Embed Size (px)
Citation preview
ROLES OF MICRONUTRIENT NUTRITION AND ENDOGENOUS PLANT HORMONES IN ENHANCED TOLERANCE OF HUANGLONGBING IN CITRUS
By
FLAVIA TABAY ZAMBON
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2020
© 2020 Flavia Tabay Zambon
To the ones that are continuously seeking for answers
4
ACKNOWLEDGMENTS
I would like to express my deepest gratitude to my advisor Dr. Jude Grosser for
all the trust put in me since the beginning of the program, for all the lessons taught in a
simple way. To my committee members Drs. Arnold Schumann, Tripti Vashisth,
Edgardo Etxeberria and Rebecca Darnell for all the advices, exchange of ideas, laughs
and classes that pushed me forward towards the completion of my degree. To all of
you, thank you for making me a better researcher and for supporting me intellectually.
To my parents and my sister that always believed on my potential of keep asking
questions and to be stubborn to finding answers. They have been my solid rock for all
those years, and without them, none of this would be achieved. To my soon to be
husband that lifted my confidence every time I thought I was not capable enough, or
strong enough. Thanks, my love for always having my back and for keeping going on in
this journey with me.
Part of this study would not be possible to be completed without the essential
and endless help of the staff from the Florida Department of Citrus, Dr. Rosa Walsh and
Mr. Tony Trama. Thank you, Tony for teaching me how to look at chemistry with other
eyes and for always be a cheerful company and thank you Dr. Walsh for allowing me to
use the equipment at the FDOC.
Thanks to the lab members and greenhouse staff that were always there to help
me with what was needed and to take care of my plants when I was abroad. Thanks to
Dr. Christopher Vincent for allowing me to use his LiCOR during the necessary period
and for his guidance during the statistical coding. Thanks much to Dr. Schumann’s lab
for all the support given during the first months of the project, and Laura Waldo and Dr.
Timothy Elbert for all the help in leaf processing and statistical analysis.
5
Thank you for all the friends I’ve made in Lake Alfred and in Gainesville. You all
filled the gap of being far from home like I never thought would be possible, by
supporting not just me, but we as a group. I cannot thank enough my eternal
roommates Tallyta Silva, Mayara Murata and Marina Arouca for all the moments you
helped me, supported me, listened to me, partied with me, laughed with me and gave
me life lessons. If I am a better person and a researcher, you all have part of it. Thank
you, Ana and Peter, for making me feel home even apart from it. You two taught me
precious habits that are sowed deep inside. Thank you. And finally, to my best friends
Aditi Satpute and Matthew Mattia. Our brainstorming sessions at our office, our
rendezvous, our serious talks and our gatherings made the weight of a doctorate feel
like a feather. Thank you for being always with me, in person or virtually.
6
TABLE OF CONTENTS
page
ACKNOWLEDGMENTS .................................................................................................. 4
LIST OF TABLES ............................................................................................................ 9
LIST OF FIGURES ........................................................................................................ 11
ABSTRACT ................................................................................................................... 14
CHAPTER
1 INTRODUCTION AND LITERATURE REVIEW ..................................................... 18
Introduction ............................................................................................................. 18 Literature Review .................................................................................................... 22
Origin, Dispersion, and Citrus in Florida ........................................................... 22 Breeding Citrus for Resistance or Tolerance to HLB ........................................ 27 New Germplasm Selected for the Greenhouse Study ...................................... 32
2 EFFECT OF MICRONUTRIENT OVERDOSES IN SUCEPTIBLE AND TOLERANT CANDIDATUS LIBERIBACTER ASIATICUS INFECTED CITRUS VARIETIES – A GREENHOUSE STUDY ............................................................... 36
Background ............................................................................................................. 36 Material and Methods ............................................................................................. 40
Plant Material ................................................................................................... 40 Nutrition Levels ................................................................................................. 41 Gas Exchange Measurements ......................................................................... 41 Physical Parameters Measured ........................................................................ 41 CLas Detection Via Quantitative Polymerase-Chain Reaction (qPCR) ............ 42 Statistical Analysis ............................................................................................ 43
Results and Discussion........................................................................................... 44 Gas Exchange Measurements ......................................................................... 44 Nutrient Analysis .............................................................................................. 48
Nitrogen ..................................................................................................... 48 Phosphorus ................................................................................................ 48 Potassium .................................................................................................. 48 Magnesium ................................................................................................ 50 Calcium ...................................................................................................... 51 Boron ......................................................................................................... 53 Manganese ................................................................................................ 55 Zinc ............................................................................................................ 56 Iron ............................................................................................................. 58 Sulfur ......................................................................................................... 59
7
Copper ....................................................................................................... 61 Plant Growth – Physical Measurements ........................................................... 63
Scion and rootstock diameters ................................................................... 63 Branch length – distinct nutritional requirements ....................................... 66 Number of leaves ....................................................................................... 67 Number of branches .................................................................................. 69 HLB index .................................................................................................. 70
CLas Detection – qPCR ................................................................................... 73 Conclusions ............................................................................................................ 76
3 SIMULTANEOUS IDENTIFICATION OF TARGETED PLANT HORMONES IN HLB-INFECTED SUSCEPTIBLE AND TOLERANT GREENHOUSE CITRUS TREES UNDER MICRONUTRIENT OVERDOSE .................................................. 97
Background ............................................................................................................. 97 Material and Methods ........................................................................................... 102
Plant Material ................................................................................................. 102 Chemicals ....................................................................................................... 103 Stock Solutions of Phytohormonal Compounds ............................................. 103 Extraction of phytohormones from citrus leaves ............................................. 104 UHPLC-MS/MS Analysis ................................................................................ 105 Statistical Analysis .......................................................................................... 106
Results .................................................................................................................. 106 Jasmonic Acid ................................................................................................ 107 Gibberellin A3 ................................................................................................. 108 Indole Butyric Acid .......................................................................................... 108 trans-Zeatin .................................................................................................... 109 trans-Zeatin Riboside ..................................................................................... 109
Discussion ............................................................................................................ 109 Jasmonic Acid Role in the Plant Defense ....................................................... 109 Gibberellins, DELLA Proteins and JA ............................................................. 111 Auxins and Plant Defense .............................................................................. 111 Cytokinins and the SA-JA/ET Backbone Plant Defense Mechanism .............. 113 Phytohormones and the Oxidative Stress ...................................................... 114 ROS, Boron and Manganese ......................................................................... 117
Conclusion ............................................................................................................ 119
4 GROUND APPLICATION OVERDOSES OF MANGANESE SHOW A THERAPEUTIC EFFECT IN SWEET ORANGE TREES INFECTED WITH CANDIDATUS LIBERIBACTER ASIATICUS ........................................................ 134
Background ........................................................................................................... 134 Material and Methods ........................................................................................... 136
Greenhouse Study ......................................................................................... 136 Field Study ..................................................................................................... 136
Results and Discussion......................................................................................... 138 Preliminary Data ............................................................................................. 138
8
Canopy Volume and Trunk Cross Section Area ............................................. 139 Soil Nutrient Analysis ..................................................................................... 139 Leaf Nutrient Analysis .................................................................................... 141 Juice Attributes and Yield Data ...................................................................... 143 Soil pH ............................................................................................................ 144 HLB Confirmation ........................................................................................... 145
Conclusion ............................................................................................................ 145
5 GENERAL CONCLUSIONS ................................................................................. 163
APPENDIX
A SUPPLEMENTAL MATERIAL FOR CHAPTER 2 AND 3 ..................................... 168
B SUPPLEMENTAL MATERIAL FOR CHAPTER 4 ................................................. 183
LIST OF REFERENCES ............................................................................................. 185
BIOGRAPHICAL SKETCH .......................................................................................... 205
9
LIST OF TABLES
Table page 2-1 Scion / rootstock combinations utilized in this study, n=3. .................................. 79
2-2 Nutrition formulations and amounts applied per plant every 6 months in an acclimated greenhouse in Lake Alfred, Central Florida ...................................... 79
2-3 Monthly average of ambient relative humidity (RH) in Lake Alfred, FL. Data retrieved from FAWN (Florida Automated Weather Network). ............................ 79
2-4 Mineral nutrient content of susceptible and tolerant scion/rootstock combinations under distinct fertilization regime and interaction between factors. ................................................................................................................ 83
2-5 Monthly average of diameter growth for all scion/rootstocks, regardless nutrition. .............................................................................................................. 85
3-1 Acronyms of scion/rootstock combinations tested at an acclimated greenhouse (CREC/UF – Lake Alfred, Central Florida) .................................... 120
3-2 Nutrition formulations and amounts applied per plant every 6 months at an acclimated greenhouse (CREC/UF – Lake Alfred, Central Florida) .................. 121
3-3 Optimized UHPLC-MS/MS parameters listed in multiple reaction mode (MRM) for quantification of targeted plant hormones ........................................ 123
3-4 Mean relative quantification of jasmonic acid (JA) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). .................................................................................................... 123
3-5 Mean relative quantification of gibberellin A3 (GA3) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). .................................................................................................... 125
3-6 Mean relative quantification of indole-3-butyric acid (IBA) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). ............................................................ 127
3-7 Mean relative quantification of trans-Zeatin (tZ) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). .................................................................................................... 129
3-8 Mean relative quantification of trans-Zeatin Riboside (tZR) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). ............................................................ 131
10
4-1 Effects of nutrient overdoses on CLas-infected Valencia/UFR-3 greenhouse trees following 1 year of treatments. ................................................................. 154
4-2 Slow release treatments and dosages applied on 10-year-old ‘Vernia’ trees. .. 154
4-3 Canopy volume (m3) and trunk cross-sectional area (cm2) for March and September 2017 and May 2018. ...................................................................... 156
4-4 Soil nutrient concentration for March and September of 2017 and May 2018. . 157
4-5 Leaf nutrient concentration for March and September 2017, and May 2018. ... 159
4-6 Juice attributes for fruits harvested in January 2018 ........................................ 161
4-7 Yield accumulation of ‘Vernia’ sweet oranges for 2015, 2016 and 2017 seasons. ........................................................................................................... 161
4-8 Cycle threshold (Ct) values of CLas detection in leaves, November 2017 ....... 162
A-1 Liquid fertilizer composition used as base for micronutrient dose requirements – 20-10-20 Peat Lite JR Peters, Allentown, PA) ......................... 181
B-1 Fertilizer and psyllid control spray schedule for 2016, 2017 and 2018 seasons – Lee Groves Alligator Grove – Mathew Block, St. Cloud, Florida ..... 183
B-2 Harrell’s® St. Helena Mix formulation (12-3-9) ................................................. 184
11
LIST OF FIGURES
Figure page 2-1 Schematics of HLB infected and healthy composite plants and nutrition
application placement in the greenhouse at the CREC/UF – Lake Alfred, FL. ... 78
2-2 Gas exchange equations. ................................................................................... 79
2-3 Transpiration rate in mol m-2 s-1 for all plants under all nutritional regimes in August and October 2016, and January 2017. ................................................... 80
2-4 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for transpiration rate in mol m-2 s-1. ...... 81
2-5 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for natural logarithm transformation of CO2 net assimilation in μmol m-2 s-1. ............................................................... 82
2-6 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for Zn concentration in leaves in mg kg -1..................................................................................................................... 84
2-7 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for S concentration in leaves in g kg-
1. ......................................................................................................................... 85
2-8 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for diameter of rootstock 5, 10 and 15 cm below the grafted union in cm. ................................................................. 86
2-9 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for diameter of scion 5, 10 and 15 cm above the insertion of the highest branch in the trunk in cm. .............................. 87
2-10 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for length of the highest branch, in centimeters, measured from the graft union. ...................................................... 87
2-11 Means of the length of the highest branch for all plants in cm. ........................... 88
2-12 Mean of number of leaves for all the trees. ........................................................ 89
2-13 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for number of leaves. ........................... 90
2-14 Natural logarithm means of number of branches for all the trees. ...................... 91
12
2-15 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for natural logarithm mean of number of branches. ........................................................................................................ 92
2-16 HLB index means of number of leaves with HLB-like symptoms per month. ...... 93
2-17 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for HLB index. ...................................... 94
2-18 Interaction plot between healthy and HLB infected scion/rootstock combinations and fertilizer formulations for cycle threshold means of CLas. ..... 95
2-19 Ct values and natural logarithm of Ct values of CLas per month. ....................... 96
3-1 Schematics of HLB infected and healthy composite plants and nutrition application placement in the greenhouse at the CREC/UF – Lake Alfred, FL. . 122
3-2 Negative natural logarithmic of mean JA relative quantification for scion/rootstock combinations in October 2016. ................................................ 124
3-3 Negative natural logarithmic of mean JA relative quantification for nutrition formulations in October 2016............................................................................ 125
3-4 Negative natural logarithmic of mean GA3 relative quantification for scion/rootstock combinations in October 2016. ................................................ 126
3-5 Negative natural logarithmic of mean IBA relative quantification for scion/rootstock combinations in October 2016. ................................................ 128
3-6 Negative natural logarithmic of mean IBA relative quantification for nutrition formulations in October 2016............................................................................ 129
3-7 Negative natural logarithmic of mean tZ relative quantification for scion/rootstock combinations in October 2016. ................................................ 130
3-8 Negative natural logarithmic of mean tZR relative quantification for scion/rootstock combinations in October 2016. ................................................ 132
3-9 Negative natural logarithmic of mean tZR relative quantification for nutrition formulations in October 2016............................................................................ 133
4-1 Nutrient level means for leaf and root of CLas infected Valencia/Carrizo (Val/Czo) versus healthy greenhouse trees. ..................................................... 147
4-2 Root nutrient level means of CLas infected field trees Valencia/Swingle (Val/SW) trees (6-10 years old) versus healthy trees. ...................................... 148
4-3 CLas-infected Valencia/UFR-3 greenhouse trees after one year; left: control standard liquid fertilizer; right: Harrell’s CRF + 3x TigerSul® manganese. ....... 148
13
4-4 CLas-infected Valencia/UFR-3 typical root systems. Left: control standard Harrell’s CRF fertilizer; Right: Harrell’s CRF + 3x TigerSul® manganese. ....... 149
4-5 Diagram of experimental design and relative tree locations. ............................ 149
4-6 Interaction plot of months and treatment for manganese concentration in soil.. .................................................................................................................. 150
4-7 Manganese concentration in leaves for March and September 2017 and May 2018. ................................................................................................................ 151
4-8 Boron concentration in leaves for March and September 2017 and May 2018. 152
4-9 Mean pH (n=12) for all treatments in March and September 2017 and May 2018. ................................................................................................................ 153
A-1 Grafting union and shoot growth of composite plants treated with Florikan Advantage (Control) in January 2016. .............................................................. 168
A-2 Grafting union and shoot growth of composite plants treated with Florikan Advantage + 2x TigerSul Mn (N1) in January 2016. ......................................... 169
A-3 Grafting union and shoot growth of composite plants treated with Florikan Advantage + 2x Sodium Borate (N2) in January 2016...................................... 170
A-4 Grafting union and shoot growth of composite plants treated with Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3) in January 2016. ........ 171
A-5 Cybrid 304 grafted onto AVO trees in February 2017. ...................................... 172
A-6 Sugar Belle grafted onto AVO trees in February 2017. .................................... 173
A-7 Valencia grafted onto AVO trees in February 2017. ......................................... 174
A-8 Cybrid 304 grafted onto Cleopatra trees in February 2017. .............................. 175
A-9 Sugar Belle grafted onto Cleopatra trees in February 2017. ............................ 176
A-10 Valencia grafted onto Cleopatra trees in February 2017. ................................. 177
A-11 Cybrid 304 grafted onto Swingle trees in February 2017. ................................. 178
A-12 Sugar Belle grafted onto Swingle trees in February 2017. ............................... 179
A-13 Valencia grafted onto Swingle trees in February 2017. .................................... 180
A-14 Healthy Valencia grafted onto healthy Swingle trees in February 2017. ........... 181
14
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
ROLES OF MICRONUTRIENT NUTRITION AND ENDOGENOUS PLANT
HORMONES IN ENHANCED TOLERANCE OF HUANGLONGBING IN CITRUS By
Flavia Tabay Zambon
May 2020
Chair: Jude William Grosser Major: Horticultural Sciences
Scions and rootstocks are crucial components of successful citrus production.
Hence, major importance is given to improved varieties tolerant to Huanglongbing
(HLB), a bacterial disease putatively caused in Florida by Candidatus Liberibacter
asiaticus. The following selections were chosen for inclusion in this study. Sugar Belle,
a scion released by the University of Florida – Citrus Research and Education Center
(UF – CREC) breeding program has shown good yields on several rootstocks in field
trials and is considered by many to be the most HLB-tolerant commercial scion in
Florida. From the same breeding program, a cybrid mandarin scion designated as
cybrid 304 has shown consistently normal fruit development (no symptomatic fruit)
under a high HLB pressure environment. A complex tetrazyg rootstock A+Volk x Orange
19-11-8 (referred to as AVO from herein) produced by the UF-CREC breeding program
also shows promising results with respect to HLB tolerance for its ability to transmit the
tolerance to grafted susceptible sweet orange scions.
