Embed Size (px)
Citation preview
Ss
RQa
Ab
a
ARRA
KCDFHSS
1
a(KmC
(fiHt
h0
Scientia Horticulturae 176 (2014) 330–339
Contents lists available at ScienceDirect
Scientia Horticulturae
journa l h om epa ge: www.elsev ier .com/ locate /sc ihor t i
hoot recovery and genetic integrity of Chrysanthemum morifoliumhoot tips following cryopreservation by droplet-vitrification
en-Rui Wanga,1, Xiao-Xia Gaoa,1, Long Chena, Liu-Qing Huoa, Ming-Fu Lib,iao-Chun Wanga,∗
State Key Laboratory of Crop Stress Biology for Arid Areas, Key Laboratory of Genetic Improvement of Horticultural Plants of Northwest China, Ministry ofgriculture of China, College of Horticulture, Northwest A&F University, Yangling 712100, Shaanxi, People’s Republic of ChinaChinese Academy of Inspection and Quarantine (CAIQ), Chaoyang DistrictBeijing 100029, People’s Republic of China
r t i c l e i n f o
rticle history:eceived 22 April 2014eceived in revised form 22 June 2014ccepted 21 July 2014
eywords:hrysanthemum morifoliumroplet-vitrificationCMistologySRhoot tips
a b s t r a c t
We reported here an efficient, widely applicable droplet-vitrification cryopreservation for shoot tipsof Chrysanthemum morifolium. Nodal segments, each being 0.5 cm in length and containing one budpositioned on nodes 3–7, were taken from 6 weeks old stock shoots and cultured on a shoot maintenancemedium (SMM) for 12 days to promote bud elongation. Shoot tips (2.0 mm in size) containing 5–6 leafprimordia were excised from elongated buds and precultured on Murashige and Skoog medium (MS)containing 0.5 M sucrose for 1 day. Precultured shoot tips were loaded, dehydrated with PVS2 for 30 min at0 ◦C and then transferred onto droplets containing 2.5 �l PVS2 on aluminum foils (2 cm × 0.8 cm), prior toa direct immersion in liquid nitrogen (LN) for 1 h. Thawed shoot tips were post-cultured on shoot recoverymedium containing MS supplemented with 0.05 mg L−1 GA3 in the dark for 3 days and then transferredon the same medium under standard culture conditions for shoot recovery. The droplet-vitrificationprocedure resulted in the highest (83%) and lowest (43%) shoot regrowth rates for C. morifolium ‘Japanese
Red’ and ‘Xizi Qiuzhuang’, with an average rate of 68% in six C. morifolium genotypes tested. Histologicalobservations showed that the pattern and percentage of surviving cells were similar in cryopreservedshoot tips of these two genotypes. No polymorphic bands were detected by simple sequence repeats(SSR) and ploidy levels analyzed by flow cytometry (FCM) were maintained in plantlets regeneratedfrom cryopreserved shoot tips of the two genotypes.© 2014 Elsevier B.V. All rights reserved.
. Introduction
Chrysanthemum (Chrysanthemum morifolium Ramat.) is glob-lly the second most important floricultural crop following roseTeixeira da Silva, 2004). In Asian countries like China, Japan andorean, Chrysanthemum has also long been used as medicines,ainly due to its pharmacological functions (China Pharmacopoeia
ommittee, 2005).China is an original center for many Chrysanthemum species
Chen, 2012). Conservation of genetic resources is a prerequisiteor breeding of novel cultivars by both classic and genetic engineer-
ng programs, and further exploitations of medicine-valued species.owever, threats imposed by industrialization and urbanizationhat have been occurring since the last years in China are making
∗ Corresponding author. Tel.: +86 29 87081660; fax: +86 29 87081660.E-mail address: [email protected] (Q.-C. Wang).
1 These authors contributed equally to the present study.
ttp://dx.doi.org/10.1016/j.scienta.2014.07.031304-4238/© 2014 Elsevier B.V. All rights reserved.
plant genetic resources including Chrysanthemum face dangers ofextinction. Cryopreservation, i.e. storage of living samples at ultra-low temperatures, usually in that of liquid nitrogen (LN, −196 ◦C),has long been recognized as an ideal means for the long-term con-servation of plant germplasm including ornamental species (Wangand Perl, 2006; Kulus and Zalewska, 2014).
Fukai (1990) and Fukai et al. (1991) were the first to suc-cessfully cryopreserve Chrysanthemum shoot tips using two-stepcooling. Since then, various cryopreservation protocols have beendescribed, such as preculture-desiccation (Hitmi et al., 1999,2000), encapsulation–dehydration (Sakai et al., 2000; Halmagyiet al., 2004; Martín and González-Benito, 2005; Martín et al.,2011), vitrification (Martín and González-Benito, 2005), DMSOdroplet (Halmagyi et al., 2004) and droplet-vitrification (Halmagyiet al., 2004; Lee et al., 2011). Two-step cooling had to use
dimethylsulfoxide (DMSO), which resulted in abnormal plants fromcryopreserved shoot tips (Fukai, 1990; Fukai et al., 1991). In vitri-fication and encapsulation–dehydration, the stock cultures hadto be cold-hardened for 3 weeks (Sakai et al., 2000; Martín and
orticu
GegaC
ct(ed(ftmG
rcodM(gedieicC
adcgr
2
2
ewvRatCsSawstcc
2
ceo
R.-R. Wang et al. / Scientia H
onzález-Benito, 2005; Martín et al., 2011), which requiresxpensive growth chamber and is time-consuming. In addition,enotype-dependent response is still very common, and efficientnd widely applicable cryopreservation protocol is still lacking forhrysanthemum (Martín and González-Benito, 2009).
Droplet-vitrification has been proved to be a suitable proto-ol for cryopreservation of a wide range of genotypes withinhe same species such as Musa (Panis et al., 2005), SolanumKim et al., 2006), Malus (Halmagyi et al., 2010) and Allium (Kimt al., 2012). Highly effective and user-friendlier characteristics ofroplet-vitrification have been demonstrated in ChrysanthemumLee et al., 2011). However, a droplet-vitrification cryopreservationor diverse Chrysanthemum genotypes has not yet been reported,hus limiting routine applications of cryopreservation to establish-
ent of cryo-banking of Chrysanthemum germplasm (Martín andonzález-Benito, 2009).
One of the most concerned issues is genetic stability inegenerants recovered form cryopreservation. Studies have beenonducted on assessments of genetic stability in regenerantsf Chrysanthemum following cryopreservation by encapsulation–ehydration and vitrification (Martín and González-Benito, 2005;artín et al., 2011). Cryo-injury varied with cryo-procedures
Wang et al., 2005, 2013, 2014), which may result in differences inenetic stability in regenerants recovered from different cryopres-rvation protocols (Martín and González-Benito, 2005). However,ata have been quite limited on assessments of genetic stabil-
ty in regenerants from droplet-vitrification cryopreservation (Leet al., 2011). Therefore, it is necessary to assess genetic stabil-ty in regenerants following droplet-vitrification, in order for thisryo-procedure to be applied for establishment of cryo-banking ofhrysanthemum germplasm.
The objective of the present study was, therefore, to developn efficient droplet-vitrification cryopreservation for shoot tips ofiverse Chrysanthemum genotypes. Histological observations onell survival pattern, and assessments of genetic stability by sin-le sequence repeats (SSR) and by flow cytometry (FCM) in theegenerants following cryopreservation were also conducted.
. Materials and methods
.1. Plant materials
C. morifolium ‘Japanese Red’ was used for optimizing the param-ters in droplet-vitrification procedure. Five additional genotypesere subsequently used for testing the developed droplet-
itrification procedure. Of the six genotypes, ‘Fall Color’, ‘Japaneseed’ and ‘Xizi Qiuzhuang’ are used as pot flowers, and ‘Roma Red’nd ‘Jinba’ as cut flowers. ‘Hangju’ is of pharmacological func-ions and mainly used as medicine in China (China Pharmacopoeiaommittee, 2005). In vitro stock shoots were maintained on ahoot maintenance medium (SMM) composed of Murashige andkoog (1962) medium (MS) supplemented with 30 g L−1 sucrosend 7 g L−1 agar (Sigma Chemical Co., USA). The pH of the mediumas adjusted to 5.8 prior to autoclaving at 121 ◦C for 20 min. The
tock cultures were maintained at 22 ± 2 ◦C under a 16-h pho-operiod with a light intensity of 50 �mol s−1 m−2 provided byool-white fluorescent tubes (standard culture conditions). Sub-ulture was done once every 4 weeks.
.2. Cryopreservation and shoot recovery
Three sizes of shoot tips: 0.5, 1.0 and 2.0 mm (Fig. 1a) in lengthontaining 1–2, 3–4, 5–6 leaf primordia (LPs), respectively, werexcised from terminal buds of 4 weeks old stock shoots. Basedn our preliminary studies, shoot tips were directly precultured
lturae 176 (2014) 330–339 331
on MS enriched with 0.25, 0.5, 0.75 M sucrose for 1 day, to selectan optimal sucrose concentration for cryopreservation. Precul-tured shoot tips were treated for 20 min at room temperaturewith a loading solution composed of MS containing 0.4 M sucroseand 2 M glycerol contained in sterile plastic Petri dishes (9 cm indiameter). Loaded shoot tips were exposed to plant vitrificationsolution 2 (PVS2) (Sakai et al., 1990) at 0 ◦C for 10–40 min. PVS2is composed of MS supplemented with 30% (w/v) glycerol, 15%(w/v) ethylene glycol, 15% (w/v) DMSO and 0.4 M sucrose (pH 5.8).Each shoot tip was transferred onto a droplet containing 2.5 �lPVS2 carried on an aluminum foil (2 cm × 0.8 cm) (Fig. 1b), fol-lowed by a direct immersion in LN. After staying in LN for a fewminutes, the foils with shoot tips were transferred into a 2 ml cry-otube filled with LN for cryostorage for 1 h. Frozen foils with shoottips were moved out from LN and immediately placed into anunloading solution containing liquid MS containing 1.2 M sucroseat room temperature for 20 min. Based on our preliminary stud-ies, cryopreserved shoot tips were post-cultured for shoot recoveryon three shoot recovery medium (SRM): (1) on SRM1 contain-ing SMM supplemented with 1.0 mg L−1 6-benzylaminopurine (BA)and 2.0 mg L−1 �-naphthalene acetic acid (NAA) under standardculture conditions, as described by Hitmi et al. (1999, 2000); (2)on SRM2 containing SMM supplemented with 1.0 mg L−1 BA and0.1 mg L−1 NAA under standard culture conditions, as describedby Halmagyi et al. (2004); (3) on SRM3 containing SMM supple-mented with 0.05 mg L−1 gibberellic acid-3 (GA3) in the dark for3 days and then transferred on the same medium under standardculture conditions. Filter-sterilized GA3 was added to the mediumafter autoclaving, while BA and NAA to the medium before auto-claving. Survival was expressed as the percentage of shoot tipsshowing any green tissues of the total samples used for cryopres-ervation after 7 days of post-culture (Fig. 1c), while shoot regrowthwas defined as percentage of shoot tips regenerating into shoots≥0.5 mm of the total samples after 4 weeks of post-culture. Shoots(≥0.5 cm in length) were transferred on SMM for further shootgrowth and root development. Shoots with roots developed after8 weeks on SMM were acclimated and transferred to soil undergreenhouse conditions, according to a method described by Wanget al. (2005).
2.3. Improvement of shoot recovery
When we applied the droplet-vitrification procedure estab-lished above to other five Chrysanthemum genotypes, shootregrowth rates were low and some genotypes even failed toshoot regrowth. In addition, shoot tips from terminal buds wereused, meaning that only one shoot tip can be taken from eachof in vitro stock shoots. Therefore, an experiment was furtherdesigned in order to improve cryopreservation efficiency in termsof shoot recovery rate and shoot tip production. Nodal seg-ments, each being about 0.4 cm in length and containing onebud, were taken from nodes positioned from 1 (youngest, api-cal bud) to 8 (oldest, axillary bud) of 4 and 6 weeks old stockshoots and numbered as 1–8 (Fig. 1d). The segments were cul-tured on SMM to promote bud elongation (Fig. 1e). After 12days of culture, shoot tips (2.0 mm in size) containing 5–6 LPswere excised from the elongated buds (Fig. 1e1) and used forcryopreservation using the optimized parameters as describedabove.
2.4. Histological observation
Histological observations were conducted to compare patternand number of surviving cells in cryopreserved shoot tips oftwo genotypes: ‘Japanese Red’ and ‘Xizi Qiuzhuang’ that pro-duced the highest (83%) and lowest (43%) shoot regrowth rate,
332 R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339
Fig. 1. Cryopreservation of shoot tips of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification. (a) A shoot tip (2.0 mm) containing 5–6 leaf primordia used forcryopreservation. (b) Droplets of 2.5 �l PVS2, each containing a shoot tip, carried on an aluminum foil. (c) A surviving shoot tip after 7 days of post-culture on SRM3. (d)A 6-weeks-old stock shoot with 8 nodes. (e) Segments taken from buds positioned on 1–8 nodes of 6 weeks old stock shoots and culture on SMM for 12 days to promotebud elongation (e1). (f) Massive callus developed without shoot regrowth in cryopreserved shoot tips that had been post-cultured on SRM1. (g) Leaves developed withouts h) Hypo lturede
rpfieffdcdw2imvaa
2
tf
hoot regrowth in cryopreserved shoot tips that had been post-cultured on SRM2. (n SRM2. (i) A shoot regenerated from cryopreserved shoot tips that had been custablished in soil.
espectively. Cryopreserved shoot tips that had been thawed andost-cultured on SRM3 for 1 day in the dark were collected,xed with formalin–acetic–alcohol solution (FAA), dehydrated andmbedded as described by Feng et al. (2013). Shoot tips that werereshly excised served as positive control, while those that werereshly excised, directly immersed in LN and post-cultured for 1ay served as negative control. Both the positive and negativeontrols followed all steps of fixation, dehydration and embed-ing as used for cryopreserved shoot tips. Five �m thick sectionsere cut from embedded samples with a microtome (Leica DM
000, Germany), mounted on glass slides, stained with 0.01% tolu-dine blue (TB) (Saikai, 1973), and were observed under a light
icroscope (Leica DM 2235, Germany). Number of total and sur-iving cells was manually counted in cryopreserved shoot tips,nd percentages of surviving cells were calculated and presented,ccording to Wang et al. (2014).
.5. Assessment of genetic stability
Plantlets of two genotypes: ‘Japanese Red’ and ‘Xizi Qiuzhuang’hat produced the highest and lowest shoot regrowth, respectively,ollowing cryopreservation, were used for this purpose by SSR
erhydric shoots regenerated from cryopreserved shoot tips that had been cultured on SRM3. (j) Plants regenerated from cryopreserved and control shoot tips and
and FCM, in order to compare genetic stability in the regenerantsbetween the two genotypes. After 12 months of shoot regeneration,samples were taken for assessments of genetic integrity by SRR andFCM.
2.5.1. SSRGenomic DNA was extracted from 0.5 g fresh leaf tissue accord-
ing to protocol of Porebski et al. (1997). Purified total DNA wasquantified and its quality verified by ultraviolet spectrophoto-metry. Each sample was diluted to 50 ng �L−1 in Tris–EDTA bufferand stored at −20 ◦C until use.
Thirty-six SSR primers were screened to select suitable primersfor assessment of genetic stability in the regenerants. Eight SSRprimer pairs selected were used for providing PCR products. PCRwas performed in a 20-�l reaction solution containing 1 �l eachprimer (forward and reverse primer), 10 �l TaqMix (Cwbiotech,China), 2 �l DNA template and 6 �l ddH2O. Conditions for PCRamplification were 94 ◦C for 3 min, 35 cycles each at 94 ◦C for
30 s, annealing temperature varied according to requirements ofprimers (Khaing et al., 2013) for 45 s, and 72 ◦C for 1 min, fol-lowed by a final extension at 72 ◦C for 10 min. The PCR productswere separated by electrophoresis in 9% native polyacrylamide gel
orticulturae 176 (2014) 330–339 333
eiC
2
dttfia(wlo(aC
2
m(sAmww2osada
ewtpvsrr
3
3
diet3
3
iaweo(
Fig. 2. Effects of time duration of exposure to PVS2 on shoot regrowth of the treatedcontrol (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium‘Japanese Red’ by droplet-vitrification. Shoot tips (2 mm in size) containing 5–6 leafprimordia excised from terminal buds of 4 weeks old stock cultures were precul-tured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposedto PVS2 at 0 ◦C for 0–40 min, prior to a direct immersion in LN. Thawed shoot tipswere post-cultured on SRM3 in the dark for 3 days and then transferred on thesame medium under standard culture conditions for shoot recovery. Results are pre-sented as means ± SE. Data with different letters in the same line indicate significant
Fig. 3. Effects of sucrose concentrations in preculture medium on shoot regrowthrate of the treated control (−LN) and cryopreserved shoot tips (+LN) of Chrysan-themum morifolium ‘Japanese Red’. Shoot tips (2 mm in size) containing 5–6 leafprimordia excised from terminal buds of 4 weeks old stock cultures were precul-tured with 0.25–0.75 M sucrose for 1 day. Precultured and loaded shoot tips were
R.-R. Wang et al. / Scientia H
lectrophoresis (native-PAGE) and visualized following silver stain-ng. The molecular marker used DNA 50 bp ladder (Cwbiotech,hina) was used for estimating the size of amplified products.
.5.2. FCMNuclear suspensions from young leaves were prepared, as
escribed by Huang et al. (2013) and nuclei were released fromhe cells by chopping samples with a razor blade in Marie’s isola-ion buffer (Galbraith et al., 1983). The suspension of nuclei wasrst filtered through a 50 �m nylon filter to remove cell fragmentsnd large tissue debris, and then 50 �g mL−1 of propidium iodidePI) (Sigma, St. Louis, MO, USA) and 20 �g ml−1 of RNAse (Sigma)ere added to the samples to stain the DNA. Samples were ana-
yzed within a 15-min period in a flow cytometer. The fluorescencef samples was measured using a BD Accuri C6 flow cytometerBD Biosciences, California, USA). Histograms were generated afternalyses of at least 5000 nuclei using the software FSC 3.0 Flowytometry Express.
.6. Experimental design and statistical analysis
In cryopreservation experiments, shoot tips receiving all treat-ents but without cooling in LN served as the treated control
−LN) and cryopreserved shoot tips served as +LN. At least 10hoot tips were included in each treatment of three replicates.ll experiments were conducted twice. Results are presented aseans with their standard error. The data were analyzed using one-ay ANOVA and Student’s t-test. Least significant differences (LSD)ere calculated at P < 0.05. In histological observation experiments,
0 samples were used in each of two replicates. In assessmentf genetic stability, 30 regenerants recovered from cryopreservedhoot tips and 30 in vitro stock shoots were randomly selected from
population of 300 cryo-derived plants and 300 in vitro culture-erived plants and used for assessment of genetic stability by SSRnd FCM.
For SSR analysis, fingerprints were manually scored for the pres-nce (1) and absence (0) of each band. Bands of equal moleculareight and mobility generated by the same primer were considered
o represent the same locus. Both distinct monomorphic bands andolymorphic bands were scored. Electrophoretic DNA bands of lowisual intensity that could not be readily distinguished were con-idered ambiguous markers and not scored. The experiments wereepeated twice to confirm their repeatability, and only reliable andepeatable bands were included in the data analysis.
. Results
.1. Effects of time duration of exposure to PVS2
Shoot regrowth rate of the treated control (−LN) graduallyecreased from 93.8% to 58.3% as time duration of exposure to PVS2
ncreased from 0 to 40 min (Fig. 2). Shoot regrowth rate of cryopres-rved shoot tips (+LN) significantly increased with an increase inime duration of exposure to PVS2, reached a maximum (61.6%) at0 min and then sharply decreased to 15.0% at 40 min (Fig. 2).
.2. Effects of sucrose preculture
Sucrose concentrations in preculture medium significantlynfluenced shoot regrowth. Shoot regrowth rates were 54.2%, 75.0%nd 22.9% in the treated control (−LN) that had been precultured
ith 0.25, 0.5 and 0.75 M sucrose, respectively (Fig. 3). For cryopres-rved shoot tips (+LN), the highest shoot regrowth rate (62.5%) wasbtained at 0.5 M sucrose (Fig. 3). Both lower (0.25 M) and higher0.75 M) sucrose resulted in markedly reduced shoot regrowth rate.
differences at P < 0.05 by Student’s t-test.
3.3. Effects of size of shoot tips
For the treated control (−LN), 1.0 mm shoot tips produced thelower shoot regrowth rate (80.3%) than 1.5 mm (91.7%) and 2.0 mm(97.9%) shoot tips (Table 1). For cryopreserved shoot tips (+LN),shoot regrowth rate significantly increased from 45.8% to 66.7% assize of shoot tips increased from 1 mm to 2 mm.
exposed to PVS2 at 0 ◦C for 30 min, prior to a direct immersion in LN. Thawed shoottips were post-cultured on SRM3 in the dark for 3 days and then transferred on thesame medium under standard culture conditions for shoot recovery. Results are pre-sented as means ± SE. Data with different letters in the different treatment indicatesignificant differences at P < 0.05 by Student’s t-test.
334 R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339
Table 1Effects of size of shoot tips on shoot regrowth rate of the treated control (−LN)and cryopreserved shoot tips (+LN) of Chrysanthemum morifolium ‘Japanese Red’ bydroplet-vitrification.
Meristem size (mm)with number of LPa
Shoot regrowth rate (%)
−LN +LN
1.0 with 1–2 LPs 80.3 ± 3.3y 45.8 ± 4.2b1.5 with 3–4 LPs 91.7 ± 2.7xy 50.0 ± 4.6b2.0 with 5–6 LPs 97.9 ± 2.1x 66.7 ± 4.2a
Three sizes of shoot tips excised from terminal buds of 4 weeks old stock cultureswere precultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tipswere exposed to PVS2 at 0 ◦C for 30 min, prior to a direct immersion in LN. Thawedshoot tips were post-cultured on SRM3 in the dark for 3 days and then transferredon the same medium under standard culture conditions for shoot recovery. Resultsas
3
eb(F4c(Wip4iwsvf
3
(tspts(
TEc‘
SbPtsta
B
Table 3Cryopreservation of Chrysanthemum morifolium shoot tips by droplet-vitrification.
Genotypes Origin Main use Survival rate(%)
Shoot regrowthrate (%)
‘Roma Red’ Japan Cut flower 75 ± 3 70 ± 4‘Jinba’ Japan Cut flower 90 ± 5 80 ± 5‘Japanese Red’ Japan Pot flower 93 ± 5 83 ± 4‘Fall Color’ China Pot flower 90 ± 3 60 ± 5‘Xizi Qiuzhuang’ China Pot flower 65 ± 2 43 ± 3‘Hangju’ China Medicine 95 ± 3 73 ± 4
Average 85 68
Shoot tips (2 mm in size) containing 5–6 leaf primordia were excised from elongatedbuds positioned on nodes 3–7 of 6 weeks old stock shoots, and precultured with0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2
◦
re presented as means ± SE. Data with different letters in the same column indicateignificant differences at P < 0.05 by Student’s t-test.
a LP = leaf primordium
.4. Effects of shoot recovery medium (SRM)
SRM did not significantly affect survival rates, but had strongffects on shoot regrowth rates. Survival rates were similarly high inoth the treated control (−LN) (>92%) and cryopreserved shoot tips+LN) (>85%) when post-cultured on all three SRM tested (Table 2).or the treated control (−LN), SRM1, SRM2 and SRM3 gave 37.1%,0.8% and 70.0% of shoot regrowth rates, respectively. When post-ultured on SRM1, cryopreserved shoot tips (+LN) developed callusFig. 1f), with only 1.7% of shoot regrowth rate produced (Table 2).
hen post-cultured on SRM2, three types of regrowth were foundn cryopreserved shoot tips. About 52% of cryopreserved shoot tipsroduced only leaves without shoot development (Fig. 1g). About8% of cryopreserved shoot tips developed multiple shoots through
ntermediate callus formation, but majority of shoots regeneratedere hyperhydric (Fig. 1h) and only 5.4% of them were normal
hoots. When post-cultured on SRM3, about 60% of cryopreser-ed shoot tips regenerated single shoots directly without callusormation (Fig. 1i).
.5. Improvement of shoot recovery
There were no significant differences in shoot regrowth rates48.2–59.4%) in cryopreserved shoot tips when the samples wereaken from buds positioned on nodes 1–6 of 4 weeks old stockhoots (Fig. 4). Shoot tips from buds positioned on 7 and 8 nodes
roduced much lower shoot regrowth rates (17.5–30.8%). Shootips taken from buds positioned on nodes 3–7 of 6 weeks oldtock shoots produced the similarly high shoot regrowth rates81.3–91.3%) in cryopreserved shoot tips (Fig. 4). Shoot tips takenable 2ffects of shoot recovery media on survival and shoot regrowth rate of the treatedontrol (−LN) and cryopreserved shoot tips (+LN) of Chrysanthemum morifoliumJapanese Red’ by droplet-vitrification.
Post-culturemediuma
Survival rate (%) Shoot regrowth rate (%)
−LN +LN −LN +LN
SRM1 95.0 ± 3.4x 94.6 ± 5.2a 37.1 ± 3.0y 1.7 ± 2.1bSRM2 92.2 ± 3.7x 90.8 ± 4.4a 40.8 ± 1.9y 5.4 ± 2.5bSRM3 92.5 ± 3.1x 85.8 ± 4.5a 70.0 ± 3.2x 60.0 ± 2.6a
hoot tips (2 mm in size) containing 5–6 leaf primordia excised from terminaluds of 4 weeks old stock cultures were precultured with 0.5 M sucrose for 1 day.recultured and loaded shoot tips were exposed to PVS2 at 0 ◦C for 30 min, prioro a direct immersion in LN. Thawed shoot tips were post-cultured on SRM1-3 forhoot recovery. Results are presented as means ± SE. Data with different letters inhe same column indicate significant differences at P < 0.05 by Student’s t-test.
SRM1 = MS + 1.0 mg L−1 BA + 2.0 mg L−1 NAA; SRM2 = MS + 1.0 mg L−1
A + 0.1 mg L−1 NAA; SRM3 = MS + 0.05 mg L−1 GA3.
at 0 C for 30 min, prior to a direct immersion in LN. Thawed shoot tips were post-cultured SRM3 in the dark for 3 days and then transferred on the same medium understandard culture conditions for shoot recovery. Results are presented as means ± SE.
from buds positioned on nodes 1, 2 and 8 resulted in markedlylower shoot regrowth rates. Mean shoot regrowth rate was muchlower in cryopreserved shoot tips taken from 4 weeks old stockshoots (46.1%) than that (76.4%) from 6 weeks old ones (Fig. 4).
3.6. Application of the droplet-vitrification protocol to other fivegenotypes of C. morifolium
Following cryopreservation, the highest (93%) and lowest (65%)survival rates were found in ‘Japanese Red’ and ‘Xizi Qiuzhuang’,with a mean survival rate (85%) produced in the six genotypestested (Table 3). Shoot tips of all six genotypes were able to regener-ate into shoots. The highest (83%) and lowest (43%) shoot regrowthrates were found in ‘Japanese Red’ and ‘Xizi Qiuzhuang’, with amean rate of 68% obtained in the six genotypes tested. Almostall shoots developed roots after 4 weeks on SMM. More than 95%plantlets were successfully established in soil in greenhouse condi-tions. Morphologies were identical in plants regenerated betweencryopreserved shoot tips and in vitro stock shoots (Fig. 1j).
3.7. Histological observations
In the positive control, dense TB-stained and well-preservedcytoplasm were clearly observed in the cells of shoot tips (Fig. 5a). Inthe negative control, nuclei were heavily condensed and structureof cells was hardly observed in the cells of shoot tips (Fig. 5b). Fol-lowing cryopreservation, cells located in the basal parts of shoottips and elder LPs 4–6 were killed, while those in apical dome(Fig. 5c and e) and LPs 1–3 (Fig. 5d and f) survived. Pattern of surviv-ing cells was similar between ‘Japanese Red’ (Fig. 5c and d) whichproduced the highest shoot regrowth rate and ‘Xizi Qiuzhuang’(Fig. 5e and f), which gave the lowest rate. Percentages of survivingcells in the apical dome and the LPs 1–3 were very similar: about75.9% for ‘Japanese Red’ and 72.7% for ‘Xizi Qiuzhuang’.
3.8. Assessment of genetic stability
3.8.1. SSROut of the thirty-six primers screened in the SSR analysis, eight
primers produced strong, clear, reproducible bands and yielded 85and 76 scored bands in each of plantlets regenerated from cryo-preserved shoot tips of ‘Japanese Red’ (the highest shoot regrowth)and ‘Xizi Qiuzhuang’ (the lowest shoot regrowth) (Table 4 andFig. 6a and b), with total 2550 bands and 2280 bands produced
by the former and the latter, respectively, across the 30 plants ana-lyzed. The number of bands for each primer varied from 5 to 19for ‘Japanese Red’ and 5 to 13 for ‘Xizi Qiuzhuang’, with an averageof 10.6 and 9.5 bands per primer produced by the former and the
R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339 335
Fig. 4. Effects of bud positions of 4 and 6 weeks old stock shoots on shoot regrowth rate of cryopreserved shoot tips of Chrysanthemum morifolium ‘Japanese Red’ by droplet-vitrification. Shoot tips (2 mm in size) containing 5–6 leaf primordia excised from elongated buds positioned on different nodes of 4 and 6 weeks old stock cultures wereprecultured with 0.5 M sucrose for 1 day. Precultured and loaded shoot tips were exposed to PVS2 at 0 ◦C for 30 min, prior to a direct immersion in LN. Thawed shoot tipswere post-cultured on SRM3 in the dark for 3 days and then transferred on the same medium under standard culture conditions for shoot recovery. Results are presented asmeans ± SE. Data with different letters in stock shoots at the same age indicate significant differences at P < 0.05 by Student’s t-test. Means represent average shoot regrowthrate in cryopreserved shoot tips taken from elongated buds positioned on nodes 1–8 of 4 and 6 weeks old stock shoots.
Fig. 5. Histological observations in transverse sections of shoot tips of Chrysanthemum morifolium ‘Japanese Red’ and ‘Xizi Qiuzhuang’. Living cells are indicated by whitearrows, while dead cells by black arrows. (a) A positive control shoot tip. Living cells showed dense, TB-stained and well preserved cytoplasm, with nucleolus enclosed innucleus. (b) A negative control shoot tip. Dead cells showed much weaker TB-stained cytoplasm. Nuclei were heavily condensed. (c) An apical dome (AD) of cryopreservedshoot tips of ‘Japanese Red’. (d) A leaf primordium 3 of cryopreserved shoot tip of ‘Japanese Red’. (e) An apical dome (AD) of cryopreserved shoot tips of ‘Xizi Qiuzhuang’. (f)A leaf primordium 3 of cryopreserved shoot tip of ‘Xizi Qiuzhuang’. Bars represent 50 �m.
336 R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339
Table 4SSR primer names, primer sequences, and number of amplified bands in plantlets regenerated from cryopreserved shoot tips of ‘Japanese Red’ and ‘Xizi Qiuzhuang’.
Primer name Primer sequence (5′–3′) Number of amplified bands Number of polymorphic bands
‘Japanese Red’ ‘Xizi Qiuzhuang’ ‘Japanese Red’ ‘Xizi Qiuzhuang’
KNUCRY-10 (GT)2CTTCATC(CCA)3 (TG)2(AG)3TGAGTGTA(GT)2GAG 5 5 0 0KNUCRY-16 TGTTCACCCATT(CA)2GCTC(CA)2TGTATGACTAGGTGAGGTGA 9 10 0 0KNUCRY-35 CCTCGCACTACTTCCAAATGA G(GA)2(TTGT)2TCGTATCCTT 19 13 0 0KNUCRY-59 CGGTC(CT)2CAGCCTTATTG GG(TG)5AAGGTGCT 10 12 0 0KNUCRY-77 CCCGGTTATCAT(GT)2ATGC CGTATTTAAAGG(TT)2CCTTTCG 10 5 0 0KNUCRY-84 CTAGGCTCCTTCAGCCCTCT TCTGGACTAGCCGTCAGTTG 14 10 0 0
1
8
lrs
3
iptQmtr
4
wilRit
Fis
KNUCRY-85 GACCAACAAAACGGAATGCT GTTGTCGTCCGTTGGCTAGT
KNUCRY-98 TCACAT(CA)3TCACTGCAA (TG)4AGGGA(CA)2TGA
Total
atter (Table 4). No polymorphic bands were observed in the plantsegenerated between cryopreserved shoot tips and in vitro stockhoots.
.8.2. FCMSimilar patterns of ploidy levels by FCM analysis were found
n nuclei isolated from leaves of shoots regenerated from cryo-reserved shoot tips and in vitro stock shoots (the control) of thewo Chrysanthemum genotypes ‘Japanese Red’ (Fig. 7A) and ‘Xiziiuzhuang’ (Fig. 7B). These data indicated that ploidy levels wereaintained in the shoots following cryopreservation, and in the
wo genotypes, regardless of their differences in shoot regrowthates.
. Discussion
An efficient, widely applicable droplet-vitrification procedureas described for cryopreserved of shoot tips of C. morifolium
n the present study. With this protocol, the highest (83%) and
owest (43%) shoot regrowth rates were obtained for ‘Japaneseed’ and ‘Xizi Qiuzhuang’, with a mean rate of 68% producedn the six genotypes tested. To the best of our knowledge,his is the widest applicable droplet-vitrification protocol so far
ig. 6. SSR banding patter in plantlets regenerated from cryopreserved shoot tips and in vn Chrysanthemum morifolium ‘Japanese Red’ (a) and in ‘Xizi Qiuzhuang’ (b). M marker, lanhoot tips.
0 12 0 08 9 0 05 76 0 0
reported for cryopreservation of shoot tips of diverse C. mori-folium genotypes with different uses such as pot, cut flowers, andmedicine.
In the present study, two significant improvements were madein cryopreservation of Chrysanthemum shoot tips, compared withthe previous reports using droplet-vitrification (Halmagyi et al.,2004; Lee et al., 2011) and other cryo-procedures (Fukai et al.,1991; Hitmi et al., 1999, 2000; Halmagyi et al., 2004; Martín andGonzález-Benito, 2005; Martín et al., 2011). First, in all previousstudies, at least two plant growth regulators (RGRs) were addedto the culture medium for multiplication of in vitro stock culturesbefore cryopreservation and shoot regrowth following cryopres-ervation (Fukai, 1990; Fukai et al., 1991; Hitmi et al., 1999, 2000;Halmagyi et al., 2004; Martín and González-Benito, 2005; Martínet al., 2011; Lee et al., 2011). With droplet-vitrification, Halmagyiet al. (2004) used 1 mg L−1 BA and 0.1 mg L−1 NAA in stock culturemaintenance medium before cryopreservation, and shoot regrowthmedium after cryopreservation. In the study of Lee et al. (2011),0.15 mg L−1 indoleacetic acid (IAA) and 0.05 mg L−1 zeatin were
added to multiplication medium, while recovery medium con-tained 0.15 mg L−1 IAA, 0.2 mg L−1 zeatin and 0.05 mg L−1 GA3. Inour study, SMM was composed of MS without any PGRs and SRMof MS containing only GA3 at 0.05 mg L−1, thus largely simplifyingitro cultures by the primer combinations KNUCRY-84 (left) and KNUCRY-85 (right)es 1–4 in vitro derived plants, lanes 5–15 plantlets regenerated from cryopreserved
R.-R. Wang et al. / Scientia Horticulturae 176 (2014) 330–339 337
F ro stocb d shoo
tpvtditevp
stdpht0tro
(ttP
ig. 7. Ploidy levels of shoots regenerated from cryopreserved shoot tips and in vity FCM. Control = in vitro stock shoots, +LN = shoots regenerated from cryopreserve
he medium required in in vitro culture steps before and after cryo-reservation, thus avoiding to great degree the risks of geneticariations, which are frequently associated with use of PGRs inissue culture of flower plants including Chrysanthemum (Teixeiraa Silva, 2003; Minano et al., 2009). Second, as mentioned above,
n the two previous reports on droplet-vitrification cryopreserva-ion of Chrysanthemum, only one cultivar was used by Halmagyit al. (2004) and Lee et al. (2011). Our study extended droplet-itrification to six genotypes with different uses, thus showing itsotential applications to diverse Chrysanthemum genetic resources.
Preculture with high sucrose concentration was a necessarytep for obtaining optimal shoot recovery of cryopreserved shootips. Working on cryopreservation of Chrysanthemum shoot tips byroplet-vitrification, Halmagyi et al. (2004) used 0.5 M sucrose inreculture medium for 1 day. Lee et al. (2011) reported that theighest shoot regrowth was obtained in cryopreserved shoot tipshat had been step-wise precultured with 0.3 M sucrose for 31 h,.5 M for 17 h and 0.7 M for 7 h. In the present study, direct precul-ure with 0.5 M sucrose for 1 day resulted in the highest shootegrowth in cryopreserved shoot tips. Our results agreed with thosef Halmagyi et al. (2004).
Chrysanthemum is a kind of plants which are sensitive to PVS2
Halmagyi et al., 2004; Lee et al., 2011). The optimal exposure timeo PVS2 varies with plant species and depends on the tempera-ure during exposure. Exposure to 100% PVS2 for 5 min or 60%VS2 for 15 min at room temperature resulted in the highest shootk shoots of Chrysanthemum morifolium ‘Japanese Red’ (A) and ‘Xizi Qiuzhuang’ (B)t tips.
regrowth rate in cryopreserved shoot tips (Halmagyi et al., 2004).However, comparing effects of several plant vitrification solutions,Lee et al. (2011) found that dehydration with PVS2 at room temper-ature produced the lowest shoot regrowth, while PVS3 (Nishizawaet al., 1993), which contained MS supplemented with 50% glyc-erol and 50% sucrose, gave the best results, with 60 min and 90 minfound optimal for axillary and apical shoot tips, respectively. Dehy-dration with PVS3 at 0 ◦C largely extended exposure time up to120 min without any significant decrease in shoot regrowth rates.Our results showed that dehydration with PVS2 for 30 min at 0 ◦Cresulted in the highest shoot regrowth of cryopreserved shoottips. In the study of Halmagyi et al. (2004), precultured shoot tips,without loading, were directly dehydrated with PVS2 at room tem-perature. These may explain the differences in exposure time toPVS2 between our study and that of Halmagyi et al. (2004). How-ever, we still cannot identify the specific reason causing differentresponse of exposure of Chrysanthemum shoot tips to PVS2 andPVS3 found between our study and that of Lee et al. (2011).
Size of shoot tips was found to significantly influence shootregrowth in cryopreserved shoot tips. For some plant species likeSolanum tuberosum (Halmagyi et al., 2005), Ipomoea batatas (Wangand Volkonen, 2008) and Malus (Li et al., 2014), larger shoot
tips gave higher post-cryopreservation shoot regrowth rate thansmaller ones. In contrast, for some plant species like Castanea sativa(Vidal et al., 2005) and Allium sativum (Kim et al., 2005), smallershoot tips resulted in the higher rate. Our results agreed with those
3 orticu
o(p
atrtbots12lewncbfefties
mwatmsriasdb(
vlwdsrcs
eaAaveTcpssaair
38 R.-R. Wang et al. / Scientia H
f Halmagyi et al. (2005), Wang and Volkonen (2008) and Li et al.2014). Therefore, it seems that suitable size of shoot tips for cryo-reservation needs to be identified in a given species.
Age of donor plants and bud position were demonstrated toffect shoot regrowth in cryopreserved shoot tips. With Solanumuberosum, Halmagyi et al. (2005) found that post-cryopreservationecovery decreased as bud position increased from the terminal tohe basal buds. The present study found that shoot tips taken fromuds positioned on nodes 1–6 of 4 weeks old stock shoots and 3–7f 6 weeks old stock shoots produced higher shoot regrowth thanhose from other nodes. In most of the studies on Chrysanthemum,hoot tips from apical buds were used (Fukai et al., 1991; Hitmi et al.,999, 2000; Halmagyi et al., 2004; Martín and González-Benito,005). Only in the study of Lee et al. (2011), both apical and axil-
ary shoot tips were tested. They found that the apical shoot tipsxcised from 4 weeks old shoots, while axillary ones from 5.5 to 7eeks old shoots, produced the highest shoot recovery. There wereo significant differences in the shoot regrowth rates between api-al and axillary shoot tips. In the present study, apical and axillaryuds taken from either 4 or 6 weeks old stock shoots were culturedor 12 days to promote bud elongation and then shoot tips werexcised from the elongated buds. We found that shoot tips takenrom 6 weeks old stock shoots gave higher shoot regrowth thanhose from 4 weeks old stock cultures. The differences in produc-ng shoot tips used for cryopreservation between the study of Leet al. (2011) and ours made it difficult to compare effects of age oftock cultures on shoot recovery following cryopreservation.
Post-cryopreservation recovery was influenced by recoveryedium. In the present study, effects of three post-culture mediaere investigated on shoot regrowth following cryopreservation,
nd the best results were obtained only when cryopreserved shootips were post-cultured on SRM3, which contained MS supple-
ented with 0.05 mg L−1 GA3 for 3 days in the dark and then undertandard culture conditions. Post-culture on both SRM1 and SRM2esulted in poor shoot recovery. In fact, SRM1 and SRM2 testedn the present study were reported by Hitmi et al. (1999, 2000)nd Halmagyi et al. (2004) for shoot regrowth of cryopreservedhoot tips of Chrysanthemum. The possible reason for this might beue to genotypic effect and/or different cryo-procedures adoptedetween the studies of Hitmi et al. (1999, 2000) and Halmagyi et al.2004), and ours.
The present study found that the pattern and number of sur-iving cells were similar in the two genotypes that produced theowest and highest shoot regrowth, respectively. The similar results
ere also observed in cryopreservation of Lilium shoot tips byroplet-vitrification (Yin et al., 2014). These data indicated thathoot regrowth rates were more affected by composition of theecovery medium than survival pattern and number of survivingells, and therefore, recovery medium needs to be defined for apecific genotype, in order to achieve optimal shoot regrowth.
