Schizosaccharomyces pombe stt3+ is a functional homologue ofSaccharomyces cerevisiae STT3 which regulates oligosaccharyltransferase activity

Yeast 15, 497–505 (1999)

Schizosaccharomyces pombe stt3+ is a FunctionalHomologue of Saccharomyces cerevisiae STT3 whichRegulates Oligosaccharyltransferase Activity

SATOSHI YOSHIDA1*, AKIRA MATSUURA2, JOSEPH MERREGAERT3 AND YASUHIRO ANRAKU4

1Kirin Brewery Co. Ltd, Central Laboratories for Key Technology, 1–13–5, Fukuura Kanazawa-ku, Yokohama-shi,Kanagawa 236-0004, Japan2Department of Life Science, Tokyo Institute of Technology, Nagatsuta, Midori-ku, Yokohama-shi,Kanagawa 226-8501, Japan3Department of Biochemistry, Laboratory of Molecular Biotechnology, University of Antwerp, Universiteitsplein 1,2610 Wilrijk, Belgium4Department of Biosciences, Teikyo University of Science and Technology, Yatsusawa 2525, Uenohara-machi,Kitatsuru-gun, Yamanashi 409-0193, Japan

The Saccharomyces cerevisiae STT3 (ScSTT3) gene encodes a protein which is involved in protein glycosylation viathe regulation of oligosaccharyltransferase activity. We have cloned and isolated the Schizosaccharomyces pombeSTT3 homologous gene (Spstt3+). The Spstt3+ gene encodes a protein consisting of 749 amino acid residues whichhas significant homology with ScStt3p and the mouse Stt3p-homologue Itm1p. Disruption of the Spstt3+ gene showsthat this gene is essential for growth. Like Itm1, Spstt3+ partially suppressed the temperature sensitivity of the stt3-1mutation of S. cerevisiae, indicating that Spstt3+ is a functional and structural homologue of the ScSTT3 gene. Thenucleotide sequence data reported in this paper appears in the DDBJ/EMBL/GenBank nucleotide sequence databasewith Accession No. AB015232. Copyright ? 1999 John Wiley & Sons, Ltd.

— Schizosaccharomyces pombe; glycosylation; oligosaccharyltransferase; STT3

*Correspondence to: S. Yoshida, Kirin Brewery Co. Ltd,Central Laboratories for Key Technology, 1–3–5, FukuuraKanazawa-ku, Yokohama-shi, Kanagawa 236-0004, Japan.Tel.: (81-45) 788-7360; fax: (81-45) 788-4042; e-mail:[email protected].

INTRODUCTION

Asparagine (Asn)-linked glycosylation of proteinsin the lumen of the endoplasmic reticulum (ER) isa protein modification which is highly conserved inall eukaryotic organisms (Kornfeld and Kornfeld,1985; Tanner and Lehle, 1987; Herscovics andOrlean, 1993). In the budding yeast Saccharomycescerevisiae, the pathway of Asn-linked glycosylationstarts with the en bloc transfer of the oligosac-charide precursor Glc3Man9GlcNAc2 from the

CCC 0749–503X/99/060497–09 $17.50Copyright ? 1999 John Wiley & Sons, Ltd.

dolichol diphosphate to the appropriate Asnresidues of nascent polypeptide chains. This initialreaction in the biosynthesis of Asn-glycosylatedproteins is catalysed by the lumen-orientatedenzyme complex oligosaccharyltransferase(OTase). OTase from canine pancreas consists ofribophorin I, ribophorin II and OST48 (Kelleheret al., 1992). In the yeast S. cerevisiae, OTaseconsists of at least seven proteins (Knauer andLehle, 1994; Kelleher and Gilmore, 1994), includ-ing Wbp1p (OST48 homologue; te Heesen et al.,1992), Swp1p (ribophorin II homologue; te Heesenet al., 1993), Ost1/Ntl1p (ribophorin I homologue;Silberstein et al., 1995a; Pathak et al., 1995), Ost2p(Silberstein et al., 1995b), Ost3p (Karaoglu et al.,

Received 19 June 1998Accepted 28 October 1998

498 . .

Figure 1.