Achievement of high yield in any crop requires a combination of genetic selection
and effective cultural practices. Roots are the primary organ for mineral nutrient uptake
from the soil. Furthermore, minerals are essential for complete growth and
15
development. Each mineral element has distinct availability depending upon soils’
characteristics (Qamar-uz-Zaman and Schumann, 2006). Delivery of micronutrients
through the soil as a controlled-release fertilizer is an alternative to existing foliar
sprays, as ground-applied nutrition assists with soil acidification and improvement of
nutrient uptake. Because HLB-affected plants have shown deficiencies in all secondary
and micronutrients, especially in the roots, ground-applied overdose of specific
micronutrients has been demonstrated to improve overall conditions of infected plants
(Grosser, personal communication; Tabay Zambon et al., 2019).
This dissertation is composed of three distinct, but related chapters as follows:
Chapter 2. a greenhouse study that characterized the influence of overdoses of
micronutrients and scion/rootstock combination in the disease development of improved
and commercial genotypes; Chapter 3. a parallel study on the same greenhouse trees
as in Chapter 2, quantifying hormonal changes in the HLB affected improved and
commercial varieties grown with overdoses of micronutrients; Chapter 4: A study of
HLB-susceptible field established trees that also received overdoses of micronutrients
over time, analyzing nutrient content in leaves and soil, yield, juice quality, and Ct
values to verify the effect of enhanced nutrition in HLB disease development.
For the greenhouse study, combinations of three CLas-infected scions (Sugar
Belle, Cybrid 304 and ‘Valencia’ sweet orange) and three rootstocks (‘Swingle’
citrumelo, ‘Cleopatra’ mandarin, and AVO (tetrazyg), were subjected to distinct
nutritional formulations with overdoses of manganese and boron. Leaf nutrients,
diameter growth, CLas detection and hormonal level results were different for each
treatment. Scions grafted onto Cleopatra and Swingle had the lowest Ct values,
16
indicating higher CLas populations. The nutritional concentration of the leaves was
distinct for each treatment; however, Cybrid 304 had more variation between rootstocks
compared to Sugar Belle and Valencia, regardless of the fertilizer formulation. Plant
hormones, the key components of plant defense, were modulated differently amongst
the treatments. The jasmonic acid (JA) level was lower in scions grafted onto AVO
when compared to scions grafted onto Swingle and Cleopatra. This could indicate
adaptation of the AVO rootstock to the presence of CLas, therefore, it may possess the
ability to better balance the allocation of energy between growth and defense. Scions
grafted onto AVO had lower number of leaves with HLB symptoms (HLB index) and
higher Ct values, indicating lower CLas titers, and overall, Sugar Belle performed better
on both parameters. Overdoses of micronutrients had mixed results, with a strong
interaction between the micronutrient treatment and the scion/rootstock combination.
Each scion/rootstock combination had a different response to HLB when supplemental
nutrition was added.
The field study consisted of applications of supplemental slow release nutrient
treatments, including overdoses of boron and manganese for over two years in bearing
'Vernia' sweet orange trees on rough lemon rootstock. The study revealed that
overdoses of Mn overtime repressed disease development in the trees, a therapeutic
effect of the nutrition on HLB-affected trees. Moreover, plants that received extra
manganese had higher yields than plants under standard nutrition regime. The nature of
the field study is crucial to demonstrate that HLB-affected plants require a distinct
nutrition regime to have a satisfactory development and productivity under disease
pressure.
17
All the studies included in this dissertation had the central focus of better
understanding the effects of genotype and nutrition on disease development; moreover,
to provide insights for developing a new nutritional guide for fruit-bearing HLB-affected
trees. Therefore, it is impossible to recommend one single nutrition regime for all the
possible permutations of commercial scion and rootstock combinations available in the
market. Nevertheless, the set of studies performed in this dissertation showed that for
the selected scion and rootstock combinations, overdoses of micronutrients could
improve greenhouse and field established tree health, growth and productivity in CLas-
infected trees. Although the growth of tested trees in the greenhouse was under cool
temperatures that favor CLas replication year-round, overall tree health at the end of the
experiment was quite remarkable.
18
CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW
Introduction
Orange juice is one of the most frequently consumed non-alcoholic beverages in
the world. For the 2017-2018 season, Brazil maintained its position as the largest
producer of oranges, followed by China, European Union, Mexico and United States.
Florida is responsible for 36% of total United States citrus production, after California at
59%, with Texas and Arizona each at 5%, respectively. The Florida citrus industry has
faced diminishing yields over the years. Prior to the 2000s, the biggest problem was the
high incidence of citrus canker, caused by the bacterium Xanthomonas citri subsp. citri
(Ference et al., 2018) and its spread by hurricanes. However, yields were acceptable
despite the presence of canker (USDA-NASS, 2019).
In 2005, the citrus greening epidemic arrived in Florida (Halbert, 2005). Putatively
caused by the fastidious phloem-limited Gram-negative alpha-proteobacteria
Candidatus Liberibacter species (Jagoueix et al., 1994), the disease was known for
centuries in China (Bové, 2006) by the name Huanglongbing (HLB, yellow dragon
disease). Three distinct bacteria species can cause HLB. In the USA, Candidatus
Liberibacter asiaticus (CLas) is vectored by the Asian Citrus Psyllid (ACP, Diaphorina
citri Kuwayama). In Brazil, both CLas and Candidatus Liberibacter americanus (CLam)
are reported, and vectored by the same psyllid (Coletta-Filho et al., 2004; Texeira et al.,
2005). Africa and Middle East have reported the presence of Candidatus Liberibacter
africanus (CLaf), vectored by the African citrus psyllid (Trioza erytreae). To date, no
effective control over HLB has been found, nor have Koch’s postulates been completed
for Candidatus Liberibacter species because they have not been successfully cultured.
19
Citrus plants susceptible to HLB show typical symptoms of nutrient and
carbohydrate depletion (Gonzalez et al., 2012). Blotchy mottled leaves, zinc deficiency,
loss of feeder roots, stunted growth, color inversion of fruit peel, misshapen fruits, early
fruit drop and reduced soluble solids accumulation in the juice sacs are some of the
most prominent HLB macro symptoms (Bové, 2006; Johnson et al., 2014; Dala-Paula et
al., 2019). As response to the bacteria, the plant’s defense mechanism is activated,
causing the deposition of callose and p-protein in the pores of the phloem sieve plates,
decreasing pores’ diameter and reducing the vascular transport of photoassimilates
throughout the plant. (Albrecht and Bowman, 2008; Kim et al., 2009). Most of the
commercial scion and rootstock cultivars are susceptible to HLB, and production over
time has been severely affected by the disease, reducing the number of fruits per tree,
juice quality and overall plant health. Therefore, a new selection of genotypes which are
resistant or highly tolerant of HLB is crucial to the preservation of citriculture in the world
(Miles et al., 2017). The University of Florida Citrus Research and Education Center
breeding team has been working for decades using all available tools to develop, select,
and release new genotypes with desired traits, with the final objective to develop
commercially viable cultivars that overcome environmental stresses and pests that
jeopardize plant growth and development, and thus sustainable yields. Advancement in
tissue culture technologies including protoplast fusion that can now routinely be used to
produce somatic hybrids and cybrids, has resulted in the production of parents allowing
conventional rootstock breeding at the tetraploid level. This approach can maximize
genetic diversity in ‘tetrazyg’ progeny that can be mixtures of three to four diploid
genomes in individual hybrids (Grosser et al., 2003; Grosser et al., 2015; Grosser et al.,
20
2016). Genotypes of putatively HLB-tolerant rootstocks have been pretested in
greenhouse studies with sweet orange (Citrus sinensis (L.) Osbeck) scions, with some
showing improved performance when compared to available commercial rootstocks,
which can be attributed to the genetic diversity of the improved rootstocks (Castle et al.,
2015).
To date, HLB management strategies have been centered on the use of
insecticides to prevent the migration of the psyllid from grove to grove, and to minimize
CLas inoculation by psyllids (Qureshi et al., 2014). However, the cost-benefit of using a
rotation of diverse insecticides has been economically disappointing for growers.
Ground-applied enhanced nutrition by various methods including the use of controlled
release fertilizers (CRF) has been a viable alternative to manage HLB (Huber and
Haneklaus, 2007). Pathogen multiplication has been enhanced or repressed depending
on the mineral nutrient applied in distinct crops (Xia et al., 2011; Kieu et al., 2012;
Satpute, 2017). Current knowledge of citrus nutrition does not consider the effects of
HLB on the overall plant nutritional status, as nutritional requirements of HLB-affected
plants are different than healthy trees (Razi et al., 2011; Kadyampakeni et al., 2015;
Tabay Zambon et al., 2019) Another approach used by growers is the frequent
application of micronutrient foliar sprays to address nutrient deficiencies or to meet
minimum nutritional requirements. Besides being costly, foliar sprays do not address
root nutrient deficiencies caused by HLB (Zhong et al., 2015; Tobergte and Curtis,
2016). Enhanced plant health and the decrease of HLB symptom severity in ‘Valencia’
grafted onto ‘Swingle’ were reported during application of soil fertilizers supplemented
with plant hormones (Shen et al., 2013).
21
Soil applied enhanced nutrition has demonstrated a positive influence in the
overall health of HLB+ ‘Valencia’ sweet orange (Citrus sinensis) when grafted onto the
putatively HLB tolerant tetrazyg rootstock AVO, as compared to the commercially
available citrumelo ‘Swingle’. Modulation of genes encoding for endogenous plant
hormones related to plant defense were distinctively expressed for the HLB-tolerant
AVO rootstock (Satpute, 2017). Nutrient signaling and endogenous plant hormones are
intrinsically related (Rubio et al., 2009). Modulation of endogenous plant hormones
changes the plant homeostasis, therefore, a cascade of genetic and proteomic events
start in response to abiotic and/or biotic stresses (Pieterse et al., 2012). Candidatus
Liberibacter americanus (CLam) reprograms genes related to plant hormones to
improve suppression of plant defense, pathogenic- and stress-related genes (Mafra et
al., 2013). The reprogramming of the susceptible host can be avoided using
scion/rootstock varieties tolerant to HLB.
Chapters 2 & 3 of this dissertation describe a greenhouse study with multiple
objectives. Chapter 2 covers the evaluation of growth and development of distinct
scion/rootstock combinations grown with enhanced nutritional programs, with some
including overdoses of selected micronutrients. To favor CLas replication, all trees were
grown in a temperature-controlled greenhouse under cool temperatures. Chapter 3
examines changes in the hormonal profile of scion/rootstock combinations under the
distinct nutritional treatments that were measured to better understand the connection
between nutrition and endogenous plant hormones in HLB affected plants. Moreover,
the experiment was designed to generate more information on the responses of
22
selected scion/rootstock combinations to overdoses of micronutrients regarding disease
development and tree health in HLB+ greenhouse plants.
Chapter 4 describes a field study of established 'Vernia' sweet orange trees on
rough lemon rootstock that received different overdoses of boron and manganese over
a two-year time period. The objective of the field study was to elucidate the effects of
enhanced nutrition on trees (with no psyllid control) under high HLB pressure by
measuring changes in the nutrient concentration in leaves, yield over the seasons, and,
most importantly the CLas Ct values, plus mineral nutrients availability and pH in the
soil.
Literature Review
Origin, Dispersion, and Citrus in Florida
Part of the Rutaceae family, the Citrus genus and its relatives belong to the
subfamily Aurantioideae, which is known to be widely distributed across Asia, Polynesia
and Australia. The oldest mention of a citrus fruit is a Sanskrit document, as citron and
lemon fruits were part of devotional ceremonies. Small mandarins were used as tributes
to the ancestors and gods by the Chinese. Han Yen-Chih described 27 varieties of
sweet-sour orange-mandarins, known to be the oldest citrus monography. Citron fruit
was consecrated with the Indian god Ganesh, and it also could be found in the hands of
the statues of the god Kuvera (Scora, 1975). The religious importance of the citron, plus
its pleasant flavor and storage attributes allowed the beginning of the journey of citrus
around the globe.
Expansion of the Roman Empire throughout the Orient permitted the migration of
sour oranges, lemons and sweet oranges into Europe. Throughout the citrus journey
towards the West, natural crossing of several citrus species followed commercial trading
23
between different groups. As the Islam Empire arose, citron, pumelo, lemons and sour
orange were brought to Africa and Spain, along with other fruit/nuts crops. Western
Europe countries began to consider citrus as a desirable and luxurious commodity after
initiating the Crusades. Citrus’ cultural and economic value further increased after
Portugal reached India and China, and traders brought back sweeter oranges for the
feudal lords of Europe. The soil conditions and a newly established market provided
ideal conditions for the growth of citrus production on the Iberian Peninsula. From
Portugal and Spain, citrus reached the New World, in St. Augustine, Florida around
1513 and Brazil through the Portuguese colonization in 1530. Californians encountered
citrus for the first time after introduction by the Franciscan missionaries in the late XVII
century. Mandarin and kumquats had a late expansion from China, where they have
been grown for centuries, to England in the end of the XVIII century, before reaching
Spain, Italy and other European regions (Webber and Batchelor, 1943).
The citrus industry in Florida started with the establishment of orange groves in
the St. Augustine coast in 1763 (Webber and Batchelor, 1943). Shortly after, in 1776,
the first orange product shipment is mentioned, from Florida in route to England. During
the following century, several freezes required reallocation of the citrus factories and
orchards in the state. In 1835 the Great Freeze injured the tender citrus trees, forcing
the budding industry to look for warmer weather south of St. Augustine (History of
Florida citrus timeline, 2000). The Indian River region emerged as a potential location
for citrus production, as sour orange grafted with sweet orange survived the Great
Freeze. In addition, Leesburg in Central Florida, arose as one of the cores of citrus
production in 1860, transporting fruits and juices to neighboring counties through the
24
lakes by boat. Transport of citrus’ products throughout the state was improved by late
1860s through the use of refrigerated railcars (Webber and Batchelor, 1943).The
increasing interest in citrus orchards supported the introduction of several other citrus
varieties by General Sandford, including ‘Valencia’ sweet orange, after his purchase of
large pieces of lands and citrus groves (Webber and Batchelor, 1943). The growing
citrus industry facilitated the creation of the Florida Fruit Grower Association and the
Florida Fruit Exchange. The final years of the 1800s brought more challenges to the
growers with two big freezes in less than 5 years, with a loss of US$ 50 million and 97%
of the crop completely lost. Growers noticed that they needed to move farther south to
grow and keep the citrus industry running (Webber and Batchelor, 1943). As
associations and factories made their way closer to the central and west regions of
Florida in the first decades of 1900, sales and publications about citrus bloomed.
Research about the production and maintenance of citrus groves increased because of
the Citrus Experiment Station. Founded in 1917 in Lake Alfred, the mission of the Citrus
Experiment Station was to provide scientifically based research and extension to
support the success of the citrus industry (History of Florida citrus timeline, 2000). The
first disease reported in the history of citrus, citrus canker (Xanthomonas citrii subsp.
citri) was described in Florida in 1914. To control canker spreading, infected trees were
burned. Total control was achieved only in 1933. Until modern times, burning infected
trees was the only cure known for citrus canker. In 1929, an infestation of
Mediterranean flies was completely eradicated in the state, but not before affecting 75%
of the citrus fruits, and imposing an embargo on all the fruit until the pest was fully
controlled (History of Florida citrus timeline, 2000).
25
As the citrus industry expanded, legislation was created to regulate the selling
and exporting of the crop. From the State Legislature, the Florida Citrus Commission
created the Florida Department of Citrus (FDOC) (Reuther and Webber, 1967). During
the World War II and following years, the crop maintenance mechanics and food
storage fields underwent evolution, as was necessary for the war effort. In order to
provide American troops with vitamin C in the form of palatable drops, the Army alone
purchased 20% of the total citrus crop in the US. However, after the war, there was a
surplus of oranges, as the US Government stopped purchasing citrus fruit. Therefore,
from all the efforts during the war, an initiative between the Florida Citrus Commission
and the USDA (United States Department of Agriculture) was created to utilize the extra
oranges. From the initiative, the Citrus Station developed a method for creating frozen
concentrated juice, still in use today (Webber and Batchelor, 1943; History of Florida
citrus timeline, 2000; Rucker and Gannon, 2007).
The first big freeze of the 1900s was in 1957. The freeze brought snow to the
central Florida region, hindering production, but the industry recovered quickly
afterwards. Innovations in mechanical harvesting, identification of potential disease
threats, and breeding for rootstocks tolerant to soil-borne disease were the highlights at
the end of the 1950’s in the citrus industry (History of Florida citrus timeline, 2000).
The ‘60s brought the hurricane Donna, ruining most of the sweet orange and
grapefruit production of the 1959-1960 season. In 1962, another outbreak of the
Mediterranean fruit fly happened in the state, followed by a root weevil report in 1964.
An important victory was achieved in the ‘60s with the release of two rootstock varieties
resistant to the burrowing nematode. Research in soil nutrient application, weed control
26
and irrigation solutions brought citrus production to the highest yields in US citrus
history, especially in the ‘70s, when the production reached 200 million boxes, after
decades of research and improvement. Even after the freeze in 1977, the outbreak of
citrus rust mites and Alternaria brown spot, total yield for that season was, once again,
over 200 million boxes (History of Florida citrus timeline, 2000).
Six disastrous freezes occurred in the ‘80s, two of them in 1989 that destroyed
most of the groves. One of the reasons of the huge loss in the decade was because
growers had very expensive and inefficient methods of freeze protection, until the
development and use of micro-irrigation for freeze protection. Besides the loss of trees
due to the freezes, a new outbreak of citrus canker happened in 1986, in the Tampa
Bay area, and lasted until eradication in 1994. However, one year later, canker was
reported in Miami-Dade County (History of Florida citrus timeline, 2000).
