Skeletal Muscle Hypertrophy After Chronic Restriction of Venous Blood Flow in Rats

Skeletal Muscle Hypertrophy after ChronmicRestrilctilon of Venous Blood Flow in Rats

SHIGEO KAWADA' and NAOKATA ISH112

'Institute of Environmnental Studies, Graduate School of Frontier Sciences, The University of Tokyo, Chiba Prefecture,JAPAN; and 2 Depar nent of Life Sciences, Graduate School of Arts and Sciences, The University of Tokyo,Tokyo, JAPAN.

ABSTRACT

KAWADA, S.. and N. ISHIT. Skeletal Muscle Hypertrophy after Chronic Restriction of Venous Blood Flow in Rats. Med. Sci. SportsExerc., Vol. 37, No. 7, pp. 1144-1150, 2005. Purpose: Some previous studies have shown that resistance exercise training with venousocclusion causes an enhanced hypertrophy in human muscles. To investigate the effects of blood flow on muscular size at either cellular

or subcellular level, we developed an animal model in which several veins from hindlimb muscles of the rat are surgicallycrush-occluded. Methods: Twenty-four male Wister rats were randomly assigned into either a group for sham operation (sham group)or a group for venous occlusion (experimental group; N = 12 for each group). Fourteen days after the operation, plantaris, soleus,gastrocnemius, extensor digitorum longus, and tibialis anterior muscles were dissected from hindlimbs and subjected to morphological

and biochemical analyses. Results: Fourteen days after the operation. the muscles expect for soleus showed similar increases in wetweight/body weight (by 7-12%) as compared with the sham-operated group (P < 0.05). Further analyses on the plantaris muscleshowed increases in muscle dry weight/ body weight (by 10%) and the concentrations of myofibrillar protein (by 23%), glycogen (by93%) and lactate (by 23%) after the operation (P < 0.05). Mean fiber cross-sectional area was larger by 34% in the experimental groupthan in the sham-operated group (P < 0.01). The content of HSP-72 increased, whereas that of myostatin protein decreased (P < 0.01).

The expression of nitric oxide synthase-l (NOS-1) mRNA increased (P < 0.01), whereas that of IGF-I mRNA showed no significantchange (P = 0.36). Although the muscle nitric oxide (NO) concentration tended to increase, but the change was not significant (P =0.10). Conclusions: Changes in muscle blood flow may affect the muscular size through actions of HSP-72, myostatin, and NOS-1.Key Words: VENOUS OCCLUSION, MYOSTATIN, HEAT SHOCK PROTEIN-72, NITRIC OXIDE SYNTHASE-I

rotein synthesis in skeletal muscle is stimulated byvarious factors including hormones, metabolic de-mand, and mechanical overload. Among these fac-

tors, strong mechanical stress, for instance, that associatedwith heavy resistance exercise. has been thought to play aprimary role in inducing increases in size and strength ofskeletal muscle. Previous studies have demonstrated thatresistance exercise training with an intensity exceeding 65%of the maximum strength (one-repetition maximum; IRM)is required for gaining muscular size and strength (15). Sucha strenuous exercise would simultaneously activate secre-tions of anabolic hormones and anaerobic energy metabo-lism, though the precise roles played by these factors in

Address for correspondence: Shigeo Kawada, Ph.D., Institute of Environmen-tal Studies, Graduate School of Frontier Sciences, The University of Tokyo,5-1-5 Kashiwanoha. Kashiwa-shi, 277-8561 Chiba Prefecture, JAPAN:E-mail: [email protected] for publication November 2004.Accepted for publication February 2005.

0195-9131/05/3707-I 144/0MEDICINE & SCIENCE TN SPORTS & EXERCISE5 ,Copyright © 2005 by the American College of Sports Medicine

DOI: 10.1249/01.mss.0000170097.59514.bb

muscular hypertrophy have not been fully understood. Onthe other hand, exercises with much lower intensity andlarger volume result in an improvement of muscle oxidativecapacity without considerable effect on muscular size (9).

Several recent studies have shown that a low-intensityresistance exercise combined with moderate vascular occlu-sion effectively causes increases in muscular size, strength,and glycogen content in humans (6,27). The acute effect ofthis exercise has been characterized by marked increases inserum concentrations of norepinephrine, growth hormone,and lactate (27). In addition, the electrical activity of muscleis considerably elevated during the exercise, suggesting thata large number of fast-twitch fibers are recruited even underthe load as small as 20% IRM. Such a resistance exercisewith small mechanical stress is expected to be useful forrehabilitation and training for elderlies. Although somestudies have shown that a similar training with occlusioncauses metabolic and neuromuscular adaptations, its mus-cle-trophic effect has not been fully established (6,18).Thus, it would be worth investigating either cellular orsubcellular events that may occur after the resistance exer-cise with occlusion.