1995) and Ost4p (Chi et al., 1996). The specificfunctions of these polypeptides are not yet shown,although it is thought that Wbp1p is directlyinvolved in the binding of the lipid-linked oligosac-charide substrate (Breuer and Bause, 1995; Pathaket al., 1995).

A growing interest in the fission yeast Schizosac-charomyces pombe as an experimental alternativeto S. cerevisiae has stimulated recent work onthe carbohydrate structure of this yeast. Unlike S.

Copyright ? 1999 John Wiley & Sons, Ltd.

cerevisiae, Sz. pombe has a morphologically dis-tinct Golgi apparatus (Smith and Svoboda, 1972).Thus, certain aspects of glycoprotein synthesis inSz. pombe resemble those in higher eukaryotic cellsmore closely than glycan modelling in S. cerevisiae.

The stt3 mutants of S. cerevisiae were originallyisolated by screening of mutants which are sensi-tive to staurosporine, a potent protein kinase Cinhibitor (Yoshida et al., 1992). The ScSTT3 genewas shown to be essential for growth and protein

Yeast 15, 497–505 (1999)

499 stt3+

glycosylation (Yoshida et al., 1995). Zufferey et al.(1995) showed that ScStt3p is involved in theregulation of OTase in vivo and in vitro, particu-larly in the substrate specificity and assembly ofthe OTase complex. ScStt3p homologous geneshave been isolated from C. elegans (Wilson et al.,1994), mouse and human (Hong et al., 1996).Using data based on the conserved residues in thevarious Stt3p homologues, we have cloned andsequenced a homologue from Sz. pombe. Thecloned Spstt3+ was shown to be a functional andstructural homologue of ScSTT3.

MATERIALS AND METHODS

Strains and growth conditionsThe Sz. pombe strains JY741 (h" ura4-D18 leu1

ade6-M216) and JY746 (h+ ura4-D18 leu1 ade6-M210) were obtained from Dr Iino (University ofTokyo). The Sz. pombe diploid strain KB1 wasconstructed by mating JY741 with JY746. The stt3mutant strain of S. cerevisiae, SYT31-RA (MATa


ura3 his3 leu2 ade8 met3 trp1 stt3-1) was used forthe suppression experiment.

Sz. pombe cells were grown at 30)C in YPD orSD medium. S. cerevisiae stt3 cells were grown at25)C in YPD, SD or SD+casamino acid medium(Rose et al., 1990).

Manipulation of DNAPlasmid DNA was propagated in Escherichia

coli JM109 and isolated by the alkaline lysismethod. Yeast DNA was prepared as describedpreviously (Rose et al., 1990). Restriction enzymeswere purchased from Takara Shuzo, Toyobo, andNew England Biolabs, and were used in accord-ance with the respective suppliers’ directions.Nucleotide sequences were determined with anautomated DNA sequencer (model 373A; AppliedBiosystems).

Figure 1. Continued

Figure 1. Nucleotide sequence of the Spstt3+ gene and flanking regions. The predicted amino acidsequence of the ORF is shown using the one-letter amino acid code. An asterisk indicates the stopcodon. Underlined nucleotide sequence indicates the intron of the Spstt3+ gene. Italic nucleotidesequence indicates conserved intron splicing sequence.

Primer design for isolation of the Spstt3+ geneProbe DNA for the isolation of the Spstt3+ gene

was isolated by the polymerase chain reaction

Yeast 15, 497–505 (1999)

500 . .

(PCR) using primers. The sense primer (S1) ATHCAYGARTTYGAYCCNT corresponds to thesequence IHEFDP (amino acid residues 43–48 ofScStt3p) and the antisense primer (AS1) RTTRTTCCANGTRTTRTTRTC corresponds to DNNTWNN (amino acid residues 534–540 of ScStt3p).Amplification by PCR was performed in 50 ìlvolumes with an automated temperature cyclingdevice (model PJ1000; Perkin–Elmer Cetus) usingSz. pombe genomic DNA as a template (35 cyclesof 94)C for 1 min, 55)C for 1 min and 72)C for3 min). The amplified products were analysed on a0·7% agarose gel. The DNA fragments were blunt-ended with PolIK and phosphorylated with T4kinase before ligation into the unique SmaI siteof the pUC19 vector. They were then sequencedby the dideoxynucleotide method using double-stranded DNA as a template.