In 1999 the insect vector of the most devastating bacterial disease in citrus, the
Asian citrus psyllid (ACP), Diaphorina citri Kuwauama, was found in Florida. In 2005,
the bacteria vectored by the ACP, Candidatus Liberibacter asiaticus (CLas), was
confirmed by qPCR in Miami-Dade County (Halbert, 2005), spreading quickly along the
Floridian east coast, Indian River County, Central Florida, and SW Florida. It is now
present in 100% of producing citrus groves in Florida. CLas is only one of the three
bacteria strains which cause huanglongbing (yellow dragon disease, HLB), also known
as citrus greening. California, Florida, Georgia, Puerto Rico, South Carolina, Texas,
Louisiana and United States Virgin Islands have been partially or totally quarantined for
citrus greening (Kunta et al., 2012; Kumagai et al., 2013; USDA, 2017). Since the
appearance of HLB in Florida in the transition of 2004-05 to 2005-06 season, total citrus
27
(oranges, tangerines and grapefruit) yield has been reduced from 174.6 million boxes
(2005-06) to 49.58 million boxes (2017-18), a reduction of 71.6% over a decade (USDA-
NASS, 2019). Until to date, no resistance has been found in the Citrus genus or any
relatives.
Breeding Citrus for Resistance or Tolerance to HLB
The origin of citrus breeding is still unknown. Wild citrus plants might have been
cross-pollinated, as pollinators could travel for long distances with the pollen from one
citrus plant to another, combining distinct genetic characteristics.
Citrus domestication probably started with the selection of distinct fruits/trees that
showed true-to-type asexual propagation from seed, in contrast to selections that
produced all zygotic seed and variable hybrids from cross-pollination. Commercial citrus
cultivars are mostly hybrids derived from combinations of the four distinct ancestral
groups, namely mandarin, pummelo (Citrus maxima Merr.), citron (Citrus medica L.)
and papeda species (Li et al., 2010b).
Citrus propagation mixes with the history of domestication, as grafting is
considered a recent technique (Mudge et al., 2009). Citrus seeds can produce several
asexual nucellar embryos, originating in the maternal tissue of the ovule, in a process
called apomixis. The selection of clones through development of a nucellar embryo, has
been pointed to as one of the methods used to domesticate desired citrus genotypes
such as of oranges, limes, lemons, grapefruit and other varieties that would show
resistance/tolerance to abiotic and biotic stresses. However, many traits in citrus are
highly polygenic, meaning that they are controlled by many genes, therefore, the
probability to achieve a successful hybrid capable of expressing the desired polygenic
trait at its fullest is very low. Also, sexual incompatibility exists between some citrus
28
genotypes, therefore, traditional breeding and clonal propagation are more difficult. To
bypass sexual incompatibility, and to better control the set of genes that would comprise
a new plant, tissue culture techniques, such as somatic hybridization via protoplast
fusion, arose as a means to facilitate the development of plants with desired admixed
genotypes (Grosser et al., 2000).
Citrus plants are generally diploid (2n=18), however, tetraploid (4n) individuals
have been reported in wild citrus relatives (Spiegel-Roy and Goldschmidt, 1996), mainly
a rare occurrence in nucellar seedling populations (autotetraploids). Production of
tetraploid individuals is highly difficult from monoembryonic varieties, because they do
not generally produce nucellar offspring. Triploid (3n) individuals are the result of a
union between a haploid (1n) gamete with a diploid one (2n). Production of triploids can
be achieved by interploid crosses between tetraploids and diploids. However, the low
seed rate survival is a major problem that has since been overcome by the application
of embryo rescue (Aleza et al., 2010). Thanks to the fact that triploids are characterized
by low numbers of or completely absent of seeds, they have been targeted by breeders
to generate new seedless cultivars for the fresh market.
According to the Merriam-Webster’s dictionary, breeding is the action or process
of bearing or generating; the sexual propagation of plants or animals (2019). Breeding
in citrus, therefore, applies to the selection of parents that have desired traits, and
moreover, selection of the progeny expressing them in the desired combinations. The
success of a breeding program depends on the knowledge of citrus genetics, as the
selection of parents provides information about the desired offspring, as does the
control of cross- and self-pollination. Because citrus is grown as composite (two or more
29
varieties grafted) distinct objectives for breeding can be set for both scions and
rootstocks. During scion breeding, varieties are chosen which have good fruit size, low
to absent seeds, good fruit shape, optimal period of ripening, long storage life, high
soluble solid accumulation, and easy to peel fruit. Tolerance or resistance to abiotic and
biotic stresses are desired in the scion depending on the environment that the plants will
be grown. Rootstocks on the contrary, have been historically required to produce many
seeds and to be highly nucellar as necessary for uniform liner production. Dwarfing
varieties are often preferred as this makes harvesting easier. Rootstock breeding
focuses on the reduction of the scion juvenility period, the tolerance or resistance to
soil-borne diseases, extreme soil pH tolerance, survival in drought and flooded areas,
and vigorous root growth. Several citrus varieties have been identified over the decades
as resistant to soil-borne diseases and to other pathogens that drastically reduce citrus
productivity (Spiegel-Roy and Goldschmidt, 1996).
Disease development is only possible if the trio composed of a virulent pathogen,
a vector for transmission, and a susceptible host are present at the same time in a
favorable environment. If one or more of the components are missing, disease
establishment is avoided. Pathogens have an elegant approach to adapt themselves to
resistant hosts. Some viruses have the ability to modify its own RNA to keep infecting
host cells (De Jong et al., 1994). Bacteria can adapt to a new environment in matter of a
couple hundred of generations (Rainey, 1999), therefore impeding host defense
response through an unrecognizable effector. For citrus greening, the pathogen
Candidatus Liberibacter asiaticus, the vector Diaphorina citri, and susceptible hosts are
all present in Florida. The control of disease inoculum transmission is, until now, an
30
effective method to combat CLas (Qureshi et al., 2014). However, it is known that
rotation of insecticides’ modes of action is necessary to delay or prevent ACP chemical
resistance (Boina and Bloomquist, 2015). Rotation of products, however, makes staying
within grower’s budget for the season a challenge. More recently, there is evidence that
the psyllid vector is developing resistance to one or more of the key chemicals used in
the rotation (Chen and Stelinski, 2017). The possibility of a tolerant or resistant trees is
considered to be the ultimate answer to sustainable and profitable citriculture in areas
where HLB is now endemic. Since no resistance has been found in the commercial
citrus scion and rootstock germplasm, identified tolerant species are used as a base for
citrus breeding, thereby improving the odds of developing commercially viable scions
and rootstocks with adequate HLB tolerance for profitable long-term citriculture.
Breeding for HLB resistance/tolerance has been ongoing for decades because it
has been difficult and time-consuming to identify viable HLB-tolerant parents.
Screening new hybrids is also difficult, especially rootstocks that are required to transmit
tolerance to grafted susceptible scions. However, significant progress has been made
and there are several reports identifying varieties with a certain degree of HLB tolerance
around the world (Albrecht and Bowman, 2012b; Grosser et al., 2016; Miles et al.,
2017). Multiple breeding strategies are being employed to develop more tolerant
varieties. In addition to the traditional breeding techniques of controlled crosspollination,
tissue culture-based biotechnologies can facilitate production of genetic combinations
that combine desired traits from selected parents.
Somatic hybridization, generally accomplished by the fusion of totipotent
callus/suspension protoplasts from one parent to leaf tissue-derived protoplasts of
31
another parent, has become a common tool used in citrus breeding programs (Grosser
et al., 2000). Complete fusion of somatic cells from both protoplast donors generates a
4n individual, called a somatic hybrid (Guo et al., 2004). Preliminary identification of 4n
individuals can be done by examination of leaf morphology, and validation is
accomplished by flow cytometry to confirm ploidy level. Simple sequences repeat (SSR)
markers are generally used to demonstrate a genetic contribution from each parent,
easily separating allotetraploids from autotetraploids that arise from the fusion of two
protoplasts of the same parent (Talon and Gmitter, 2008; Liu et al., 2013).
Allotetraploids have thicker leaves and are usually quite thorny, and generally grow
more slowly than diploid hybrids. However, they are often utilized as parents in
interploid crosses to breed triploid scions. Pollen from 4n individuals can be used for
crosses with selected monozygotic diploid females, resulting in the production of triploid
hybrids (Grosser et al., 2000). Usually the female parents used in such crosses are
required to have a high incidence of zygotic seeds, i.e. pummelos and selected
mandarin hybrids. It is also helpful if the pollen parent exhibits a markedly distinct leaf
characteristic, i.e. possessing trifoliate leaves, to facilitate early identification of hybrids.
For rootstock improvement, the production of allotetraploids with complementary traits
can increase soil-borne disease resistance, control tree size, and improve horticulture
performance of commercial scions. Moreover, breeding genetically distant varieties
could expand the germplasm foundation. Somatic hybridization can also bypass sexual
incompatibility often encountered in wide crosses, resulting in unique genetic
combinations (Grosser and Gmitter, 1990; Louzada et al., 1993; Grosser et al., 1996;
Chen et al., 2008). The most important outcome of the application of somatic
32
hybridization to citrus improvement is the production of novel tetraploid breeding
parents that can be used for both scion and rootstock improvement.
Another outcome that can happen during protoplast fusion is the production of
cybrids. Cybrids are cytoplasmic hybrids in which only one parental nuclear genome is
present, while the cytoplasmic genome (mitochondria and chloroplast DNA) originates
from either a second parent (fusion partner) or a combination of both parents which
have the potential to improve resistance to diseases (Omar et al., 2017). Cybrids are a
sophisticated alternative to study the influence of genomic organelles in cytoplasmic
inheritance, and their role in the plant genomic regulation (Spiegel-Roy and
Goldschmidt, 1996; Guo et al., 2013; Murata et al., 2019).
Development of diploid, triploid and tetraploid hybrids for scion and rootstock
improvement has been ongoing at the University of Florida - Citrus Research and
Education Center (UF-CREC) in Lake Alfred for decades to improve quality of both
scion and rootstocks. Hybrid selections developed and evaluated at the UF-CREC have
shown potential to grow under disease and/or environmental pressures (Grosser and
Gmitter, 2011; Grosser et al., 2015). Since the first report of HLB incidence in the state,
the program has made the development of HLB-tolerant commercially viable scions and
rootstocks the top priority, as necessary to keep the citriculture industry alive.
New Germplasm Selected for the Greenhouse Study
‘Sugar Belle®’ mandarin, a hybrid of ‘Clementine’ ‘Citrus reticulata’ x ‘Minneola’
tangelo [‘C. reticulata x Citrus paradisi], has shown to be one of the most HLB-tolerant
scions commercially available (Gmitter Jr et al., 2010; Stover et al., 2016; Killiny et al.,
2017). This selection produces delicious fruits similar to that of the its parent ‘Minneola’
tangelo (or ‘HoneyBell’). Genetic regulation in Sugar Belle might be the main player in
33
HLB tolerance, as rapid phloem regeneration was observed in HLB-affected plants,
compensating for the phloem blockage caused by the plant defense mechanism (Deng
et al., 2019).
Another putative tolerant hybrid from the UF-CREC breeding program is the
Cybrid 304, a cybrid made from a diploid hybrid of ‘Fortune’ hybrid tangerine
(‘Clementine’ x ‘Dancy’) x ‘Murcott’ tangor (by Dr. Fred G. Gmitter); with cytoplasm from
G1 Satsuma (Grosser, personal communication). The cybrid occurred as an accidental
byproduct in an effort to produce an allotetraploid somatic hybrid of UF-304 with G1
Satsuma. Although HLB+ for several years, field trees of Cybrid 304 have always
produced fruit with normal development (shape and size) and without the color inversion
expected in fruits of HLB-symptomatic trees (Grosser, personal communication).
In addition to success in scion breeding, the rootstock breeding program at the
UF-CREC is a pioneer in the creation of 4n allotetraploid ‘tetrazyg’ rootstock candidates.
The term ‘tetrazyg’ was coined to identify zygotic progeny from crosses of tetraploid
parents, either autotetraploids, allotetraploid somatic hybrids, or other ‘tetrazygs’
(Grosser et al., 2003). As mentioned, this approach can maximize genetic diversity in
progeny available for rootstock improvement (Grosser and Gmitter, 2011). For this
study, the AVO rootstock was chosen from the many other tetrazygs being screened for
HLB tolerance or resistance based on its early exceptional HLB tolerance in HLB+ trees
with Valencia sweet orange scion (Grosser, personal communication) This rootstock
candidate is one of several promising progeny resulting from a cross of a cybrid
autotetraploid Volkamer lemon with the commercially available UFR-4 rootstock,
formerly known as Orange 19. UFR-4 is a ‘tetrazyg’ produced from a conventional
34
sexual cross of the two allotetraploid somatic hybrids [Nova + Hirado Butan Pummelo]
and [Cleopatra + Argentine Trifoliate Orange]. Through conventional breeding, UFR-4
was the pollen donor, while the cybrid [Amblycarpa + Volkameriana] served as the
female. The cybrid mother autotetraploid Volk was produced by accident from a
protoplast fusion of ‘Amblycarpa’ suspension protoplasts with ‘Volkamer’ lemon (or
Volkameriana) leaf protoplasts. In this cybrid, Amblycarpa is the callus/suspension
parent that provided the mitochondria, while Volkameriana provided a 4n nucleus,
possibly resulting from the fusion of 3 protoplasts. The source of the chloroplasts in this
cybrid has not been determined. Cybrid rootstocks with citron background containing
‘Amblycarpa’ cytoplasm are showing improved fruit quality (higher soluble solids),
correcting this deficiency in this category of rootstocks (Grosser, personal
communication). Preliminary rootstock screening results showed good Phytophthora
ssp. resistance and tolerance to HLB, indicating that this tetrazyg, designated as AVO
from herein, is a promising potential new rootstock to be implemented in the new HLB
era of citriculture.
The hypotheses of this project are that enhanced nutrition influences the plant
performance when infected with CLas, and that improved scion and rootstock
genotypes react to the disease differently than the susceptible commercially available
varieties. To test the first hypothesis, a field study was performed with the objective to
elucidate the effect of overdose of micronutrients delivered as controlled-release
fertilizer in susceptible Vernia sweet orange grafted onto Rough lemon growth, essential
mineral concentration in the leaves and in the soil, soil pH, yield, juice quality and Ct
values. The second hypothesis was tested in a greenhouse condition trial with two
35
distinct experiments. The first experiment evaluated the genetically improved scions and
rootstocks growth, Ct values and gas exchange under distinct overdose of
micronutrients. The second experiment utilized the same set of plants to unveil the
changes in targeted endogenous plant hormones of the distinct scion/rootstock
combinations and nutrition application.
36
CHAPTER 2 EFFECTS OF MICRONUTRIENT OVERDOSES IN SUSCEPTIBLE AND TOLERANT
CANDIDATUS LIBERIBACTER ASIATICUS INFECTED CITRUS VARIETIES – A GREENHOUSE STUDY
Background
For the past decade, the citrus industry has been suffering significant economic
losses because of the presence of the centenary huanglongbing (HLB) disease.
Commonly known as greening, the putative causal agent belongs to the alpha-
proteobacteria class, named Candidatus Liberibacter ssp (Bové, 2006). Three different
strains of Candidatus Liberibacter are known to infect citrus and its relatives. In the
American continent the presence of Candidatus Liberibacter asiaticus (CLas) and
Candidatus Liberibacter americanus (CLam) have been reported (Halbert, 2005;
Texeira et al., 2005), while Candidatus Liberibacter africanus (CLaf) is only found in the
African continent and the Middle East (Pietersen et al., 2010). The three strains are
insect vectored, although by distinct psyllid species. The Asian Citrus Psyllid (ACP,
Diaphorina citri) is vector of CLas and CLam, whereas Trioza erytreae is known to be
the vector for CLaf.
Identified in Florida in 2005, citrus greening have been negatively affecting yield
and juice quality ever since (USDA-NASS, 2019). Slow disease symptoms development
and spread of the psyllid by hurricanes have set the state of Florida under quarantine
for all citrus production counties, as all of them have reported the disease. Several
citrus production states in the USA have reported the presence of either the disease or
the psyllid (Kunta et al., 2012; Kumagai et al., 2013), now including Texas and
California. To date, no resistant citrus commercial variety or a cure is known, and there
has not been completion of Koch's postulate.
37
Blotchy mottle leaves resembling zinc deficiency, misshapen fruits, early drop of
immature fruits, poor juice quality, inverted color development in fruits, phloem
blockage, root depletion and quick die back are some of the classical HLB symptoms
(Bové, 2006). Several approaches have been tested in affected groves to decrease
CLas incidence and its spread to new citrus plantings. Thermotherapy and application
of antibiotics have been alternatives to decrease bacterial titer in infected citrus plants
(Ehsani et al., 2013; Zhang et al., 2014; Yang et al., 2016; Hu et al., 2018). Rotation of
insecticides is a common strategy to control psyllids (Boina and Bloomquist, 2015; Chen
and Stelinski, 2017), as the release of natural psyllid predators (Juan-Blasco et al.,
2012), and the use of natural psyllid repellent trees (Zaka et al., 2010). Host
improvement, as planting of genetically improved varieties that exhibit more tolerance to
HLB (Stover et al., 2016) and adjustment of nutrition fertilizers (Kadyampakeni et al.,
2015; Tabay Zambon et al., 2019) have been the preferred choice by the grower to aid
CLas infected groves.
