootstrap test (1000 replicates) was

shown next to the branches (Felsenstein, 1985). The phylogenetic tree was

linearized assuming equal evolutionary rates in all lineages (Takezaki et al.

2004). The clock calibration to convert distance to time was 0.01 (time/node

height). The tree is drawn to scale, with branch lengths in the same units as those

of the evolutionary distances used to infer the phylogenetic tree. The evolutionary

distances were computed using the Maximum Composite Likelihood method

(Tamura et al. 2004) and are in the units of the number of base substitutions per

site. Codon positions included were 1st+2nd+3rd+Noncoding. All positions

containing gaps and missing data were eliminated from the dataset (Complete

deletion option). There were a total of 910 positions in the final dataset.

Phylogenetic analyses were conducted in MEGA4 (Tamura, et al. 2007).

4.18: Ginger pests:

Leaf Roller/feeder: Udaspes folus Cram.

Classification:

It is one of the serious pests on the ginger. Lefroy (1906) recorded it as

ginger caterpillar, green in colour with a dark head. Generally larvae of Udaspes

folus found feeding on the leaves of ginger.

The eggs laid by butterflies hatched in May-June and the caterpillars

pupate in September – October. The caterpillar was about 10 mm and light

Kingdom : Animalia

Phylum : Arthtropoda

Class : Insecta

Order : Lepidoptera

Family : Hesperiidae

Subfamily : Hesperiinae

Genus : Udaspes

Species : folus



uniform leaf green color. Larvae of leaf roller cut and fold leaves and feed from

within. Five larval instars were observed. The total larval duration varied from 17

to 22 days. The pupa was long and cylindrical, watery green in color. The pupa

broadens towards the shoulders and the abdomen gradually tapers to the last

segment. Pupation occurred within the leaf roll, and the mean pupal duration was

7 days. The adults are medium sized butterflies about 13 mm with brownish

black wings with white spots; the larvae are dark green (Plate IX).

Shoot borer: Conogethes punctiferalis Guen.

Lefroy (1906) recorded this insect as a pest boring in to the castor capsule and

destroying them.

Classification:

Description:

The shoot borer is the most serious pest of ginger. Larvae are up to 20 mm

long and have a dark head and are grey-pink with darker oval spots on the body.

The adult is a medium sized moth with a wingspan of about 20 mm; the wings

are orange-yellow with minute black spots. Moths are 13 mm long and are bright

yellow-orange with black markings.

Larvae are similar to pink spotted bollworm larvae. The larvae bore into

pseudostems and feed on internal tissues resulting in yellowing and drying of

leaves of infested pseudostems (Plate X).

Kingdom : Animalia

Phylum : Arthtropoda

Class : Insecta

Order : Lepidoptera

Suborder : Heterocera

Family : Pyralidae

Genus : Conogethes

Species : punctiferalis



o The presence of a bore-hole on the pseudostem through which frauss is

extruded and the withered and yellow central shoot is a characteristic

symptom of pest infestation. o Fully-grown larvae are light brown with sparse hairs.

The pest population is higher in the field during September-October. The

shoot borer is ginger’s most serious pest, especially in India, but little information

is available on its distribution in various areas in the country (Ravindran and

Nirmal Babu, 2004). Nybe, (2001) reported 23.6 to 25.0 percent of pseudostems

damaged by the pest at Kottayam and Idukki districts in Kerala (India). For

Maharashtra this is the first report of its occurance.

4.19: LC-MS/MS Analysis of Ginger wine:

The phenolic compounds were analyzed from ginger wine (Plate: XI) by

LC-MS/MS with electrospray ionization in positive polarity. The quantitation

was done using external calibration standards (5 points). 0.1% formic acid gave

better sample stability during the analysis and also the gradient conditions were

optimized in such a fashion to get the epimer separately. In some cases there was

matrix interference peaks observed those were separated by chromatographically

by using gradient mobile phase. The first transition was used for the quantitation

whereas second transition was used for the confirmation. The quantitation was

done by considering the S/N ratio 10 for the limit of quantitation and S/N ratio

was 3 for the limit of detection. Those compounds positively detected as per

above criteria were mentioned in Table 4.24. The chromatogram (Figure: 4.28 –

a) showed standard phenolic compounds with retention time and in

chromatogram 4.28 – b detailed account of phenolic compounds present in ginger

wine with retention time was depicted. During the process of wine preparation

significant changes took place in the composition and content of phenolic

compounds resulting from the process of fruit disintegration as well as wine

fermentation and ageing (Lopez et al., 2001).



