Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
Supplemental Figure 1. Effects of the srd2-1 and rid1-1 mutation on callus formation and root formation from hypocotyl and root explants. Hypocotyl and root explants of the wild type (WT), srd2-1, and rid1-1 were cultured on callus-inducing medium (CIM) or root-inducing medium (RIM) for 24 days at 22°C or 28°C. Bar = 1 cm.
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental Figure 2. Effects of rid1-1 mutation on root tip morphology. Root tips of 12-day-old seedlings of the wild type (WT) and rid1-1 grown at 22°C or 28°C were stained with Lugol’s solution, which stains starches abundant in columella cells, and then analyzed by microscopy. For Lugol’s staining, we followed the protocol of Ding and Friml (2010). Bar = 100 µm.
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
RID1*!At1g27900*!At1g33390!
At4g01020!
861
1000
1000
1000 997
1000
At1g48650!At2g01130!
At2g35920!At2g30800!At1g06670!At1g58050!At1g58060!At5g10370!
Group of DEIH or DEVH RNA helicases
1000
1000
1000 1000
At5g13010!At4g16680!
At2g35340!At1g32490(ESP3)!
Prp2!
1000 1000 At2g47250*!
At3g62310*!Prp43!At4g18465*!
998 Prp22!At3g26560!Prp16!
*Lacking N-terminal non-conserved region
Supplemental Figure 3. Phylogenetic tree of Arabidopsis DExH RNA helicase proteins. An unrooted phylogenetic tree of Arabidopsis DExH RNA helicase proteins and yeast Prp proteins was established using amino acid sequences of the conserved RNA helicase domain by the neighbor-joining method. Numbers are bootstrap values and given for clades that received support values of over 70% (1000 resamplings).
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental Figure 4. Effects of the rid1-1 mutation on alternative splicing patterns. Total RNAs were isolated from hypocotyl explants of the wild type (WT) and rid1-1 cultured on CIM at 22°C or 28°C for the indicated periods of time, and subjected to RT-PCR analysis. This experiment was repeated three times. Arrows indicated splice variants that were more or less abundant in rid1-1 at 28°C.
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
A RID1!
Prp22!
RNA helicase domain!
Conserved C-terminal
region!
Non-conserved region!
B
vector control!
vector control!
RID1!RID1!
PRP22!PRP22!
prp22 R805A!
!
prp22 T637A!
PRP22-RID1!
PRP22-RID1!
30°C! 15°C!
Supplemental Figure 5. Complementation analysis of yeast prp22 mutants. (A) Schematic diagrams of RID1 and yeast Prp22 protein domain structures. RID1 lacks the non-conserved N-terminal region found in Prp22. (B) Complementation tests of cold-sensitive growth phenotypes of prp22 mutants. Missense mutants prp22T637A and prp22R805A were transformed with pYES-DEST52 plasmids carrying PRP22, RID1, or PRP22-RID1. Cells were precultured on SC minimal agar medium lacking uracil and tryptophan with 2% raffinose for 4 days at 30°C, and then streaked onto induction agar medium, which lacked uracil and tryptophan and contained 2% galactose and 1% raffinose to induce the genes of interest. The plates were photographed after incubation for 6 days at 15°C or 2 days at 30°C. Diagram on left shows layout of yeast strains on plates.
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
A
5′ ETS 3′ ETS ITS1 ITS2 18S
5.8S 25S
probe (ITS1)
B
Supplemental Figure 6. Effects of the rid1-1 mutation on pre-rRNA processing. (A) Diagram illustrating 35S rRNA gene. Mature rRNA regions are indicated with rectangles, and the 5′ and 3′ external transcribed sequences (ETS), and two internal transcribed spacer (ITS) regions are represented by thin lines. ITS1-specific probe used for RNA gel blot analysis is shown as a gray bar. (B) RNA gel blot analysis of rRNA precursor accumulation. Total RNAs were isolated from hypocotyl explants of the wild type (WT) and rid1-1 cultured on CIM at 22°C or 28°C for the indicated periods of time, and subjected to RNA gel blot analysis. The fluorescent image of the gel stained with SYBR® Gold Nucleic Acid Gel Stain (Invitrogen) after electrophoresis is shown as a loading control.