Adaptation to extreme environmental pressure of selected varieties is one of the
premises for citrus breeding. Historically, citrus varieties have changed genetically upon
emergence of devastating pests, discovery of spontaneous plant mutations leading to
improved varieties, and disease pressure (Hutchison, 1974; Zekri and Parsons, 1992;
Abbate et al., 2012; Stover et al., 2016; Miles et al., 2017). Enhanced varieties
developed and selected at the Citrus Research and Education Center in Lake Alfred
(CREC-IFAS-UF) have become a contributing source for maintenance of citrus
production under diseases and water stresses in Florida. Somatic hybridization via
38
protoplast fusion, induced mutation and traditional crossing are some of the methods
used to breed citrus (Abbate et al., 2012; Grosser et al., 2012; Guo et al., 2013).
Although the full breeding process generally takes a minimum of 15 years to yield
a new selected individual, it is necessary to combine in one plant a specific set of
desired traits, such as abiotic and biotic stress tolerances. Resistance or high tolerance
to water stress and soil-borne diseases are examples of traits selected in rootstock
breeding. Fruit setting and reliable development, resistance or tolerance to diseases
and vigorous growth are some of the desired traits for scions. However, few commercial
scions and rootstock varieties exhibit tolerance for the stresses listed.
Three new selections from the breeding program at the CREC, two scions and
one rootstock, were chosen to be tested in this study. Sugar Belle® (Citrus reticulata X
[Citrus reticulata X Citrus paradisi]), a tangelo, was selected due to its exceptional
tolerance to HLB, attractive dark orange peel marketable fruits, and better adapted to
current Florida environmental conditions when compared to 'Valencia' sweet orange
(Citrus sinensis) (Gmitter Jr et al., 2010). Selection of a cybrid, the result of a somatic
fusion that has the nucleus of one parent, and the cytoplasm of the other parent, named
here as Cybrid 304 [(‘Clementine’ x ‘Dancy’) x (‘Murcott’) + cytoplasm of G1 ‘Satsuma’],
was chosen for this study because of its healthy fruit development in symptomatic HLB
trees. Although a mandarin hybrid, this selection produces juice with sweet orange
organoleptic characteristics (Grosser, unpublished data). An improved ‘tetrazyg’
rootstock A+Volk x Orange 19-11-8, referred as AVO throughout this dissertation, was
selected to be part of this study. Resistant to the soil born root-rot (Phytophthora ssp.)
and highly tolerant to HLB, AVO is the result of a cross of a cybrid autotetraploid
39
(cytoplasm of Citrus amblycarpa + tetraploid nucleus of Volkameriana) and a ‘tetrazyg’
somatic hybrid, named UFR-4 ([Nova + Hirado Butan Pumelo] X [Cleopatra + Argentine
Trifoliate orange]) (Grosser, 2017). UFR-4 is gaining popularity as an HLB-tolerant
commercial rootstock (Florida Department of Agriculture and Consumer Services, 2018)
and has shown a higher ability to preserve feeder roots following CLas infection, as
compared to other standard rootstocks (E. Johnson, personal communication).
Appropriate nutrition is necessary to maintain plant health and regular
development (Obreza and Sartain, 2010; Auler et al., 2011; Yasin Ashraf et al., 2013;
Ilyas et al., 2015), and in combination with breeding and selection of improved varieties,
has shown promising results (Satpute, 2017). The lack of a sufficient concentration of a
mineral element in the soil fails the Liebig's law of the minimum, as the limiting nutrient
jeopardizes plant's growth. Citrus plants affected with HLB show decreased nutrient
uptake (Cao et al., 2015), and severe feeder root loss (Graham et al., 2013; Johnson et
al., 2014). To address the nutritional deficiency in HLB affected leaves, nutritional
sprays and pruning have revitalized field stablished CLas infected ‘Valencia’ sweet
orange (Rouse, 2013). Macro- and micronutrients recommended dosages for plant
growth are known for healthy citrus trees. However, in the HLB-era, a revision of the
minimum requirements for maximum plant development is due (Kadyampakeni et al.,
2015). Currently, fertigation and ground applied nutrients are the most used and most
effective nutrient delivery methods. Field stablished ‘Vernia’ sweet orange grafted onto
rough lemon rootstock that received three times the recommended overdose of
manganese (Mn) showed negative correlation to CLas inoculum cycle threshold values,
a possible therapeutic effect of Mn in HLB infected trees (Tabay Zambon et al., 2019,
40
see Chapter 3). In this experiment, soil-applied poly-coated fertilizers were used to
deliver all macro and micronutrients in a slow release form (Zekri and Koo, 1992).
Considering genotype and nutrition factors, the objective of this chapter was to
compare the effects of slow-release fertilizer formulations applied to distinct CLas-
infected scion and rootstock combinations along with a control HLB-negative healthy
scion/rootstock combination. Differences in growth rate, nutritional status, and the effect
of the fertilizer formulations on CLas cycle threshold in the various combinations were
studied.
Material and Methods
Plant Material
The experiment was performed in a temperature-controlled greenhouse (20-25̊ C
year-round) at the University of Florida – Citrus Research and Education Center (Lake
Alfred, FL). CLas is known to be sensitive to heat, so maintaining these temperatures in
the greenhouse favors CLas replication and disease development. One hundred and
twenty (120) composite potted trees (15.2 x 30.5 cm, 4.26 L) were divided in a split-plot
design (Figure 2-1). Three scion varieties: Sugar Belle® tangelo, Cybrid 304 and
‘Valencia’ sweet orange, previously confirmed as CLas infected, and three distinct
rootstocks: Swingle, Cleopatra and putatively HLB-tolerant experimental AVO were
chosen to be part of the composite plants (Table 2-1). Scions were grafted during the
spring of 2015 by two methods on the same day to ensure HLB infection. Bud-sticks of
field established trees, cleaned with soapy water, soaked in 30% bleach solution for 15
minutes, paper dried and wrapped in parafilm were grafted in a cleft graft followed by a
traditional inverted “T” graft below the cleft graft, secured with parafilm until the
development of the axillary buds (Supplemental Figures A-1 – A-4). Twelve healthy
41
‘Valencia’ grafted on Swingle trees were purchased from BriteLeaf Nursery (Lake
Panasoffkee, FL)
Nutrition Levels
Florikan Advantage (14-4-10) (Table 2-2), a 6-month controlled release fertilizer
containing enhanced micronutrients was used as the control treatment and as the base
fertilizer for the micronutrient overdose treatments. Controlled released fertilizers (CRF)
of two times the recommended dose of manganese (applied using TigerSul Mn) and
boron (applied using Florikan polycoated boron) were applied individually and in
combination with the CRF Florikan Advantage (14-4-10) (Table 2-2). The recommended
dose was determined based on the liquid fertilizer micronutrient composition used for
greenhouse plants (Supplemental Table A-1). Composite plants were fertilized every 6-
7 months starting August 2016. All nutrition levels were applied in the same day,
followed by tap water irrigation. Pest management was performed as necessary, and as
recommended for greenhouse maintenance.
Gas Exchange Measurements
Net photosynthetic assimilation (A) and transpiration rate (E) were measured in
three distinct leaves of each plant in August and October of 2016 and January 2017.
Measurements were done with a LI-6800 portable photosynthesis system with a
Multiphase Flash™ fluorometer chamber (LI-COR Biosciences, Lincoln, NE, USA),
throughout the day (9am to 5pm). Plants were fully watered prior to measurement, and
measurements were divided into 3 days, one day for each block of plants (Figure 2-1).
Physical Parameters Measured
Physical measurements of rootstock diameters at 5, 10, 15 cm (DR5, DR10,
DR15) below the graft union zone, diameters of the highest scion branch at 5, 10, 15 cm
42
(DS5, DS10, DS15) from the trunk insertion were performed with a digital caliper.
Length of the highest branch (HBB) in centimeters was measured with a measuring
tape. Number of leaves (NL), number of branches (NB), and number of leaves with HLB
symptoms (HLB) were counted. All physical parameters were recorded for July, August,
September, October and November of 2016, January, August, September, November
and December of 2017, May and September of 2018. Nutritional status of the plants
was evaluated in April of 2016, March and December of 2017, May and September of
2018. Three leaves from each plant were sampled for nutrient analysis. In April 2016,
leaves were subjected to acid wash with phosphate free soap and a solution of 5% of
12 N hydrochloric acid in distilled water and dried for 48 hours in an air forced heated
oven until stable dry weight. Acid wash, drying and grinding of the leaves were
performed at Dr. Schumann’s Lab at the CREC-Lake Alfred. Ground samples were sent
to Waters Agricultural Labs Inc (Camilla, GA) for nutrient analysis. Because of the high
labor to prepare ground samples at the CREC, for the subsequent sampling months, the
leaves were sent fresh to Waters Agricultural Labs Inc. (Camilla, GA).
CLas Detection Via Quantitative Polymerase-Chain Reaction (qPCR)
CLas cycle threshold (Ct) for July and October 2016 was measured, and
samples were prepared in Dr. Grosser’s Lab at the CREC-Lake Alfred. A composite of
ten midvein leaf discs from 5 different leaves for each tree were sampled with a single
paper punch, placed in a labeled screwed tube in ice with two steeling steal beats (2
mm). DNA was extracted according to kit instructions (GeneJET Plant Genomic DNA
Purification Kit, ThermoScientific, CA, USA.), and DNA was prepared for quantitative
polymerase chain reaction (qPCR) using TaqMan® gene expression master mix
(Applied Biosystems, Foster City, CA, USA), and cqul primer (Probe: 5’-/56-
43
FAM/ATCGTCTCG/ZEN/TCAAGATTGCTATCCGTGATACTAG/3IABkFQ/-3’, Primer 1:
5’-CCAACGAAAAGATCAGATATTCCTCTA-3’, Primer 2: 5’-
TGGAGGTGTAAAAGTTGCCAAA-3’; IDT DNA). Triplicates of each plant extracted
DNA, were analyzed in triplicate in a 96-well plate. A positive (known CLas infected
plant DNA) and a negative (water) controls had two replications in the same plate.
qPCR was performed in a StepOnePlus System (Applied Biosystems, Foster City, CA,
USA). Samples from January and August 2017, May and September 2018 were sent to
Southern Gardens Citrus Diagnostic Laboratory (Clewiston, FL) for CLas confirmation
via qPCR.
Statistical Analysis
Mineral elements concentrations were analyzed as a one-way analysis of
variance (ANOVA), with fertilizer, scion/rootstock combination and month as factors.
Zinc and sulfur were analyzed as two-way ANOVA (interaction between fertilizer and
scion/rootstock combination). Statistically significant means (p-value ≤ 0.05) were
separated by Tukey’s honest significant difference (HSD; HSD.test function, agricolae
package) (de Mendiburu, 2019) for the one-way ANOVA. Interactions were separated
by Tukey’s p-value adjusted pairwise comparison (emmeans function, from emmeans
package) (Lenth, 2019), and interaction plots were done. Boron and manganese were
analyzed as quasi-Poisson (glm function, from stats package) and natural log
transformed response, respectively.
Physical and gas exchange measurements were analyzed as two-way ANOVA,
(interaction between fertilizer treatments and scion/rootstock combination). Each
parameter was fitted to a distinct distribution family (glm function, from stats package).
44
Significantly different interaction means (p-value ≤ 0.05) were separated as described
before. CLas Ct values were analyzed as a two-way ANOVA, with scion/rootstock
interacting with fertilizer treatment. Ct values were log transformed and statistically
significant means (p-value ≤ 0.05) were separated by Tukey’s honest significant
difference. All statistical analyses were performed on RStudio v.1.2.1335 (R Core
Team, 2018).
Results and Discussion
Gas Exchange Measurements
Photosynthesis is an essential process on Earth to give life to all beings.
Oxidization of the water molecule and electron transport throughout the thylakoid
membranes in the chloroplast yields oxygen for respiration and ATP for carbon fixing
reactions. Several reviews have detailed explanation of the intricate mechanisms and
protein complexes utilized during the photosynthesis process (Sharkey, 1985; Allen et
al., 2011; Hohmann-Marriot and Blakenship, 2011). Photosynthesis and transpiration
measurements are done with a LiCOR 6800 XT open system. Based on the changes on
the flow rates of air and CO2, and flow rates of air and water concentrations entering
and leaving the machine chamber (Figure 2-2) photosynthesis and transpiration at the
immediate moment are calculated.
Net photosynthesis and transpiration data failed Levene's test for homogeneity of
variances. A generalized linear model was used to fit transpiration and net
photosynthesis data in a Gaussian distribution of the means, and identity distribution of
the residuals of the variances. Two-way analysis of deviance revealed statistically
significant transpiration rate over time (Figure 2-3), and between scion/rootstock
combinations and nutrition (Figure 2-4). For net photosynthesis, only the interaction
45
between scion/rootstock combinations and nutrition was statistically significant (Figure
2-5).
It is expected a reduction of transpiration rate overtime in plants, because of the
decrease of temperature and relative humidity and the natural decrease of plant
metabolism during the winter season. However, as the greenhouse has an air
conditioning/heating system, air temperature was not a major factor for the decrease of
transpiration over time (Ribeiro and Machado, 2007; Hu et al., 2009). As the relative
humidity was not controlled in the greenhouse, it is possible to assume that the
reduction of transpiration from August to January is based on the changes in the air
relative humidity (Table 2-3).
Transpiration rate of the interaction between nutrition formulation and
scion/rootstock combinations had a distinct pattern (Figure 2-4). The most extreme
interactions are discussed. Overdoses of boron (F+2xB and F+2xMn+2xB) decreased
transpiration rate in healthy Valencia grafted onto Swingle. Same results were found in
different citrus scion/rootstock combinations under excess of boron (Sheng et al. 2010).
However, the transpiration rates of CLas-infected scion/rootstock combinations under
F+2xB and F+2xMn+2xB formulations were mostly higher than healthy Valencia grafted
onto Swingle. All scions grafted onto Swingle had lower transpiration rates compared to
AVO and Cleopatra rootstocks under F+2xMn+2xB nutrition treatment. Cybrid 304
grafted onto AVO had higher transpiration rates when fertilized with F+2xMn+2xB than
Sugar Belle and Valencia grafted onto the same rootstock.
Sugar Belle grafted onto the selected rootstocks had a complex transpiration
response amongst the nutritional regimes (Figure 2-4). Sugar Belle grafted onto Swingle
46
also yielded the lowest transpiration rate under F+2xMn+2xB nutrition, compared to the
other rootstock varieties. Moreover, the transpiration rate of Valencia grafted onto
Swingle fertilized with F+2xMn+2xB was not statistically different from Valencia grafted
onto Swingle under the control Florikan Advantage formulation. Reduction of
transpiration is a mechanism that plants develop by closing stomata under stressed
environments (Foy and Weidner, 1987; Sheng et al., 2010). Plants infected with CLas in
this study showed reduced transpiration in unique responses of Cybrid 304 and Sugar
Belle scions grafted onto Swingle and fertilized with F+2xMn+2xB (Figure 2-4)
compared to the healthy Valencia grafted onto Swingle. Following the stomata closure,
water and nutrient movement upward from the roots by the xylem is reduced under low
transpiration rate, reducing the distribution of xylem sap to acropetal parts of the plant.
Net photosynthesis measurements showed differences amongst the treatments.
Amongst rootstocks, all scions grafted onto Swingle, including the healthy combination,
when fertilized with F+2xMn+2xB had a low net photosynthesis. Healthy Valencia
grafted onto Swingle had the highest photosynthesis values when fertilized with the
Florikan Advantage and F+2xMn compared to all the other combinations and fertilization
treatments (Figure 2-5). As previously reported excesses of Mn and B resulted in
reduction of photosynthesis (Li et al., 2010a; Sheng et al., 2010), jeopardizing all
processes in the plant. The same outcome was found in most of the scion/rootstock
combinations used in this study under overdose of B and Mn (Figure 2-5).
Rootstocks had a direct influence on the photosynthesis rates in selected scions.
Cybrid 304 grafted onto AVO and fertilized with F+2xMn had higher photosynthetic rate
means compared to Cleopatra and Swingle, a distinct rootstock effect under the same
47
fertilizer regime (Grosser, 2017). Cybrid and Sugar Belle scions grafted onto AVO net
photosynthesis were not statistically different from the healthy Valencia/Swingle
combination when fertilized with F+2xMn. The ability to perform like a healthy plant
when under a disease pressure demonstrates AVO tolerance to HLB. AVO was
previously shown to be an HLB-tolerant rootstock in a previous greenhouse study
(Satpute, 2017) and HLB+ Sugar Belle, Cybrid 304 and Valencia trees on AVO
remaining from this study that were planted in a commercial grove near Avon Park, FL
(under DPI permit) have all shown exceptional health after two years. (J.W. Grosser,
personal communication).
AVO rootstock could directly influence CLas infected scions to cope with low
photosynthesis rates, as it is reported for HLB affected plants (Cen et al., 2017).