In the resistance exercise with occlusion, suppression ofmuscular blood flow and resulting changes in environment

1144

around muscle fibers, for instance, hypoxia or accumulation of

metabolic subproducts, may cause changes in up-stream reg-ulators of protein synthesis. Among these regulators, heat

shock prote-m-72 (HSP-72), myostatin, insulinlike growth fac-tor-i (IGF-1), and nitric oxide synthase-I (NOS-1) are thoughtbe involved in exercise-induced muscular hypertrophy. HSP-72, one of the stress proteins, has been shown to play as a

chaperone against ischemia in such cells as myoblast andmyocardium (11,14). In humans, this protein has been shownto increase in muscles of patients with arterial occlusive disease

(12). Myostatin. a member of the transforming growth factor-3(TGF- ,) superfamily, is a potent negative regulator of musclegrowth (16), and its content within muscle has been shown to

decrease in response to mechanical stress (10). It has also beenreported that the follistatin related gene protein, an antagonistto myostatin increases, whereas the activin IIb receptor, areceptor of myostatin decreases after heavy resistance training(30). On the other hand, IGF-I is one of the critical growthmediators of muscle and other tissues. Overexpression ofIGF-i with viral mediated IGF-1 gene transfer has been shownto cause muscular hypertrophy (5). NOS-1 produces nitric

oxide (NO) from L-arginine, which may activate ERK1/2, oneof mean arterial pressure (MAP)-kinase family, thereby finally

stimulate muscle growth through phosphorylation cascade re-actions (28). If the suppression of muscular blood flow actuallycauses muscular hypertrophy, it may also cause changes in the

intramuscular concentrations of some of these substances.An appropriate animal model is of great advantage to

study the subcellular mechanisms underlying the effects of

muscle blood flow on the size of muscle. Thus the presentstudy aimed to develop a novel model with hindlimb mus-cles of the rat. To suppress moderately the muscular bloodflow, some veins from hindlimb muscles were occluded bya surgical operation. Fourteen-day normal cage activitycaused hypertrophy and changes in the concentrations ofglycogen, lactate, HSP-72, and myostatin, and NOS-1 ex-pression in the occluded muscle.

MATERIALS AND METHODS

Animals. Male Wister rats (age, I1 wk; body weight,260-300 g; N = 24) were used. They were housed in ananimal room with regulated temperature (22 0 C), humidity(60%), and illumination cycles (12-h light and 12-h dark).They were allowed to eat conunercial rat chow (CLEA,Japan) and drink water ad libitum. Rat care and all experi-mental procedures employed were in accordance with thepolicy statement of the American College of Sports Medi-cine on research with experimental animals. The study wasapproved by the Ethical Committee for Animal Experimentsat the University of Tokyo.

Venous occlusion. The rats were randomly assigned

into a group for sham operation (sham group) or a group forvenous occlusion (experimental group; N = 12 for eachgroup). In the experimental group, vena saphena magna,vena saphena accessoria medialis, vena circumflexa iliumsuperficialis, and vena epigastrica superficialis in the righthindlimb were crush-occluded by means of a heated metal

needle under anesthesia with an intraperitoneal injection ofsodium pentobarbital (100 mg -kg-' body weight). Theoccluded points were about 1 cm apart from the junctionwhere the described veins join vena femoralis. In addition,vena femoralis was also occluded at the point about 1 cmapart from its junction to the region subinguinalis (Fig. 1).In sham-operated group, the skin of right hindlimb was cutopen and then sutured. The contralateral muscles in theexperimental group were not used as control, because theymight be overloaded in compensation to occluded muscles.

After the operation, animals of both experimental andsham-operated groups were kept in rat cages for 2 wk. Thisperiod was based on our preliminary observation that bloodvessels were regenerated rapidly around crush-occludedportions and blood circulation was almost recovered at >3wk after the operation. Two weeks after the operation, therats were sacrificed by an intraperitoneal injection of so-dium pentobarbital, and hindlimb muscles [plantaris, soleus,gastrocnemius, extensor digitorum longus (EDL), and tibi-alis anterior (TA)] were dissected and weighed. For planta-ris and soleus muscles, six samples from each group weredried at 50°C for 24 h to measure dry weight. The dryweight was the same when measured 16 h and 24 h after theinitiation of treatment, indicating that the specimen wasalmost completely desiccated. A part of the remaining sam-ples was snap frozen in liquid nitrogen for biochemicalanalysis, while the other part was frozen in cold isopentanefor morphological observations. Both samples were storedat -80°C until analysis.