Figure: 4. 28a: Chromatogram of standard phenolic and b



hromatogram of standard phenolic and b: Chromatogram

of ginger phenolic


Page No.: 113

Chromatogram



Ginger wine contained different polyphenolic compounds at different

levels. The detailed account of all 17 compounds quantified in ginger wine was

depicted in Table 4.24.

Table 4.24: Different polyphenol compounds analyzed in ginger wine by LC MS

Analyte Peak Name Calc. Conc. (ng/ml) Analyte RT

Epicatechin -I 291.0 /123.0 313.00 7.06 Epicatechin -II 291.0 /139.0 310.00 7.06 Epicatechin -III 291.0 /165.0 313.00 7.06 Rutin hydrate -I 611.0 /303.0 113.00 7.35 Rutin hydrate -II 611.0 /465.0 129.00 7.34 Rutin hydrate -III 611.0 /85.0 106.00 7.36 Syringic acid -I 199.0 /155.0 259.00 7.21 Syringic acid -II 199.0 /123.0 226.00 7.22 Syringic acid -III 199.0 /77.0 207.00 7.21 Vanillic acid -I 169.0 /125.0 643.00 7.13 Vanillic acid -II 169.0 /93.0 505.00 7.15 Resvaratrol -I 229.0 /135.0 31.20 9.22 Resvaratrol -II 229.0 /107.0 81.90 9.17 Resvaratrol -III 229.0 /119.0 40.20 8.98 Catechin -I 291.0 /165.0 176.00 6.78 Catechin -II 291.0 /139.0 157.00 6.77 Catechin -III 291.0 /123.0 186.00 6.77

Among the polypheonls analyzed vanillic acid – I (643 ng/ml) found to be

most abundant followed by vanillic acid – II (505 ng/ml) and Resvaratrol – I

(31.20 ng/ml) was found in lowest amount (Figure: 4.29). Researches conducted

on the compositions of phenolics in wines, are generally focused on the

concentrations of resveratrol and anthocyanidins (Kallithraka et al., 2001;

Tsanova-Savova et al., 2002; Gambelli and Santaroni, 2004; Kolouchova et al.,

2004; Zhou et al, 2004; De Villiers et al., 2004; Villano et al., 2005 and Abril et

al., 2005).



Figure: 4.29: Content of phenolic compounds in ginger wine by LC

According to present

composition of phenolic compounds in ginger wine

contributes new knowledge of the composition of phenolic compounds by LC

MS in the ginger wines. Further studies, with a larg

necessary to confirm the differences observed.

4.20: General chemical Properties of ginger Wine

The chemical compositions of

samples were summarized in

sample was 7.5g/l tartaric acid equivalent,

was ranged from 5.7 to 7.6 g

acid equivalent for ginger wine. Grape wines

acid/l. The pH of grape wines

was 3.85.

Vanilic acid -II

Resvaratrol -I

Resvaratrol -II

Resvaratrol -III

Catechin -I

Catechin -II

Catechin



Content of phenolic compounds in ginger wine by LC

knowledge, there are no detailed data regarding the

composition of phenolic compounds in ginger wine. So this preliminary study

contributes new knowledge of the composition of phenolic compounds by LC

wines. Further studies, with a larger number of samples, are

necessary to confirm the differences observed.