Nevertheless, F+2xMn fertilizer treatment increased the photosynthesis rate of HLB+
Valencia when grafted onto AVO, Cleopatra, and Swingle, respectively. HLB+ Valencia
grafted onto Swingle when fertilized with F+2xMn and Cybrid 304 grafted onto
Cleopatra fertilized with control Florikan Advantage achieved the highest photosynthetic
rate averages amongst all the treatments. Manganese is known to be part of a complex
in the photosystem II, responsible for the breakdown of the water molecule, and
therefore, initiating the electron transfer to the complex (Allen et al., 2011). Presumably,
susceptible HLB+ Valencia plants are more deficient in the building blocks necessary for
the photosynthesis apparatus, therefore, achieving the higher photosynthetic rates is
possible when manganese is more accessible.
Scion influence was not as pronounced as rootstock, but Sugar Belle grafted
onto AVO and Cleopatra had higher photosynthesis rates when fertilized with F+2xMn
48
compared to Sugar Belle grafted onto Swingle. A phloem regeneration mechanism
previously identified in HLB+ Sugar Belle tangelo and "Bearss" lemon, cross- sections
from vascular tissue infected field established trees might be a possible explanation for
the tolerance to CLas, as the new sieve tubes can maintain photo assimilates
distribution throughout the plant, free of callose and p-protein deposition at the sieve
plates (Deng et al., 2019).
Nutrient Analysis
All the results of leaf nutrition analyses are presented in the Table 2-4 and
Figures 2-6 and 2-7; however, results for each mineral nutrient will be discussed
separately.
Nitrogen
Plants did not have nitrogen (N) measured for 2017 and 2018 years, as individual
dry weight necessary for N extraction and quantification were insufficient to perform N
extraction and quantification along with the other nutrients.
Phosphorus
Phosphorus (P) concentration in leaves was statistically significant between
December 2017 and May 2018 (Table 2-4).The non-linear accumulation over the
months can be due to remains of the nutrient in the potting substrate, since P has a
strong bond to soil colloids, decreasing the chances of leaching through the substrate.
Potassium
Potassium (K) concentration in leaves was statistically significant between
fertilization treatments, scion/rootstock combinations, and over time of the collection
(months) (Table 2-4). According to the Nutrition of Florida Citrus trees guide, optimum
levels of K range from 1.2-1.7%, high levels range from 1.8-2.4% and excess over
49
2.4%. All months had leaf potassium means concentration in the high range, with April
as the only month with K ranging in the excess. Amongst the nutritional formulations,
the highest K concentration was extracted from plants fertilized with F+2xB, statistically
higher than F+2xMn and Florikan Advantage. Manganese appears to attenuate the
uptake of K by the plants, as F+2xMn and Florikan Advantage were not statistically
different, neither from F+2xMn+2xB (Samet et al., 2015). Among the scion/rootstock
combinations, Sugar Belle grafted on AVO and healthy Valencia onto Swingle
combination were the only two combinations that had K in the optimum range according
to the Nutrition of Florida Citrus Guide. All the other combinations showed K in the high
range (Table 2-4). Cybrid 304 grafted onto Cleopatra had the highest averaged
concentration of K, statistically higher than Sugar Belle grafted onto AVO, healthy
Valencia onto Swingle, Cybrid 304 grafted onto AVO, Sugar Belle grafted onto AVO,
Swingle and Cybrid 304 grafted onto Swingle
Influence of the scion on the rootstock and vice versa is an old subject in the
study on how composite plants behave in adverse environments (Albrecht et al., 2012;
Dubey and Sharma, 2016; Albrecht et al., 2019). In this study, the K concentration was
influenced by the presence/absence of the disease, as healthy Valencia on Swingle was
statistically lower in K concentration in leaves compared to the HLB+ Valencia on
Swingle (Table 2-4). Unlike studies that revealed influence of rootstock on the mineral
composition and metabolite profiles, there was no statistical differences between AVO,
Swingle and Cleopatra.
Although not linear, K concentration decreased over the months in leaves of all
the combination levels among all the fertilizer treatments. Leaf K was higher before the
50
first nutrition level application (April 2016), and lowest in the last sampling month
(September 2018).
Magnesium
Magnesium (Mg) concentration in leaves was statistically significant for fertilizer
treatments, scion/rootstock combinations, and months (Table 2-4). All nutrition levels
kept leaf Mg concentration in the optimum range (0.3 – 0.49%) according to the Florida
Nutrition Guide. Florikan Advantage + 2xMn + 2xB resulted in a higher Mg
concentration in leaves, compared F+2xB (Table 2-4). Florikan Advantage was not
statistically different from the other nutrition treatments, which can be interpreted as a
balanced level of Mg in the base fertilizer for HLB affected citrus growth.
Healthy Valencia on Swingle combination versus the HLB+ affected Valencia on
Swingle were not statistically different. The improved scions Sugar Belle and Cybrid 304
grafted onto AVO had Mg levels above the optimum range set by the Florida Nutrition
Guide. Scions grafted onto AVO rootstock had statistically higher Mg concentration than
HLB+ Valencia grafted onto Swingle, as UFR-4 parent of AVO was chosen due to the
its root preservation. The constant root growth of the improved AVO rootstock could be
a possible the reason behind higher Mg concentration in scions' leaves grafted onto it,
compared to highly susceptible rootstock varieties to CLas (Grosser, 2017).
Regardless of the scion/rootstock combination and nutrition treatments,
magnesium concentration in leaves accumulated over the months of sampling. Such
accumulation could be a response of the plants to CLas in an attempt to cope with the
loss of the Mg from disrupted chloroplasts gramma from starch accumulation (Cimò et
al., 2013), as well as the formation of new leaves over time (Figure 2-12), therefore the
requirement of Mg for the synthesis of new chlorophyll.
51
Magnesium is a crucial nutrient for the synthesis of the chlorophyll molecule
(Huber and Jones, 2012); therefore, essential for plant survival through photosynthesis.
Because of similarities in atomic size, Mg and Mn can replace each other in several
enzymatic reactions (Marschner, 1995). Boron and magnesium in this study had an
antagonistic relationship, as plants fertilized with F+2xB showed statistically significant
lower levels of Mg compared to the F+2xMn+2xB (Table 2-4). Pepper, tomatoes, and
cucumber responded the same way for boron and magnesium antagonistic interaction
(Dursun et al., 2010). The increasing of B concentration in soil negatively affects Ca and
Mg concentration in-field established 'Vernia' sweet orange grafted onto 'Rough lemon'
under overdoses of micronutrients applied as poly-coated slow-release fertilizers (Tabay
Zambon et al., 2019).
Calcium
Calcium (Ca) concentration in leaves was statistically different between nutrition
treatment, scion/rootstock combinations, and month of sampling (Table 2-4). Highest Ca
leaf concentration was found in plants treated with Florikan Advantage, and Ca
concentrations from all nutrition treatments were in the low range according to the
Florida Nutrition Guide (1.5-2.9%).
Calcium concentration in plants fertilized with Florikan + 2xB was statistically
lower than the control (Table 2-4). Under Ca excess in the soil, foliar and soil boron
applications alleviated calcium translocation in tomato (Singaram and Prabha, 1997),
moreover elevated concentrations of boron in the soil decrease the leaf Ca in pepper,
cucumber and tomato (Dursun et al. 2010). The healthy Valencia/Swingle combination
yielded the highest Ca level in the optimum range (3.0-4.9%) for foliar Ca, followed by
Cybrid 304 grafted onto AVO. All remaining combinations ranged low for Ca
52
concentration in citrus leaves. Calcium cation (Ca2+) regulates most of the plant growth
and development in plants, from permeability and selectivity of ions, and plasticity of the
cell membrane through interaction with pectates, and promotion of growth of pollen
tubes (Hepler, 2005). Under abiotic stress cytosolic free Ca2+ level increased in plants,
inducing stomatal closure as the plant perceives Ca2+ oscillations. Pathogen triggered
immunity (PTI) is one of the mechanisms by which plants can stop pathogen invasion
(Jones and Dangl, 2006). When PTI is activated, there is an influx of extracellular Ca2+,
regulating post-translational modifications on the respiratory burst of oxidase homolog
(Rboh) protein. Rboh is known to induce production of reactive oxygen species (ROS)
for physiological and developmental processes (Knight and Knight, 2001). Cybrid 304
fruits from HLB-positive trees in the field exhibit healthy color development and
morphology, in contrast to fruits from other varieties from HLB-positive trees, along with
no HLB-induced fruit drop. The reason of asymptomatic Cybrid 304 fruits could be the
activation of PTI and the following induction of Rboh towards growth and development,
diminishing plants’ reaction to CLas. Some fruit of this variety is lost to splitting due to
thin fruit rind. Besides the statistically higher Ca+2 concentration in leaves of healthy
Valencia onto Swingle, CLas infected Cybrid 304 onto AVO Ca+2 leaf concentration was
statistically higher than the commercial Valencia onto Cleopatra combination,
supporting the hypothesis that improved genotypes respond differently to CLas
presence than CLas susceptible combinations, by importing the extracellular Ca+2 as a
PTI response.
More susceptible plants, however, showed lower Ca concentration in leaves
compared to healthy Valencia grafted onto Swingle, which could be due to the reduced
53
root area for uptake of nutrients, as loss of root mass is one of the earliest symptoms of
HLB. Susceptible plants appear to have an unbalanced allocation of energy between
routine growth and defense favoring defense by activating all the mechanisms to
prevent bacteria spreading to distal parts of the plant through plugging of phloem sieve
tubes by callose deposition and pp2 protein (Bové, 2006; Satpute, 2017; Deng et al.,
2019).
Boron
A quasi-Poisson regression was used to fit boron (B) concentration in citrus
leaves since the data failed Levene's homoscedasticity test. The quasi-Poisson
regression allows, accordingly to its properties, an error distribution model other than
the normal distribution, as the variance is considered a function of the mean
(Wedderburn, 1974). The interaction between scion/rootstock combinations and
fertilizer treatments was not significant with a two-way ANOVA; therefore, all factors
were analyzed independently in a one-way ANOVA. All factors examined showed
significant p-values (≤ 0.05). Although the quasi-Poisson distribution default log
transforms the response variable, honest significant difference test presented the
means in their integral value. All nutrition treatment means were statistically different
from each other (Table 2-4). As expected, plants that received the 2x B in its nutrition
had the highest B concentration in leaves, over two times the limit for excess (>
200ppm) according to the Florida Nutrition Guide. Plants that received Florikan
Advantage and F+2xMn were in the high range for B concentration (101-200ppm).
Presence of overdose of Mn in the mix reduced the B uptake, as can be seen in the B
concentration of the F+2xMn+2xB nutrition treatment compared to the F+2xB nutrition
treatment (Table 2-4). B concentration in leaves decreased over the months, following
54
plant necessities for growth of new shoots/root tips during the growing season. All
scion/rootstock combinations had B concentration in leaves in excess (>200 ppm);
however, Cybrid 304 and Sugar Belle grafted onto AVO had the lowest B concentration.
Boron absorption and transport are dependent on the water potential in the plant and
changes with the transpiration rate (Boaretto et al., 2008). Swingle plants are known to
require more water to grow, (Mesquita et al., 2016), therefore increasing B
concentration in the scion. However, in this experiment, several scion/rootstock
combinations transpired more compared to any scion grafted onto Swingle. Hass (1945)
grafted buds of orange trees on distinct rootstocks and concluded that leaf B in orange
trees decreased in the following sequence of rootstocks: trifoliate orange, sweet orange,
grapefruit, and sour orange. Swingle is a hybrid of trifoliate orange and grapefruit;
therefore, its higher B accumulation and transpiration rate are traits probably inherited
from its trifoliate parent. AVO is a complex tetrazyg crossed with a cybrid autotetraploid
developed at the Citrus Research and Education Center (Grosser et al., 2007; Grosser
et al., 2015; Grosser, 2017). One of the AVO parents is a mix of trifoliate orange, a
mandarin, and pumelo. The other parent has a nuclear contribution from lemon and
cytoplasm from a mandarin. Trifoliate hybrids and mandarins are known for tolerance to
a range of abiotic and biotic stresses and (Grosser et al., 2007). It is known that CLas
infected rough lemon shows the same response in starch accumulation compared to
mock-inoculated seedlings, as xylem remained the primary starch storage in the roots
(Fan et al., 2013). The putative tolerance of AVO, therefore, may be due to several traits
bred into a unique outcome, such as the tolerance of trifoliate orange and mandarins to
55
soil-borne diseases, and the phloem regeneration of lemons when infected with CLas
(Fan et al., 2012; Fan et al., 2013; Deng et al., 2019).
The role of boron in plant growth and development is related to the cell structure,
as most of the boron concentration is in the cell wall composition. Accumulation of
boron in the growing points of leaves and stems could have led to a dependency of
boron concentration at the apex for typical meristem cell metabolism, as abnormalities
in the cell wall and middle lamella are the first symptoms of boron deprivation. Like
calcium, boron has an intimate relationship with pectinates, as it keeps the cell-matrix
intact in the presence of a potent chelator in the cell solution intended to destabilize cell
wall pectin structure (Ginzburg, 1961). By doing so, B maintained Ca concentration in
the cell, therefore maintaining a healthy cell structure.
Manganese
Manganese leaf concentration was analyzed as log-transformed and explained in
mg kg-1 (Table 2-4). As expected, the nutrition treatments with overdoses of Mn
(F+2xMn, F+2xMn+2xB) had significantly higher Mn concentration in leaves compared
to the other nutrition treatments. Leaf Mn concentration for both nutrition treatments with
an overdose of Mn was in the range of excess Mn, according to the Florida Nutritional
Citrus Guide. Florikan Advantage and F+2xB were not statistically different between
each other and were classified in the range for high and optimum concentration ranges
of Mn according to the Citrus Guide, respectively (Table 2-4). Accumulation of Mn
overtime was not linear; however, it is possible to distinguish higher Mn concentration in
leaves during the spring–summer months (April-May) and decrease of Mn concentration
in the fall-winter months (September-December). Such differences can be explained by
56
the build-up of new growth flush as sink demand, and synthesis of new chlorophyll
molecules during the spring season.
All scion/rootstock combinations had high Mn concentration according to the
Florida Citrus Nutrition Guide. Moreover, Mn concentration for the healthy
Valencia/Swingle combination was statistically different from the HLB+
Valencia/Swingle.
A healthier root system with functional feeder roots could explain the
accumulation of Mn in the healthy combination compared to HLB+ trees. However,
several HLB+ scion/rootstock combinations were not statistically different from the
healthy combination. Citrus plants can deal with excess of manganese in the soil, as
accumulation of feeder roots has been observed (Leonard and Stewart, 1959; Blamey
et al., 1986; Marschner, 1991). In Citrus volkameriana, chloroplasts are essential sinks
for high levels of Mn, apart from vacuoles, which can be considered an adaptative
response of the plant against Mn excess (Papadakis et al., 2007). AVO rootstock, which
has half of its nucleus from C. volkameriana in its genome, yielded the lowest Mn
concentration compared to the healthy combination (Table 2-4); therefore,
demonstrating the adaptation to excess of Mn. Genotype has an important role, as it
could distribute roots and shoots excessive Mn, through metal complexes in roots.
Further studies in AVO roots are necessary to describe Mn distribution under Mn
excess in the soil.
Zinc
Accumulation of Zn in citrus leaves was statistically higher during summer (Apr-
2016, May-2018) than and early fall (Sept-2018), following new growth flushes (Table 2-
4). Scions grafted onto Cleopatra had the highest Zn concentration in leaves when
57
fertilized withF+2xMn+2xB (Figure 2-6). Healthy Valencia/Swingle ranged in the
optimum levels of Zn for all the nutrition treatments, while HLB+ Cybrid 304 grafted
onto Cleopatra also had Zn levels ranging in the optimum level, but F+2xMn, that
ranged in the limit of low range for Zn according to the Florida Citrus Nutrition Guide. Zn
concentration in HLB+ Sugar Belle grafted onto AVO and Swingle in all nutrition
treatments were below the optimum level for citrus. Whereas, Sugar Belle grafted onto
Cleopatra reached optimum Zn levels when fertilized with overdoses of micronutrients.
Since the only source of Zn was from the base fertilizer Florikan Advantage, it is
possible to infer that Cleopatra accumulates Zn under F+2xMn+2xB nutrition. Increment
of Zn concentration in leaves could be caused by the soil low pH, achieved by the
presence of elemental sulfur in the Mn overdose nutrition treatments (Wallace et al.,
1979). As all combinations received the same fertilizer treatments, Zn concentration in
leaves should not be different, however, under the F+2xMn+2xB treatment, scions
grafted onto AVO had lower Zn leaf concentration compared to scions grafted onto
Cleopatra.
Zn is part of the structure of the Cu/Zn superoxide dismutase (Cu/Zn-SOD), a
critical ROS scavenger in the cytoplasm, while Cu is responsible for the catalysis.
Grapefruit plants infected with HLB showed up-regulation of Cu/Zn superoxide
dismutase protein (Nwugo et al., 2013b), suggesting that susceptible HLB plants require
more Zn to stabilize SODs for ROS defense (López-Millán et al., 2005). Cleopatra
rootstock also showed an increase of Cu/Zn-SOD expression when infected with CLas
compared to healthy control (Albrecht and Bowman, 2012a). However, symptomatic
Valencia grafted onto AVO showed low expression of Cu/Zn-SOD and zinc finger
58
protein 7 (Satpute, 2017). The low expression of Cu/Zn-SOD in AVO may be involved
with a better adaptation to high concentrations of ROS, created by the presence of
CLas by a secondary glutathione scavenging pathway, moreover, improving tolerance
to CLas (Wang et al., 2016).
Iron
Several studies have found differences between iron (Fe) uptake between citrus
genotypes infected with HLB (Nwugo et al., 2013a; Nwugo et al., 2013b). In this study,
healthy Valencia/Swingle yielded the highest Fe concentration in leaves; however, it
was not statistically significant from HLB infected Valencia/Cleopatra, Cybrid
304/Swingle, and Valencia/Swingle. Sugar Belle grafted onto Cleopatra, and AVO
yielded Fe leaf concentration below the optimum range according to the Florida Citrus
Nutrition Guide.
Volkamer lemon and mandarin types followed by citranges, citrumelos, and
trifoliate orange showed high to a low rate of Fe3+ reduction under Fe deficient solutions
(Castle et al., 2009). In the complex AVO genotype, the UFR-4 contains genetic
contributions from trifoliate orange and pummelo; both parents ranked as very low in
reducing Fe3+ in a Fe deficient solution. The presence of a 4n nucleus from
Volkameriana in the other parent would be the biggest influence in the Fe reduction, in
AVO.
Accumulation of Fe in leaves was found statistically higher for late spring months
compared to fall and winter months (Table 2-4), which agrees with the seasonal
changes found in Washington Navel orange and 'Kinnow' mandarin 'on' and 'off' season
(Labanaukas et al., 1959; Mirsoleimani et al., 2014).
59
A detailed description of the relationship between manganese and iron in the soil
has been reviewed (Warden and Reisenauer, 1991). Soil pH influences the
bioavailability of Fe, as it precipitates in high pH soils, with low organic matter and
cation-exchange capacity. Excess of Mn in a solution increased the uptake of Fe.
However, the accumulation of Fe in its inactive form was found in the leaves because
NA efficiently complexes Mn into a chelate complex, transported in the phloem vessels
(Stephan et al., 1996). An iron transporter (IRT1) expressed in yeast could successfully
transport manganese into the cells; however, in the presence of Fe2+, Mn uptake was
inhibited (Korshunova, 1999). The nutrient analysis shows statistically lower of Fe
concentration in leaves when under overdoses of manganese (F+2xMn) compared to
the other nutritional formulations, an antagonistic effect of Mn towards Fe uptake by the
citrus roots. Excess of iron in the solution decreased Mn uptake significantly by rice
seedlings (Fageria and Rabelo, 1987), and Fe/Mn ion ratio is what determines Fe and
Mn toxicity/deficiency in sugar beet seedlings (Hewitt, 1948). Under deficient and
regular Mn supply, an antagonistic effect for Fe uptake was found in tomatoes,
whereas, excessive amounts of Mn in the solution yielded increase in Mn and Fe
absorption, regardless the B levels in the solution (Alvarez-Tinaut et al., 1980). In this
experiment, however, overdoses of Mn with and without B had the lowest Fe
concentration in citrus leaves, while the control, with regular Mn dose and overdose of
B, yielded the highest Fe concentration. Data in this study suggest that Mn-Fe
interactions in citrus roots are antagonistic under overdoses of Mn in the soil.
Sulfur
Sulfur (S) is an essential macronutrient, part of the amino acids cysteine, cystine
and methionine, and hence an important part of proteins, vitamins and plant hormones
60
precursors. This experiment showed enough uptake of S by all combinations in all
nutrition regimes, with most of the S concentration levels considered high (Figure 2-7,
Zekri and Obreza, 2013). Overtime, S concentration in leaves was constant (Table 2-4),
a response to the regular application of the fertilizer treatments. Moreover, as nutrition
formulations with overdoses of Mn has Sulphur in its composition, in contact with the
soil moisture, Sulphur associates with OH-, increasing the Because S is deeply
associated with the organic matter in the soil, the potted plants likely have a higher
supply of S than field established trees under regular fertilizer regime. Although S
ranged in the high levels, plants showed no sulfur phytotoxicity (Supplemental Figures
A-5 - 11). When absorbed in excess, vacuoles store sulfate, and, as soon it is
necessary for plant metabolism, can be re-mobilized. Mobilized S can be translocated to
other parts of the plants in its reduced form as glutathione, or as S-methylmethionine, in
addition to sulfate (Hawkesford and De Kok, 2006).
Sulfate (SO4-2
) is the primary source of S present in the soil, actively transported
through plasma membrane transporters into root cells, and then distributed to distal
parts of the plant. Availability of S in the cell is dependent on several reductions before
the formation of cysteine (Cys) in the chloroplast and the cytoplasm (Hell, 1997; Saito,
2004). Cys is the main compound for the formation of several metabolites that contain
reduced sulfur (S2-), such as methionine, glutathione, phytochelatins, and glucosinolates
(Mendum et al., 1990; Hesse and Hoefgen, 2003; Grubb and Abel, 2006; Lallement et
al., 2014). Glutathione is part of the abiotic stress signaling pathway, responsible for the
scavenging of damaging reactive oxygen species (ROS, Gupta et al., 2016). HLB
tolerant citrus trees showed an increase in the expression of glutathione-S-transferase
61
genes related to disease response (Wang et al., 2016; Satpute, 2017). In this study,
healthy Valencia/Swingle had the highest S concentration in leaves, while no
phytotoxicity was observed (Table 2-4, Supplemental Figure A-14). Scions grafted onto
Cleopatra had the lowest S concentration in leaves, a possible influence of rootstock
genotype to avoid excess sulfate uptake through the carrier proteins via negative
feedback of high intracellular sulfate concentration (Jensén and König, 1982). In a
previous study, neither scion nor rootstock varieties influenced S leaf concentration in
Navel and mandarin (Taylor and Dimsey, 1993). In this study, however, a higher
concentration of S with overdoses of Mn and B (F+2xMn+2xB) was observed, and it
was statistically different from the nutrition treatment with extra B alone (F+2xB, Table
2-4). Previous studies with high application of S (6 g kg-1) with an increase of N rates
(100, 200, 400 mg kg-1) in corn showed enhanced Mn and P uptake, while Fe and Zn
had negatively affected by high S concentration treatment (Soliman et al., 1992).
Copper
Copper (Cu) concentration in this study was in the excessive range for all the
factors analyzed. Besides the initial six months of nutrient fertilization (April 2016 to Dec
2017), where leaf Cu concentration in the trees was considered optimum, all the
remaining timepoints have statistically significant excessive amounts of Cu in leaves
(Table 2-4). Boron and Cu interaction pattern in the soil are frequently inconclusive, as
several reports present antagonistic and synergic interactions between both elements
(Tariq and Mott, 2007). In this study, the overdose of B (F+2xB) reduced significantly Cu
concentration in leaves compared to the control nutrition treatment without other
micronutrient overdoses (Table 2-4). Excess of Cu in leaves could be a response to the
low soil pH, as controlled released fertilizers are designed to acidify the rhizosphere,
62
therefore, improving nutrient uptake by the feeder roots. No signs of Cu toxicity and Fe
chlorosis were seeing on the potted plants. Excess of Cu in plants could lead to
oxidative stress due to the increase in ROS production (Ravet and Pilon, 2013) from
irreversible dysfunction of proteins. Dysfunction of proteins and enzyme degradation
affect cellular biochemistry and inhibit growth (Yruela, 2009).
Scion or rootstock variety did not influence Cu concentration in Navel oranges
(Taylor and Dimsey, 1993). In this study, healthy Valencia/Swingle yielded almost the
double of Cu in leaves compared to HLB+ Valencia/Swingle, an indication that CLas
can modulate Cu uptake and translocation in HLB infected plants. Moreover, although
Valencia/AVO showed upregulation of Cu transporters and Cu/Zn SOD compared to
symptomatic Valencia/Swingle (Satpute, 2017), in this study, Valencia/AVO leaf Cu
concentration was not statistically different from Valencia grafted onto Swingle (Table 2-
4).
Cu is a redox-active transitional metal that participates in several physiological
processes because of its multiple oxidation states in vivo. Cu2+ and Cu+ are bound by
nitrogen in histidine side chains, and to S in cysteines or methionine amino acids,
respectively. Cu is part of the Cu/Zn SOD, as it is necessary as a co-factor and catalytic
element (Yruela, 2009). As structural element, Cu is part of metalloproteins, which are
involved in the electron transport in chloroplasts and several oxidative processes, such
as the maintenance of the redox state in the apoplast, catalysis of the reduction of
putrescine (precursor of several polyamines responsible for regular plant growth and
development, as plant defense; Walters, 2003) to lignification of cell walls, and defense
from ROS (Yruela, 2009). Although the differences between scion/rootstock
63
combinations were slightly significant, improved scions showed a higher concentration
of Cu. The increase of Cu could possibly rise the pool of Zn/Cu-SOD pool, therefore,
reducing the concentration of ROS from plant disease response.
Plant Growth – Physical Measurements
Scion and rootstock diameters
An analysis of deviance for a general linear model was performed for trunk
diameters at 5, 10 and 15 cm below the graft union for rootstocks, and 5, 10 and 15 cm
from the trunk insertion for the most extended branch. Time of sampling (month) and
the interaction between scion/rootstock combinations and nutrition treatments were
significant for the three rootstock diameter measurements. As the homogeneity of
variance was not satisfied by Levene’s test; rootstocks diameters fitted a Gamma
distribution. The healthy Valencia/Swingle combination had only rootstock diameter at 5
cm below the graft union measured. For standard nursery grafting practices, the
rootstock shall not exceed 15 cm. However, all HLB+ plants had longer rootstock length
due to the possibility of bud-stick grafting failure, and to reutilize the same rootstock in
case of death of the grafted scion.
Diameter growth of scion and rootstocks over the months were significant (Table
2-4). As expected, diameters at 15cm below the graft zone and 5 cm from the trunk
insertion (DS5) were higher than the other diameters, respectively from rootstocks and
scions (Figures 2-6 and 2-7). Interaction between genotype and nutrition treatments
was significant for both diameters of scion and rootstocks; therefore, separate
discussions will be presented each for scions and rootstocks.
• Rootstock growth: diameter at 5, 10 and 15 cm below the graft union zone
64
Cleopatra rootstock had statistically significant thicker diameters when grafted
with Valencia, compared to Sugar Belle and Cybrid 304 scions under the F+2xMn+2xB
(N3) nutrition regime (Figure 2-8). Cleopatra performs very poorly when infected with
HLB (Albrecht and Bowman, 2012b), and rootstock thickness had a noticeable pattern
under the F+2xMn+2xB treatment.
Besides the healthy combination, that had the thickest diameter at 5 cm below
the graft zone, among the HLB+ combinations, Valencia/Swingle under the control
treatment yielded the thickest diameters. Swingle is known to be very vigorous in
growth, developing a much thicker rootstock in comparison to the scion above and
below the graft union. However, Florikan + 2xMn + 2xB (N3) nutrition treatment had little
impact on the growth diameter of Swingle when grafted with Cybrid 304, Sugar Belle
and Valencia, compared to the other nutritional treatments. This difference in thickness
was not found in the AVO rootstock, as diameters ranged in the same thickness,
regardless of the nutrition applied (Figure 2-8.). Overall, Florikan + 2xMn + 2xB (N3)
had the worst performance regarding increasing of diameter thickness for Swingle and
Cleopatra rootstocks, while AVO had similar trends for diameter thickness when grown
with the other nutritional treatments. A distinct pattern of rootstock growth was found for
Swingle growth in comparison to new hybrid rootstock varieties grafted with sweet
orange varieties in field trials (Albrecht et al., 2012), as Swingle had some of the lowest
growth percentages between seasons.
• Scion growth: diameter at 5, 10 and 15 cm of the highest branch
The three diameter measurements failed to fit normality in a linear model,
therefore, a generalized linear model was applied. The predicted values fitted a
quasipoisson distribution. Diameters at 5 cm from the insertion of the highest branch on
65
the trunk had the highest values, followed by 10 and then 15 cm (Figure 2-9). Cleopatra
influenced the scion diameter growth, as it did for rootstock thickness (Figure 2-9).
Cybrid 304 and Sugar Belle had the lowest scion diameter for all three points when
grafted onto Cleopatra, when grown with the F+2xMn+2xB nutrition treatment.
Whereas, Valencia/Cleopatra had the thickest diameters under the same nutrition
treatment. Overall, healthy Valencia/Swingle had the highest scion thickness for all the
three points regardless of the nutrition application, hence proving that overdoses of
micronutrients for healthy combinations are not different from the base control
fertilization. However, when infected with CLas, the micronutrients in overdoses proved
to be necessary to support asymptomatic scion growth. HLB+ Valencia/Swingle had
thicker branches under the F+2xB fertilization treatment (Figure 2-9). Overdose of Mn
from the F+2xMn fertilization treatment inhibited diameter growth of Valencia grafted
onto AVO compared to the other nutritional fertilizers, suggesting a possible utilization
on the Mn towards synthesis of Mn-SOD, instead of cambium growth. Sugar Belle/AVO
did not show differences between the nutrition treatments applied, which could be a
better energetic balance between growth and pathogen defense to HLB (Huot et al.,
2014; Satpute, 2017). Overall, for Cybrid 304, the control nutrition treatment (Florikan
Advantage) was the best for scion thickness, regardless of the rootstock (Figure 2-9).
Sugar Belle/AVO did not present any diameter differences regarding the nutritional
treatments. Whereas, when grafted onto Cleopatra and Swingle, F+2xB and the control
Florikan treatments yielded the thickest branches, respectively. Valencia/Swingle had
thicker scion diameter when fertilized with F+2xB, whereas Valencia onto AVO and
Cleopatra diameters were thicker when F+2xMn+2xB was applied. The choice of a
66
specific nutritional regime, can, therefore, improve or repress thickness of both scion
and rootstock. In this trial, amongst the HLB+ affected plants, Valencia/Swingle had the
best response to diameter thickness when Florikan Advantage, or Florikan + 2x B
treatments were applied.
Branch length – distinct nutritional requirements
Each plant had the highest branch measured from the graft union until the apical
meristem. Since the data fails the Levene’s homogeneity of variance test, a generalized
linear model under Gaussian distribution and residuals distributed in a log form fitted the
data, followed by the analysis of deviance. Interaction between genotype and nutrition
was found significant over time (months; Figure 2-10). Following the trend of poor
performance under the F+2xMn+2xB nutrition treatment, Sugar Belle/Cleopatra had the
smallest branches of all the combinations. As expected, the healthy Valencia/Swingle
combination had the longest branches (Figure 2-10). Among the CLas infected
combinations, Cybrid 304/Cleopatra fertilized with the F+2xB treatment had one of the
longest branches, followed by the same combination grown with the Florikan Advantage
fertilization treatment (control) and Cybrid 304 grafted onto Swingle fertilized with
control Florikan Advantage. The overdose of manganese nutrition treatment (F+2xMn)
limited Cybrid 304 growth when grafted on AVO and Cleopatra, however, when grafted
on Swingle, growth of the longest branch was improved. The response of different
rootstocks to the same nutritional treatment can be related to the nutritional necessities
of AVO, Cleopatra, and Swingle when infected with CLas. HLB+ Sugar Belle/Cleopatra
branch growth revealed that the scion/rootstock combination is sensitive to overdoses of
Mn and B together (F+2xMn+2xB), as the branches were among the shortest of all the
nutrition treatments (Figure 2-10). Control Florikan Advantage, however, yielded the
67
longest branches for Sugar Belle/Cleopatra and Sugar Belle/Swingle, suggesting a
better response of the scion/rootstock combination to the disease (Figure 2-10). The
length of Sugar Belle/AVO branches did not change amongst the nutritional treatments,
a similar behavior found in healthy plants. The commercial combination
Valencia/Swingle HLB+ had shorter branches when fertilized with F+2xMn+2xB,
consistent with another scions’ response grafted onto Swingle. However, F+2xB
treatment was the best nutritional mix, which can be related to this specific
scion/rootstock combination nutritional requirement when infected with CLas. Overall,
scion/rootstock combinations will perform differently under distinct nutritional
formulations due to different nutritional requirements when exposed to stress, in this
case, a bacterial pathogen.
Branch length over time (month) was statistically different (Figure 2-11), and as
expected, branch length increased over time. Trimming of branches in January 2017
and May 2018 caused a decrease in branch length. Trees were excessively tall and
shading each other in the greenhouse.
Number of leaves
The total number of leaves for each plant was counted and recorded. An analysis
of deviance was performed for the generalized linear model, with Gaussian distribution,
and identity as the link for the residual distribution, as the data failed Levene’s test for
homogeneity of variances. The month of collection and the interaction between
scion/rootstock combination and nutrition treatment were found statistically significant
(Figures 2-12 and 2-13).
Sugar Belle/Cleopatra grown with the F+2xMn+2xB nutritional treatment had the
lowest number of leaves. Sugar Belle grafted on AVO and Swingle rootstocks
68
performed distinctively regarding the total number of leaves under each of the nutritional
treatments (Figure 2-13). Nutritional treatment did not influence the number of leaves in
Sugar Belle/AVO, whereas the same scion grafted onto Cleopatra and Swingle, had a
noticeable difference in the average number of leaves grown with the various nutritional
treatments. Unique nutrient requirements of AVO, Cleopatra, and Swingle, when grafted
with infected Sugar Belle, could have a role in the final number of leaves. Therefore, the
number of leaves is dependent on the nutrition treatment applied to the soil.
Interestingly, the healthy Valencia/Swingle combination had a slightly higher
number of leaves grown with the overdosed of B (F+2xB) compared to healthy plants
under the Florikan nutritional treatment (Figure 2-13). The response could be because
of an increase in the meristematic apices’ activity without B phytotoxicity. Differences
between nutrition treatments were not significant in Cybrid 304 grafted onto AVO, as the
number of leaves was consistent amongst the nutrition treatments (Figure 2-13).
However, the number of leaves of Cybrid 304 grafted on Cleopatra and Swingle
combinations had different influences from the nutrition treatments. Cybrid
304/Cleopatra had more leaves when under the Florikan Advantage nutrition treatment,
while when grafted onto Swingle, F+2xMn yielded more Cybrid 304 leaves, a strong
rootstock genotype influence on the scion (Figure 2-13). Similarity, Valencia grafted
onto AVO, Cleopatra and Swingle also revealed an influence on the number of leaves
under the various nutrition treatments. Valencia/AVO had the lowest leaf quantity for all
nutrition treatments compared to Valencia/Cleopatra and Valencia/Swingle.
Nevertheless, Valencia/Swingle fertilized with either control (Florikan Advantage) or the
69
F+2xB treatment produced more leaves in comparison to Valencia grafted onto AVO
and Cleopatra under the same nutrition treatments (Figure 2-13).
Number of branches
Differently, from the other analysis that fitted in a generalized linear model, the
number of branches’ responses were log-transformed as the data failed Levene’s test.
The month of measurement and interactions between scion/rootstock combination and
nutrition were statistically significant by the analysis of variance (Figures 2-14 and 2-15).
The number of branches increased over time (months), but in December 2017 it
decreased because of the unexpected Phytophthora infestation (Figure 2-14).
Interaction between genotype and nutrition treatment for the number of branches
was analogous of the number of leaves, with a few distinct differences (Figure 2-15).
The overdose of B in the F+2xB and F+2xMn+2xB nutrition treatments yielded more
branches in Cybrid 304/AVO, compared to the control (Florikan Advantage), but not
higher than F+2xMn nutrition (Figure 2-15). Whereas, Cybrid 304 grafted onto Cleopatra
had the highest number of branches grown with F+2xMn+2xB, that was equivalent to
the worst nutrition treatment for Cybrid 304/AVO. Moreover, when grafted on Swingle,
F+2xMn and F+2xB nutrition treatments yielded the highest number of branches.
The healthy Valencia/Swingle combination had more branches when fertilized
with F+2xMn+2xB, while HLB+ Valencia/Swingle had more branches grown with the
control treatment (Florikan Advantage) and the F+2xB nutrition, a direct effect of CLas
on plant nutrient requirements for growth. Control Florikan Advantage treatment effects
on Valencia branching was dependent on rootstock, as the number of branches
increased from AVO > Cleopatra > Swingle. The same trend was noticeable for F+2xB
(Figure 2-15). While the F+2xMn nutrition treatment yielded the highest number of
70
branches in Valencia/AVO, when Valencia was grafted onto Cleopatra, the same
nutritional treatment yielded the lowest number of branches. HLB tolerant Sugar Belle
also showed a rootstock influence when fertilized with F+2xMn+2xB, by sprouting more
branches when grafted onto AVO. Moreover, Cleopatra and Swingle yielded a lower
number of Sugar Belle branches grown with F+2xMn+2xB nutritional treatment. The
rootstock response to nutritional treatments in scion branching was statistically different
for all HLB+ scions. Additionally, scions also had a distinct response to nutrition
treatments within the same rootstock varieties. The complex scion-rootstock relationship
is justified in this study and it is in agreement with previous studies (Benjamin et al.,
2013; Laino et al., 2015). However, the growth results showed that one nutrition does
not fit all the possible scion/rootstock combinations infected with HLB tested in this
study. Several studies tested or the effect of CLas in the plant nutritional status or how
the nutrition influence the plant status infected with HLB (Spann and Schumann, 2009;
Razi et al., 2011; Shen et al., 2013; Rouse et al., 2017). As shown in this study,
improved varieties are more propense to keep growth and development regardless the
nutrition applied over time, whereas commercially available combinations of
scion/rootstocks had a variety of responses from the nutrition formulations.
HLB index
HLB-like symptomatic leaves, such as blotchy mottled, corky feeling to touch, an
upright pattern of leaf growth (rabbit ears) were counted starting August 2017, in
addition to the qPCR for confirmation of CLas genomic material in the test plants. HLB
index consisted of the percentage of the HLB symptomatic leaves of the total of leaves
of each plant. The HLB-index data failed Levene’s test as well; therefore, data fitted a
generalized linear model with a quasipoisson distribution and residuals’ variance
71
distribution as a log. The month of sampling and interaction between scion/rootstock
combinations and nutrition treatments were statistically significant, as computed by the
analysis of deviance (Figure 2-16 and 2-17). Overall average of leaves with HLB-like
symptoms decreased over one year of measurements (Figure 2-16). Symptoms of HLB
in plants are known to be cyclical, as the bacteria multiply during winter, when colder
weather conditions are favorable, and the symptoms appear 4-6 months later, in the
newest fully expanded leaves, matching the new late spring-early summer flush
(Gasparoto et al., 2012; Sauer et al., 2015). Reduction of HLB index after three years
since the first fertilization is noticeable, especially from fall 2017 to fall 2018, when the
identification and sampling for HLB infected plants are the best because of the higher
populations of CLas in planta.
Sugar Belle hybrid mandarin is known to be tolerant to HLB, as it develops
marketable fruits and HLB+ trees present a healthy appearance compared to the
commercial ‘Valencia’ sweet orange (Gmitter Jr et al., 2010). Sugar Belle grafted on
Swingle had the lowest HLB index amongst the scion varieties (Figure 2-17). However,
several plants of distinct combinations in the experiment succumbed to the unexpected
infestation of Phytophthora. For example, Sugar Belle on Cleopatra grown with
F+2xMn+2xB declined significantly by the time HLB indexes measurements were
started, and plants were already too sick to be measured (data not shown). The
overdose of B on the F+2xB yielded the lowest HLB-index for HLB+ Sugar Belle/AVO
and although not statistically significant from the control Florikan Advantage. Moreover,
within the same scion genotype it was possible to observe the distinct nutritional
requirements for the tested rootstocks (Supplemental Figures A-5-13). For Sugar Belle
72
scion F+2xMn yielded higher percentage of leaves with HLB symptoms regardless the
rootstocks, however, not statistically different for F+2xMn+2xB when grafted onto AVO.
The high HLB index for Cybrid 304 grafted onto Cleopatra suggested an
incredibly high infection of CLas, however, boron toxicity must have misled the visual
symptomology for HLB, as excess of B leads to smaller and corkier leaves (Pandey and
Verma, 2017). The same mistake could have happened for measurements of HLB index
in Cybrid 304 grafted on Swingle. Cybrid 304 grafted on AVO, however, grown with
F+2xB did not show the same high number for HLB index, indicating a possible
transference of tolerance trait from the rootstock to the scion.
The similarity of HLB index values between Sugar Belle grafted on AVO,
Cleopatra, and Swingle defines as mostly a scion effect, as rootstocks had minimum
influence on the development of HLB-like symptoms when grown with F+2xMn+2xB. In
contrast, the rootstocks influenced the HLB index in Cybrid 304 and Valencia leaves
(Figure 2-17). Grown with overdose of Mn (F+2xMn), Cybrid 304 exhibited more HLB-
like symptoms when grafted onto Swingle, while on Cleopatra exhibited a middle range
for HLB-like symptoms in Cybrid 304, and on AVO had the least amount of HLB
symptoms. Whereas, Valencia grown with the same F+2xMn treatment had distinct
HLB-index pattern, as Valencia/Cleopatra had the highest HLB-like symptoms. No
statistical differences were observed between nutrition treatments of Valencia grafted
onto Swingle. Likewise, HLB evaluations of different scion/rootstock combinations in
field trials over the 2008-2009 season showed no significant differences among
Valencia grafted onto Cleopatra and Swingle (Albrecht and Bowman, 2012b). Overall,
Sugar Belle showed the lowest HLB-index average among all scions. Tolerance of
73
Sugar Belle to HLB, and therefore low HLB-indexes regardless of the rootstock could be
attributed to the distinct volatile metabolites synthesized by the improved scion,
responsible for the induction of plant defense mechanisms (Killiny et al., 2017) Also, an
anatomical visualization of phloem sieve tubes regeneration in Sugar Belle infected
plants in comparison to HLB susceptible ‘Valencia’ sweet orange was reported (Deng et
al., 2019).
As expected, the putatively tolerant AVO rootstock produced trees with lowest
disease indexes for all scions, supporting its presumed ability to transmit tolerance to
grafted scions.
CLas Detection – qPCR
Besides the visual symptoms of HLB, the detection and monitoring of bacterial
titers are fundamental to address if the treatments applied to the plants are working to
suppress pathogen growth. Therefore, ten midrib leaf discs were collected from 5
different leaves for each one of the test trees by a single paper punch (Tabay Zambon
et al., 2017) and subjected to a real-time polymerase chain reaction (qPCR). Sampling
for qPCR was first performed before the application of the nutrient treatments, on June
2016, and then at October 2016, January 2017, August 2017, May 2018 and September
2018. The data was log-transformed, as Levene’s test was significant for Ct values.
Interaction between genotype and nutrition formulations was significant, as was the time
of sampling (Figure 2-19).
As expected from a tolerant scion, Sugar Belle had the highest Ct values (and
thus lowest bacterial titers) from all the three scions tested, regardless of the rootstock.
Interestingly, Sugar Belle grafted onto Cleopatra under F+2xMn+2xB nutrition regime
had Ct values over 32, while overall growth was not favored under the same nutrition,
74
clear evidence that energy balance has been directed towards plant defense instead of
carbon skeleton building (Huot et al., 2014). Sugar Belle/Swingle under the F+2xMn
treatment had the highest Ct values amongst Sugar Belle combinations. This result is in
agreement to a previous study where Mn act as a therapeutic element in HLB+ ‘Vernia’
grafted onto Rough Lemon rootstock field trees (Tabay Zambon et al., 2019).
Cybrid 304 is known to develop fruits normally, without the color inversion and
misshapen fruit, as compared to other scion fruit from HLB+ trees (Grosser, personal
communication, Bové, 2006). Interestingly, AVO did not influence the final CLas Ct
values on the Cybrid 304 scion, as it exhibited the lowest Ct values compared to the
other rootstocks grafted with Cybrid 304. Swingle citrumelo, however, showed an
increase of Ct values amongst all nutritional formulations when Cybrid 304 was the
scion, and fertilized with the F+2xMn and F+2xMn+2xB treatments. Cybrid 304 grafted
onto Cleopatra under F+2xMn+2xB had the lowest Ct average amongst the selected
rootstocks, and the corresponding high CLas titer may be responsible for reducing
diameters of both scion and rootstock, number of leaves, and number of branches.
The rootstock genotype profoundly influenced responses from Cybrid 304 to
CLas infection, but none of the Cybrid 304 combinations exceeded the average for a
minimum of 32 cycles to be considered negative for an active CLas infection. By
analyzing the overall growth of Cybrid 304 grafted onto the selected rootstocks, it is not
possible to identify a pattern, as each nutrition treatment had a distinct effect on the
scion/rootstock combination. The Valencia/AVO combination, in contrast, showed
distinct Ct average responses depending on the nutritional treatment applied. The
F+2xMn+2xB was the best nutritional regime for HLB infected Valencia /AVO, as Ct
75
values were the highest for this interaction, and Valencia overall growth was higher
under the same nutritional regime. An unexpected contrast between HLB index and Ct
values were found, as higher Ct value average for Valencia /AVO grown with the
F+2xMn+2xB treatment corresponded to the highest HLB index for the same
combination and nutrition treatment (Figures 2-17 and 2-18). High Ct values could be a
heritage from the tolerant rootstock, while the Valencia scion is very susceptible to the
disease, therefore, showing HLB leaf symptoms even under low bacteria populations. It
is also possible that this combination needs more time to recover following the titer
reduction. The hypothesis of a rootstock influence can be confirmed by the averaged Ct
values of Valencia grafted onto Cleopatra and Swingle under the same nutritional
regime, as both combinations had low averaged Ct values as compared to Valencia
grafted onto AVO and had high averages for HLB index values as expected.
Sampling month was also statistically significant for Ct averaged values. Both
log-transformed and non-transformed data for Ct value curves have the same pattern
(Figure 2-19) CLas has a cyclical growth pattern (López-Buenfil et al., 2017), and since
both scion/rootstock combinations and nutrition treatment were statistically significant,
the increase of overall averaged Ct for the treatments relies on the interaction of both
factors in the process of the disease development. A cyclical pattern was noticeable
until August 2017, an exact year after the first fertilization. After August 2017, overall
averaged Ct values for all the plants increased, surpassing the negative threshold. The
higher average for Ct values means a better adaptation of citrus plants under specific
overdoses of micronutrients. The Ct value data across the entire experiment suggests
that a soil-applied high-quality slow-release nutrition program has the potential to
76
suppress CLas populations over time for most scion/rootstock combinations, thereby
allowing for improved tree health and productivity.
In March 2017, plants started to exhibit Phytophthora symptoms (slow growth
and exudates). Soil from 45 plants, 11 of them with evident root-rot symptoms, were
plated for root-rot screening in Dr. Evan Johnson’s Lab at the CREC-Lake Alfred in
October 2017. Infestation affected virtually all the plants. In an effort to correct this
problem, all old potting soil was removed, and all trees were repotted with new potting
soil in pots cleaned with bleach. Benches were sprayed with a 70% solution of bleach
before placement of the plants and allowed to dry. To control Phytophthora infestation
plants received a drench application the recommended dose of Revus ® (Syngenta,
200 mL of the fungicide solution per plant). Eleven trees did not survive the root rot
attack (data not shown) and of course were not included in the remainder of the
experiment.
Conclusions
Huanglongbing has been a reality in many Florida citrus groves for over a
decade. Since its first detection in the largest producers of fresh fruit and juice (China,
Brazil, United States) and other regions of the world (Africa and the Middle East), few
approaches have successfully prevented the rapid spread of the psyllid vector and the
disease. Several crops have used specialized nutrition to induce plant defense
mechanisms against biotic and abiotic stresses; however, application of nutrition for
defense mechanism in citrus is not well known.
Nutritional treatment response, tree growth and development, gas exchange and
CLas detection were measured in 120 plants, divided into 40 treatments, consisting of
10 scion/rootstock combinations and 4 nutritional formulations, some with overdoses of
77
Mn and B. This study shows control of scion/rootstocks over CLas under specialized
nutrition regimes, by balancing the energy status of the plants towards growth and
development, but as well, delivering the necessary constant supply of micronutrients to
maintain the overall nutritional status needed for a functional vascular system under
disease pressure. Few studies can connect plant growth and development, nutrition,
and genotype response to a pathogen. Interdisciplinary studies require an
understanding of the complex interactions, as the results from reports disagree amongst
crops and plant models.
In this experiment, it was confirmed that HLB+ citrus plants infected with the
causal agent CLas require a specialized nutritional formulation featuring elevated levels
of secondary and micronutrients to cope with the initial loss of phloem due to blockage
by callose and p-protein deposition as the typical citrus plant response to CLas
infection. By delivering an adequate quantity of micronutrients from the soil via the
roots, the infected plant defense mechanism has the essential minerals in quantities
necessary to fight the disease; however, not in an unbalanced way. Considering
nutrition as the only factor that improves citrus plants response to HLB is a
misunderstanding. Although all scion/rootstock combinations appear to respond to
enhanced nutrition at some level, some scions and rootstocks have a quicker and more
robust response for branch growth and leaf number. There can also be a
scion/rootstock synergy in the response. This study shows interactions between
improved varieties and overdoses of micronutrients necessary for the survival under
presence of CLas, compared to the commercial varieties available. Each one of the
scion/rootstock combinations had a specific best response to HLB under a specific
78
nutritional regime computed as Ct values, suggesting that each scion/rootstock
combination may have its optimum nutrient requirements for achieving maximum
tolerance to HLB.
Improved scion and rootstock varieties produced by conventional breeding
methods are thought of by many to be the future of citriculture in an HLB-era, as
genetically modified lines (GMO), and injection of antibiotics are still debatable topics for
the public. This study is the beginning to help further understanding of the fundamental
roles of micronutrient overdoses in HLB infected plants, and a start for additional
research on the reformulation of citrus nutritional guidelines for infected trees. Data
generated in the study also supports the enhanced HLB tolerance previously observed
in the Sugar Belle scion and the AVO rootstock (Satpute, 2017).