There have been several studies on genetic stability in regen-rants from cryopreserved shoot tips of Chrysanthemum (Martínnd González-Benito, 2005; Martín et al., 2011; Lee et al., 2011).ssessment of genetic stability by RAPD markers did not detectny polymorphic bands in 21 regenerants from cryopreser-ed shoot tips by vitrification, but one in 25 regenerants byncapsulation–dehydration (Martín and González-Benito, 2005).hese results confirmed again that genetic stability varies withryo-procedures, and should be conducted when a specific cryo-rocedure is used. Further assessments by RAPD and AFLP markershowed that variations started to occur from sucrose preculturetep onwards (Martín et al., 2011). Polymorphic rates were 5.8%
nd 40.1% in regenerants from cryopreserved shoot tips by RAPDnd AFLP markers, respectively (Martín et al., 2011). These resultsndicated that genetic variations detected in post-cryopreservationegenerants may be associated with other steps rather thanlturae 176 (2014) 330–339
freezing in LN. SSR markers are repeats of short nucleotidesequences, usually equal to or less than six bases in length, thatvary in number (Rafalski et al., 1996) and has been used tostudy genetic stability in regenerants from various cryopreser-vation protocols such as vitrification for Malus (Liu et al., 2008),encapsulation–dehydration for Pyrus (Condello et al., 2009) andslow-cooling for Rubus (Castillo et al., 2010). In this study, weused SSR markers to assess genetic stability in post cryopreser-vation regenerants of two Chrysanthemum genotypes representingthe highest and lowest shoot regrowth, and did not detect anyvariations in both of them.
FCM analysis conducted in the present study showed that ploidylevels were maintained in shoots regenerated from cryopreserva-tion compared with the control. Lee et al. (2011) employed FCM foranalyzing DNA content profiles in C. morifolium shoots regeneratedfrom cryopreserved shoot tips by droplet-vitrification, and foundthat the profiles of relative DNA content were the same betweenthe plants developed from cryopreserved shoot tips by droplet-vitrification and by in vitro cultures. Thus, the results of Lee et al.(2011) and reported here supported each other. The similar resultswere also reported in regenerants derived from cryopreservationin plant species such as Oncidium flexuosum (Galdiano et al., 2013),Dendrobium (Galdiano et al., 2014) and Quercus suber (Fernandeset al., 2014). The present study further found that ploidy levelswere not affected in the shoots following cryopreservation in thetwo Chrysanthemum genotypes ‘Japanese Red’ and ‘Xizi Qiuzhuang’,regardless of their different shoot regrowth rates. The FCM analysisis a simple and practical method for rapid evaluation of ploidy lev-els by fast scanning the whole genome using very small amountsof plant material.
In conclusion, an efficient, widely applicable droplet-vitrification cryopreservation was described for six Chrysanthemumgenotypes with different uses. No genetic variations were detectedby both SSR and FCM in the shoots regenerated from cryopreservedshoots tips. Therefore, results obtained here provide a technicalsupport for establishment of cryo-banking of Chrysanthemumgermplasm.
Acknowledgements
We acknowledged a finical support from Chinese Academy ofInspection and Quarantine through a project “Technical Devel-opments of the Entry-exit Inspection and Quarantine for Plants”(Project number: 2013-03). Thanks are given to Dr. Bo Hong fromChina Agricultural University for her kindly providing Chrysanthe-mum materials.
References
Castillo, N.R.F., Bassil, N.V., Wada, S., Reed, B.M., 2010. Genetic stability of cryopres-erved shoot tips of Rubus germplasm. In Vitro Cell. Dev. Biol. Plant 46, 246–256.
China Pharmacopoeia Committee, 2005. Pharmacopoeia of the People’s Republic ofChina, vol. 1. China Chemical Industry Press, Beijing.
Chen, J.Y., 2012. The Origin of Garden Chrysanthemum. Anhui Science & TechnologyPublishing House, Hefei.
Condello, E., Palombi, M.A., Tonelli, M.G., Damiano, C., Caboni, E., 2009. Geneticstability of wild pear (Pyrus pyraster, Burgsd) after cryopreservation byencapsulation–dehydration. Agric. Food Sci. 18, 136–143.
Feng, C.H., Cui, Z.H., Li, B.Q., Chen, L., Ma, Y.L., Zhao, Y.H., Wang, Q.C., 2013. Durationof sucrose preculture is critical for shoot regrowth of in vitro-grown apple shoottips cryopreserved by encapsulation–dehydration. Plant Cell Tissues Organ Cult.112, 369–378.
Fernandes, P., Rodriguez, E., Pinto, G., Rolán-Ruiz, O., Loose, M., Santos, C., 2014. Cryo-preservation of Quercus suber somatic embryos by encapsulation–dehydration
and evaluation of genetic stability. Tree Physiol. 28, 1841–1850.Fukai, S., 1990. Cryopreservation of Chrysanthemum shoot tips. Sci. Hortic. 45,167–174.
Fukai, S., Goi, M., Tanaka, M., 1991. Cryopreservation of shoot tips of Chrysanthemummorifolium and related species native to Japan. Euphytica 54, 201–204.
orticu
G
G
G
H
H
H
H
H
H
K
K
K
K
K
L
L
L
M
M
R.-R. Wang et al. / Scientia H
albraith, D.W., Harkins, K.R., Maddox, J.M., Ayres, N.M., Sharma, D.P., Firoozabady,E., 1983. Rapid flow cytometric analysis of the cell-cycle in intact plant-tissues.Science 220, 1049–1051.
aldiano Jr., R.F., Macedo Lemos, E.G., Vendrame, W.A., 2013. Cryopreservation, earlyseedling development, and genetic stability of Oncidium flexuosum Sims. PlantCell Tissues Organ Cult. 114, 139–148.
aldiano Jr., R.F., Macedo Lemos, E.G., Faria, R.T., Vendrame, W.A., 2014. Seedlingdevelopment and evaluation of genetic stability of cryopreserved Dendrobiumhybrid mature seeds. Appl. Biochem. Biotechnol. 172, 2521–2529.
almagyi, A., Deliu, C., Coste, A., 2005. Plant regrowth from potato shoot tips cryo-preserved by a combined vitrification-droplet method. Cryo Letters 26, 313–322.
almagyi, A., Deliu, C., Isac, V., 2010. Cryopreservation of Malus cultivars: compari-son of two droplet protocols. Sci. Hortic. 124, 387–392.
almagyi, A., Fischer-klüver, G., Mix-Wagner, G., Schumacher, H.M., 2004. Cryopres-ervation of Chrysanthemum morifolium (Dendranthema grandiflora Ramat.) usingdifferent approaches. Plant Cell Rep. 22, 371–375.
itmi, A., Barthomeuf, C., Sallanon, H., 1999. Cryopreservation of Chrysanthemumcinerariaefolium shoot tips: effects of pretreatment conditions and retention ofbiosynthetic capacity. Cryo Letters 20, 109–120.
itmi, A., Barthomeuf, C., Sallanon, H., 2000. Cryopreservation of Chrysanthemumcinerariaefolium shoot tips. J. Plant Physiol. 156, 408–412.
uang, H., Tong, Y., Zhang, Q.J., Gao, L.Z., 2013. Genome size variation amongand within Camellia species by using flow cytometric analysis. PLOS ONE 8,e64981.
haing, A.A., Moe, K.T., Hong, W.J., Park, C.S., Yeon, K.H., Park, H.S., Kim, D.C., Choi,B.J., Jung, J.Y., Chae, S.C., Lee, K.M., Park, Y.J., 2013. Phylogenetic relationshipsof chrysanthemums in Korea based on novel SSR markers. Genet. Mol. Res. 12,5335–5347.
im, H.H., Popova, E., Shin, D.J., Yi, J.Y., Kim, C.H., Lee, J.S., Yoon, M.K., Engelmann, F.,2012. Cryobanking of Korean Allium germplasm collections: results from 10-yearexperience. Cryo Letters 33, 45–57.
im, H.H., Yoon, J.W., Park, Y.E., Cho, E.G., Sohn, J.K., Kim, T.S., Engelmann, F., 2006.Cryopreservation of potato cultivated varieties and wild species: critical factorsin droplet vitrification. Cryo Letters 27, 223–234.
im, J.B., Kim, H.H., Baek, H.J., Cho, E.G., Kim, Y.H., Engelmann, F., 2005. Changesin sucrose and glycerol content in garlic shoot tips during freezing using PVS3solution. Cryo Letters 26, 103–112.
ulus, D., Zalewska, M., 2014. Cryopreservation as a tool used in long-term storageof ornamental species – a review. Sci. Hortic. 168, 88–107.
ee, Y.G., Popova, E., Cui, H.Y., Kim, H.H., Park, S.U., Bae, C.H., Lee, S.C., Engelmann,F., 2011. Improved cryopreservation of Chrysanthemum (Chrysanthemum mori-folium) using droplet-vitrification. Cryo Letters 32, 487–497.
i, B.Q., Feng, C.H., Hu, L.Y., Wang, M.R., Chen, L., Wang, Q.C., 2014. Shootregeneration and cryopreservation of shoot tips of apple (Malus) byencapsulation–dehydration. In Vitro Cell. Dev. Biol. Plant 50, 357–368.
iu, Y.G., Liu, L.X., Wang, L., Gao, A.Y., 2008. Determination of genetic stability insurviving apple shoots following cryopreservation by vitrification. Cryo Letters29, 7–14.
artín, C., Cervera, M.T., González-Benito, M.E., 2011. Genetic stability analysis ofChrysanthemum (Chrysanthemum × morifolium Ramat.) after different stages of
an encapsulation–dehydration cryopreservation protocol. J. Plant Physiol. 168,158–166.artín, C., González-Benito, M.E., 2005. Survival and genetic stability of Dendran-thema grandiflora Tzvelev shoot apices after cryopreservation by vitrificationand encapsulation–dehydration. Cryobiology 51, 281–289.
lturae 176 (2014) 330–339 339
Martín, C., González-Benito, M.E., 2009. Cryopreservation and genetic stability ofDendranthema grandiflora Tzvelev in vitro cultures. Agric. Food Sci. 18, 129–135.
Minano, H.S., González-Benito, M.E., Martín, C., 2009. Molecular characterizationand analysis of somaclonal variation in Chrysanthemum cultivars using RAPDmarkers. Sci. Hortic. 122, 238–243.
Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bioassayswith tobacco cell cultures. Physiol. Plant. 15, 473–497.
Nishizawa, S., Sakai, A., Amano, Y., Matsuzawa, T., 1993. Cryopreservation of aspara-gus (Asparagus officinalis L.) embryogenic suspension cells and subsequent plantregeneration by vitrification. Plant Sci. 91, 67–73.
Panis, B., Piette, B., Swennen, R., 2005. Droplet vitrification of apical meristems: acryopreservation protocol applicable to all Musaceae. Plant Sci. 168, 45–55.
Porebski, S., Bailey, G., Baum, B.R., 1997. Modification of a CTAB DNA extractionprotocol for plants containing high polysaccharide and polyphenol components.Plant Mol. Biol. Rep. 15, 8–15.
Rafalski, J.A., Vogel, J.M., Morgante, M., Powell, W., Andre, C., Tingey, S.V., 1996.Generating and using DNA markers in plants. In: Birren, B., Lai, E. (Eds.), Non-mammalian Genomic Analysis: A Practical Guide. Academic Press, San Diego,pp. 75–134.
Saikai, W., 1973. Simple method for differential staining of paraffin embedded plantmaterial using toluidine blue O. Biotech. Histochem. 48, 247–249.
Sakai, A., Kobayashi, S., Oiyama, I., 1990. Cryopreservation of nucellar cells of navelorange (Citrus sinensis Osb. var. brasiliensis Tanaka) by vitrification. Plant CellRep. 9, 30–33.
Sakai, A., Matsumoto, T., Hirai, D., Niino, T., 2000. Newly developedencapsulation–dehydration protocol for plant cryopreservation. Cryo Letters21, 53–62.
Teixeira da Silva, J.A.T., 2003. Chrysanthemum: advances in tissue culture, cryo-preservation, postharvest technology genetics and transgenic biotechnology.Biotechnol. Adv. 21, 715–766.
Teixeira da Silva, J.A.T., 2004. Ornamental chrysanthemums: improvement bybiotechnology. Plant Cell Tissues Organ Cult. 79, 1–18.
Vidal, N., Sanchez, C., Jorquera, L., Ballestre, A., Viettez, A.M., 2005. Cryopreservationof chestnut by vitrification of in vitro-grown shoot tips. In Vitro Cell. Dev. Biol.Plant 41, 63–68.
Wang, B., Wang, R.R., Li, J.W., Ma, Y.L., Sheng, W.M., Li, M.F., Wang, Q.C., 2013. Devel-opment of three vitrification-based cryopreservation procedures for shoot tipsof China’s potato. Cryo Letters 34, 369–380.
Wang, Q.C., Laamanen, J., Uosukainen, M., Valkonen, J.P.T., 2005. Cryopres-ervation of in vitro-grown shoot tips of raspberry (Rubus idaeus L.) byencapsulation–vitrification and encapsulation–dehydration. Plant Cell Rep. 24,280–288.
Wang, B., Li, J.W., Zhang, Z.B., Wang, R.R., Ma, Y.L., Blystad, D.R., Keller, E.R.J., Wang,Q.C., 2014. Three vitrification-based cryopreservation procedures cause differ-ent cryo-injuries to potato shoot tips while all maintain genetic integrity inregenerants. J. Biotechnol. 32, 583–595.
Wang, Q.C., Perl, A., 2006. Cryopreservation in floricultural crops. In: Silva, J.T. (Ed.),Floricultural, Ornamental and Plant Biotechnology: Advances and Topics. GlobalScience Books, London, pp. 523–539.
Wang, Q.C., Volkonen, J.P.T., 2008. Elimination of two viruses which interact syn-
ergistically from sweet potato by shoot tip culture and cryotherapy. J. Virol.Methods 154, 135–145.Yin, Z.F., Bi, W.L., Long, C., Zhao, B., Volk, G.M., Wang, Q.C., 2014. An efficient, widelyapplicable cryopreservation of Lilium shoot tips by droplet-vitrification. ActaPhysiol. Plant. 36, 1683–1692.