General chemical Properties of ginger Wine:

l compositions of ginger wine alongwith other grape wine

summarized in Table 4.25. Total acid content in

tartaric acid equivalent, while for other grape wine

was ranged from 5.7 to 7.6 g of tartaric acid/l. Volatile acidity was 0.57 g/l acetic

acid equivalent for ginger wine. Grape wines ranged from 0.14 to 0.58

grape wines ranged from 3.3 to 3.8 while pH of ginger wine

0

100

200

300

400

500

600

700

Epicatechin -I

Epicatechin -II

Epicatechin -III

Rutin hydrate

hydrate

hydrate

Syringic acid -I

Syringic acid -II Syringic

acid -III Vanillic acid

-I

Vanilic acid

Catechin -III

Conc. in ng/ml


Page No.: 115

Content of phenolic compounds in ginger wine by LC-MS

knowledge, there are no detailed data regarding the

So this preliminary study

contributes new knowledge of the composition of phenolic compounds by LC-

er number of samples, are

ginger wine alongwith other grape wine

ginger wine

while for other grape wine samples it

olatile acidity was 0.57 g/l acetic

0.58 g of acetic

of ginger wine

Epicatechin

Rutin hydrate -I

Rutin hydrate -II

Rutin hydrate -III

Syringic

Conc. in ng/ml



Total SO2 content ranged from 45.9 to 246.5 mg/l in grape wines. Total

SO2 for the ginger wine was 12.28 mg/l. Free SO2 ranged from 12.3 to 96 mg/l in

grape wines, while for ginger wine it was 1.53mg/l. The results indicated that

ginger wine sample possess good quality of organoleptic properties.

During fermentation sugars were converted into alcohols. Quantity of

sugars was maintained by controlling the fermentation. Residual sugar was found

to be 4.23 g/l in ginger wine sample. The range of reducing sugar for grape wines

was from 3.48g/l to 11.91g/l.

Table 4.25:- Chemical Properties of ginger and grape wine samples

Sr.

No.

Name of Variety pH

TA

g/l (Tartaric acid eq.)

Volitile Acid

g/l (Acetic acid eq.)

Free

SO2

mg/l

Total

SO2

mg/l

Reducing Sugar

g/l

1 Ginger wine 3.85 7.5 0.57 1.53 12.28 4.23

2 Cabernet sauvignon

3.7 5.9 0.21 92.2 245.8 4.18

3 Shiraz 3.7 5.7 0.14 95 206.4 3.48

4 Zinfandel 3.6 7.1 0.58 96 240 11.91

5 Figueira Finest Ruby Port

3.6 6.6 0.16 96 213.3 5.18

6 Rose 3.4 6.4 0.17 90 246.5 5.49

7 Chennin Blanc

3.3 6.6 0.2 12.3 45.9 10.07

8 Sauvignon Blanc

3.6 7.6 0.23 27.6 79.9 7.88



Table 4.26: Bureau of Indian Standard (BIS) for wine

Sr.No. Charateristic Dry

White/Red Sweet

White/Red Sparkling

Wine Ginger

wine

1 Ethyl Alcohol 8 to 15.5 (%

by volume )

+-5

8 to 15.5 (%

by volume )

+-5

8 to 15.5 (%

by volume )

+-5

2.8%

2 Reducing residual

sugar, g/l

10 Max 10 to 150 100, Max 4.23

3 pH 3.0-4.0 3.0-4.0 3.0-4.0 3.85

4 Total Acids (as

tartaric acid), g/l,

Max

10.00 10.00 10.00 7.5

5 Volatile Acidity

expressed as acetic

acid, g/l, Max

1.0 1.0 1.0 0.57

6 Total sulphur

dioxide, mg/l, Max

250 250 250 12.28

7 Free sulphur

dioxide, mg/l, Max

100 100 100 1.53

All the chemical parameters used for the evaluation of the quality of

ginger wine found to be good and within the BIS range (Table 4.26) with respect

to its colour, pH, total acidity, volatile acidity, residual sugar and SO2. Therefore

ginger wine possessing good quality and suits for consumption.

Documents

Studies in Zingiber Officinale Roscoeshodhganga.inflibnet.ac.in/bitstream/10603/4030/12/12...STUDIES IN ZINGIBER OFFICINALE ROSCOE Laboratory of Cytogenetics and Plant Breeding Table: