Vol. 174, No. 11JOURNAL OF BACTERIOLOGY, June 1992, p. 3659-36660021-9193/92/113659-08$02.00/0Copyright © 1992, American Society for Microbiology

The Streptomyces glaucescens TcmR Protein RepressesTranscription of the Divergently Oriented tcmR and tcmA

Genes by Binding to an Intergenic Operator RegionPATRICK G. GUILFOILE' AND C. RICHARD HUTCHINSON' 2*

School ofPharmacy2 and Department of Bacteriology,' University ofWisconsin, Madison, Wisconsin 53706

Received 27 January 1992/Accepted 30 March 1992

Preliminary evidence has been presented by Guilfoile and Hutchinson (J. Bacteriol. 174:3651-3658, 1992)suggesting that the Streptomyces glaucescens TcmR protein is a transcriptional repressor. Here, we extend thatwork by showing that transcription of the S. glaucescens tcmA gene is inducible by tetracenomycin C and thatinactivation of the tcmR gene results in constitutive transcription of the tcmnA gene. Gel retardation studies showthat the TcmR protein binds to the tcmA-tcmR intergenic region in vitro and that this binding is inhibited bytetracenomycin C. Footprinting experiments demonstrate that the TcmR protein binds to an operator regionthat encompasses both the tcmA and the tcmR promoters. This genetic and biochemical evidence stronglysupports the model of the TcmR protein acting as a repressor in inhibiting transcription of both the tcmA andthe tcmR genes, in much the same way that TetR from TnlO inhibits transcription of tetA and tetR.

Regulation of antibiotic resistance in streptomycetes ispoorly understood. There have been several reports ofinducible resistance genes (for a review, see reference 27),but only in the cases of the actinorhodin export gene fromStreptomyces coelicolor (actll-Orf2) (6, 13), the macrolide-lincosamide-streptogramin B resistance gene ermSF (tirA) ofStreptomycesfiradiae (21), and the strA (aphD) streptomycinresistance gene from Streptomyces griseus (11, 20) havesome of the molecular details of this regulation been workedout. Understanding the regulation of antibiotic resistancewill be important in the construction of antibiotic-overpro-ducing strains and in understanding the genetic regulation ofsecondary metabolism in these commercially important or-ganisms.We are studying the regulation of tetracenomycin (TCM)

C resistance in Streptomyces glaucescens. The sequencedata presented in the accompanying paper (15) suggestedthat the TcmR protein of S. glaucescens may act as atranscriptional regulator of both the tcmR gene and the tcmATCM C resistance gene. Initial experiments showed thatwild-type S. glaucescens accumulated temA mRNA (andproduced TCM C) very early in the growth of the culture,making analysis of tcmA regulation difficult (16). Therefore,we decided to use S. glaucescens mutants specificallyblocked at several points in the TCM C biosynthetic path-way for further study. Previous work had shown that thesemutants are resistant to TCM C (30) but that at least one ofthe mutants (S. glaucescens WMH1068) does not constitu-tively synthesize tcmA mRNA (15). Study of these S.glaucescens non-TCM C-producing mutants enabled us todemonstrate the induction of tcmA and tcmR expression bythe addition of TCM C. Further work with crude cellextracts containing TcmR demonstrated the ability of thisprotein to bind to the tcmA-tcmR promoter regions in theabsence of TCM C, consistent with the function of TcmR asa transcriptional repressor.

* Corresponding author.

MATERIALS AND METHODS

Chemicals and biochemicals. TCM C (>95% pure byhigh-performance liquid chromatography) was a gift fromHeinrich Decker, University of Wisconsin-Madison. Thio-strepton (TH) was obtained from Sal Lucania, E. R. Squibband Co., Princeton, N.J. Oligodeoxynucleotides were syn-thesized on an Applied Biosystems (Foster City, Calif.)model 391 DNA synthesizer. Other chemicals and biochem-icals were obtained from standard commercial sources.

Strains and plasmids. Escherichia coli DH5at (BethesdaResearch Laboratories, Gaithersburg, Md.) was used as ahost strain for isolation of plasmids and for expression of theTcmR protein. pUC19 (39) was used for most cloningexperiments. pGEM-llzf(+) was obtained from PromegaBiotec (Madison, Wis.). The other strains and plasmids usedin this work are described in Table 1.DNA and RNA isolation. Chromosomal DNA was isolated

from 0.25 ml of densely grown S. glaucescens cultures,essentially as described by Hopwood et al. (19), except thatno spermine precipitation was used and nucleic acids weretreated with RNase after the first precipitation step. PlasmidDNA isolations from Streptomyces species and E. coli andRNA isolations from S. glaucescens were as described byGuilfoile and Hutchinson (15). RNA was typically isolatedfrom 25 ml of 2-day-old cultures grown in R2YENG medium(29) that had been seeded with 5 ml of 2-day-old culturesgrown from frozen spore stocks.Measurement of steady-state RNA levels. Steady-state

RNA levels were determined by using S1 mapping, accord-ing to the hybridization and digestion conditions describedby Sambrook et al. (34). Single-stranded, uniformly labeledhybridization probes were generated by performing a label-ing reaction with the primers (Fig. 1) previously used to mapthe 5' end of the tcmA gene (15). An M13 clone containing aportion of the 5' end of the tcmA gene was used as thetemplate for the labeling reaction. The probe was synthe-sized by the method of Sharrocks and Hornby (35), exceptthat 35S-dCTP was used for labeling. The products of thelabeling reaction were applied to a denaturing polyacryl-amide gel without restriction enzyme digestion, and DNA

3659

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

3660 GUILFOILE AND HUTCHINSON

TABLE 1. Strains and plasmids used

Strain or plasmid Phenotype, genotype, and/or description/construction Reference

S. glaucescens strainsGLA.O Wild-type strain 38WMH1068 Nonproducing strain with a deletion mutation in the tcmL gene (36); cosynthesizes TCM C 30

with all other mutant classesWMH1089 Accumulates TCM A2, the last TCM C pathway intermediate, and about 0.05% of wild-type 30

levels of TCM C; has a deletion in the tcmG gene (9) and cosynthesizes TCM C with allmutant classes blocked at earlier steps

WMH1094 Accumulates TCM E, the second-to-last TCM C pathway intermediate, and has an insertion in 30the tcmP gene (9); cosynthesizes TCM C with all mutant classes blocked at earlier steps

WMH1446 S. glaucescens WMH1068 with a deletion in the tcmR gene; generated with pWHM632, as This paperdescribed in Materials and Methods

PlasmidspTrc99A E. coli expression plasmid 1pGM160 Temperature-sensitive E. coli-Streptomyces species shuttle plasmid 31pWHM153 tcmA tcmR 29pWHM631 AtcmR; pWHM153 was digested with SstI and BglII and ligated into the SstI-BamHI site of This paper

pUC19; the resulting plasmid was digested with SplI and Asp 718 and religated, generating a493-bp deletion between nt 163 and 656 in the tcmR gene

pWHM632 AtcmR; pWHM631 was digested with EcoRI and NcoI and ligated into the EcoRI-NcoI site of This paperpGM160

pWHM633 tcmA tcmR; pWHM153 was digested with Notl and BgIII and ligated into the NotI-BamHI This papersite of pGEM-llzf(+)

pWHM634 tcmA tcmR; pWHM633 was digested with SspI and Hindlll and ligated into the HincIl- This paperHindIII site of pUC19

pWHM635 tcmR; the PCR product described in Materials and Methods was digested with PstI and This paperBamHI and ligated into the PstI-BamHI site of pWHM634

pWHM636 tcmR; pWHM635 was digested with HindIII and NcoI and ligated into the HindIII-NcoI site This paperof pTrc99A

pWHM637 tcmA AtcmR; exonuclease III deletion of the tcmA-tcmR region, resulting in a clone in pUC19 This paperthat extends from nt 575 to 2461 of the tcmA-tcmR region

pWHM638 AtcmA AtcmR; exonuclease III deletion of the tcmA-tcmR region, resulting in a clone in This paperpUC19 that extends from nt 1189 to 2461 of the tcmA gene

fragments in the range of 300 to 600 bp were eluted by usingthe crush and soak method (34). The tcmA transcript startpoint identified by this method was consistent with thatidentified by using 32P-labeled double-stranded DNA probes(15).

Southern blot hybridization. After overnight digestion witha restriction enzyme, chromosomal DNA was electro-phoresed in a 0.7% agarose gel and blotted to a solid support(Hybond N; Amersham) by capillary transfer, with an alka-line elution buffer (34). Probe labeling, hybridization, anddetection were done with the Genius 1 kit, according to theprotocols of the manufacturer (Boehringer Mannheim, Indi-anapolis, Ind.).

Isolation of a tcmR deletion mutant. S. glaucescens WMH1068 (30) protoplasts were transformed with pWHM632(which contains a deleted tcmR gene on a plasmid that istemperature-sensitive for replication [Table 1]), overlaidwith 20 ,ug of TH per ml on R2YENG plates (29), andallowed to grow for 3 days at 30°C. Plates containing TH-resistant colonies were incubated at 37°C for 7 to 10 moredays. To ensure that TH-resistant colonies had the plasmidintegrated into the chromosome by a Campbell type ofhomologous recombination, the edges of colonies werepicked and further incubated for an additional 2 to 3 days at37°C in liquid R2YENG containing 50 ,ug of TH per ml.Dilutions of these cultures were plated on Hickey-Tresneragar (30) without TH and allowed to sporulate at 30'C beforebeing replica plated to fresh Hickey-Tresner plates. Growingthe cells at 30°C in the absence of TH promoted the loss ofthe integrated vector, presumably because strains with the

inserted plasmid would have two active origins of replicationin the chromosome, a genotype that is likely to be unstable.After two cycles of sporulation on nonselective medium,spores were replica plated to Hickey-Tresner agar with andwithout TH to screen for TH-sensitive colonies. Since theTH-sensitive colonies could have regenerated either thewild-type or the deleted tcmR gene via homologous recom-bination, these TH-sensitive colonies were screened for thepresence of a deletion in the tcmR gene by Southern blothybridization. At least 20% of the TH-sensitive colonies thatwere screened contained the desired AtcmR gene.

Construction of a TcmR expression plasmid. The tcmRgene was inserted into the NcoI-HindIII site of pTrc99A (1),generating pWHM636 (Table 1), following a mutagenic poly-merase chain reaction (PCR) and a series of cloning steps. Aportion of pWHM634 (Table 1) was amplified by using VentDNA polymerase (New England Biolabs, Beverly, Mass.)under conditions recommended by the manufacturer. Foramplification, the reaction mixture was incubated at 100°Cfor 5 min and cooled to 72°C, 2 units of Vent polymerase wasadded, and elongation was allowed to proceed for 10 min.The reaction was continued for 20 cycles of 40 s each at100°C and then for 2 min at 68°C, with a Coy model 50thermocycler (Ann Arbor, Mich.). Primer no. 28 (5'-ATGTGCAACGCGCCGTC-3') extending from nucleotides (nt)357 to 373 (15) and primer no. 36 (5'-TCTAGAGGATCCGGAGGTTGGCCATGGACTCCGCCGAAACCGAC-3') ex-tending from nt 738 to 719 (15) (the 24 nt at the 5' end of thisprimer contain several restriction enzyme sites that are notcomplementary to the DNA sequence) were used in the PCR

J. BACTERIOL.

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

S. GLAUCESCENS TcmR REPRESSION OF TRANSCRIPTION 3661

A#32 O

PvuII MluI SplIGCTCGTAACCCTGCGCCAGGAACAGCTCCAGGGCCTCGCGGATCAGCTGATCACGCGTACGGCGCAGCTTCCGCTGGCGCAGGCCGGGGCCGTTGGGGGTGCTGCGGGTGCTGGGGGTGTCGGTTTCGGCGGAGTCCGAGCATTGGGACGCGGTCCTTGTCGAGGTCCCGGAGCGCCAGTCGACTAGTGCGCATGCCGCGTCGAAGGCGACCGCGTCCGGCCCCGGCAACCCCCACGACGCCCACGACCCCCACAGCCAAAGCCGCCTCAGH E Y G Q A L F L E L A E R I L Q D R T R R L K R Q R L G P G N P T S R T S P T D T E A S D

MluIDT- * tanA-p - B

CACCCGCCAACCCTATCTTGCGCCACCTGGTGACACCTGCATGCGA0-TGTCACTGACTGCTGT35-3GGG5CCATGTTCTCCTCGTCACACACGCGTCCGTCCTGCCGGAAATCGTTAGGGGGACGCTGAA=G3,GGC?GTGGAuCAICGCGGTGGACCACTGTGGCA ACGCTAACAGTTTACAGTGACTGACGACAATCGAAGCCCCGGTACAAGAGGAGCAGTGTGTGCGCAGGCAGGACGGCCTTTAGCAAr- TGCGACTTTAC

V 42 -10 -35 -35to~stcR tcmR-p1 - ---> <--- -4-AGCACGGAAACGCACGACGAGCCGTCAGGCGTCGCACACACCCCCGCTTCCGGTCTGCGTGGACGTCCCTGGCCGACCCTGCTCGCGGTCGCGGTCGGCGTGATGATGGTGGCTCTGGACTCGTGCCZMTGCTGCTCGGCAGTCCGCAGCGTGTGTGGGGGCGAAGGCCAGACGCACCTGCAGGGACCGGCTGGGACGAGCGCCAGCGCCAGCCGCACTACTACCACCGAGACCTGS T E T H D E P S G V A H T P A S G L R G R P W P T L L A V A V G V M M V A L D

-35.< #21

B 0

cmH IJ NOCH3 %(0H3

°NC OS,6N1I CHSEnz 3 COOH0

CH3 OH 0 HO CH3.tcmKLM Tetracenomycin E -tcmP-

CH3COSCoA + 9 CH2(COOH)COSCoA

0CH3 NCH3

C02CH3OH 0 HO CH3

Tetracenomycin A2itcmG

CH3O

0CH3

~~~CO2CH3HO CH3

0- Tetracenomycin C

FIG. 1. (A) Sequence of the tcmA-tcmR intergenic region. The region shown encompasses bp 601 to 1000 of the previously describedtcmA-tcmR sequence (15). The large arrows indicate oligonucleotides that were used to generate PCR fragments for the footprintingexperiments and probes for the S1 experiments. Selected restriction enzymes are listed above their recognition sequences. The small, angledarrows indicate previously identified transcript start sites (15). Probable translation start codons for the temA and tcmR genes are underlined.The -10 and -35 promoter regions for the tcmA and tcmR genes are indicated. The small dashed arrows indicate inverted repeats within thebinding site for the TcmR protein. The patterned box indicates the location of TcmR protein binding. (B) Abbreviated TCM C biosyntheticpathway (40). Large open arrows indicate multiple steps.

reaction to generate a NcoI site at the start of the tcmR geneand to place a BamHI restriction site upstream of this gene.

Preparation of the TcmR crude extract. E. coli DH5aocontaining pWHM636 was grown overnight in 50 ml of 2xYT medium (34) at 37°C with 100 ,ug of ampicillin per ml.This 50-ml culture was added to 500 ml of prewarmed 2x YTcontaining 100 ,ug of ampicillin per ml and incubated at 37°Cfor 1 h and 45 min. Isopropyl-p-D-thiogalactopyranoside wasadded to 1 mM, and the culture was incubated for an

additional 2 h. Cells were pelleted by centrifugation andwashed once with 20% (vol/vol) aqueous glycerol and thenonce with 10% glycerol. The washed cells were lysed bygrinding the frozen pellet with a mortar and pestle in thepresence of liquid nitrogen, and the cell paste was resus-

pended in 5 ml of a solution containing 10 mM sodiumphosphate (pH 6), 100 mM KCl, 10% glycerol, 1 mM EDTA(buffer A), and 0.5 mM phenylmethylsulfonyl fluoride. Thelysate was spun for 10 min at 14,000 rpm in a microcentri-fuge, and the supernatant was saved. Protein concentrationswere determined by using the Bradford assay with bovineserum albumin (BSA) as a standard (5). Sodium dodecylsulfate (SDS)-polyacrylamide gel electrophoresis of proteinextracts was conducted in a 15% polyacrylamide gel, as

described by Laemmli (24). Protein size markers were pur-chased from Bethesda Research Laboratories.

Gel retardation assays. Gel retardation assays were per-formed essentially as described by Carey (7), except that thepolyacrylamide gels contained 5% acrylamide and 0.08%N,N'-methylenebisacrylamide, 20 mM sodium phosphate(pH 6) was used as the running buffer, and the samples were

incubated in buffer A prior to gel loading. Typically, 20 to100 ng of an 35S-labeled fragment and 0.1 to 10 ,ug of totalprotein were used for each assay. The MluI fragment (nt 554to 842; see Fig. 1A and 5A) was labeled with Sequenaseenzyme (United States Biochemicals) by using a fill-in reac-

tion with 35S-dCTP and unlabeled dGTP.DNase I footprinting. For footprinting, a PCR product was

generated by using 5' end-labeled primer no. 32 and unla-beled primer no. 21 (Fig. 1A). A total of 20 pmol of eachprimer was incubated with 30 ng of pWHM637 DNA (Table1) in a solution containing 20 mM Tris-HCl (pH 8.3), 1.2 mMMgCl2, 20 mM KCl, 0.1% Triton X-100, 100 ,ug of BSA, 60,uM dCTP and dGTP, 40 ,uM dATP and dTTP, and 5%aqueous formamide (vol/vol) in a 99-pl total volume. Afterbeing overlaid with mineral oil, the reaction mixture was

heated to 100°C for 5 min. The reaction mixture was thencooled to 70°C, and 4.5 units of Taq DNA polymerase(Promega Biotec) was added. Amplification was achievedwith 20 cycles of denaturation at 96°C for 40 s, followed byannealing and extension at 70°C for 1.5 min in a Coy model50 thermocycler. Taq DNA polymerase (4.5 units) was

added at cycles 5, 10, and 15, and the final annealing andextension reaction was held at 70°C for 7 min. The resultingproduct was purified by chromatography with SephadexG-50 resin (34) and ethanol precipitated. Approximately 0.5pmol of labeled PCR product was used for each footprintingreaction. Reactions were carried out in buffer A containing10 mM dithiothreitol, 1.5 ,ug of unlabeled pWHM638 DNA(Table 1) containing a portion of the tcmA coding region, and10 ,ug of total cell protein. After 20 min of incubation at room

-10tr.mR-p2talS

VOL. 174, 1992

601

737l

881

-10

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

3662 GUILFOILE AND HUTCHINSON

temperature, 2 ,ul of a solution containing 5 ,g of DNase I(Bethesda Research Laboratories) per ml and MgCl2 to 10mM were added. The reaction mixture was incubated at 37°Cfor 30 s, and the reaction was stopped by the addition ofEDTA to 50 mM; then, the reaction mixture was extractedonce with phenol-chloroform (3:1 [vol/vol]) and the DNAwas ethanol precipitated. The resulting pellet was resus-pended in 5 pl of Tris-EDTA and 3.3 ,ul of Sequenase loadingbuffer (95% formamide, 20 mM EDTA, 0.05% bromphenolblue, and 0.05% xylene cynanol FF) and applied to a 6%polyacrylamide-13% formamide-8 M urea sequencing gel.

RESULTS

Transcription of the tcm4 gene is inducible by TCM C. TheS. glaucescens WMH1068 mutant is a TCM C-resistant,nonproducing strain that can cosynthesize with any mutantblocked after the earliest steps in the TCM C biosyntheticpathway (30). This mutant has recently been characterizedas having a deletion in the tcmL polyketide synthase gene

(36) and therefore is a useful host for testing the inducibilityof resistance gene expression, since this strain is incapableof producing any of the TCM metabolites (Fig. 1B). To testfor inducibility, cultures of S. glaucescens WHM1068 were

grown for 2 to 3 days, TCM metabolites were added, andthen RNA was isolated from the cells 25 min after metaboliteaddition. From Fig. 2A, lanes 3 and 4, it is clear that theaddition of purified TCM C to cultures of the WMH1068strain caused the induction of tcmA mRNA. Not surpris-ingly, a crude extract containing TCM C plus other TCMmetabolites also induced tcmA transcription (Fig. 2A, lane5). Wild-type S. glaucescens makes TCM C and accumulatestcmA mRNA under these growth conditions (Fig. 2B, lane4).

In order to test whether other TCM C biosynthetic path-way intermediates induce tcmA expression, RNA was iso-lated from an S. glaucescens mutant blocked in the second-to-last step of TCM C biosynthesis and assayed for thepresence of tcmA mRNA. The tcmP mutant, S. glaucescensWMH1094 (30), accumulates the second-to-last pathwayintermediate, TCM E (40), because this strain has an inser-tion mutation in a putative methylase gene required for theconversion of TCM E to TCM A2 (9) (Fig. 1B). Conse-quently, analysis of this mutant provides a way of testingwhether tcmA expression is induced by TCM E (and earlierpathway intermediates). As shown in Fig. 2B, lane 1, thisstrain does not produce detectable tcmiA mRNA in theabsence of inducer. This strain is resistant to TCM C (30)and is capable of producing tcmA mRNA in the presence ofpurified TCM C, however (Fig. 2B, lane 2). Consequently,we conclude that TCM E (and earlier pathway intermedi-ates) does not induce transcription of tcmA mRNA.The result shown in Fig. 2B (lane 3) suggests that very low

levels of TCM C can cause induction of tcmA transcription.The tcmG mutant, S. glaucescens WMH1089 (29), has a

deletion mutation in a hydroxylase gene that is required forthe conversion of TCM A2 to TCM C (9) (Fig. 1B). (TheTcmG protein produced by this strain must be partiallyactive, since it synthesizes a small amount of TCM C [9].)This mutant accumulates TCM A2 and about 0.05% of thewild-type amount of TCM C (approximately 0.1 ,ug/ml [9]),suggesting that very low levels of TCM C induce tcmAtranscription. TCM A2 is not likely to be an inducer of tcmAtranscription, since pure TCM A2 does not inhibit binding ofTcmR to its operator at a concentration at least 50 times

FIG. 2. Inducibility of tcmA transcription by TCM C and otherbiosynthetic pathway intermediates. The tcmA transcript was de-tected by using high-resolution Si mapping with single-stranded,35S-dCTP-labeled probe as described in Materials and Methods. Allhybridizations used 100 1Lg of RNA hybridized to equal amounts ofprobe (generated with primer B [Fig. 1]) and were digested with 90units of Si nuclease. (A) Inducibility of the tcmA gene by TCM C.Lanes: 1, undigested probe; 2, probe plus tRNA; 3, probe plus RNAfrom the S. glaucescens WMH1068 culture with no addition ofTCMmetabolites; 4, probe plus RNA from the S. glaucescens WMH1068culture with the addition of 5 ,Ug of purified TCM C per ml; 5, probeplus RNA from the S. glaucescens WMH1068 culture with theaddition of 25 p.g of crude TCM C per ml. (B) Inducibility of thetcmA gene by other TCM C biosynthetic pathway intermediates.Lanes: 1, probe plus RNA from S. glaucescens WMH1094, with no

addition of metabolites; 2, probe plus RNA from S. glaucescensWMH1094, induced with 5 pg of purified TCM C per ml; 3, probeplus RNA from S. glaucescens WMH1089, with no addition ofmetabolites; 4, probe plus RNA from S. glaucescens GLA.O, withno addition of metabolites; 5, probe plus tRNA; 6, undigested probe.In both panels, lane T indicates size markers generated by using a

sequencing reaction with dideoxy TTP and the primer used togenerate the probe. Numbers to the sides of the figures indicate sizes(in nucleotides) of the marker DNA. The arrows indicate theexpected sizes of the protected probe, on the basis of the resultsshown in Fig. 6 of the accompanying paper (15). The doublet ofbands visible in this figure was typical of the results of Si-mappingexperiments with this probe under these digestion conditions (16).

higher than that required for TCM C inhibition of TcmRbinding (16).The multiple bands seen in Fig. 2 and 3B show the typical

pattern observed under these digestion conditions. Thearrow points to a band the same size as the Si digestionproduct shown in Fig. 6B in the accompanying paper (15).Steady-state tcmA mRNA levels were approximately 30-foldhigher for the WMH1068 and WMH1094 strains when grownwith (versus without) TCM C, on the basis of scintillationcounting of dried gel slices containing these two bands (16).

Transcription of tcmR from the pl promoter is alsoinduced by TCM C, since this message is detectable in theWMH1068 strain only when it is exposed to TCM C, on thebasis of the results shown in Fig. 8B of the accompanyingpaper (15).

Transcription of the tcmA gene is repressed by the tcmRgene. To establish the role of the tcmR gene in regulatingexpression of tcmA, a deletion mutation in tcmR was createdin the S. glaucescens WMH1068 strain by gene replacement,as described in Materials and Methods. The desired mutantwould have a 493-bp deletion between nt 163 and 656,resulting in the loss of a PstI site at nt 440 in the previouslyreported sequence (15). Therefore, PstI-digested chromo-somal DNA from the tcmR deletion strain should generate a

A B

155-

110-

71-65-

-155

-110

-71

-65

J. BACTERIOL.

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

S. GLAUCESCENS TcmR REPRESSION OF TRANSCRIPTION 3663

A B

1 2 3 4 T 1 2 3 4

-4.3

-2.3-2.0

155-

1 10-

71--.

:0A0l: ~~~~ ~~~65-a _

-0.56

FIG. 3. Control of tcmA transcription by the tcmR gene. (A)Verification of the generation of a deletion in the tcmR gene in theS. glaucescens WMH1446 strain. The DNA shown in this figurewas digested with the restriction enzyme PstI. Lanes: 1, DNAisolated from the tcmR deletion mutant, S. glaucescens WMH1446;2, pWHM632 DNA; 3, DNA isolated from the S. glaucescensWMH1068 strain; 4, DNA isolated from the S. glaucescens GLA.Ostrain. Numbers to the side of the gel indicate sizes (in kilobases) ofmarker DNA run on the same gel. (B) Repression of tcmA transcrip-tion by the tcmR gene. Hybridization and digestion were as de-scribed in the legend to Fig. 2. Lanes: 1, undigested probe; 2, probeplus RNA from S. glaucescens WMH1068; 3, probe plus RNA fromwild-type S. glaucescens GLA.O; 4, probe plus RNA from the S.glaucescens WMH1446 strain; T, size markers generated by using a

sequencing reaction with dideoxy TTP and the primer used togenerate the probe. Numbers to the side of the gel indicate sizes (innucleotides) of the marker DNA. The arrows indicate the positionsof a doublet of bands typically seen under these digestion condi-tions. The top arrow indicates the expected size of the protectedprobe, on the basis of the results shown in Fig. 6 of the accompa-

nying paper (15). The band labeled rp indicates the position ofreannealed probe, since the single-stranded probe used in thisexperiment was not as efficiently separated from its complementarystrand, compared with the experiments shown in Fig. 2.

4.2-kb DNA fragment, compared with the expected 1.36-kbDNA fragment in the parental strain, when this DNA ishybridized to a probe extending from nt 574 to the PstI siteat nt 1800 (15). S. glaucescens WMH1446 chromosomalDNA digested with PstI generated the expected fragmentsize of 4.2 kb, indicating that this strain has a deletion in thetcmR gene (Fig. 3A, lane 1). In contrast, the plasmid used togenerate the deletion showed a 3.2-kb DNA-hybridizingfragment that contains portions of the temA and tcmR genes

as well as vector sequences, when digested with PstI (Fig.3A, lane 2). As expected, PstI-digested chromosomal DNAfrom the wild-type S. glaucescens GLA.O and the parentalS. glaucescens WMH1068 strains produced a 1.36-kb DNA-hybridizing fragment (Fig. 3A, lanes 3 and 4). This result wasconfirmed by Southern blot hybridization with chromosomalDNA digested with two other restriction enzymes and byusing the PCR with primers flanking the deleted region,which gave an amplified DNA fragment of the expected sizefor a deletion of 493 bp between the Asp 718 and the SplIsites of the tcmR gene (16).

If the tcmR gene actually represses tcmA transcription, weexpected the S. glaucescens WMH1446 strain to exhibitconstitutive expression of the temA gene, compared with itsinducible expression in the parental S. glaucescensWMH1068 strain. As shown in Fig. 3B, lane 2, an intact

43

18.- Uh:

29

1 8 4. 4- L.....:

FIG. 4. Overexpression of the TcmR protein in E. coli. In eachlane, 20 ,ug of total protein was electrophoresed through an SDS-15% polyacrylamide gel. M, protein size markers; -, protein fromDH5ot containing pTrc99A; +, protein from DH5at containingpWHM636 (Table 1), which has the tcmR gene under transcriptionalcontrol of the tac promoter. The arrow indicates the location of aunique protein band in the + lane which is likely to be the TcmRprotein. The numbers along the left side of the gel indicate themolecular masses of protein size markers (in kilodaltons).

tcmR gene in the S. glaucescens WMH1068 strain doesprevent tcmnA transcription in the absence of TCM C (alsoshown in Fig. 2A, lane 3). In contrast, the S. glaucescensWMH1446 AtcmR strain, in the absence of TCM metabo-lites, accumulated tcmA mRNA at a level equal to that of thewild-type strain during TCM C production (Fig. 3B, lanes 3and 4).

This negative regulation of tcmA transcription by thetcmR gene was also observed in Streptomyces lividans. S.lividans containing a plasmid with both the temA and thetcmR genes had much higher levels of temA mRNA accu-mulation in the presence of TCM metabolites than in theirabsence (16). As expected, S. lividans containing only thetcmA gene showed high levels of tcmA mRNA accumulationin the absence of TCM metabolites (16).

Overexpression of the TcmR protein. Initial experiments todetect proteins that bound the tcmA-tcmR intergenic regionin crude extracts from S. glaucescens WMH1068 orWMH1446 (containing or lacking, respectively, an intacttcmR gene) gave inconclusive results. More DNA-bindingactivity was observed when crude cell extracts from S.glaucescens WMH1068 were used, although some apparentbinding to the tcmA-tcmR intergenic region was also ob-served when extracts from the WMH1446 strain were used(16). To reduce the potential background DNA binding fromproteins other than TcmR in crude cell extracts, we there-fore decided to overexpress the TcmR protein in E. coli byusing pTrc99A as the expression plasmid (1). Details of theconstruction of the expression plasmid, pWHM636, aregiven in Table 1 and in the Materials and Methods section.Figure 4 (lane +) shows the presence of a unique band of theappropriate size in protein extracts from the pWHM636-containing strain, compared with protein extracts from astrain containing only pTrc99A (Fig. 4 [lane -]). The Mr ofthis protein band (26,000) closely approximates the predictedmolecular weight of TcmR (25,300), suggesting that theTcmR protein was produced in E. coli DH5ot.The TcmR protein binds specifically to the tcmA-tcmR

intergenic region. Gel retardation assays were used to deter-mine the specificity of TcmR binding. A 200-bp MluI frag-ment that contains the tcmA-tcmR intergenic region (Fig. 1Aand 5A) was used in these experiments. The specificity of

VOL. 174, 1992

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

3664 GUILFOILE AND HUTCHINSON

A

tcmR(repressor)p M SM

II

tomA(resistance gene)

P S EI

M M fiepient used for gel retadadon experiments

B

E-_ pWHM637

EJ pWHM638

Clane

pWHM637

pWHM638

protein

1 2 3 4

+ + + -

5lane 1 2 3 4 5 6 7

TcmC - - - 10 20 30 30

FIG. 5. Binding of the TcmR protein to the tcmA-tcmR inter-genic region. (A) Map of the fragments used for binding studies andcompetition experiments. Restriction enzyme site abbreviations: E,EcoRI; M, MluI; P, PstI; S, SphI. pWHM637 and pWHM638 aredescribed in Table 1. (B) Specificity of TcmR binding. In each lane,approximately 3.5 ng (-200 fmtol) of labeled MluI fragment wasused. When indicated, 2 ,ug of pWHM637 or pWHM638 was addedas specific and nonspecific competitor DNA, respectively. In thecase of pWHM637, this amount of DNA equals an approximately40-fold molar excess of unlabeled MluI fragment. In the protein row,- indicates that no protein was added, n indicates that 0.1 p.g ofprotein from E. coli containing pTrc99A (no TcmR repressor) wasadded, and r indicates that 0.1 p,g of protein from E. coli containingpWHM636 (TcmR repressor) was added. (C) Inhibition of TcmRbinding by TCM C. For each reaction, approximately 20 ng oflabeled MluI fragment, 1.5 p,g of pWHM638, and 10 pg of proteinwere used. In the row labeled TcmC, - indicates that no TCM Cwas added and the numbers indicate the amounts of TCM C(micrograms per milliliter) that were added to the reaction mixture.Symbols for the protein lanes are as in panel B.

trations of TCM C cause decreasing amounts of binding ofthe TcmR protein to the tcmA-tcmR intergenic region. Thissuggests that TCM C interacts with and thereby reduces theDNA-binding ability of the TcmR repressor protein.The presence of a band that migrates at an intermediate

position in lanes 4 to 6 of Fig. 5C may be due to the presenceof two operator sites in this fragment. (Further evidence forthe presence of multiple operators in the tcmA-tcmR inter-genic region is presented in the following section.) Thepossible ability of the TcmR protein to bind to one operatorsite on this fragment, in the presence of TCM C, may reflectincomplete titration of TCM C-binding sites on the repres-sor. Since we do not know the concentration ofTcmR in ourcrude preparation, and since TCM C is poorly soluble inaqueous solution (38) and might also be sequestered byintercalating into the DNA present in this experiment, wecannot determine the molar ratio of available repressor toavailable TCM C. The fact that increases in the concentra-tions of TCM C apparently cause decreases in the amountsofTcmR binding to both operator sites (Fig. 5C, lanes 4 to 6,top band) and to the putative single operator site (Fig. 5C,lanes 4 to 6 [intermediate band]) suggests that there is noenhancement of TcmR binding to one operator site in thepresence of TCM C.The TcmR protein binds to an operator(s) in the tcmA-tcmR

intergenic region. In order to determine the precise locationsof the TcmR-binding sites, we performed DNase I footprint-ing analysis on a 247-bp PCR fragment extending fromprimer no. 32 to primer no. 21 (Fig. 1A) that contains theMluI fragment used for the gel retardation experiments. Aprotected region was observed from nt 744 to 811, whichencompasses the -10 and -35 promoter regions for both thetcmA and the tcmR-pl promoters (Fig. 6). This regioncontains inverted repeats that are likely to be involved insequence-specific recognition by TcmR (Fig. 1A). On thebasis of the size of the protected region, along with the gelretardation data presented in Fig. 6C, we suggest that twoadjacent operators exist, one of which overlaps the tcmApromoter and the other of which overlaps the tcmR-plpromoter, perhaps separated by a few base pairs betweenthe -35 regions of the tcmA and tcmR-pl promoters (Fig. 1Aand 6). The location of TcmR binding is consistent with thedescription of an inducible pl and constitutive p2 promoterfor the tcmR gene described in the accompanying paper (15).On the basis of the footprinting data (Fig. 6), TcmR binds tothe tcmR-pl promoter region but not the tcmR-p2 promoterregion.

TcmR binding is demonstrated in Fig. SB, lanes 3 and S. Asshown in lane 3, the TcmR protein present in the crude cellextracts binds to this MluI fragment in the presence of 2 ,ugof unlabeled plasmid pWHM638 that contains a portion ofthe tcmA coding region (Table 1; Fig. SA). In contrast, 2 ,ugof plasmid pWHM637 containing the tcmA-tcmR intergenicregion (Table 1; Fig. 5A) abolishes binding of the TcmRprotein to the MluI fragment (Fig. 5B, lane 5). A crudeextract from the E. coli strain containing only pTrc99Ashows no binding activity, regardless of the type of unla-beled DNA present (Fig. SB, lanes 2 and 4).

Binding of the TcmR protein is inhibited by TCM C. Asdescribed above, tcmA transcription is induced by the addi-tion ofTCM C in vivo. To determine whether this inductioncould be caused by TCM C inhibiting the DNA-bindingcapability of the TcmR protein, we conducted gel retardationassays in the presence of various concentrations of TCM C.As shown in Fig. SC, lanes 3 to 6, increases in the concen-

DISCUSSION

In this paper, we establish the role of TcmR as a repressorof tcmA expression. Transcription of tcmA is clearly regu-lated by TcmR, on the basis of the tcmR gene inactivationexperiment (Fig. 3), which shows constitutive tcmA tran-scription in the AtcmR strain, in the absence of inducer. Dataconsistent with autoregulation of the tcmR-pl promoter areprovided by the footprinting experiment (Fig. 6), whichshows that the TcmR protein binds to the tcmR-pl promoterin a region that should prevent tcmR transcription. Autoreg-ulation of tcmR is also supported by the Si-mapping data forthe tcmR-pl promoter in the S. glaucescens WMH1068 andwild-type strains, which show that transcription from thetcmR-pl promoter is repressed in the absence of TCM C(15). The analogies between TCM C resistance regulation inS. glaucescens and tetracycline resistance regulation in E.coli (23) and the regulation of actinorhodin export in S.

J. BACTERIOL.

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

S. GLAUCESCENS TcmR REPRESSION OF TRANSCRIPTION 3665

S r n

tcmA

-10

-35-35

I-10

tcmR

+

FIG. 6. Determination of specific location of TcmR binding tothe tcmA-tcmR intergenic region. S, sequencing reaction generatedwith primer no. 32; r, DNase I footprinting reaction with proteinextracts from E. coli containing pWHM636 (TcmR repressor); n,

DNase I footprinting with protein extracts from E. coli containingpTrc99a (no TcmR repressor). The locations of the -10 and -35promoter regions for the temA and tcmR genes are given along theright side of the figure.

coelicolor (6) provide further support for the idea that tcmRautoregulates its expression, although the available data are

not yet sufficient to constitute absolute proof of such auto-regulation.The discovery of a regulatory gene upstream of the tcmA

TCM C resistance gene is precedented by examples fromboth Streptomyces species and other bacteria. Regulation ofa resistance gene by a divergently transcribed repressor gene

has been well-studied in the case of E. coli tetracyclineresistance (2, 3, 17, 18, 22, 23, 28, 33). In many ways, the S.glaucescens tcmA-tcmR and the E. coli TnlO tetA-tetRregulatory systems are very similar. Both have a singleresistance gene promoter and two repressor gene promoters(although the tetR promoters [3, 18] are closer together thanthe tcmR promoters [15]). In both cases, transcription of theresistance gene is induced by the antibiotic, and the antibi-otic inhibits binding of the repressor to DNA. Finally, inboth cases, the repressor binds to both its own promoter andthe resistance gene promoter in a region typical of theDNA-binding contacts for repressors (8).

Negative regulation of an antibiotic export gene by a

repressor (ActIl-Orfl) has been recently reported for theActII-Orf2 actinorhodin export protein in S. coelicolor (6).Regulation of the resistance gene by a repressor is likely tobe seen for other large, membrane-bound, Streptomycessecondary metabolite resistance proteins, whose overex-

pression may be lethal to the cell (12). Alternatively, or

additionally, this system, which allows uncoupling of antibi-otic production and antibiotic resistance, may be useful forensuring resistance to TCM C encountered in the environ-ment, even when the individual organism is not producingthe antibiotic itself.The presence of a divergently transcribed repressor gene

upstream of a resistance gene is not a universal feature ofStreptomyces antibiotic production gene clusters, however.In one alternate scheme, the genes divergently transcribedfrom resistance genes are antibiotic biosynthetic genes. Thisarrangement has been well-characterized for the ermE eryth-romycin resistance and eryCl biosynthetic genes from S.erythraea (4, 10, 37) and recently described for the drrABdoxorubicin resistance gene from Streptomyces peucetius(14). In another pattern, regulatory genes are located up-stream of the resistance gene and are apparently part of apolycistronic mRNA that includes both the regulatory andthe resistance genes. Such a regulatory circuit has beendescribed for the nsh nosiheptide resistance gene fromStreptomyces actuosus (26) and the strA (aphD) streptomy-cin resistance gene from S. griseus (11, 20, 32).A plausible model for regulation of the tcmA-tcmR genes

and TCM C resistance can be deduced from the informationpresented here. Initially, constitutive, low-level synthesis oftcmR mRNA from the tcmR-p2 promoter generates a suffi-cient amount of TcmR protein to repress tcmR and tcmAltranscription by binding to the operator sites upstream ofthose genes. As the TcmR concentration in the cell reachesa point where repressor-binding sites are essentially com-pletely occupied, less transcription from the tcmR-p2 pro-moter could be expected to read through the TcmR proteinbinding sites. (However, even with almost complete occu-pancy of the repressor binding sites, some transcription ofthe tcmR gene from the p2 promoter is likely to occur, sincethe location of TcmR binding should result in less efficientrepression of tcmR-p2 than of tcmR-pl [25].) Eventually,expression of tcm biosynthetic genes results in the produc-tion of TCM C, which binds to the TcmR repressor andthereby prevents the repressor from binding to these opera-tor sites. This allows expression of the temA gene, resultingin TCM C export and resistance as well as a higher level oftcmR expression, which may originate from the tcmR-plpromoter. The ensuing higher concentration of TcmR pro-tein in the cell would result in a quick shutoff of furthertranscription from the tcmR and temA genes once theconcentration of antibiotic in the cell drops (because of itsexport by the TcmA protein) to a level at which some TcmRprotein no longer binds TCM C.

ACKNOWLEDGMENTS

We thank Heinrich Decker for the gift of purified TCM C and forcommunicating information prior to publication. We also thankRichard Summers for communicating information prior to publica-tion and for valuable discussions regarding this work and WolfgangWohlleben for providing pGM160.

This work was supported by Public Health Service grant CA35381and an NIH traineeship to P.G.G. from the Cellular and MolecularBiology training grant (NIH T32-GM07215).

REFERENCES1. Amann, E., B. Ochs, and K.-J. Abel. 1988. Tightly regulated tac

promoter vectors useful for the expression of unfused and fusedproteins in Escherichia coli. Gene 69:301-315.

2. Beck, C., R. Mutzel, J. Barbe, and W. Muller. 1982. A multi-functional gene (tetR) controls TnlO-encoded tetracycline resis-tance. J. Bacteriol. 150:633-642.

3. Bertrand, K. P., K. Postle, L. V. Wray, and W. S. Reznikoff.

VOL. 174, 1992

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

3666 GUILFOILE AND HUTCHINSON

1983. Overlapping divergent promoters control expression ofTn]O tetracycline resistance. Gene 23:149-156.

4. Bibb, M. J., and G. R. Janssen. 1986. Unusual features oftranscription and translation of antibiotic resistance genes fromantibiotic-producing Streptomyces, p. 309-318. In M. Alacevic,D. Hranueli, and Z. Toman (ed.), Fifth International Sympo-sium on the Genetics of Industrial Microorganisms. Pliva,Zagreb, Yugoslavia.

5. Bradford, M. M. 1976. A rapid and sensitive method for thequantitation of microgram quantities of protein utilizing theprinciple of protein-dye binding. Anal. Biochem. 72:248-254.

6. Caballero, J., F. Malpartida, and D. A. Hopwood. 1991. Tran-scriptional organization and regulation of an antibiotic exportcomplex in the producing Streptomyces culture. Mol. Gen.Genet. 228:372-380.

7. Carey, J. 1988. Gel retardation at low pH resolves trp repressor-DNA complexes for quantitative study. Proc. Natl. Acad. Sci.USA 85:975-979.

8. Collado-Vides, J., B. Magasanik, and J. D. Gralla. 1991. Controlsite location and transcriptional regulation in Escherichia coli.Microbiol. Rev. 55:371-394.

9. Decker, H. (University of Wisconsin-Madison). Personal com-munication.

10. Dhillon, N., R. S. Hale, J. Cortes, and P. F. Leadlay. 1989.Molecular characterization of a gene from Saccharopolysporaerythraea (Streptomyces erythraeus) which is involved in eryth-romycin biosynthesis. Mol. Microbiol. 3:1405-1414.

11. Distler, J., K. Mansouri, G. Mayer, M. Stockmann, and W.Piepersberg. Streptomycin biosynthesis and its regulation instreptomyces. Gene, in press.

12. Eckert, B., and C. F. Beck. 1989. Overproduction of transposonTnIO-encoded tetracycline resistance protein results in celldeath and loss of membrane potential. J. Bacteriol. 171:3557-3559.

13. Fernandez-Moreno, M. A., J. L. Caballero, D. A. Hopwood, andF. Malpartida. 1991. The act cluster contains regulatory andantibiotic export genes, direct targets for translational controlby the bldA tRNA gene of Streptomyces. Cell 66:769-780.

14. Guilfoile, P. G., and C. R. Hutchinson. 1991. A bacterial analogof the mdr gene of mammalian tumor cells is present inStreptomyces peucetius, the producer of daunorubicin anddoxorubicin. Proc. Natl. Acad. Sci. USA 88:8553-8557.

15. Guilfoile, P. G., and C. R. Hutchinson. 1992. Sequence andtranscriptional analysis of the Streptomyces glaucescens tcmARtetracenomycin C resistance and repressor gene loci. J. Bacte-riol. 174:3651-3658.

16. Guilfoile, P. G., and C. R. Hutchinson. Unpublished data.17. Hillen, W., C. Gatz, L. Altschmied, K. Schollmeir, and I. Meier.

1983. Control of expression of the TnJO-encoded tetracyclineresistance genes. J. Mol. Biol. 169:707-721.

18. Hillen, W., K. Schollmeier, and C. Gatz. 1984. Control ofexpression of the TnJO-encoded tetracycline resistance operon.II. Interaction of RNA polymerase and TET repressor with thetet operon regulatory region. J. Mol. Biol. 172:185-201.

19. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J.Brunton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward,and H. Schrempf. 1985. Genetic manipulation of Streptomyces.A laboratory manual. John Innes Foundation, Norwich, UnitedKingdom.

20. Horinouchi, S., and T. Beppu. Regulation of secondary metab-olism and cell differentiation in Streptomyces: A-factor as amicrobial hormone and the AfsR protein as a response regula-tor. Gene, in press.

21. Kamimiya, S., and B. Weisblum. 1988. Translational attenuationcontrol of ermSF, an inducible resistance determinant encodingrRNA N-methyltransferase from Streptomyces fradiae. J. Bac-teriol. 170:1800-1811.

22. Kleinschmidt, C., K. Tovar, W. Hillen, and D. Porschke. 1988.Dynamics of repressor-operator recognition: the TnJO-encodedtetracycline resistance control. Biochemistry 27:1094-1104.

23. Klock, G., B. Unger, C. Gatz, W. Hillen, J. Altenbuchner, K.Schmid, and R. Schmitt. 1985. Heterologous repressor-operatorrecognition among four classes of tetracycline resistance deter-minants. J. Bacteriol. 161:326-332.

24. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

25. Lanzer, M., and H. Bujard. 1988. Promoters largely determinethe efficiency of repressor action. Proc. Natl. Acad. Sci. USA85:8973-8977.

26. Li, Y., D. C. Dosch, W. R. Strohl, and H. G. Floss. 1990.Nucleotide sequence and transcriptional analysis of the nosi-heptide-resistance gene from Streptomyces actuosus. Gene 91:9-17.

27. Martin, J. F., and P. Liras. 1989. Organization and expressionof genes involved in the biosynthesis of antibiotics and othersecondary metabolites. Annu. Rev. Microbiol. 43:173-206.

28. Meier, I., L. V. Wray, and W. Hillen. 1988. Differential regula-tion of TnlO-encoded tetracycline resistance genes tetA andtetR by the tandem tet operators O1 and 02. EMBO J. 7:567-572.

29. Motamedi, H., and C. R. Hutchinson. 1987. Cloning and heter-ologous expression of a gene cluster for the biosynthesis oftetracenomycin C, the anthracyline antitumor antibiotic ofStreptomyces glaucescens. Proc. Natl. Acad. Sci. USA 84:4445-4449.

30. Motamedi, H., E. Wendt-Pienkowski, and C. R. Hutchinson.1986. Isolation of tetracenomycin C-nonproducing Streptomy-ces glaucescens mutants. J. Bacteriol. 167:575-580.

31. Muth, G., B. Nussbaumer, W. Wohlleben, and A. Puhler. 1989.A vector system with temperature-sensitive replication for genedisruption and mutational cloning in streptomycetes. Mol. Gen.Genet. 219:341-348.

32. Piepersberg, W., J. Distler, A. Ebert, P. Heinzel, K. Mansouri,G. Mayer, and K. Pissowotzki. 1988. Expression of genes forstreptomycin biosynthesis, p. 86-91. In Y. Okami, T. Beppu,and H. Ogawara, (ed.) Biology of actinomycetes 1988. JapanScientific Societies Press, Tokyo.

33. Postle, K., T. T. Nguyen, and K. P. Bertrand. 1984. Nucleotidesequence of the repressor gene of the TnJO tetracycline resis-tance determinant. Nucleic Acids Res. 12:4849-4863.

34. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual, 2nd ed. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

35. Sharrocks, A. D., and D. P. Hornby. 1991. S1 nuclease tran-script mapping using Sequenase-derived single-stranded probes.BioTechniques 10:426-428.

36. Summers, R. (University of Wisconsin-Madison). Personalcommunication.

37. Vara, J., M. Lewandowska-Skarbek, Y. Wang, S. Donadio, andC. R. Hutchinson. 1989. Cloning of genes governing the deox-ysugar portion of the erythromycin biosynthesis pathway inSaccharopolyspora erythraea (Streptomyces erythreus). J. Bac-teriol. 171:5872-5881.

38. Weber, W., H. Zahner, J. Siebers, K. Schroder, and A. Zeeck.1979. Stoffwechselprodukte von Mikroorganismen. 175. Mit-teilung. Tetracenomycin C. Arch. Microbiol. 121:111-116.

39. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

40. Yue, S., H. Motamedi, E. Wendt-Pienkowski, and C. R. Hutchin-son. 1986. Anthracycline metabolites of tetracenomycin C-non-producing Streptomyces glaucescens mutants. J. Bacteriol.167:581-586.

J. BACTERIOL.

on March 21, 2020 by guest

http://jb.asm.org/

Dow

nloaded from