Upload
grant-luke-stafford
View
213
Download
0
Tags:
Embed Size (px)
Citation preview
Society, Biology and ComputersSociety, Biology and Computers
Views from a Black Woman ScientistViews from a Black Woman Scientist
By Raquell HolmesBy Raquell Holmes
Research Asst. ProfessorCenter for Computational ScienceBoston University
Financial DirectorInstitute for African-American E-Culture
OverviewOverview Biology and SocietyBiology and Society
– Interests of a studentInterests of a student
Biology and ComputersBiology and Computers– A changing professionA changing profession
Computers and SocietyComputers and Society– Creating community and technologyCreating community and technology
Starting OutStarting Out High School Interests: High School Interests:
– Society, Math and BiologySociety, Math and Biology (Social arguments (Social arguments are often based on biology/science)are often based on biology/science)
College thinking: College thinking: – Jobs: Jobs: Biology, Math and Sociology Biology, Math and Sociology – Skills: Skills: Biology, SociologyBiology, Sociology– Money: Money: BiologyBiology
Biology in college: Biology in college: – Little math required, few societal discussionsLittle math required, few societal discussions
Starting OutStarting OutGraduate SchoolGraduate School: Cell Biology: Cell BiologyMammalian Ovary: Cell Signaling and AdhesionMammalian Ovary: Cell Signaling and Adhesion
Skills:Skills:General- inquiry, reading and General- inquiry, reading and
interpretationinterpretation
Math- basic calculations, some statistics Math- basic calculations, some statistics
Computation-use of commercial tools.Computation-use of commercial tools.
Needing MoreNeeding MorePersonal:Personal:
Create learning environmentsCreate learning environmentsIncrease role of technologyIncrease role of technologyIncrease social concernsIncrease social concerns
Job Market for Biologists-Job Market for Biologists-Fewer academic positions for Fewer academic positions for
experimentalistsexperimentalistsIncreased need for computationIncreased need for computation
Biology and ComputersBiology and Computers
New ways of approaching life sciences.
A New Way of Doing Science
Experiment
Theory
Computation
The “New Biology” Era
Biology is an increasingly interdisciplinary science.
The biggest revolutions in biology are emerging from engineering, technology & computer science.
Genomics & Bioinformatics
…………………...GGAAGAACAGGTATAAGCAATTCAATAATTATTGATGGACCATCTCCGTATGTGACAATTATACATAAAGACCCAAATGGAACTGTTCTAGATGATACACTAGCATTAAGAGAAAAATTCGAAGAATCAGTCGATAAATACAAACTTCATTTTACTGGATTAATCGCTGACAAAATTGCAAAAGAAAAACTGAATACTTACGTCCTCACTTATAAAAAAGCAGACGAAGCTATGCCTGCAGACGAAGCTATGCCAACTGATGTACCTAGTACTTCTGTTACTGGATCAACAATGGCAAACGAGCAACCAGAAACTCGTCCTGCAAAAATCGCTCAACCCGCGATGGAAGAGACAGATACTGCTCACATATCGGGATCTGAACCACAGGCTGATACAACACAAGCTGATACTTCAAATTCAGAAAGTGTTCCATCAGAGACAACTAAAACAGTGGCTGAAAATAATCCGCAAGAAAGTGCAACAGCAGAGAAAAACGAGCAAGAAGTCGCCGAGACAACACCTCAAAATGGAGAAGTTGCAAAAGAAGCTCAACCAACTGTAGAAGCTAGCACTCAAACAAATGAAGTCGCCCAAAATGGAAGCGAAAAAGA……. ……. ……. ……. …….
A genome can be viewed as a computer program….
Cell (Machine) DNA(Program)
Organism(Computer)
Bioinformatics premise: from codes to life
The conversionThe conversion Cell Biology--> BioinformaticsCell Biology--> Bioinformatics
– Biological data placed in databases.Biological data placed in databases.
– Computer Science, Computational Science and Computer Science, Computational Science and Biology in one.Biology in one.
Experimental--> Computational SkillsExperimental--> Computational Skills– modeling, database, programming, algorithmsmodeling, database, programming, algorithms
Training RequiredTraining RequiredModelingModeling
Mathematics Mathematics
statistics, linear algebra, differential equations.statistics, linear algebra, differential equations.
Computer Science Computer Science
programming languages- Pearl, Java, C+, C++programming languages- Pearl, Java, C+, C++
Biology Biology
ecology, genomics, genetics, biochemistry, cell ecology, genomics, genetics, biochemistry, cell and developmentaland developmental
Computers and SocietyComputers and Society
Who gets to play?
Full Participation in IT means…Full Participation in IT means…
CreationCreation DesignDesign DevelopmentDevelopment
Decision MakingDecision Making OwnershipOwnership
To research, develop, and deploy To research, develop, and deploy advanced information technologies in advanced information technologies in
concert with and in support of concert with and in support of African-American communitiesAfrican-American communities..
Institute for African American E-Culture
iAAEC is an IT Research CommunityiAAEC is an IT Research Community
Computer ScientistsComputer Scientists Educators and Education ResearchersEducators and Education Researchers Cognitive ScientistsCognitive Scientists Social ScientistsSocial Scientists EntrepreneursEntrepreneurs Youth and StudentsYouth and Students Community ActivistsCommunity Activists
Culture Specific ApproachesCulture Specific Approaches Research: creating culturally dependent IT Research: creating culturally dependent IT
that works to bridge Digital Divide.that works to bridge Digital Divide. Development: creating communities across Development: creating communities across
the Digital Divide that design, use and the Digital Divide that design, use and create technology.create technology.
iAAEC iAAEC IT Development Zones IT Development Zones
Create social and collaborative Create social and collaborative environments that support the development environments that support the development of communities that design, create, and of communities that design, create, and assess culture-specific IT.assess culture-specific IT.
One example is the High Performance One example is the High Performance Computing Lab Restoration Project. Computing Lab Restoration Project. http://family.bu.edu/hpcl/http://family.bu.edu/hpcl/