DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al PD in Hong Kong Chinese

-acetyltransferase 2 genotype andNStrong association between

This information is current as of March 25 2003

httpwwwneurologyorgcontent6061002fullhtmllocated on the World Wide Web at

The online version of this article along with updated information and services is

0028-3878 Online ISSN 1526-632Xsince 1951 it is now a weekly with 48 issues per year Copyright All rights reserved Print ISSN

reg is the official journal of the American Academy of Neurology Published continuouslyNeurology

Strong association betweenN-acetyltransferase 2 genotype and PD

in Hong Kong ChineseDKY Chan MD MBBS FRACP FHKCP MKP Lam PhD R Wong BSc WT Hung PhD and

DEL Wilcken MD FRCP FRACP

AbstractmdashBackground The slow acetylator genotype for N-acetyltransferase 2 (NAT2 genotype) may be associated withPD in white subjects and the genotype is common in both white and Chinese populations Whether there is a relationshipbetween NAT2 genotype and PD in Chinese subjects is not known Objective To investigate the association between theslow acetylator genotype for N-acetyltransferase 2 and PD in a Chinese population Methods The authors obtained DNAsamples and documented sex age and smoking history in 99 Chinese patients with PD and in 126 control subjects fromtwo major Hong Kong hospitals PCRndashrestriction fragment length polymorphism was used to identify M1 M2 and M3mutant polymorphisms of the slow acetylator genotype for N-acetyltransferase 2 Logistic regression analyses were carriedout to investigate the relationships between the different variables and PD Results The frequency of the slow acetylatorgenotype for N-acetyltransferase 2 in the PD group was significantly higher than that of the control group (687 vs286) with an OR of 553 (95 CI 308 to 992) after adjusting for age sex and smoking history In a subgroup analysissmoking had no modifying effect on the association between genotype and PD Conclusions There is a significantassociation between PD and the slow acetylator genotype for N-acetyltransferase 2 in Hong Kong Chinese The OR foundis among the highest reported so far in all susceptibility gene studies for PD in both Chinese and white subjects andprovides evidence for a possible functional relationship between NAT2 slow acetylator genotype and PD in both racialgroups

NEUROLOGY 2003601002ndash1005

PD is a common neurodegenerative disorder affect-ing dopaminergic cells in the substantia nigral re-gion of the brain causing a deficiency of dopamine inthe CNS Despite intensive research the mechanismbehind the degeneration of these cells remains un-known in the majority of sporadic onset cases Thediscovery that drug users who have injected drugscontaminated by N-methyl-4-phenyl-1236-tetra-hydropyridine (MPTP) may develop a parkinsoniandisorder clinically identical to PD has cast some lighton the topic1 A model of PD resulting from failure ofxenobiotic metabolism has therefore been postulatedThe more commonly studied genes involved in xeno-biotic metabolism include CYP2D6 Many othergenes have been studied and a recent review summa-rizes these findings2

N-acetyltransferase 2 (NAT2) catalyzes the trans-fer of an acetyl group from the cofactor acetyl coen-zyme A to the amine nitrogen atom of aromaticamines and hydrazines The degree of activity of thisenzyme determines the rate of detoxification of aro-matic amines3 such as isoniazid The three mutantalleles M1 (contemporary nomenclature NAT25Aand NAT25B) M2 (NAT26A) and M3 (NAT27B)

account for most slow acetylators in humans4 Recentmeta-analyses have identified a significant but mod-est association of poor metabolizer genotype and PDin white subjects (OR 136)2 Whether this is thecase in Chinese subjects is unknown As previousinvestigations5-7 have found substantial differencesbetween Chinese and white patients in PD geneticpolymorphism association studies we therefore ex-plored the possibility of such a relationship in HongKong Chinese Because smoking may affect the ex-pression of genotypic relationship to PD8 we alsoundertook a subgroup analysis in smokers andnonsmokers

Methods Subject recruitment and diagnosis of PD We re-cruited only Chinese patients and controls in this study Therewere 99 patients with PD and 126 age-matched controls All thecases were collected by two major hospitals in Hong Kong (Princeof Wales and United Christian) PD cases were diagnosed by con-sultant neurologists or geriatricians based on the diagnostic crite-ria9 with supportive evidence of a good response to levodopaControl subjects were recruited from the same sources and exam-ined by neurologists or geriatricians to exclude parkinsonism Inthe selection of controls 10-year age group sex and locality (hos-pital catchment area) were taken into account to make the controlgroup as comparable with the PD group as possible

From the University of New South Wales (Drs Chan and Wilcken) and Department of Aged Care and Rehabilitation (Dr Lam) Bankstown HospitalBankstown Cardiovascular Genetics (Dr Wilcken) Prince of Wales Hospital (R Wong) Randwick New South Wales and Key University Research Strengthin Health Technology (Dr Hung) University of Technology Broadway New South Wales AustraliaSupported by Mr Jeffery and Mrs Maria Yip and Mrs Mabel HayesReceived September 11 2002 Accepted in final form December 2 2002Address correspondence and reprint requests to Dr Daniel Kam Yin Chan Professor of Medicine University of New South Wales Bankstown HospitalEldridge Rd Bankstown New South Wales 2200 Australia e-mail DanielChanswsahsnswgovau

1002 Copyright copy 2003 by AAN Enterprises Inc

Blood samples were obtained from patients with PD and con-trols Subjects also responded to a structured questionnaire aboutpotential risk factors for PD which included their smoking statusDepending on their responses all subjects were classified as ei-ther nonsmokers (those who have never smoked) or currentex-smokers (those who are currently smoking or those who haveceased smoking) The study was approved by the ethics committeeof the Chinese University of Hong Kong

Laboratory procedures After blood samples were obtainedfrom patients and controls genomic DNA was extracted from pe-ripheral blood lymphocytes using a salting out method10 NAT2genotype was analyzed by PCRndashrestriction fragment length poly-morphism for all 225 DNA samples The primer sequences usedfor the DNA amplification were forward primer (charscalex905GGAACAAATTGGACTTGG3) and reverse primer (charscalex905TCTAGCATGAATCACTCTGC 3) Each PCR contained 100 nggenomic DNA 10 pmol of each primer 200 M final concentrationfor each dNTP (Pharmacia Piscataway NJ) 25 L of 10X PCRBuffer (Pharmacia) 2 mM MgCl2 1 unit of Taq polymerase (Phar-macia) and double-distilled water to a final volume of 25 L Allreactions were performed on an omni thermal cycler The PCRconditions were 94 degC for 5 minutes followed by 35 cycles of 94 degCfor 30 seconds 56 degC for 30 seconds and 72 degC for 90 secondsfollowed by a final extension time of 5 minutes at 72 degC All PCRproducts were then digested with three different digestive en-zymes KpnI for M1 allele TaqI for M2 allele and BamHI for M3allele An aliquot of the PCR product was taken and digested byrespective restriction enzymes at 37 degC (for KpnI and BamHI) and65 degC (for TaqI) for 4 hours The restriction digests were thenseparated on 15 Trisborateethylenediaminetetraacetate (TBE)agarose gel (Gibco Carlsbad CA) stained with ethidium bromidefor 45 minutes and subsequently photographed under ultravioletlight

Determination of the slowfast acetylator genotypes forNAT2 Genotyping was performed on coded samples withoutknowledge of the parkinsonian status of the subjects Those withany two mutant alleles were identified as having a slow acetylatorgenotype for NAT2 whereas the presence of either one or twowild-type alleles defined the fast acetylator genotype for NAT2