Colony hybridizationGenomic libraries of Sz. pombe, pAL-SK+XbaI

and pAL-SK+BamHI containing fragments ofgenomic DNA that had been completely digestedwith XbaI or BamHI, respectively, in pAL-SK+,were kindly provided by Dr K. Okazaki. Approxi-mately 50 000 recombinant colonies were screenedusing standard techniques with a probe preparedby random priming (Megaprime DNA labellingsystems, Amersham). Hybridization of the probewas performed in Rapid Hybridization Buffer(Amersham) at 42)C for 2 h. Filters were washedonce for 20 min at room temperature in 2#SSC/0·1% sodium dodecylsulphate (SDS) and twice for15 min at 65)C in 1#SSC/0·1% SDS.

Gene disruptionFor the disruption of the Spstt3+ gene, a disrup-

tion plasmid named pstt3Ä was constructed.The 1·3 kb KpnI–HindIII fragment carrying theinternal region of Spstt3+ was inserted intopUC119 to make pUC119-KH. Then, a 1·7 kbHindIII fragment carrying the entire ura4+ genewas inserted into pUC119-KH at the HindIII site.The resulting plasmid (pstt3Ä) was digested withSalI restriction endonuclease. This was then usedto transform the diploid strain KB1 to uracilprototrophy. Transformation was performed usinglithium acetate (Okazaki et al., 1990). Stable Ura+

transformants were selected and disruption ofone Spstt3+ copy was confirmed using PCRprimers:


LA5 (GCTAATTCTGCTACAATTACGAGTAAAAAAGGCGT) and LA3 (ATAATCCCTGAGAAATTCGGATCATCCAAAGGAAC).

PCR reactions were performed in 50 ìl volumeswith an automated temperature cycling device(model PJ1000; Perkin–Elmer Cetus) with TakaraLA PCR kit (Takara Shuzo) (30 cycles of 94)C for20 s and 68)C for 15 min).

Rescue of stt3-1 mutation with ScSTT3, Spstt3+

and Itm1 in S. cerevisiae

For heterologous expression, we constructed theplasmid pYES–PGK which contains the PGKpromoter and CYC1 terminator with the URA3marker. The ScSTT3, Spstt3+ and Itm1 ORFswere amplified by PCR in order to introduce aNotI site, and the amplified fragments wereinserted at the NotI site of pYES–PGK.

The STT3–Itm1 (pMM2) and STT3–stt3+

(pSP2) chimeras were constructed by two stepsof PCR amplification. For construction ofSTT3–Itm1, we made four primers:

C1 (ATAAGAATGCGGCCGCATGGGATCCGACCGGTCGTGTGTTTTG),M1 (ATAAGAATGCGGCCGCTTATGTCCTTGACAAGCCTCGATT),M2 (TGGTTCAATTATAGGGCTACCCGGTTTCTGGCTGAGGAGGGGTT) andM3 (AACCCCTCCTCAGCCAGAAACCGGGTAGCCCTATAATTGAACCA).

First, we amplified the ScSTT3 DNA using the C1and M3 primers, and the Itm1 DNA using the M1and M2 primers. Then, we amplified the ScSTT3–Itm1 DNA using C1 and M1 as primers and theDNAs obtained in the first step as template DNAs.For construction of ScSTT3–Spstt3+, we usedfour primers:

C1,P1 (ACATGCATGCTCAAAGGAATTTCGTTAGTTTTTGCA),P2 (TGGTTCAATTATAGGGCTACCAAAA TATTGGTGGAACAAGGT) andP3 (ACCTTGTTCCACCAATATTTTGGTAGCCCTATAATTGAACCA).

First, we amplified the ScSTT3 DNA using the C1and P3 primers, and the Spstt3+ DNA using the

Yeast 15, 497–505 (1999)

501 stt3+

Copyright ?

Figure 2. Sequence comparison of various Stt3p homologues. The deduced amino acidsequences of various Stt3p homologues were aligned to maximize homology. Residuesidentical to all sequences are indicated below the alignment. + Indicates the homologousamino acid residues. The sequences are from Schizosaccharomyces pombe (AB015232),Saccharomyces cerevisiae (D28952), Caenorhabditis elegans (U13019) and mouse(L34260). The amino acid residues where chimerical gene products were constructed areindicated by an asterisk.