Measurements of myofibrillar protein, glycogen,lactate, and nitric oxide concentrations. For planta-ris and soleus muscles, the amount of total protein remainedafter the preparation for Western blot analysis was deter-mined spectrophotometrically using a protein determinationkit (Bio-Rad, Richmond, CA). The total protein content wasexpressed relative to muscle wet weight. The muscle gly-cogen and lactate concentrations were measured as de-scribed by Russel and Taylor (23) and Gutmann and Wahl-

1 ~~~~V. femoralisV. circumflxa ilium superficialis / m

V V. epigastrioal superficialis

V. saphena macia g na

FIGURE 1-Illustration showing the portions of occlusion on venousblood vessels of the right hindlimb. The region denoted with thick lineswas crush-occluded.

ANIMAL MODEL FOR SKELETAL MUSCLE HYPERTROPHY Medicine & Science in Sports & Exerciseo 1145

efeld (8). For glycogen assay, 15 mg of muscle sample wasdissolved in 30% KOH saturated with Na2SO4 at 100°C for15 min and then cooled on ice. To precipitate glycogen, 95%ethanol (1.2 volumes) was added to the sample, and thesample was centrifuged at 2500 X g (20°C) for 20 min. Theglycogen precipitate was dissolved in 400-jLL distilled wa-ter; 100 ptL of 5% phenol solution and 1 mL of H2SO4 wereadded into 200 ZL of the obtained glycogen solution, whichwas then incubated at room temperature for 10 min. Theglycogen concentration was determined spectrophotometri-cally at 490 nm. For lactate assay, another 15 mg of musclesample was homogenized in 300 AL of 0.6 N HC104 andcentrifuged at 10,000 X g (20°C) for 5 miin 50 AL of thesupernatant, 100 juL of 40 mM nicotinamide-adenine dinu-cleotide (Sigma-Ardrich Co.), and 3 AL of lactate dehydro-genase (10 mg * mL-T; Roche Diagnostics) were added into2 mL of a buffer (0.5 M glycine, 0.0127 M EDTA, and 0.4M hydrazine, pH 9.0), and then incubated at room temper-ature for 30 min. The lactate concentration was determninedspectrophotometrically at 340 nm. For NO assay, 30 mg ofmuscle sample was homogenized in 300 ,LL of 10 mMTris-HCl (pH. 7.4) and centrifuged at 15,000 X g (4°C) for15 min. The supematant was filtrated with microcon YM-10(Millipore Co.) at 5000 X g (4°C) for 60 min. Then NOconcentration in the filtrated sample was measured using aN02/N03 Assay Kit-CII, FlI (Dojindo, Japan) according tothe manufacture's procedure.

Morphological observation. Cross-sections (10-,umthick) were cut from frozen samples of plantaris musclesand stained with hematoxylin-eosin (Sakura Finetek JapanCo.) according to the standard procedure. Cross-sectionalarea of muscle fibers was determined using the NIH image(version 1.61; National Institutes of Health, Bethesda, MD).

Western blot analysis. Tissue samples were homog-enized in a buffer containing 10-mM Tris-HCI (pH 7.4),5%sodium dodecyl sulfate, and 5% 2-mercaptoethanol. Thehomogenate was boiled for 3 min, then centrifuged at13,000 X g (4°C) for 15 min. The supematant was removedand its protein concentration was determined using a proteindetermination kit (Bio-Rad, Richmond, CA). Then equalamounts of extracted muscle proteins (100 ,ug total protein)were separated by sodium dodecyl sulfate-polyacrylamide(12%) gel electrophoresis (SDS-PAGE). Proteins on a gelwere transferred onto poly vinylidene diflouride (PVDF)membrane (ATIO, Japan) electrophoretically. The follow-ing primary antibodies were used for immunoblotting: HSP-72, 1:10,000 dilution of purified rabbit polyclonal anti-HSP70 antibody (StressGen Biotechnologies Co.); myostatin,1:250 dilution of antimyostatin antibody as described previ-ously (10). And then horseradish peroxidase (HRP)-conjugatedgoat antirabbit IgG [1:10000 (American Qualex, CA)] wasreacted as a secondary antibody. After incubation with thesecondary antibody, the membrane was incubated with Super-Signal West Pico Chemiluminescent Substrate (Perbio ScienceCo., Rockford) according to the manufacture's recommenda-tion. Band densities were determined by using the NIH image,and used as indicators of HSP-72 and myostatin contents in thesame amount of solubilized proteins, respectively. To obtain

1146 Official Journal of the American College of Sports Medicine

TABLE 1. PCR Primers for GAPDH, NOS-1, and IGF-1.

Product SizeForward/Reverse (5'--3') (bp)

GAPDH CCACAGTCCATGCCATCAC 442TCCACCACCCTGTTGCTGTA

NOS-1 AAGGATGMTCTCGCCTCCC 623GATTGTCGACACCCGAAGAC

IGF-1 GGGGC1TACTTCAACAAG 390GGAAATGCCCATCTCTGAAA

the same reaction condition, samples of a series of experimentwere analyzed on the same gels and membranes.

Measurements of NOS-1 and IGF-1 mRNA. Forreverse transcriptase-polymerase chain reaction (RT-PCR),RNA was extracted from plantaris muscles using total RNAextraction kit (ISOGEN, NIPPON GENE, Japan). Extractedtotal RNA was treated with RNase-free DNase-1 (RQ-1;Promega, Madison, WI) at 37°C for 1 h to eliminategenomic DNA contamination. The quantity of extractedRNA was determined by absorbance at 260 nm. Comple-mentary DNA (cDNA) was reverse transcribed (RT) from 5jig of total RNA using 0.5-,ug oligo (dT) and superscript IIreverse transcriptase (Invitrogen, Netherlands) in a 20-,Lvolume. To confirm the RT reaction, PCR amplification wasperformed on the resulting RT product using primers forglyceraldehydes-3-phosphate dehydrogenase (GAPDH) as apositive control. And then PCR amplification for NOS-1and IGF-1 were performed on the RT product using specificprimers. Primers for NOS-1 and IGF-1 were synthesized onthe basis of published information (19,22). The sequences ofthe primers are listed in Table 1. The linear portion of theamplification curve for each transcript was defined and thenused to determine the appropriate number of PCR amplifi-cation cycles in the RT-PCR analysis. PCR for NOS-1started with an initial denaturation at 94°C for 5 min, fol-lowed by 37 cycles of denaturation at 94°C for 1 min,annealing at 60°C for 1 min and extension at 72°C for 1 min,and a final extension cycle at 72°C for 7 min. PCR for IGF-1started with an initial denaturation at 94°C for 5 min, fol-lowed by 32 cycles of denaturation at 94°C for 1 min,annealing at 53 0C for 1 min and extension at 72°C for 1 min,and a final extension cycle at 72°C for 7 min. The amplifiedPCR products for each gene were visualized on 1.5% aga-rose gels stained with ethidium bromide. As described inwestern blot analysis, band density was determined by usingthe NIH image. The mRNA concentrations of both geneswere normalized with respect to GAPDH.

Statistical analysis. Differences between groups wereexamined with Student's t-test. P < 0.05 was regarded asstatistically significant.

RESULTS

Muscular size and concentrations of myofibrillarprotein, glycogen and lactate. Fourteen days after theoperation, plantaris, gastrocnemius, EDL, and TA from theoccluded limbs (right) showed significant increases(7-12%) in wet weight per body weight as compared with

http://www.acsm-msse.org

those in sham-operated group. Conversely, the soleus mus-cle showed no significant increase. For muscle dry weight,the plantaris muscle showed an increase (10%), whereas the

soleus muscle did not. In the plantaris muscle, concentra-tions of total protein, glycogen and lactate also increased by

23, 93, and 23% respectively, and the changes were signif-icant as compared with the sham-operated group (Table 2).

Muscle-fiber diameter. Typical appearances of cross-

sections of the plantaris muscle are shown in Figure 2. Invenous-occluded muscle, the muscle fibers exhibited hyper-trophy without any sign of abnormality, that is, edema,

necrosis, and apoptosis (Figs. 2A and B). On the other hand,when a complete occlusion of both arteries and veins was

made for only 30 min by strong ligation with a thread at theproximal end of hindlimb, the muscle exhibited an abnormalappearance and a number of necrotic fibers were observedon the next day (Fig. 2C). The distribution of fiber cross-sectional area in sham and experimental groups showed ashift towards the larger value in the experimental group(Fig. 3). The mean fiber cross-sectional area was larger by34% in experimental group than in sham-operated group(4980 + 2281 ,am2 vs 3704 + 1326 um2

2 N 750; P <

0.01).HSP-72, myostatin, NOS-1, IGF-1, and NO. In the

plantaris muscle, venous occlusion caused a significant in-crease in the content of HSP-72 (Fig. 4A). On the otherhand, the content of myostatin decreased significantly (Fig.4B). RT-PCR analysis showed that, in venous-occludedmuscle, NOS-1 mRNA expression was significantly up-regulated (Fig. 5A). Although muscle NO concentrationtended to show an increase, the change was not significant(P = 0.10) due mainly to the large variation (Table 2). Also,

TABLE 2. Effects of venous occlusion on body weight, muscle weight,concentrations of myofibrillar protein, muscle glycogen, lactate, and nitric oxide.

ExperimentalSham Group Group

Body weight (g)Preexperiment 279 (2.7) 281 (4.0)Postexperiment 330 (4.7) 336 (3.4)

Muscle wet weightbody weight(mg * g-1)

Plantaris 0.983 (0.023) 1.103 (0.007)*Gastrocnemius 4.708 (0.045) 5.075 (0.093)*

EDL 0.458 (0.005) 0.492 (0.011)*TA 1.583 (0.015) 1.774 (0.037)*Soleus 0.389 (0.010) 0.389 (0.007)Muscle dry weight/body weight

(mg * g-')Plantaris 0.254 (0.003) 0.279 (0.005)*Soleus 0.100 (0.002) 0.100 (0.002)

Myofibrillar protein concentration(mg * g-1 wet tissue)

Plantaris 196 (17,8) 242 (9.0)*Muscle glycogen concentration

(JLmol * g-1 wet tissue)Plantaris 12.7 (1.3) 24.5 (3.6)*

Muscle lactate concentration([imol * g-1 wet tissue)

Plantaris 32.1 (1.9) 39.4 (1.2)*Muscle NO concentration (nmol -g-1

wet tissue)Plantaris 29.5 (5.7) 48.7 (8.8)

Values of SEM are shown in parentheses. Asterisks indicate significant difference (P<0.05) as compared with sham group. EDL, extensor digitorum longus; TA, tibialisanterior.

ANIMAL MODEL FOR SKELETAL MUSCLE HYPERTROPHY

A

B

C

FIGURE 2-Cross-sections of plantaris muscle stained with hematox-ylin/eosin. A, sham-operated; B, venous occluded; C, both veins andarteries were occluded for 30 min. Bars, 50 ,um.

IGF-1 mRNA expression showed an insignificant increase(P = 0.36) after venous occlusion (Fig. 5B).

DISCUSSION

The present study showed that chronic restriction of mus-cular venous blood flow induces muscle hypertrophy with

35

30

25

A 20S 15

10

5

I0

a shm group*expre group

1000 2000 3(10 4000 5000 6000 7000 8000 9000 10000 11000 12000

Cross-sectional area (iun2)

FIGURE 3-Distribution of fiber cross-sectional area in plantarismuscle. Open bars, sham group; filled bars, experimental group; totalfiber number = 750 for each group.

Medicine & Science in Sports & Exercisea 1147

A

sham group experimental group

I

250

a 200

I 1501

S 100

50

0

control group experimental group

B


I I350

3300.a

250

1 200

X 1500

-- 50

2 50

0

T


FIGURE 4-Effects of venous occlusion on the concentrations ofHSP-72 (A) and myostatin (B) in plantaris muscle (N = 6). Bars denoteSEM; * significantly different as compared to sham-operated group(P < 0.01).

normal cage activity in the hindlimb muscles but not thesoleus muscle (Table 2). This suggests that some majormuscles of the hindlimb responded with hypertrophy to theoperation in a similar manner, and there was not any unex-pected change in muscle loading due to the treatment. Inaccordance with previous studies (4), myosin ATPase stain-ing showed that the percentage of Type 1 fibers in the soleusmuscle was much larger than in other hypertrophied mus-cles (data not shown). Therefore, the effects of venousocclusion may depend on the muscle-fiber composition.

The hypertrophied plantaris muscle showed increases inthe concentrations of glycogen and lactate. Previous studieshave shown that resistance training with vascular occlusion

also causes muscle glycogen in humans (6). This effect mayinvolve, at least partially, a hypoxia-induced activation ofmuscle glucose uptake through the translocation of the glu-cose transporter GLUT-4 (7). On the other hand, chronicallyelevated concentration of lactate is likely caused by eitherrestricted clearance of lactate from the muscle or elevatedactivity of fast-twitch fibers. Therefore, the increases inmuscle glycogen and lactate suggest that muscle blood flowwas suppressed during the experimental period.

The hypertrophy of the plantaris muscle was associatedwith an increased content of HSP-72. It has been shown thatexercise training also causes an increase in muscle HSP-72content (20). Although the exact roles of HSP-72 in proteinmetabolism in skeletal muscle are not fully understood, itmay stabilize both existing and newly synthesized proteinsagainst several stressors associated with exercise training. Ithas been shown that in a variety of in vivo and in vitroexperiments, HSP-72 is induced by such stressors as heat,ischemia, hypoxia, and free radicals, and acts as chaperoneto prevent misfolding or aggregation of proteins (11,14). Inaddition, a short-time exposure of skeletal muscle to heat(41°C) has been shown to cause an increase in HSP-72content and attenuate the atrophy when the muscle is sub-sequently subjected to unloading (21). Therefore, an in-creased production of HSP-72 may play a part in thepresent, occlusion-induced muscular hypertrophy.

An increased expression of NOS-1 within muscle fibers mayalso play an important role in muscular hypertrophy, becauseseveral recent studies have shown that NO stimulates themuscle growth (3,28). A NOS inhibitor N c-nitro-L-argininemethyl ester hydrochloride suppresses the activation of musclesatellite cells, whereas a NO donor, sodium nitroprusside di-hydrate, promotes their proliferation (28). NO has also beenshown to mediate the expression of vinculin and talin, whichare cytoskeletal proteins responsible for force transmission in avariety of cells (29). In spite of the increased NOS-1 expres-sion, muscle NO concentration did not show a significantincrease due to large variations (Table 2). The life span of NOis so short that the present study evaluated its concentrationindirectly by measuring its oxidation products. Therefore, ob-tained values might be resulted from production and break-down of NO, both of which might be influenced by the re-striction of muscle blood flow.

The hypertrophy of the plantaris muscle was associatedwith the decrease in muscle mnyostatin content. Myostatingene has two binding sites for NF-kJ3 in its regulatoryregions (13), which has been shown to be activated byreactive oxygen species (ROS) produced in hypoxic condi-tion (24). As has been well known, myostatin stronglyinhibits the growth of muscle, and mutations of its generesult in overgrowth of musculature in mice, cattle andhumans (16,17,25). In addition, muscle myostatin contenthas been shown to decrease in response to mechanicaloverloading, implying its role in regulating the muscle sizein normal organisms (10).

A number of studies have so far shown that mechanicaloverloading upregulates IGF-1 and causes hypertrophy inskeletal muscle (1,2). It has also been shown that an increase

1148 Official Joumal of the American College of Sports Medicine http://www.acsrn-rnsse.org

BIGF-I

GAPDH


la

i

I.

8

220

200

180

160

140

120

100

80

60

40

20

0


sham group experimental group sham group experimental group

FIGURE 5-Effects of venous occlusion on the expression of NOS-1 (A) and IGF-1 (B) in plantaris muscle (N = 6). Bars denote SEM; *significantlydifferent as compared with sham-operated group (P < 0.01).

in muscle IGF-I production induced by gene transfer with aviral injection method strongly enhances the growth ofmuscle (5). The IGF-1 induced muscular hypertrophy isassociated with the increase in muscle-fiber diameter andthe presence of central nuclei, suggesting the involvement ofthe proliferation of muscle-satellite cells and their fusioninto parent muscle fibers (5). In the present study, thevenous occlusion did not cause a significant increase inIGF-1 expression, and the central nuclei were not clearlyseen (Figs. 2 and 5B). These results suggest that IGF-1would not be always essential for muscle hypertrophy, ifsuch factors as myostatin, HSP-72, and NOS-1 wouldchange in favor of the muscular growth.

The present animal model may not be ideal for studyingthe mechanism underlying the resistance exercise with oc-

REFERENCES

1. ADAMs. G. R., D. C. CHENG, F. HADDAD, and K.M. BALDWIN.Skeletal muscle hypertrophyin response to isometric, lengthening,and shortening training bouts of equivalentduration. J. Appl.Physiol. 96:1613-1618. 2004.

2. ADAMs, G. R., F. HADDAD, and K. M. BALDWIN. Time course ofchanges in markers of overloaded rat skeletal muscles. J. Appl.PhysioL 87:1705-1712, 1999.

3. ANDERSON, J. E. A role for nitric oxide in muscle repair: nitricoxide-mediated activation of muscle satellite cells. MoL Biol. CelL11:1859-1874, 2000.

4. BAR, A., and D. PErrE. Three fast myosin heavy chains in adult ratskeletal muscle. FEBS Lett. 235:153-155, 1988.

clusion for humans, because both exercise and occlusionstimuli last for only a few minutes (5-10 min) in the latter(27). However, it may uncover some possible processes thatare activated after the resistance exercise with occlusion. Inaddition, normal strenuous exercise training may share someof these processes, because during muscular activities, themuscle is subjected to repeated ischemia and reperfusion inphase with contraction and relaxation, respectively (26).

We thank Kato Mal (The University of Tokyo) for technical sup-ports to measure muscle glycogen and lactate, and Dr. WagaToshiaki (Asahi Breweries, Ltd.) for valuable assistance in obtainingthe data of muscle weight.

This study was supported by the grant-in-aid (No.16300207 toN.I.) from the Japan Ministry of Education, Culture, Sports, Science,and Technology.

5. BARTON-DAvis, E. R., D. I. SHOTURMA. A. MUSARO, N. ROsENTHAL,and H. L. SWEENEY. Viral mediated expression of insulin-likegrowth factor 1 blocks the aging-related loss of skeletal musclefunction. Proc. Natl. Acad. Sci. USA 95:15603-15607, 1998.

6. BURGOMASTER, A. K., D. R. MooRE, L. M. SCHOFIELD, S. M.PHILLIPS, D. G. SALE, and M. J. GIBALA. Resistance training withvascular occlusion: metabolic adaptations in human muscle. Med.Sci. Sports Exerc. 35:1203-1208, 2003.

7. CARTEE, G. D., A. G. DOUEN, T. RAMLAL, A. KLIP. and J. 0.HoLLoZY. Stimulation of glucose transport in skeletal muscle byhypoxia. J. AppL Phiysiol. 70:1593-1600, 1991.

8. GUTMANN, I., and A.W. WAHLEFELD. L-(+)-Lactate determina-

ANIMAL MODEL FOR SKELETAL MUSCLE HYPERTROPHY

ANOS-I

GAPDH

160

140

Igi

i

I

0

0z

120

100

80

60

40

20

0

I

Medicine & Science in Sports & Exercise� 1149

tion with lactate dehydrogenase and NAD. In: Methods ofEnzymatic Analysis. New York: Academic Press, 1974, pp.1464-1468.

9. HoLLoszY, J. O., and F. W. BouTH. Biochemical adaptations to en-durance exercise in muscle. Annu. Rev. PliysioL 18:273-291, 1976.

10. KAWADA, S., C. TAcHi, and N. IsHII. Content and localization ofmyostatin in mouse skeletal muscle during aging, mechanicalunloading and reloading. J. Muscle Res. Cell Motil. 22:627-633,2001.

11. LEpoRE, D. A.. J. V. HuRLEY, A. G. STEWART. W. A. MORRISON, andR. L. ANDERSON. Prior heat stress improves survival of ischemic-reperfused skeletal muscle in vivo. Muscle Nerve 23:1847-1855,2000.

12. Liu, Y., M. LEHMANN, C. BAUR, M. STORCK, L. S. PLASSMANN, andJ. M. STEINACKER. HSP70 expression in skeletal muscle of patientswith peripheral arterial occlusive disease. Eur. J. Vasc. Endovasc.Surg. 24:269-273, 2002.

13. MA, K, C. MALLIDIS, J. ARTAZA, W. TAYLOR, N. GONZALEZ-CADAVID, and S. BHAsIN. Characterization of 5'-regulatory regionof human myostatin gene: regulation by dexamethasone in vitro,Am. J. Physiol. Endocrinol. 281:E1128-E1136, 2001.

.14. MARBER, M. S., R MEsTRIL, S- H. CHI, M. R. SAYEN, D. M., andYELLON, W. H. DILLMAN. Overexpression of the rat inducible70-kD heat stress protein in a transgenic mouse increases theresistance of the heart to ischemic injury. J. Clin. Invest. 95:1446-1456, 1995.

15. McDONAGH, M. J., and C. T. M. DAVIES. Adaptive response ofmammalian skeletal muscle to exercise with high loads. Eur.J. Appl. Physiol. 52:139-155, 1984.

16. McPHERRON, A. C., A. M. LAWLER, and S. J. LEE. Regulation ofskeletal muscle mass in mice by a new TGF-3 superfamily mem-ber. Natur-e 387:83-90, 1997.

17. McPHERRON, A. C., and S. J. LEE. Double muscling in cattle due tomutations in the myostatin gene. Proc. Natl. Acad. Sci. USA94:12457-12461. 1997.

18. MOOR, D. R., K A. BURGOMASTER, L. M. SCHOFIELD, M. J. GIBALA,D. G. SALE, and S. M. PHiLLIps. Neuromuscular adaptations inhuman muscle following low intensity resistance training withvascular occlusion. Eur. J. Appl. Physiol. 92:399-406, 2004.

19. MURPHY, L. J., G. 1. BELL, M. L. DucKwoRTH, and H. G. FRIESEN.

Identification. characterization, and regulation of rat complemen-tary deoxyribonucleic acid which encodes insulin-like growthfactor-I. Endocrinology 121:684-691, 1987.

20. NAiTO, H., S. K. POWERS, H. A. DEMIREL, and J. AOKi Exercisetraining increases heat shock protein in skeletal muscles of oldrats. Med. Sc. Sports Exerc. 33:729-734, 2001.

21. NArro, H., S. K. POWERS, H. A. DEMIREL, T. SUGIURA, S. L. DODD,and J. AOKI. Heat stress attenuates skeletal muscle atrophy inhindlimb-unweighted rats. J. AppL Physiol. 88:359-363, 2000.

22. PERREAULT, M., L. DOMBROWSKI, and A. MARETTE. Mechanism ofimpaired nitric oxide synthase activity in skeletal muscle of strep-tozotocin-induced diabetic rats. Diabetologia 43:427-437, 2000.

23. RUSSELL, S. L. J. C., and A. W. TAYLOR. Determination of glycogenin small tissue samples. J. Appl. Plhysiol. 28:234-236, 1970.

24. SCHRECK, R., P. RiEBER, and P. A. BAEUERLE. Reactive oxygenintermediates as apparently widely used messengers in the acti-vation of the NF-kB transcription factor and HIV-1. EMBO J.10:2247-2258, 1991.

25. SCHUELKE, M., K. R. WAGNER, L. E. STOLZ, et al . Myostatinmutation associated with gross muscle hypertrophy in a child. N.EngL J. Med. 350:2682-2688, 2004.

26. TACHI, M., M. KouzAKi, H. KANEHISA, and T. FUKUNAGA. Theinfluence of circulatory difference on muscle oxygenation andfatigue during intermittent static dorsiflexion. Eur. J. Appl.Phlysiol. 91:682-688, 2004.

27. TAKARADA, Y., Y. NAKAMURA, S. ARUGA, T. ONDA, S. MIYAZAKI,and N. ISHII. Rapid increase in plasma growth hormone afterlow-intensity resistance exercise with vascular occlusion. J. Appl.Phzysiol. 88:61-65, 2000.

28. TATsuMI, R., A. HATTORI, Y. IKEucHI, J. E. ANDERSON, and R. E.ALLEN. Release of hepatocyte growth factor from mechanicallystretched skeletal muscle satellite cells and role of pH and nitricoxide. MoL BioL Cell. 13:2909-2918, 2002.

29. TIDBALL, J., G. M. J. SPENCER, M. WEHLING, and E. LAVERGNE.Nitric-oxide synthase is a mechanical signal transducer that mod-ulates talin and vinculin expression. J. Biol. Chem. 274:33155-33160, 1999.

30. WILLOUGHBY, D. S. Effects of heavy resistance training on myo-statin mRNA and protein expression. Med. Sci. Sports Exerc.36:574-582, 2004.

1150 Official Journal of the American College of Sports Medicine http://www.acsrn-msse.org

COPYRIGHT INFORMATION

TITLE: Skeletal Muscle Hypertrophy after Chronic Restriction ofVenous Blood Flow in Rats

SOURCE: Med Sci Sports Exercise 37 no7 Jl 2005WN: 0518201727010

The magazine publisher is the copyright holder of this article and itis reproduced with permission. Further reproduction of this article inviolation of the copyright is prohibited.

Copyright 1982-2005 The H.W. Wilson Company. All rights reserved.

Documents

Skeletal Muscle Hypertrophy After Chronic Restriction of Venous Blood Flow in Rats