Data analysis We used logistic regression analyses to calcu-late the adjusted OR and their corresponding 95 CI to examineassociations between the variables of interest and PD The vari-ables were sex age group (60 vs 60) smoking status (currentex-smoker vs nonsmoker) and NAT2 genotype (slow acetylator vsfast acetylator) Subgroup analysis by smoking status was alsoconducted to further examine the effect of smoking on the associ-ations between NAT2 genotype and PD

Results In total 99 patients with PD and 126 controls wererecruited for this study The mean age of the PD group was 717years (range 46 to 93) there were 60 men and 39 women Themean age of the control group which consisted of 63 men and 63women was 702 years (range 33 to 96) The two groups werecomparable for age and sex with no significant differences Onlythree patients with PD had a positive family history and therewas none in the control group Regarding the age at onset of PDonly four patients were 45 or younger at onset (one each at age 4544 41 and 40) and none was younger than 40

Table 1 shows the frequency of the wild-type allele and the

mutant alleles M1 M2 and M3 The overall frequencies of thefour alleles are different (2 796 df 3 p 00001)

The frequency of slow and fast acetylators in the PD and thecontrol groups was compared (table 2) The frequency of slowacetylators in the PD group was greatly increased compared tothat of the control group (687 vs 286 OR 548 95 CI 309 to974) After adjusting for the other three variables (sex age smok-ing status) the OR was 553 (95 CI 308 to 992) Smoking wasfound to have a near significant inverse association with PD (OR055 95 CI 027 to 112) after adjusting for all other variablesHowever the subgroup analysis by smoking status is consistentwith smoking having no modifying effect on the association be-tween NAT2 genotype and PD (currentex-smoker vs nonsmokerOR 807 [95 CI 350 to 1864] vs OR 371 [95 CI 161 to 859])but the numbers were small

Discussion This case-control study explored apossible relationship between NAT2 genotype andPD in a Chinese population Interestingly unlikeother negative studies of PD susceptibility genes inChinese we have found that a highly significant pro-portion of our patients with PD possess the slowacetylator genotype when compared to controls Thefrequency of the slow acetylator genotype in our con-trols was 286 which is in accordance with thereported frequency of 254 in healthy Chinese sub-jects11 Therefore the current finding is unlikely toresult from an underestimation of slow acetylatorgenotype in the control group Our finding that theslow NAT2 acetylator frequency in Chinese is pre-dominantly due to a low frequency of the M1 geno-type has also been noted by others1213

The OR of 553 is very strong Association studiesrarely reach such a high OR Previous associationstudies of NAT2 genotype and PD among white pa-tients yielded variable results with a recent meta-analysis2 showing a weak albeit significantassociation (OR 136) The differences in intereth-nic distribution of fast and slow acetylator genotypesmay explain the contrasting OR In most white pop-ulations slow acetylator frequencies of 40 to 70have been reported compared to 10 to 30 amongAsians13 The lower frequency of slow acetylators inChinese may also explain the lower frequency of PDin this population

Smoking has been found to be protective against PDin many epidemiologic studies14-16 The risk of PD in

Table 1 Frequency distribution of wild-type allele and mutantalleles M1 M2 and M3

NAT2 alleles N Frequencies

WT 172 038

M1 51 011

M2 142 031

M3 85 019

Total 450 10

The overall frequency is different for the four alleles (Pearson2 796 df 3 p 00001)

Table 2 Frequency distributions and adjusted associationsbetween genotype and PD in cases and control subjects

Cases n 99n ()

Controlsn 126 n ()

Results OR(95 CI)

Genotype

Slow 68 (687)dagger 36 (286) 553 (308ndash992)Dagger

Fast 31 (313) 90 (714) 100

Smoking

Currentex-smoker

51 (520) 69 (548) 055 (027ndash112)

Nonsmoker 47 (480) 57 (452) 100

Adjusted for age and sexdagger Column percentagesDagger p 00001

March (2 of 2) 2003 NEUROLOGY 60 1003

persons who ever smoked is about half that of lifelongnonsmokers Different biologic hypotheses have beenput forward to explain this association Most focus onthe action of nicotine in inducing detoxifying enzymesand inhibiting bioactivating enzymes1718 Howevernone of these hypotheses is proven

In our analysis of a relatively modest number ofsubjects we have found a near significant inverseassociation of smoking and PD in Hong Kong Chi-nese (adjusted OR 055 CI 027 to 112) This nearsignificant association was attained after adjustingfor age and sex with major effect from sex adjust-ment Further subgroup analysis by smoking statusfailed to indicate any modifying effect of smoking onthe relationship between slow acetylator genotypeand PD Interestingly both current and ex-smokerswho possessed the slow acetylator genotype were athigher risk for PD compared to those who were fastacetylators (OR 807 CI 35 to 186) This finding isin contrast to the concept that smoking generallyprotects against PD but could explain some varia-tions reported in the literature of the relationshipbetween smoking and PD Differences in susceptibil-ity genes for PD between white and Chinese subjectsare also of interest and table 3 provides a summaryof the comparison for some selected susceptibilitygenes These differences should be taken into ac-count when generating hypotheses in relation to sus-ceptibility genes and PD

The finding of an association between slow acetyla-tor status and PD across different races underscoresthe need to establish the relevant pathophysiologicmechanisms One possible mechanism is that theslow acetylation of arylamines may lead to accumu-lation of toxic xenobiotics causing neuronal damagein the substantia nigral region However given thevery strong OR documented in the current studythere is a need to explore further the role of thisgenetic polymorphism in the pathogenesis of PD inChinese and white populations as there may be im-portant therapeutic implications

AcknowledgmentDaniel KY Chan planned the study and the protocol arrangedfor the collection of blood samples and clinical data and wrote thefirst draft Mary Lam contributed to interpretation of genotypingdata collation statistical analysis and revision of the draft RoseWong contributed to genotyping in conjunction with Mary LamWai Tak Hung contributed to statistical analysis of the dataDavid Wilcken was responsible for the genotyping and contributedto the revision and the writing of the final version of themanuscript

The authors thank the staffs of the United Christian Hospital andPrince of Wales Hospital in Hong Kong for collection of blood andDNA extraction and Prof Jean Woo Prof Richard Kay Dr CPPang Dr Man Fook Leung and Dr Ping Wing Ng for theirassessments of patients

References1 Langston JW Ballard P Tetrud JW et al Chronic parkinsonism in

humans due to a product of meperidine analog synthesis Science 1983219979ndash980

2 Tan EK Khajavi M Thornby JI et al Variability and validity of poly-morphism association studies in Parkinsonrsquos disease Neurology 200055533ndash538

3 Evans DA Survey of the human acetylator polymorphism in spontane-ous disorders J Med Genet 198421243ndash253

4 Lin H Han C-Y Lin B et al Slow acetylator mutations in the humanpolymorphic N-acetyltransferase gene in 786 Asians blacks Hispanicsand whites application to metabolic epidemiology Am J Hum Genet199352827ndash834

5 Chan DKY Woo J Ho SC et al Genetic and environmental risk factorsof Parkinsonrsquos disease in a Chinese population J Neurol NeurosurgPsychiatry 199865781ndash784

6 Mellick GD Buchanan D Silburn P et al The monoamine oxidase B(MAOB) gene GT repeat polymorphism and Parkinsonrsquos disease in aChinese population J Neurol 200024752ndash55

7 Leighton PW Le Couteur DG Pang CCP et al The dopamine trans-porter gene and Parkinsonrsquos disease in a Chinese population Neurology1997491577ndash1579

8 Checkoway H Franklin GM Costa-Mallen P et al A genetic polymor-phism of MAOB modifies the association of cigarette smoking and Par-kinsonrsquos disease Neurology 1998501458ndash1461

9 Maraganore D Harding AE Marsden CD A clinical and genetic studyof familial Parkinsonrsquos disease Mov Disord 19916205ndash211

10 Miller SA Dykes DD Polesky HF A simple salting out procedure forextracting DNA from human nucleated cells Nucleic Acids Res 1988161215

11 Xie HG Xu ZH Ou-Yang DS et al Meta-analysis of phenotype andgenotype of NAT2 deficiency in Chinese populations Pharmacogenetics19977503ndash514

12 Lu JF Cao XM Liu ZH et al Genetic analysis of N-acetyltransferasepolymorphism in a Chinese population Zhongguo Yao Li Xue BaoActaPharmacologica Sinica 199819347ndash351

Table 3 Comparison of findings of selected susceptibility genes for PD between Chinese and white subjects

Type of polymorphism No of studies Overall results OR (95 CI)

CYP2D6 (white) 13 Frequency of poor metabolizer higher in PD 136 (104ndash178)

CYP2D6 (Chinese) 2 Poor metabolizer frequency 1 NA

NAT2 (white) 7 Frequency of slow acetylators higher in PD 133 (108ndash162)

NAT2 (Chinesemdashthis study) 1 Frequency of slow acetylators higher in PD 553 (308ndash992)

MAOB (GT)n dinucleotide repeat (white) 4 Frequency of allele 188 bp higher in PD 258 (138ndash482)

MAOB (GT)n dinucleotide repeat (Chinese) 1 Not significant 077 (036ndash163)

MAOB G polymorphism (Chinese) 1 Significant 207 (112ndash381)

GSTT1 gene deletion (white) 4 Frequency of GSTT1 deletions higher in PD 134 (10ndash179)

GSTT1 gene deletion unknown in Chinese

A4336G at tRNAGlu gene (white) 7 Frequency of A4336G higher in PD 30 (11ndash82)

A4336G at tRNAGlu gene unknown inChinese

NA not applicable

1004 NEUROLOGY 60 March (2 of 2) 2003

13 Meyer UA Zanger UM Molecular mechanisms of genetic polymorphisms ofdrug metabolism Annu Rev Pharmacol Toxicol 199737269ndash296

14 Tanner C Loller W Gilley D et al Cigarette smoking alcohol drinkingand Parkinsonrsquos disease cross-cultural risk assessment Mov Disord1990511

15 Wang W Fang X Cheng S et al A case-control study on the environ-mental risk factors of Parkinsonrsquos disease in Tianjian China Neuroepi-demiology 199312209ndash218

16 Grandinetti A Morens D Reed D et al Prospective study of cigarettesmoking and the risk of developing idiopathic Parkinsonrsquos diseaseAm J Epidemiol 19941391129ndash1138

17 Fowler J Volkow N Wang G et al Inhibition of monoamine oxidase Bin the brains of smokers Nature 1196379733ndash736

18 Maggio R Riva M Vaglini F et al Nicotine prevents experimentalparkinsonism in rodents and induces striatal increase of neurotrophicfactors J Neurochem 1998712439ndash2446

Staging disease severity inpathologically confirmed cases of

frontotemporal dementiaM Broe PhD JR Hodges MD FRCP E Schofield BSc(Hons) CE Shepherd PhD JJ Kril PhD and

GM Halliday PhD

AbstractmdashObjective To devise a staging scheme for addressing the severity of atrophy in patients with pathologicallyproven frontotemporal dementia (FTD) and determine any relationship with clinical indices Methods Twenty-four cases withclinical and pathologic features of FTD were selected using standard inclusion and exclusion criteria from 125 dementia casescollected in Sydney Australia over an 85-year period Patterns of gross atrophy were determined in two coronal brain slicesReproducibility of a four-stage severity scheme was tested Nonparametric statistics were used to determine relationships be-tween the stage of atrophy and clinical indices (age at death duration from diagnosis and clinical severity at death) ResultsThe FTD cases studied could be reliably grouped ( 097) into four progressively severe stages of global atrophy Initialmild atrophy occurred in the orbital and superior medial frontal cortices and hippocampus (stage 1) progressed to involve theother anterior frontal regions temporal cortices and basal ganglia (stage 2) then involved all remaining tissue in these coro-nal slices (stage 3) until very marked atrophy was observed in all areas (stage 4) These stages correlated with disease dura-tion and clinical dementia severity lending validity to the progressive nature of the staging scheme Conclusions Theauthors have identified a reproducible staging system for the severity of gross atrophy in cases of FTD This staging schemeprovides the required framework to compare different research indices and determine correlates relating to time and diseaseprogression in FTDmdashinformation necessary to determine core disease processes and etiologic factors

NEUROLOGY 2003601005ndash1011

Frontotemporal dementia (FTD) is the second mostcommon neurodegenerative disease resulting in de-mentia in patients younger than 65 years1 Multipleneuropathologic changes underlie more homogenousclinical presentations of this disorder2-4 Current re-search on FTD has focused largely on pathogenesisclinical phenomenology and differentiation fromother dementia syndromes

Whereas there are reports documenting the clini-cal progression of FTD disorders in individual casesthe neuropathologic staging or progression of diseaseis poorly understood In other degenerative conditionsseverity staging of key pathologic indices has consider-ably advanced correlative studies and has proven to bean adequate surrogate for disease progression56 InFTD all cases demonstrate macroscopic changes in

frontal and anterior temporal regions23 with variableatrophy of other gray and white matter structures Wepresent a new schema for staging the severity of suchmacroscopic atrophy in order to understand the rela-tionship of this key neuropathologic feature to the clin-ical and pathologic disease processes

Methods Cases Cases were selected from a neuropathologicseries of 125 patients with dementia collected from a brain donorprogram in Sydney Australia between October 1993 and Febru-ary 2002 Only cases with full medical records detailing theirclinical history were included In particular we included patientswho underwent regular follow-up even after entry into nursinghome care The study was approved by the Human Ethics Com-mittees of the Universities of Sydney and New South WalesBrains were removed at autopsy (mean postmortem delay SDwas 18 17 hours range 2 to 72 hours) and the entire brainfixed by suspension in 15 buffered formalin for 2 weeks The

From the Centre for Education and Research on Ageing (Drs Broe Shepherd and Kril) Department of Medicine The University of Sydney MRC Cognitionand Brain Sciences Unit (Dr Hodges) Cambridge UK and Prince of Wales Medical Research Institute and the University of New South Wales (E Schofieldand Dr Halliday) Sydney AustraliaSupported by the National Health and Medical Research Council of Australia CES is a Rolf Edgar Lake Fellow of the University of SydneyReceived July 22 2002 Accepted in final form December 2 2002Address correspondence and reprint requests to Assoc Prof Glenda Halliday Prince of Wales Medical Research Institute Barker Street Randwick 2031Australia e-mail GHallidayunsweduau

Copyright copy 2003 by AAN Enterprises Inc 1005

DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al Chinese

-acetyltransferase 2 genotype and PD in Hong KongNStrong association between

This information is current as of March 25 2003

ServicesUpdated Information amp

httpwwwneurologyorgcontent6061002fullhtmlincluding high resolution figures can be found at

References

httpwwwneurologyorgcontent6061002fullhtmlref-list-1at This article cites 16 articles 8 of which you can access for free

Subspecialty Collections

kinsonismhttpwwwneurologyorgcgicollectionparkinsons_disease_parParkinsons diseaseParkinsonism

geneticshttpwwwneurologyorgcgicollectionassociation_studies_in_Association studies in genetics s

httpwwwneurologyorgcgicollectionall_movement_disorderAll Movement Disordersfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpwwwneurologyorgmiscaboutxhtmlpermissionsor in its entirety can be found online atInformation about reproducing this article in parts (figurestables)

Reprints

httpwwwneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

Blood samples were obtained from patients with PD and con-trols Subjects also responded to a structured questionnaire aboutpotential risk factors for PD which included their smoking statusDepending on their responses all subjects were classified as ei-ther nonsmokers (those who have never smoked) or currentex-smokers (those who are currently smoking or those who haveceased smoking) The study was approved by the ethics committeeof the Chinese University of Hong Kong

Laboratory procedures After blood samples were obtainedfrom patients and controls genomic DNA was extracted from pe-ripheral blood lymphocytes using a salting out method10 NAT2genotype was analyzed by PCRndashrestriction fragment length poly-morphism for all 225 DNA samples The primer sequences usedfor the DNA amplification were forward primer (charscalex905GGAACAAATTGGACTTGG3) and reverse primer (charscalex905TCTAGCATGAATCACTCTGC 3) Each PCR contained 100 nggenomic DNA 10 pmol of each primer 200 M final concentrationfor each dNTP (Pharmacia Piscataway NJ) 25 L of 10X PCRBuffer (Pharmacia) 2 mM MgCl2 1 unit of Taq polymerase (Phar-macia) and double-distilled water to a final volume of 25 L Allreactions were performed on an omni thermal cycler The PCRconditions were 94 degC for 5 minutes followed by 35 cycles of 94 degCfor 30 seconds 56 degC for 30 seconds and 72 degC for 90 secondsfollowed by a final extension time of 5 minutes at 72 degC All PCRproducts were then digested with three different digestive en-zymes KpnI for M1 allele TaqI for M2 allele and BamHI for M3allele An aliquot of the PCR product was taken and digested byrespective restriction enzymes at 37 degC (for KpnI and BamHI) and65 degC (for TaqI) for 4 hours The restriction digests were thenseparated on 15 Trisborateethylenediaminetetraacetate (TBE)agarose gel (Gibco Carlsbad CA) stained with ethidium bromidefor 45 minutes and subsequently photographed under ultravioletlight

Determination of the slowfast acetylator genotypes forNAT2 Genotyping was performed on coded samples withoutknowledge of the parkinsonian status of the subjects Those withany two mutant alleles were identified as having a slow acetylatorgenotype for NAT2 whereas the presence of either one or twowild-type alleles defined the fast acetylator genotype for NAT2

Data analysis We used logistic regression analyses to calcu-late the adjusted OR and their corresponding 95 CI to examineassociations between the variables of interest and PD The vari-ables were sex age group (60 vs 60) smoking status (currentex-smoker vs nonsmoker) and NAT2 genotype (slow acetylator vsfast acetylator) Subgroup analysis by smoking status was alsoconducted to further examine the effect of smoking on the associ-ations between NAT2 genotype and PD

Results In total 99 patients with PD and 126 controls wererecruited for this study The mean age of the PD group was 717years (range 46 to 93) there were 60 men and 39 women Themean age of the control group which consisted of 63 men and 63women was 702 years (range 33 to 96) The two groups werecomparable for age and sex with no significant differences Onlythree patients with PD had a positive family history and therewas none in the control group Regarding the age at onset of PDonly four patients were 45 or younger at onset (one each at age 4544 41 and 40) and none was younger than 40

Table 1 shows the frequency of the wild-type allele and the

mutant alleles M1 M2 and M3 The overall frequencies of thefour alleles are different (2 796 df 3 p 00001)

The frequency of slow and fast acetylators in the PD and thecontrol groups was compared (table 2) The frequency of slowacetylators in the PD group was greatly increased compared tothat of the control group (687 vs 286 OR 548 95 CI 309 to974) After adjusting for the other three variables (sex age smok-ing status) the OR was 553 (95 CI 308 to 992) Smoking wasfound to have a near significant inverse association with PD (OR055 95 CI 027 to 112) after adjusting for all other variablesHowever the subgroup analysis by smoking status is consistentwith smoking having no modifying effect on the association be-tween NAT2 genotype and PD (currentex-smoker vs nonsmokerOR 807 [95 CI 350 to 1864] vs OR 371 [95 CI 161 to 859])but the numbers were small

Discussion This case-control study explored apossible relationship between NAT2 genotype andPD in a Chinese population Interestingly unlikeother negative studies of PD susceptibility genes inChinese we have found that a highly significant pro-portion of our patients with PD possess the slowacetylator genotype when compared to controls Thefrequency of the slow acetylator genotype in our con-trols was 286 which is in accordance with thereported frequency of 254 in healthy Chinese sub-jects11 Therefore the current finding is unlikely toresult from an underestimation of slow acetylatorgenotype in the control group Our finding that theslow NAT2 acetylator frequency in Chinese is pre-dominantly due to a low frequency of the M1 geno-type has also been noted by others1213

The OR of 553 is very strong Association studiesrarely reach such a high OR Previous associationstudies of NAT2 genotype and PD among white pa-tients yielded variable results with a recent meta-analysis2 showing a weak albeit significantassociation (OR 136) The differences in intereth-nic distribution of fast and slow acetylator genotypesmay explain the contrasting OR In most white pop-ulations slow acetylator frequencies of 40 to 70have been reported compared to 10 to 30 amongAsians13 The lower frequency of slow acetylators inChinese may also explain the lower frequency of PDin this population

Smoking has been found to be protective against PDin many epidemiologic studies14-16 The risk of PD in

Table 1 Frequency distribution of wild-type allele and mutantalleles M1 M2 and M3

NAT2 alleles N Frequencies

WT 172 038

M1 51 011

M2 142 031

M3 85 019

Total 450 10

The overall frequency is different for the four alleles (Pearson2 796 df 3 p 00001)

Table 2 Frequency distributions and adjusted associationsbetween genotype and PD in cases and control subjects

Cases n 99n ()

Controlsn 126 n ()

Results OR(95 CI)

Genotype

Slow 68 (687)dagger 36 (286) 553 (308ndash992)Dagger

Fast 31 (313) 90 (714) 100

Smoking

Currentex-smoker

51 (520) 69 (548) 055 (027ndash112)

Nonsmoker 47 (480) 57 (452) 100

Adjusted for age and sexdagger Column percentagesDagger p 00001

March (2 of 2) 2003 NEUROLOGY 60 1003

persons who ever smoked is about half that of lifelongnonsmokers Different biologic hypotheses have beenput forward to explain this association Most focus onthe action of nicotine in inducing detoxifying enzymesand inhibiting bioactivating enzymes1718 Howevernone of these hypotheses is proven

In our analysis of a relatively modest number ofsubjects we have found a near significant inverseassociation of smoking and PD in Hong Kong Chi-nese (adjusted OR 055 CI 027 to 112) This nearsignificant association was attained after adjustingfor age and sex with major effect from sex adjust-ment Further subgroup analysis by smoking statusfailed to indicate any modifying effect of smoking onthe relationship between slow acetylator genotypeand PD Interestingly both current and ex-smokerswho possessed the slow acetylator genotype were athigher risk for PD compared to those who were fastacetylators (OR 807 CI 35 to 186) This finding isin contrast to the concept that smoking generallyprotects against PD but could explain some varia-tions reported in the literature of the relationshipbetween smoking and PD Differences in susceptibil-ity genes for PD between white and Chinese subjectsare also of interest and table 3 provides a summaryof the comparison for some selected susceptibilitygenes These differences should be taken into ac-count when generating hypotheses in relation to sus-ceptibility genes and PD

The finding of an association between slow acetyla-tor status and PD across different races underscoresthe need to establish the relevant pathophysiologicmechanisms One possible mechanism is that theslow acetylation of arylamines may lead to accumu-lation of toxic xenobiotics causing neuronal damagein the substantia nigral region However given thevery strong OR documented in the current studythere is a need to explore further the role of thisgenetic polymorphism in the pathogenesis of PD inChinese and white populations as there may be im-portant therapeutic implications

AcknowledgmentDaniel KY Chan planned the study and the protocol arrangedfor the collection of blood samples and clinical data and wrote thefirst draft Mary Lam contributed to interpretation of genotypingdata collation statistical analysis and revision of the draft RoseWong contributed to genotyping in conjunction with Mary LamWai Tak Hung contributed to statistical analysis of the dataDavid Wilcken was responsible for the genotyping and contributedto the revision and the writing of the final version of themanuscript

The authors thank the staffs of the United Christian Hospital andPrince of Wales Hospital in Hong Kong for collection of blood andDNA extraction and Prof Jean Woo Prof Richard Kay Dr CPPang Dr Man Fook Leung and Dr Ping Wing Ng for theirassessments of patients

References1 Langston JW Ballard P Tetrud JW et al Chronic parkinsonism in

humans due to a product of meperidine analog synthesis Science 1983219979ndash980

2 Tan EK Khajavi M Thornby JI et al Variability and validity of poly-morphism association studies in Parkinsonrsquos disease Neurology 200055533ndash538

3 Evans DA Survey of the human acetylator polymorphism in spontane-ous disorders J Med Genet 198421243ndash253

4 Lin H Han C-Y Lin B et al Slow acetylator mutations in the humanpolymorphic N-acetyltransferase gene in 786 Asians blacks Hispanicsand whites application to metabolic epidemiology Am J Hum Genet199352827ndash834

5 Chan DKY Woo J Ho SC et al Genetic and environmental risk factorsof Parkinsonrsquos disease in a Chinese population J Neurol NeurosurgPsychiatry 199865781ndash784

6 Mellick GD Buchanan D Silburn P et al The monoamine oxidase B(MAOB) gene GT repeat polymorphism and Parkinsonrsquos disease in aChinese population J Neurol 200024752ndash55

7 Leighton PW Le Couteur DG Pang CCP et al The dopamine trans-porter gene and Parkinsonrsquos disease in a Chinese population Neurology1997491577ndash1579

8 Checkoway H Franklin GM Costa-Mallen P et al A genetic polymor-phism of MAOB modifies the association of cigarette smoking and Par-kinsonrsquos disease Neurology 1998501458ndash1461

9 Maraganore D Harding AE Marsden CD A clinical and genetic studyof familial Parkinsonrsquos disease Mov Disord 19916205ndash211

10 Miller SA Dykes DD Polesky HF A simple salting out procedure forextracting DNA from human nucleated cells Nucleic Acids Res 1988161215

11 Xie HG Xu ZH Ou-Yang DS et al Meta-analysis of phenotype andgenotype of NAT2 deficiency in Chinese populations Pharmacogenetics19977503ndash514

12 Lu JF Cao XM Liu ZH et al Genetic analysis of N-acetyltransferasepolymorphism in a Chinese population Zhongguo Yao Li Xue BaoActaPharmacologica Sinica 199819347ndash351

Table 3 Comparison of findings of selected susceptibility genes for PD between Chinese and white subjects

Type of polymorphism No of studies Overall results OR (95 CI)

CYP2D6 (white) 13 Frequency of poor metabolizer higher in PD 136 (104ndash178)

CYP2D6 (Chinese) 2 Poor metabolizer frequency 1 NA

NAT2 (white) 7 Frequency of slow acetylators higher in PD 133 (108ndash162)

NAT2 (Chinesemdashthis study) 1 Frequency of slow acetylators higher in PD 553 (308ndash992)

MAOB (GT)n dinucleotide repeat (white) 4 Frequency of allele 188 bp higher in PD 258 (138ndash482)

MAOB (GT)n dinucleotide repeat (Chinese) 1 Not significant 077 (036ndash163)

MAOB G polymorphism (Chinese) 1 Significant 207 (112ndash381)

GSTT1 gene deletion (white) 4 Frequency of GSTT1 deletions higher in PD 134 (10ndash179)

GSTT1 gene deletion unknown in Chinese

A4336G at tRNAGlu gene (white) 7 Frequency of A4336G higher in PD 30 (11ndash82)

A4336G at tRNAGlu gene unknown inChinese

NA not applicable

1004 NEUROLOGY 60 March (2 of 2) 2003

13 Meyer UA Zanger UM Molecular mechanisms of genetic polymorphisms ofdrug metabolism Annu Rev Pharmacol Toxicol 199737269ndash296

14 Tanner C Loller W Gilley D et al Cigarette smoking alcohol drinkingand Parkinsonrsquos disease cross-cultural risk assessment Mov Disord1990511

15 Wang W Fang X Cheng S et al A case-control study on the environ-mental risk factors of Parkinsonrsquos disease in Tianjian China Neuroepi-demiology 199312209ndash218

16 Grandinetti A Morens D Reed D et al Prospective study of cigarettesmoking and the risk of developing idiopathic Parkinsonrsquos diseaseAm J Epidemiol 19941391129ndash1138

17 Fowler J Volkow N Wang G et al Inhibition of monoamine oxidase Bin the brains of smokers Nature 1196379733ndash736

18 Maggio R Riva M Vaglini F et al Nicotine prevents experimentalparkinsonism in rodents and induces striatal increase of neurotrophicfactors J Neurochem 1998712439ndash2446

Staging disease severity inpathologically confirmed cases of

frontotemporal dementiaM Broe PhD JR Hodges MD FRCP E Schofield BSc(Hons) CE Shepherd PhD JJ Kril PhD and

GM Halliday PhD

AbstractmdashObjective To devise a staging scheme for addressing the severity of atrophy in patients with pathologicallyproven frontotemporal dementia (FTD) and determine any relationship with clinical indices Methods Twenty-four cases withclinical and pathologic features of FTD were selected using standard inclusion and exclusion criteria from 125 dementia casescollected in Sydney Australia over an 85-year period Patterns of gross atrophy were determined in two coronal brain slicesReproducibility of a four-stage severity scheme was tested Nonparametric statistics were used to determine relationships be-tween the stage of atrophy and clinical indices (age at death duration from diagnosis and clinical severity at death) ResultsThe FTD cases studied could be reliably grouped ( 097) into four progressively severe stages of global atrophy Initialmild atrophy occurred in the orbital and superior medial frontal cortices and hippocampus (stage 1) progressed to involve theother anterior frontal regions temporal cortices and basal ganglia (stage 2) then involved all remaining tissue in these coro-nal slices (stage 3) until very marked atrophy was observed in all areas (stage 4) These stages correlated with disease dura-tion and clinical dementia severity lending validity to the progressive nature of the staging scheme Conclusions Theauthors have identified a reproducible staging system for the severity of gross atrophy in cases of FTD This staging schemeprovides the required framework to compare different research indices and determine correlates relating to time and diseaseprogression in FTDmdashinformation necessary to determine core disease processes and etiologic factors

NEUROLOGY 2003601005ndash1011

Frontotemporal dementia (FTD) is the second mostcommon neurodegenerative disease resulting in de-mentia in patients younger than 65 years1 Multipleneuropathologic changes underlie more homogenousclinical presentations of this disorder2-4 Current re-search on FTD has focused largely on pathogenesisclinical phenomenology and differentiation fromother dementia syndromes

Whereas there are reports documenting the clini-cal progression of FTD disorders in individual casesthe neuropathologic staging or progression of diseaseis poorly understood In other degenerative conditionsseverity staging of key pathologic indices has consider-ably advanced correlative studies and has proven to bean adequate surrogate for disease progression56 InFTD all cases demonstrate macroscopic changes in

frontal and anterior temporal regions23 with variableatrophy of other gray and white matter structures Wepresent a new schema for staging the severity of suchmacroscopic atrophy in order to understand the rela-tionship of this key neuropathologic feature to the clin-ical and pathologic disease processes

Methods Cases Cases were selected from a neuropathologicseries of 125 patients with dementia collected from a brain donorprogram in Sydney Australia between October 1993 and Febru-ary 2002 Only cases with full medical records detailing theirclinical history were included In particular we included patientswho underwent regular follow-up even after entry into nursinghome care The study was approved by the Human Ethics Com-mittees of the Universities of Sydney and New South WalesBrains were removed at autopsy (mean postmortem delay SDwas 18 17 hours range 2 to 72 hours) and the entire brainfixed by suspension in 15 buffered formalin for 2 weeks The

From the Centre for Education and Research on Ageing (Drs Broe Shepherd and Kril) Department of Medicine The University of Sydney MRC Cognitionand Brain Sciences Unit (Dr Hodges) Cambridge UK and Prince of Wales Medical Research Institute and the University of New South Wales (E Schofieldand Dr Halliday) Sydney AustraliaSupported by the National Health and Medical Research Council of Australia CES is a Rolf Edgar Lake Fellow of the University of SydneyReceived July 22 2002 Accepted in final form December 2 2002Address correspondence and reprint requests to Assoc Prof Glenda Halliday Prince of Wales Medical Research Institute Barker Street Randwick 2031Australia e-mail GHallidayunsweduau

Copyright copy 2003 by AAN Enterprises Inc 1005

DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al Chinese

-acetyltransferase 2 genotype and PD in Hong KongNStrong association between

This information is current as of March 25 2003

ServicesUpdated Information amp

httpwwwneurologyorgcontent6061002fullhtmlincluding high resolution figures can be found at

References

httpwwwneurologyorgcontent6061002fullhtmlref-list-1at This article cites 16 articles 8 of which you can access for free

Subspecialty Collections

kinsonismhttpwwwneurologyorgcgicollectionparkinsons_disease_parParkinsons diseaseParkinsonism

geneticshttpwwwneurologyorgcgicollectionassociation_studies_in_Association studies in genetics s

httpwwwneurologyorgcgicollectionall_movement_disorderAll Movement Disordersfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpwwwneurologyorgmiscaboutxhtmlpermissionsor in its entirety can be found online atInformation about reproducing this article in parts (figurestables)

Reprints

httpwwwneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

persons who ever smoked is about half that of lifelongnonsmokers Different biologic hypotheses have beenput forward to explain this association Most focus onthe action of nicotine in inducing detoxifying enzymesand inhibiting bioactivating enzymes1718 Howevernone of these hypotheses is proven

In our analysis of a relatively modest number ofsubjects we have found a near significant inverseassociation of smoking and PD in Hong Kong Chi-nese (adjusted OR 055 CI 027 to 112) This nearsignificant association was attained after adjustingfor age and sex with major effect from sex adjust-ment Further subgroup analysis by smoking statusfailed to indicate any modifying effect of smoking onthe relationship between slow acetylator genotypeand PD Interestingly both current and ex-smokerswho possessed the slow acetylator genotype were athigher risk for PD compared to those who were fastacetylators (OR 807 CI 35 to 186) This finding isin contrast to the concept that smoking generallyprotects against PD but could explain some varia-tions reported in the literature of the relationshipbetween smoking and PD Differences in susceptibil-ity genes for PD between white and Chinese subjectsare also of interest and table 3 provides a summaryof the comparison for some selected susceptibilitygenes These differences should be taken into ac-count when generating hypotheses in relation to sus-ceptibility genes and PD

The finding of an association between slow acetyla-tor status and PD across different races underscoresthe need to establish the relevant pathophysiologicmechanisms One possible mechanism is that theslow acetylation of arylamines may lead to accumu-lation of toxic xenobiotics causing neuronal damagein the substantia nigral region However given thevery strong OR documented in the current studythere is a need to explore further the role of thisgenetic polymorphism in the pathogenesis of PD inChinese and white populations as there may be im-portant therapeutic implications

AcknowledgmentDaniel KY Chan planned the study and the protocol arrangedfor the collection of blood samples and clinical data and wrote thefirst draft Mary Lam contributed to interpretation of genotypingdata collation statistical analysis and revision of the draft RoseWong contributed to genotyping in conjunction with Mary LamWai Tak Hung contributed to statistical analysis of the dataDavid Wilcken was responsible for the genotyping and contributedto the revision and the writing of the final version of themanuscript

The authors thank the staffs of the United Christian Hospital andPrince of Wales Hospital in Hong Kong for collection of blood andDNA extraction and Prof Jean Woo Prof Richard Kay Dr CPPang Dr Man Fook Leung and Dr Ping Wing Ng for theirassessments of patients

References1 Langston JW Ballard P Tetrud JW et al Chronic parkinsonism in

humans due to a product of meperidine analog synthesis Science 1983219979ndash980

2 Tan EK Khajavi M Thornby JI et al Variability and validity of poly-morphism association studies in Parkinsonrsquos disease Neurology 200055533ndash538

3 Evans DA Survey of the human acetylator polymorphism in spontane-ous disorders J Med Genet 198421243ndash253

4 Lin H Han C-Y Lin B et al Slow acetylator mutations in the humanpolymorphic N-acetyltransferase gene in 786 Asians blacks Hispanicsand whites application to metabolic epidemiology Am J Hum Genet199352827ndash834

5 Chan DKY Woo J Ho SC et al Genetic and environmental risk factorsof Parkinsonrsquos disease in a Chinese population J Neurol NeurosurgPsychiatry 199865781ndash784

6 Mellick GD Buchanan D Silburn P et al The monoamine oxidase B(MAOB) gene GT repeat polymorphism and Parkinsonrsquos disease in aChinese population J Neurol 200024752ndash55

7 Leighton PW Le Couteur DG Pang CCP et al The dopamine trans-porter gene and Parkinsonrsquos disease in a Chinese population Neurology1997491577ndash1579

8 Checkoway H Franklin GM Costa-Mallen P et al A genetic polymor-phism of MAOB modifies the association of cigarette smoking and Par-kinsonrsquos disease Neurology 1998501458ndash1461

9 Maraganore D Harding AE Marsden CD A clinical and genetic studyof familial Parkinsonrsquos disease Mov Disord 19916205ndash211

10 Miller SA Dykes DD Polesky HF A simple salting out procedure forextracting DNA from human nucleated cells Nucleic Acids Res 1988161215

11 Xie HG Xu ZH Ou-Yang DS et al Meta-analysis of phenotype andgenotype of NAT2 deficiency in Chinese populations Pharmacogenetics19977503ndash514

12 Lu JF Cao XM Liu ZH et al Genetic analysis of N-acetyltransferasepolymorphism in a Chinese population Zhongguo Yao Li Xue BaoActaPharmacologica Sinica 199819347ndash351

Table 3 Comparison of findings of selected susceptibility genes for PD between Chinese and white subjects

Type of polymorphism No of studies Overall results OR (95 CI)

CYP2D6 (white) 13 Frequency of poor metabolizer higher in PD 136 (104ndash178)

CYP2D6 (Chinese) 2 Poor metabolizer frequency 1 NA

NAT2 (white) 7 Frequency of slow acetylators higher in PD 133 (108ndash162)

NAT2 (Chinesemdashthis study) 1 Frequency of slow acetylators higher in PD 553 (308ndash992)

MAOB (GT)n dinucleotide repeat (white) 4 Frequency of allele 188 bp higher in PD 258 (138ndash482)

MAOB (GT)n dinucleotide repeat (Chinese) 1 Not significant 077 (036ndash163)

MAOB G polymorphism (Chinese) 1 Significant 207 (112ndash381)

GSTT1 gene deletion (white) 4 Frequency of GSTT1 deletions higher in PD 134 (10ndash179)

GSTT1 gene deletion unknown in Chinese

A4336G at tRNAGlu gene (white) 7 Frequency of A4336G higher in PD 30 (11ndash82)

A4336G at tRNAGlu gene unknown inChinese

NA not applicable

1004 NEUROLOGY 60 March (2 of 2) 2003

13 Meyer UA Zanger UM Molecular mechanisms of genetic polymorphisms ofdrug metabolism Annu Rev Pharmacol Toxicol 199737269ndash296

14 Tanner C Loller W Gilley D et al Cigarette smoking alcohol drinkingand Parkinsonrsquos disease cross-cultural risk assessment Mov Disord1990511

15 Wang W Fang X Cheng S et al A case-control study on the environ-mental risk factors of Parkinsonrsquos disease in Tianjian China Neuroepi-demiology 199312209ndash218

16 Grandinetti A Morens D Reed D et al Prospective study of cigarettesmoking and the risk of developing idiopathic Parkinsonrsquos diseaseAm J Epidemiol 19941391129ndash1138

17 Fowler J Volkow N Wang G et al Inhibition of monoamine oxidase Bin the brains of smokers Nature 1196379733ndash736

18 Maggio R Riva M Vaglini F et al Nicotine prevents experimentalparkinsonism in rodents and induces striatal increase of neurotrophicfactors J Neurochem 1998712439ndash2446

Staging disease severity inpathologically confirmed cases of

frontotemporal dementiaM Broe PhD JR Hodges MD FRCP E Schofield BSc(Hons) CE Shepherd PhD JJ Kril PhD and

GM Halliday PhD

AbstractmdashObjective To devise a staging scheme for addressing the severity of atrophy in patients with pathologicallyproven frontotemporal dementia (FTD) and determine any relationship with clinical indices Methods Twenty-four cases withclinical and pathologic features of FTD were selected using standard inclusion and exclusion criteria from 125 dementia casescollected in Sydney Australia over an 85-year period Patterns of gross atrophy were determined in two coronal brain slicesReproducibility of a four-stage severity scheme was tested Nonparametric statistics were used to determine relationships be-tween the stage of atrophy and clinical indices (age at death duration from diagnosis and clinical severity at death) ResultsThe FTD cases studied could be reliably grouped ( 097) into four progressively severe stages of global atrophy Initialmild atrophy occurred in the orbital and superior medial frontal cortices and hippocampus (stage 1) progressed to involve theother anterior frontal regions temporal cortices and basal ganglia (stage 2) then involved all remaining tissue in these coro-nal slices (stage 3) until very marked atrophy was observed in all areas (stage 4) These stages correlated with disease dura-tion and clinical dementia severity lending validity to the progressive nature of the staging scheme Conclusions Theauthors have identified a reproducible staging system for the severity of gross atrophy in cases of FTD This staging schemeprovides the required framework to compare different research indices and determine correlates relating to time and diseaseprogression in FTDmdashinformation necessary to determine core disease processes and etiologic factors

NEUROLOGY 2003601005ndash1011

Frontotemporal dementia (FTD) is the second mostcommon neurodegenerative disease resulting in de-mentia in patients younger than 65 years1 Multipleneuropathologic changes underlie more homogenousclinical presentations of this disorder2-4 Current re-search on FTD has focused largely on pathogenesisclinical phenomenology and differentiation fromother dementia syndromes

Whereas there are reports documenting the clini-cal progression of FTD disorders in individual casesthe neuropathologic staging or progression of diseaseis poorly understood In other degenerative conditionsseverity staging of key pathologic indices has consider-ably advanced correlative studies and has proven to bean adequate surrogate for disease progression56 InFTD all cases demonstrate macroscopic changes in

frontal and anterior temporal regions23 with variableatrophy of other gray and white matter structures Wepresent a new schema for staging the severity of suchmacroscopic atrophy in order to understand the rela-tionship of this key neuropathologic feature to the clin-ical and pathologic disease processes

Methods Cases Cases were selected from a neuropathologicseries of 125 patients with dementia collected from a brain donorprogram in Sydney Australia between October 1993 and Febru-ary 2002 Only cases with full medical records detailing theirclinical history were included In particular we included patientswho underwent regular follow-up even after entry into nursinghome care The study was approved by the Human Ethics Com-mittees of the Universities of Sydney and New South WalesBrains were removed at autopsy (mean postmortem delay SDwas 18 17 hours range 2 to 72 hours) and the entire brainfixed by suspension in 15 buffered formalin for 2 weeks The

From the Centre for Education and Research on Ageing (Drs Broe Shepherd and Kril) Department of Medicine The University of Sydney MRC Cognitionand Brain Sciences Unit (Dr Hodges) Cambridge UK and Prince of Wales Medical Research Institute and the University of New South Wales (E Schofieldand Dr Halliday) Sydney AustraliaSupported by the National Health and Medical Research Council of Australia CES is a Rolf Edgar Lake Fellow of the University of SydneyReceived July 22 2002 Accepted in final form December 2 2002Address correspondence and reprint requests to Assoc Prof Glenda Halliday Prince of Wales Medical Research Institute Barker Street Randwick 2031Australia e-mail GHallidayunsweduau

Copyright copy 2003 by AAN Enterprises Inc 1005

DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al Chinese

-acetyltransferase 2 genotype and PD in Hong KongNStrong association between

This information is current as of March 25 2003

ServicesUpdated Information amp

httpwwwneurologyorgcontent6061002fullhtmlincluding high resolution figures can be found at

References

httpwwwneurologyorgcontent6061002fullhtmlref-list-1at This article cites 16 articles 8 of which you can access for free

Subspecialty Collections

kinsonismhttpwwwneurologyorgcgicollectionparkinsons_disease_parParkinsons diseaseParkinsonism

geneticshttpwwwneurologyorgcgicollectionassociation_studies_in_Association studies in genetics s

httpwwwneurologyorgcgicollectionall_movement_disorderAll Movement Disordersfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpwwwneurologyorgmiscaboutxhtmlpermissionsor in its entirety can be found online atInformation about reproducing this article in parts (figurestables)

Reprints

httpwwwneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

13 Meyer UA Zanger UM Molecular mechanisms of genetic polymorphisms ofdrug metabolism Annu Rev Pharmacol Toxicol 199737269ndash296

14 Tanner C Loller W Gilley D et al Cigarette smoking alcohol drinkingand Parkinsonrsquos disease cross-cultural risk assessment Mov Disord1990511

15 Wang W Fang X Cheng S et al A case-control study on the environ-mental risk factors of Parkinsonrsquos disease in Tianjian China Neuroepi-demiology 199312209ndash218

16 Grandinetti A Morens D Reed D et al Prospective study of cigarettesmoking and the risk of developing idiopathic Parkinsonrsquos diseaseAm J Epidemiol 19941391129ndash1138

17 Fowler J Volkow N Wang G et al Inhibition of monoamine oxidase Bin the brains of smokers Nature 1196379733ndash736

18 Maggio R Riva M Vaglini F et al Nicotine prevents experimentalparkinsonism in rodents and induces striatal increase of neurotrophicfactors J Neurochem 1998712439ndash2446

Staging disease severity inpathologically confirmed cases of

frontotemporal dementiaM Broe PhD JR Hodges MD FRCP E Schofield BSc(Hons) CE Shepherd PhD JJ Kril PhD and

GM Halliday PhD

AbstractmdashObjective To devise a staging scheme for addressing the severity of atrophy in patients with pathologicallyproven frontotemporal dementia (FTD) and determine any relationship with clinical indices Methods Twenty-four cases withclinical and pathologic features of FTD were selected using standard inclusion and exclusion criteria from 125 dementia casescollected in Sydney Australia over an 85-year period Patterns of gross atrophy were determined in two coronal brain slicesReproducibility of a four-stage severity scheme was tested Nonparametric statistics were used to determine relationships be-tween the stage of atrophy and clinical indices (age at death duration from diagnosis and clinical severity at death) ResultsThe FTD cases studied could be reliably grouped ( 097) into four progressively severe stages of global atrophy Initialmild atrophy occurred in the orbital and superior medial frontal cortices and hippocampus (stage 1) progressed to involve theother anterior frontal regions temporal cortices and basal ganglia (stage 2) then involved all remaining tissue in these coro-nal slices (stage 3) until very marked atrophy was observed in all areas (stage 4) These stages correlated with disease dura-tion and clinical dementia severity lending validity to the progressive nature of the staging scheme Conclusions Theauthors have identified a reproducible staging system for the severity of gross atrophy in cases of FTD This staging schemeprovides the required framework to compare different research indices and determine correlates relating to time and diseaseprogression in FTDmdashinformation necessary to determine core disease processes and etiologic factors

NEUROLOGY 2003601005ndash1011

Frontotemporal dementia (FTD) is the second mostcommon neurodegenerative disease resulting in de-mentia in patients younger than 65 years1 Multipleneuropathologic changes underlie more homogenousclinical presentations of this disorder2-4 Current re-search on FTD has focused largely on pathogenesisclinical phenomenology and differentiation fromother dementia syndromes

Whereas there are reports documenting the clini-cal progression of FTD disorders in individual casesthe neuropathologic staging or progression of diseaseis poorly understood In other degenerative conditionsseverity staging of key pathologic indices has consider-ably advanced correlative studies and has proven to bean adequate surrogate for disease progression56 InFTD all cases demonstrate macroscopic changes in

frontal and anterior temporal regions23 with variableatrophy of other gray and white matter structures Wepresent a new schema for staging the severity of suchmacroscopic atrophy in order to understand the rela-tionship of this key neuropathologic feature to the clin-ical and pathologic disease processes

Methods Cases Cases were selected from a neuropathologicseries of 125 patients with dementia collected from a brain donorprogram in Sydney Australia between October 1993 and Febru-ary 2002 Only cases with full medical records detailing theirclinical history were included In particular we included patientswho underwent regular follow-up even after entry into nursinghome care The study was approved by the Human Ethics Com-mittees of the Universities of Sydney and New South WalesBrains were removed at autopsy (mean postmortem delay SDwas 18 17 hours range 2 to 72 hours) and the entire brainfixed by suspension in 15 buffered formalin for 2 weeks The

From the Centre for Education and Research on Ageing (Drs Broe Shepherd and Kril) Department of Medicine The University of Sydney MRC Cognitionand Brain Sciences Unit (Dr Hodges) Cambridge UK and Prince of Wales Medical Research Institute and the University of New South Wales (E Schofieldand Dr Halliday) Sydney AustraliaSupported by the National Health and Medical Research Council of Australia CES is a Rolf Edgar Lake Fellow of the University of SydneyReceived July 22 2002 Accepted in final form December 2 2002Address correspondence and reprint requests to Assoc Prof Glenda Halliday Prince of Wales Medical Research Institute Barker Street Randwick 2031Australia e-mail GHallidayunsweduau

Copyright copy 2003 by AAN Enterprises Inc 1005

DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al Chinese

-acetyltransferase 2 genotype and PD in Hong KongNStrong association between

This information is current as of March 25 2003

ServicesUpdated Information amp

httpwwwneurologyorgcontent6061002fullhtmlincluding high resolution figures can be found at

References

httpwwwneurologyorgcontent6061002fullhtmlref-list-1at This article cites 16 articles 8 of which you can access for free

Subspecialty Collections

kinsonismhttpwwwneurologyorgcgicollectionparkinsons_disease_parParkinsons diseaseParkinsonism

geneticshttpwwwneurologyorgcgicollectionassociation_studies_in_Association studies in genetics s

httpwwwneurologyorgcgicollectionall_movement_disorderAll Movement Disordersfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpwwwneurologyorgmiscaboutxhtmlpermissionsor in its entirety can be found online atInformation about reproducing this article in parts (figurestables)

Reprints

httpwwwneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online

DOI 10121201WNL000005278787093B82003601002-1005 Neurology

DKY Chan MKP Lam R Wong et al Chinese

-acetyltransferase 2 genotype and PD in Hong KongNStrong association between

This information is current as of March 25 2003

ServicesUpdated Information amp

httpwwwneurologyorgcontent6061002fullhtmlincluding high resolution figures can be found at

References

httpwwwneurologyorgcontent6061002fullhtmlref-list-1at This article cites 16 articles 8 of which you can access for free

Subspecialty Collections

kinsonismhttpwwwneurologyorgcgicollectionparkinsons_disease_parParkinsons diseaseParkinsonism

geneticshttpwwwneurologyorgcgicollectionassociation_studies_in_Association studies in genetics s

httpwwwneurologyorgcgicollectionall_movement_disorderAll Movement Disordersfollowing collection(s) This article along with others on similar topics appears in the

Permissions amp Licensing

httpwwwneurologyorgmiscaboutxhtmlpermissionsor in its entirety can be found online atInformation about reproducing this article in parts (figurestables)

Reprints

httpwwwneurologyorgmiscaddirxhtmlreprintsusInformation about ordering reprints can be found online