1999 John Wiley & Sons, Ltd. Yeast 15, 497–505 (1999)

502 . .

P1 and P2 primers, respectively. Then, we ampli-fied the ScSTT3–Spstt3+ DNA using C1 and P1 asprimers and the DNAs obtained in the first step astemplate DNAs. PCR reactions were performed in100 ìl volumes with an automated temperaturecycling device (model PJ1000; Perkin–ElmerCetus) using Takara Ex Taq polymerase (TakaraShuzo) (30 cycles of 94)C for 30 s, 48)C for 1 minand 72)C for 2 min). The resulting DNAs wereinserted into the NotI site of the pYES–PGKplasmid.

Figure 3. Disruption of the SpStt3+ gene. (A) A limited restriction map ofthe SpStt3+ locus showing the extent and direction of the ORF. Therestriction map of the SpStt3+ disrupted chromosome is shown below themap. LA5 and LA3 are primers for the LA PCR amplification (seeMaterials and Methods). Abbreviations for restriction sites; H, HindIII; K,KpnI; S, SalI. (B) The pattern of DNAs amplified by PCR using Sz. pombegenomic DNA. Lane 1, lambda HindIII molecular marker; lane 2, wild-typediploid cells (stt3+/stt3+); lane 3, stt3+ disrupted diploid cells (stt3::ura4+/stt3+); lanes 4–14, haploid segregants derived from the stt3+ disrupteddiploid cells (stt3::ura4+/stt3+).


Polyacrylamide gel electrophoresis and Westernblotting

Proteins were separated by SDS polyacrylamidegel electrophoresis (SDS-PAGE) on a 10% gel. Thegels were electrophoretically blotted on to PVDFmembranes (Millipore). The membranes wereprobed with an anti-carboxypeptidase Y (CPY)mouse monoclonal antibody (Molecular Probes,Inc.). The mouse antibody was detected with agoat anti-mouse IgG coupled to horseradish

Yeast 15, 497–505 (1999)

503 stt3+

peroxidase (HRP) using an ECL detection system(Amersham).

RESULTS AND DISCUSSION

Figure 4. Suppression of the stt3-1 mutation of S. cerevisiae by Spstt3+. (A) Construction of the expression plasmids forS. cerevisiae. pSC-1, ScSTT3; pSP-1, Spstt3+; pSP-2, ScSTT3–Spstt3+ chimera; pMM-1, Itm1; pMM-2, ScSTT3–Itm1 chimera.(B) Suppression of the temperature sensitivity of the stt3-1 mutants of S. cerevisiae. The stt3-1 mutant SYT31-RA cells which weretransformed with the indicated plasmids were incubated on a SD (-Uracil) plate at 25)C (a), on a YPD plate at 32)C (b) and ona SD (-Uracil) plate at 32)C (c) for 4 days. (C) Western blot analysis using the anti-CPY antibody. SYT31-RA cells weretransformed with the indicated plasmids and glycosylation of CPY was analysed.

Cloning and sequence of the Sz. pombe stt3+ geneSequence comparison of Stt3p homologues from

various organisms identified a pair of oligonucleo-


tides that could be used to amplify genes encodingrelated proteins in Sz. pombe (Yoshida et al.,1995). We designed degenerate oligonucleotideprimers based on two conserved regions found inthe S. cerevisiae, C. elegans, mouse and humanStt3p homologues (see Figure 2) (Yoshida et al.,1995; Wilson et al., 1994; Hong et al., 1996). PCR
amplification with primers S1 and AS1 using
Yeast 15, 497–505 (1999)

504 . .

Sz. pombe genomic DNA as a template yielded afragment of approximately 1·6 kb (data notshown). The PCR products obtained were clonedinto pUC19 and sequenced. The deduced aminoacid sequence has a significant level of homologywith ScStt3p. One of the homologous productswas then used to screen the Sz. pombe genomiclibraries constructed in the multicopy plasmidpAL-SK+. By screening approximately 50 000colonies, we identified several independent cloneswhich fell into two groups, pSTT3-1 and pSTT3-2;pSTT3-1 was isolated from the pAL-SK+XbaIlibrary and pSTT3-2 was isolated from thepAL-SK+BamHI library. The restriction maps ofthe DNA inserts revealed that they had an over-lapping region. The minimal DNA fragment thathybridized with the probe DNA was subclonedfrom pSTT3-1. Finally, pSTT3-3, containing a5·0 kb SacI–NheI fragment, was hybridized andsequenced (Figure 1).