WT rid1-1 0 d 1 d
22℃ 28℃ 0 d 1 d
22℃ 28℃
Pro
be
(ITS
1)
load
ing
cont
rol
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental Table 1. Number of normal and aborted seeds in siliques borne on
RID1/rid1-2 and RID1/rid1-3 plants
Normal seeds Aborted seeds
In siliques born on RID1/RID1 plantsa 261 1
In siliques born on RID1/rid1-2 plantsb 226 230
In siliques born on RID1/rid1-3 plantsb 288 242 a5 siliques were analyzed. b10 siliques were analyzed.
Supplemental Table 2. Oligonucleotides used in this study.Primer Name Sequence (5'-3') Experiments Comments
F2J7-153-F TGTAAACCAACCAGGATCTTTTGG CAPS marker for Chromosome Mapping Restriction enzyme; Tru 9IF2J7-153-R CTTGTACATAGTGCAAACAAACTATC CAPS marker for Chromosome Mapping Ler; 196 bp, Col; 32 bp and 164 bpF28B23-22713-F TGATTACTTAATCTTTAAGAAATTCACG CAPS marker for Chromosome Mapping Restriction enzyme; Taq IF28B23-22713-R CACCAACGGCTATCTGATGAAGATGG CAPS marker for Chromosome Mapping Ler; 214 bp, Col; 97 bp and 117 bpT1K7-37752-F AGGTTGCCTTTGAAATCTGTAGC CAPS marker for Chromosome Mapping Restriction enzyme; Tru 9IT1K7-37752-R TGAAGACAGTTGAATATAGGAGC CAPS marker for Chromosome Mapping Ler; 146 bp, Col; 33 bp and 113 bpT1K7-81291-F TTCTATCCGACGGTTCTACATC CAPS marker for Chromosome Mapping Restriction enzyme; Fba IT1K7-81291-R CGGTATTTGAGATATCTCGACG CAPS marker for Chromosome Mapping Ler; 184 bp, Col; 69 bp and 115 bpT24P13-43589-F TTGGCAGACCAATTAACAAGTCAGG CAPS marker for Chromosome Mapping Restriction enzyme; Hinf IT24P13-43589-R TTCTCAAGCAAACAGCCACAACGG CAPS marker for Chromosome Mapping Ler; 126 bp and 226 bp, Col; 352 bpT2P11-60823-F CTGATCTACTGTTATAAGTTTCG dCAPS marker for Chromosome Mapping Restriction enzyme; Hinf IT2P11-60823-R TTTTTTTTGATAAAATTGTATTGAGAT dCAPS marker for Chromosome Mapping Ler; 28 bp and 147 bp, Col; 175 bpT7N9-571451-F AGCTTACAAGACGGGATTCTGC CAPS marker for Chromosome Mapping Restriction enzyme; Hinf IT7N9-571451-R ACTCACGCGTGAACTCTGTTTCG CAPS marker for Chromosome Mapping Ler; 107 bp and 436 bp, Col; 543 bpAt1g26370pro-F(cacc) CACCGTCCTTCTAGGTAGACCTACGGATCC Cloning of Promoter Region of RID1 Located at –2084 to –2055 position from start codon (+1) of At1g26370At1g26370pro-R TGAGTTCTCCTTGCGCCATTGATGGCAT Cloning of Promoter Region of RID1 Located at +1 to +27 position from start codon (+1) of At1g26370At1g26370-R1(pENTR) CTCTGCCGTTTGGAAATGGTGAGG Cloning of Genomic Region of RID1 Located at +3312 to +3336 position from start codon (+1) of At1g26370InYFP-F ATGTCGACATGCTACAGTGGTACC RT-PCR for In-YFP transcriptsGFP512-R TTGTGGCGGATCTTGAAGTTCACC RT-PCR for In-YFP transcriptsT1K7-76362-F TTGTGGAATGGACTTGCGAATG dCAP marker for Genotyping of rid1-1 Restriction enzyme; Nde Irid1/dCAPS-R3 TTTCATCTTGCCCAGTGAGGAAAACAC dCAP marker for Genotyping of rid1-1 WT; 128 bp, rid1-1; 30 bp and 98 bpT1K7-76362-F TTGTGGAATGGACTTGCGAATG Genotyping for rid1-2 Locaetd in RID1 genomic regionT1K7-76574-R GAAAAGATAGCAAGTGGCAGTAGC Genotyping for rid1-2 Locaetd in RID1 genomic regionGABI730B12.T-DNA CCCATTTGGACGTGAATGTAGACAC Genotyping for rid1-2 Locaetd in T-DNA regionT1K7-77684-F TTTGTTTTGCCAGGCAAGAACC Genotyping for rid1-3 Locaetd in RID1 genomic region310A05primer-R ATAAAACAGAAGTTGGGTGGATGT Genotyping for rid1-3 Locaetd in RID1 genomic regionpAC161primer CCCATTTGGACGTGAATGTAGACAC Genotyping for rid1-3 Locaetd in T-DNA regionAt1g02840sp-F GGCCCCCGCTCGAAGTCAAGG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At1g02840sp-R GGTAGAGGAGATCTTGATCTTG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At2g40910sp-F GGAGGGATCTGAAACAAG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At2g40910sp-R GTGCTACACATGCGCATAGG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At3g55630sp-F CGATGTCCGAGAGAGATTCC RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At3g55630sp-R CCCTAGAGAAGAAATACCAC RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At5g15230sp-F CCTCTTGACCCTCATTGTCC RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At5g15230sp-R CCAGTTGTTGTAGCAGGAGC RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At3g12110Csp-F GGCTCCTCTCAACCCCAAGG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At3g12110Csp-R GGTAATCAGTAAGGTCACGG RT-PCR for Detection of Alternative Splicing Simpson et al. (2008)At1g55310sp-F CTCCGTCGTTCCTCACCACCG RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At1g55310sp-R GTTCCCCACATGTTCCATAG RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At3g53500sp-F GTATCATCCGCGGTTCACTT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At3g53500sp-R TGTCCTCCACGCTTTTCTCT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At3g55460sp-F CTCCTCGACGTGGATATGGT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At3g55460sp-R ACCTTCATAGCCAGGGGAGT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At4g02430sp-F GGCGATATCCGTGAAAGAGA RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At4g02430sp-R TCTTCCAACAGACCCAGCTT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At4g25500sp-F ACTACGCCTGCCAAAATCAT RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)At4g25500sp-R CACCATCATACCCACCATCA RT-PCR for Detection of Alternative Splicing Palusa et al. (2007)Prp22cDNA-F CACCATGTCTGATATATCGAAACTCATAGG Cloning of Prp22 genePrp22cDNA-R TTACCTCTTGATACCTAATGC Cloning of Prp22 geneAt1g26370cDNA-F CACCATGCCATCAATGGCGCAAGGAGAAC Cloning of RID1 cDNARID1cDNA-R(stop) TCACTCTGCCGTTTGGAAATGGTGAGGAGC Cloning of RID1 cDNARID1(RSLPI-)-F AGATCTCTTCCTATTGCTTCAGTGGAGAAACG Construction of Prp22-RID1 genePrp22-480-RID1-R AATAGGAAGAGATCTACGCTGTGCACTGATTGGTAA Construction of Prp22-RID1 geneITS1-F TCGATACCTGTCCAAAACAG Making probe specific for ITS region of pre-rRNA Ohbayashi et al. (2011)ITS1-R AGACTTCAGTTCGCAGC Making probe specific for ITS region of pre-rRNA Ohbayashi et al. (2011)18SrRNA-F AGTCATCAGCTCGCGTTGAC Making probe specific for 18S rRNA Magome et al. (2004)18SrRNA-R TCAATCGGTAGGAGCGACG Making probe specific for 18S rRNA Magome et al. (2004)
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental Data. Ohtani et al. (2013). Plant Cell 10.1105/tpc.113.111922
Supplemental References Ding, Z., and Friml, J. (2010) Auxin regulates distal stem cell differen7a7on in Arabidopsis roots. Proc. Natl. Acad. Sci. USA 107: 12046–12051. Magome, H., Yamaguchi, S., Hanada, A., Kamiya, Y., and Oda, K. (2004) dwarf and delayed-‐flowering 1, a novel Arabidopsis mutant deficient in gibberellin biosynthesis because of overexpression of a puta7ve AP2 transcrip7on factor. Plant J. 37: 720–729. Ohbayashi, I., Konishi, M., Ebine, K., and Sugiyama, M. (2011) Gene7c iden7fica7on of Arabidopsis RID2 as an essen7al factor involved in pre-‐rRNA processing. Plant J. 67: 49–60.