Structural characteristics and disruption of theSpstt3+ gene

Nucleotide sequencing of the 5·0 kb SacI–NheIfragment identified an ORF that was predicted toencode a protein consisting of 749 amino acidresidues (Figure 1). By comparison of the pre-dicted protein sequence of Spstt3+ with sequencesin GenBank, this protein was found to have asignificant level of homology with ScStt3p(Yoshida et al., 1995), the potential transmem-brane proteins of C. elegans (Wilson et al., 1994),mouse and human Itm1 proteins (Hong et al.,1996) (Figure 2).

To determine whether the Spstt3+ gene isessential for cell growth, the Spstt3+ gene wasdisrupted (Figure 3A). The plasmid used in genedisruption was digested with SalI to transform thewild-type diploid strain KB1 by selection for uracilprototrophy. PCR amplification analysis of thegenomic DNA from the transformants was carriedout to confirm that the disruption had occurred atthe Spstt3+ locus (Figure 3B). The 1·9 kb fragmentwas amplified using the genomic DNA derivedfrom the wild-type cells. An 8·1 kb fragment wasamplified when integration of the plasmid DNAhad occurred at the chromosomal Spstt3+ locus.The resulting stt3::ura4+/stt3+ diploid cells weresporulated and the resulting tetrads were dissected.Of 22 tetrads, only two spores gave rise to colonieson YPD plates at 25)C. PCR analyses of allthe haploid colonies obtained produced a single


wild-type band, indicating that Spstt3+ is essentialfor cell growth.

The Spstt3+ gene is a functional homologue of theScSTT3 gene

As the Spstt3+ gene is a structural homologue ofthe ScSTT3 gene, we investigated whether Spstt3+

is also a functional homologue of ScSTT3. Weconstructed plasmids for the expression of Spstt3+

and Itm1 in S. cerevisiae as described in Materialsand Methods (Figure 4A). The Spstt3+ andScSTT3–Spstt3+ chimera suppressed the tempera-ture sensitivity of the stt3-1 mutant on YPD plates,but not on SD plates (Figure 4B). The defect inCPY glycosylation which is caused by the stt3-1mutation was not suppressed by Spstt3+ orScSTT3–Spstt3+ (Figure 4C). The same resultswere obtained with the mouse Itm1 and ScSTT3–Itm1 chimera (Figure 4B). These results suggestthat the regulation of the OTase by ScStt3p differsfrom that by SpStt3p or Itm1p. However, it ispossible that the expression level of Spstt3+ andItm1 is not high enough for complete suppressionof the defect caused by the stt3-1 mutation.

ACKNOWLEDGEMENTS

We thank Drs Ando and Toh-e (University ofTokyo) for materials and discussion. We alsothank Drs Iino (University of Tokyo) and Okazaki(Kazusa DNA Research Institute) for materials.

REFERENCES

Breuer, W. and Bause, E. (1995). Oligosaccharyl trans-ferase is a constitutive component of an oligomericprotein complex from pig liver endoplasmic reticulum.Eur. J. Biochem. 228, 689–696.

Chi, J. C., Roos, J. and Dean, N. (1996). The OST4 geneof Saccharomyces cerevisiae encodes an unusuallysmall protein required for normal levels of oligo-saccharyltransferase activity. J. Biol. Chem. 271,3132–3140.

Herscovics, A. and Orlean, P. (1993). Glycoproteinbiosynthesis in yeast. FASEB J. 7, 540–550.

Hong, G., Deleersnijder, W., Kozak, C. A., Van Marck,E., Tylzanowski, P. and Merregaert, J. (1996).Molecular cloning of a highly conserved mouse andhuman integral membrane protein (Itm1) and geneticmapping to mouse chromosome 9. Genomics 31,295–300.

Karaoglu, D., Kelleher, D. J. and Gilmore, R. (1995).Functional characterization of Ost3p. Loss of the
34-kD subunit of the Saccharomyces cerevisiae
Yeast 15, 497–505 (1999)

505 stt3+

oligosaccharyltransferase results in biased under-glycosylation of acceptor substrates. J. Cell Biol. 130,567–577.

Kelleher, D. J. and Gilmore, R. (1994). The Saccharo-myces cerevisiae oligosaccharyltransferase is a proteincomplex composed of Wbp1p, Swp1p and fouradditional polypeptides. J. Biol. Chem. 269,12 908–12 917.

Kelleher, D. J., Kreibich, G. and Gilmore, R. (1992).Oligosaccharyltransferase activity is associated with aprotein complex composed of ribophorins I and IIand a 48 kDa protein. Cell 69, 55–65.

Knauer, R. and Lehle, L. (1994). The N-oligosaccharyltransferase complex from yeast. FEBSLett. 344, 83–86.

Kornfeld, R. and Kornfeld, S. (1985). Assemblyof asparagine-linked oligosaccharide. Ann. Rev.Biochem. 56, 915–944.

Okazaki, K., Okazaki, N., Kume, K., Jinno, S., Tanaka,K. and Okayama, H. (1990). High-frequency trans-formation method and library transducing vectorsfor cloning mammalian cDNAs by trans-complementation of Schizosaccharomyces pombe.Nucl. Acids Res. 18, 6485–6489.

Pathak, R., Parker, C. S. and Imperiali, B. (1995).The essential yeast NLT1 gene encodes the 64 kDaglycoprotein subunit of the oligosaccharyltransferase.FEBS Lett. 362, 229–234.

Rose, M. D., Winston, F. and Hieter, P. (1990).Methods in Yeast Genetics. A Laboratory CourseManual. Cold Spring Harbor Laboratory Press, NewYork.

Silberstein, S., Collins, P. G., Kelleher, D. J., Rapiejko,P. J. and Gilmore, R. (1995a). The á subunit of theSaccharomyces cerevisiae oligosaccharyltransferasecomplex is essential for vegetative growth of yeast andis homologous to mammalian ribophorin I. J. CellBiol. 128, 525–536.


Silberstein, S., Collins, P. G., Kelleher, D. J. andGilmore, R. (1995b). The essential OST2 geneencodes the 16-kD subunit of the yeast oligosac-charyltransferase, a highly conserved proteinexpressed in diverse eukaryotic organisms. J. CellBiol. 131, 371–383.

Smith, D. G. and Svoboda, A. (1972). Golgi apparatusin normal cells and protoplasts of Schizosaccharo-myces pombe. Microbios 5, 177–182.

Tanner, W. and Lehle, L. (1987). Protein glycosylationin yeast. Biochim. Biophys. Acta 906, 81–99.

te Heesen, S., Janetzky, B., Lehle, L. and Aebi, M.(1992). The yeast WBP1 is essential for oligosac-charyltransferase activity in vivo and in vitro. EMBOJ. 11, 2017–2075.

te Heesen, S., Knauer, R., Lehle, L. and Aebi, M.(1993). Yeast Wbp1p and Swp1p from a proteincomplex essential for oligosaccharyltransferaseactivity. EMBO J. 12, 279–284.

Wilson, R. et al. (1994). 2·2 Mb of contiguous nucleotidesequence from chromosome III of C. elegans. Nature368, 32–38.

Yoshida, S., Ikeda, E., Uno, I. and Mitsuzawa, H.(1992). Characterization of a staurosporine- andtemperature-sensitive mutant, stt1, of Saccharomycescerevisiae: STT1 is allelic to PKC1. Mol. Gen. Genet.231, 337–344.

Yoshida, S., Ohya, Y., Nakano, A. and Anraku, Y.(1995). STT3, a novel essential gene related to thePKC1/STT1 protein kinase pathway, is involved inprotein glycosylation in yeast. Gene 164, 167–172.

Zufferey, R., Knauer, R., Burda, P., Stagljar, I., teHeesen, S., Lehle, L. and Aebi, M. (1995). STT3, ahighly conserved protein required for yeast oligo-saccharyl transferase activity in vivo. EMBO J. 14,4949–4960.

Yeast 15, 497–505 (1999)

Documents

Schizosaccharomyces pombe stt3+ is a functional homologue ofSaccharomyces cerevisiae STT3 which regulates oligosaccharyltransferase activity