N2 CT N1 N3 N2 N1 CT N3 N3 N2 N1 CT
SC CS SS H VA SS VS H SS CC VS SS
VA H VC VA SC VC SC SS VA SC CS SC
VS SA VS CA CA VA VA CC CA H H SA
VC SC H SC CS SC H SC SC VA CA VS
CS CA SC SS VC SA VC VA CS CA SA VC
H VA CA CC SA CC CA CS H VC SS H
CA VC VA VC H VS SS VS SA SS SC VA
SS SS CC CS CC H CC CA VS VS VC CS
CC VS CS VS SS CA CS SA CC CS CC CC
SA CC SA SA VS CS SA VC VC SA VA CA
Figure 2-1. Schematics of HLB infected and healthy composite plants and nutrition
application placement in the greenhouse at the CREC/UF – Lake Alfred, FL. Scion and rootstock combinations: CA, Cybrid 304 grafted onto AVO; CC, Cybrid 304 grafted onto Cleopatra; CS, Cybrid 304 grafted onto Swingle; SA, Sugar Belle grafted onto AVO; SC, Sugar Belle grafted onto Cleopatra; SS, Sugar Belle grafted onto Swingle; VA, Valencia grafted onto AVO; VC, Valencia grafted onto Cleopatra; VS, Valencia grafted onto Swingle; H, healthy Valencia grafted onto healthy Swingle. Nutrition formulations: CT, Florikan Advantage; N1, Florikan Advantage + 2x Mn; N2, Florikan Advantage + 2x B; N3, Florikan Advantage + 2x Mn + 2x B.
Block 1 Block 2 Block 3
79
Table 2-1. Scion / rootstock combinations utilized in this study, n=3.
Rootstock Scion
Sugar Belle Cybrid 304 Valencia Healthy Valencia Swingle SS CS VS - Cleopatra SC CC VC - AVO SA CA VA - Healthy Swingle - - - H
Table 2-2. Nutrition formulations and amounts applied per plant every 6 months in an
acclimated greenhouse in Lake Alfred, Central Florida
Nutrition Symbol Formulation Amount Z
Product names
Control CT 14-4-10 20.5g Florikan Advantage Florikan Advantage + 2x Mn
N1 14-4-10 + 0.22% Mn
20.5 g + 1.32g
Florikan Advantage + TigerSul Manganese (MnO2)
Florikan Advantage + 2x B
N2 14-4-10 + 0.08% B
20.5 g + 1.8
Florikan Advantage + Florikan Polycoated Sodium Borate (Na2[B4O5(OH)4])
Florikan Advantage + 2x Mn + 2x B
N3 14-4-10 + 0.22% Mn + 0.08% B
20.5 g + 1.32g +1.8g
Florikan Advantage + TigerSul Manganese (MnO2) + Florikan Polycoated Sodium Borate (Na2[B4O5(OH)4])
Z Grams per tree
Pnet=uece- uoco
L (A)
T=uehe- uoho
L (B)
Figure 2-2. Gas exchange equations. (A) Net photosynthesis: Pnet; ue: flow rate air entering the chamber; uo: flow rate air leaving the chamber; ce: CO2 entering the chamber; co: CO2 leaving the chamber; he: water concentration entering the chamber; ho: water concentration leaving the chamber; L: leaf area measured.
Table 2-3. Monthly average of ambient relative humidity (RH) in Lake Alfred, FL. Data retrieved from FAWN (Florida Automated Weather Network).
FAWN Station Period RH avg 2m (pct) N (# obs)
Lake Alfred Aug-16 83 2976
Lake Alfred Sep-16 83 2880
Lake Alfred Oct-16 79 2976
Lake Alfred Nov-16 75 2880
Lake Alfred Dec-16 80 2976
Lake Alfred Jan-17 79 2976
80
Figure 2-3. Transpiration rate in mol m-2 s-1 for all plants under all nutritional regimes in
August and October 2016, and January 2017. Error bars represent standard error. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
0
0.0005
0.001
0.0015
0.002
0.0025
August 2016 October 2016 January 2017
Tra
nsp
ira
tio
n r
ate
(m
ol m
-2s
-1)
Month of measurement
A
C
B
81
Figure 2-4. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for transpiration rate in mol m-2 s-1. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
0.0005
0.0007
0.0009
0.0011
0.0013
0.0015
0.0017
0.0019
0.0021
CA CC CS H SA SC SS VA VC VS
Tra
nsp
ira
tio
n r
ate
(m
ol m
-2s
-1)
Scion/Rootstock combinations
CT N1 N2 N3
82
Figure 2-5. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for natural logarithm transformation of CO2 net assimilation in μmol m-2 s-1. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
3.5
4.0
4.5
5.0
5.5
6.0
CA CC CS H SA SC SS VA VC VS
Natu
ral lo
ga
rith
m o
f n
et C
O2
assim
ilatio
n (
μm
ol m
-2s
-1)
Scion/Rootstock combinations
CT N1 N2 N3
83
Table 2-4. Mineral nutrient content of susceptible and tolerant scion/rootstock combinations under distinct fertilization regime and interaction between factors. Letters with the same letter are not statistically significant by Tukey’s means separation with 𝛼 ≤ 0.05.
Nutrition Formulation P K Mg Ca S B Zn Mn Fe Cu
g kg-1 mg kg-1
Florikan Advantage (control) 0.16 1.84 B 0.46 AB 2.99 A 0.54 B 110.78 D 25.47 106.62 B 66.58 A 45.81 A Florikan Advantage + 2x Mn 0.15 1.85 B 0.46 AB 2.82 AB 0.56 B 142.39 C 25.52 462.67 A 58.85 B 39.81 AB Florikan Advantage + 2x B 0.15 2.02 A 0.44 B 2.77 B 0.45 C 565.8 A 25.32 100.58 B 70.63 A 31.29 B Florikan Advantage + 2xMn + 2x B 0.21 1.97 AB 0.49 A 2.92 AB 0.63 A 509.2 B 27.51 399.14 A 66.58 A 41.21 AB
p-value N.S. *** ** * *** *** N.S. *** *** *
Scion/Rootstock combination
CA 0.15 1.81 C-E 0.54 A 3.06 B 0.61 AB 252.56 G 25.62 173.87 B 63.25 B 54.0 AB CC 0.16 2.18 A 0.47 A-C 2.88 BC 0.48 C 282.35 E 30.75 213.19 AB 64.38 B 35.78 AB CS 0.15 1.9 B-E 0.45 B-D 2.85 BC 0.53 BC 349.17 C 26.8 213.00 AB 68.40 AB 37.01 AB H 0.17 1.76 DE 0.42 CD 3.50 A 0.71 A 268.62 F 29.59 295.97 A 76.36 A 62.56 A SA 0.16 1.72 E 0.54 A 2.85 BC 0.60 AB 251.45 G 22.08 174.63 B 58.83 B 37.55 AB SC 0.15 1.94 A-E 0.43 B-D 2.72 BC 0.47 C 274.66 F 27.03 209.91 AB 59.60 B 27.55 B SS 0.16 1.88 B-E 0.43 B-D 2.66 C 0.51 BC 395.87 B 23.41 187.64 AB 64.40 B 28.91 B VA 0.16 1.97 A-D 0.49 AB 2.76 BC 0.52 BC 300.77 D 22.60 185.36 AB 62.8 B 37.13 AB VC 0.23 2.06 AB 0.39 D 2.67C 0.44 C 425.68 A 26.45 193.50 AB 68.68 AB 38.34 AB VS 0.16 2.01 A-C 0.42 CD 2.71 BC 0.46 C 304.14 D 25.28 181.08 AB 67.16 AB 32.89 B
p-value N.S. *** *** *** *** *** *** * *** ***
Month of Sampling
April 2016 0.18 AB 2.84 A 0.37 C 1.80 D 0.34 B 478.48 A 31.57A 220.85 AB 78.25 A 11.55 C March 2017 0.19 AB 2.05 B 0.41 C 2.55 C 0.6 A 336.73 C 21.28 B 168.22 BC 57.7 C 65.55 A December 2017 0.13 B 1.82 C 0.38C 2.4 C 0.54 A 405.38 B 23.52 B 141.71 C 59.70 B 8.41 C May 2018 0.20 A 1.85 C 0.49 B 3.17 B 0.55 A 201.89 E 29.09 A 314.95 A 68.49 AB 38.49 B September 2018 0.15 AB 1.81 C 0.55 A 3.4 A 0.54 A 283.46 D 25.21 B 187.16 B 68.33 B 67.85 A
p-value * *** *** *** *** *** *** *** *** ***
Interaction
Scion/Rootstock * nutrition N.S. N.S. N.S. N.S. . N.S. * N.S. N.S. N.S. Significance codes: “***” 0.001; “**” 0.001; “*” 0.05; “.” 0.1; N.S. not significant
84
Figure 2-6. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for Zn concentration in leaves in mg kg -1. Data below the dashed black line range in the considered low concentration, above the dashed green line, data range in the optimum range of Zn in leaves. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
15
20
25
30
35
40
45
50
55
CA CC CS H SA SC SS VA VC VS
Zn
co
nce
ntr
atio
nin
lea
ve
s (
mg k
g-1
)
Scion/Rootstock combinations
CT N1 N2 N3
85
Figure 2-7. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for S concentration in leaves in g kg-1. Data below the dashed yellow line range in the considered optimum concentration, between the lines, considered in high, data above the black dashed line in the excessive range of S in leaves. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
Table 2-5. Monthly average of diameter growth for all scion/rootstocks, regardless
nutrition. Letters within the same column with the same letter are not statistically significant with 𝛼 ≤ 0.05.
Month of measurement DR5 DR10 DR15 DS5 DS10 DS15
(cm)
July 2016 0.72 F 0.72 F 0.73 F 0.45 E 0.41 F 0.38 D
August 2016 0.85 E 0.76 EF 0.77 EF 0.54 E 0.5 EF 0.46 D
September 2016 0.84 E 0.76 EF 0.77 EF 0.54 E 0.5 EF 0.47 D
October 2016 0.87 E 0.78 E 0.79 E 0.55 E 0.51 EF 0.48 D
November 2016 0.87 E 0.78 E 0.8 E 0.56 E 0.53 E 0.49 D
January 2017 0.88 E 0.79 E 0.8 E 0.56 E 0.52 E 0.49 D
August 2017 9.88 D 9.0 D 9.1 D 6.83 D 6.47 D 6.07 C
September 2017 10.02 C 9.1 C 9.26 C 7.0 BC 6.64 BC 6.19 C
November 2017 10.01 C 9.12 C 9.27 C 6.96 C 6.6 C 6.1 C
December 2017 10.08 B 9.19 B 9.41 B 7.03 BC 6.62 BC 6.14 C
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
CA CC CS H SA SC SS VA VC VS
S c
on
ce
ntr
atio
nin
lea
ve
s (
g k
g-1
)
Scion/Rootstock combinations
CT N1 N2 N3
86
Table 2-5. Continued
May 2018 10.09 B 9.23 B 9.35 B 7.1 B 6.74 B 6.34 B
September 2018 10.44 A 9.58 A 9.67 A 7.48 A 7.11 A 6.7 A DR5, DR10 and DR15: diameters at 5, 10 and 15 cm below the grafted zone; DS5, DS10 and DS15:
diameters at 5, 10 and 15 cm above highest branch insertion from the main trunk.
Figure 2-8. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for diameter of rootstock 5, 10 and 15 cm below the grafted union in cm.
0
2
4
6
8
10
CA CC CS H SA SC SS VA VC VS
Roo
tsto
ck d
iam
ete
r m
ea
n (
cm
)
Scion/Rootstock combinations
CT-DR5 CT-DR10 CT-DR15 N1-DR5 N1-DR10 N1-DR15
N2-DR5 N2-DR10 N2-DR15 N3-DR5 N3-DR10 N3-DR15
87
Figure 2-9. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for diameter of scion 5, 10 and 15 cm above the insertion of the highest branch in the trunk in cm.
Figure 2-10. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for length of the highest branch, in centimeters, measured from the graft union. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
0
1
2
3
4
5
6
7
CA CC CS H SA SC SS VA VC VS
Scio
n d
iam
ete
r m
ea
n (
cm
)
Scion/Rootstock combinations
CT-DS5 CT-DS10 CT-DS15 N1-DS5 N1-DS10 N1-DS15
N2-DS5 N2-DS10 N2-DS15 N3-DS5 N3-DS10 N3-DS15
25
35
45
55
65
75
85
95
105
115
CA CC CS H SA SC SS VA VC VS
Hig
he
st
bra
nch
len
gth
(cm
)
Scion/Rootstock combinations
CT N1 N2 N3
88
Figure 2-11. Means of the length of the highest branch for all plants in cm. Error bars
represent standard error. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
30
40
50
60
70
80
90
100H
igh
est
bra
nch
len
gth
me
an
(cm
)
Month
AAB AB B
CCD
CDEDEE
E
E
F
89
Figure 2-12. Mean of number of leaves for all the trees. Error bars represent standard
error. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
30
40
50
60
70
80
90
100A
ve
rage
of
nu
mb
er
of le
ave
s p
er
mo
nth
Month
A
B
CDC
CC
EFEFEF
DEDE
F
90
Figure 2-13. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for number of leaves. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
15
30
45
60
75
90
105
120
CA CC CS H SA SC SS VA VC VS
Num
be
r o
f le
ave
s
Scion/Rootstock combinations
CT N1 N2 N3
91
Figure 2-14. Natural logarithm means of number of branches for all the trees. Orange
line represents the same set of data. Error bars represent standard error. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
0
0.5
1
1.5
2
2.5
3N
atu
ral lo
ga
rith
m o
f n
um
be
r o
f b
ran
ch
es
Month
AA
BBB
B
C
D
D D D
B
92
Figure 2-15. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for natural logarithm mean of number of branches. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
0.5
1.0
1.5
2.0
2.5
3.0
CA CC CS H SA SC SS VA VC VS
Natu
ral lo
ga
rith
im o
f n
um
be
r o
f b
ran
ch
es
Scion/Rootstock combinations
CT N1 N2 N3
93
Figure 2-16. HLB index means of number of leaves with HLB-like symptoms per month.
Error bars represent standard error. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
0
2
4
6
8
10
12
14
16
18
August2017
September2017
November2017
December2017
May 2018 September2018
HLB
ind
ex (
%)
Month
A
B
C
D
E
F
94
Figure 2-17. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for HLB index Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
-5
0
5
10
15
20
25
30
35
40
45
CA CC CS H SA SC SS VA VC VS
HLB
ind
ex (
%)
Scion/Rootstock combinations
CT N1 N2 N3
95
Figure 2-18. Interaction plot between healthy and HLB infected scion/rootstock
combinations and fertilizer formulations for cycle threshold means of CLas. Green dash line correspondent to minimum of 32 cycles to be considered negative for HLB. Error bars represent standard error for Tukey’s HSD comparison of means with 𝛼 ≤ 0.05.
22
24
26
28
30
32
34
36
38
40
CA CC CS H SA SC SS VA VC VS
Cycle
th
resh
old
of
CL
as (
Ct
va
lue
)
Scion/Rootstock combinations
CT N1 N2 N3
96
Figure 2-19. Ct values and natural logarithm of Ct values of CLas per month. Green
line correspondent to minimum of 32 cycles to be considered negative for HLB. Letters with the same letter are not significantly different by Tukey’s HSD means separation with 𝛼 ≤ 0.05.
2.85
3.05
3.25
3.45
3.65
16
20
24
28
32
36
40
June 2016 October2016
January2017
August2017
May 2018 September2018
Natu
ral lo
ga
rithm
(Ct v
alu
e)
Ct va
lue
Month
Ct Log[Ct]
A
BBC
D
BC CD
97
CHAPTER 3 SIMULTANEOUS IDENTIFICATION OF TARGETED PLANT HORMONES IN HLB-
INFECTED SUSCEPTIBLE AND TOLERANT GREENHOUSE CITRUS TREES UNDER MICRONUTRIENT OVERDOSE
Background
Over the past decade the Florida citrus industry has been challenged by the
presence of the bacteria Candidatus Liberibacter ssp (Coletta-Filho et al., 2004; Halbert,
2005), the putative causal agent of the centenary disease known as huanglongbing
(HLB), or greening (Bové, 2006). Three different bacteria strains are known to infect
citrus genera and related species: Candidatus Liberibacter asiaticus (CLas); Candidatus
Liberibacter americanus (CLam); Candidatus Liberibacter africanus (CLaf). Both CLas
and CLam strains are found in Brazilian orchards, while in the USA, CLas was the only
strain reported. In Africa, another psyllid species (Trioza erytreae) is the vector of the
Candidatus Liberibacter africanus (CLaf) strain. In response to CLas presence,
deposition of callose and p-protein at the phloem sieve tubes occurs, decreasing the
size exclusion limit, therefore reducing the plant’s long-distance transport and signaling
(Koh et al., 2012). However, there are no reports about visible bacteria aggregates in
the phloem vessels or cases of physical blocking of the sieve plate pores of the phloem
vessels by a single bacteria (Kim et al., 2009). Moreover, before the observation of any
visual symptom in the aerial part of the plant, the root system collapses, causing feeder
root loss that culminates in decreased nutrient absorption and translocation (Fan et al.,
2013; Johnson et al., 2014).
Variety improvement for tolerance or resistance to HLB is critical in long-term
efforts to overcome the effects of disease on yield and grove longevity. Somatic
hybridization via protoplast fusion has been used to facilitate development of improved
98
varieties of citrus to overcome sexual incompatibility, to improve disease resistance, to
decrease the juvenility period, and to generate seedless fruits (Grosser et al., 1992;
Medina-Urrutia et al., 2004; Dambier et al., 2011; Guo et al., 2013). Sugar Belle®
(Citrus reticulata X [Citrus reticulata X Citrus paradisi]), an early-mid season bell-shaped
tangelo is one of the many outcomes from University of Florida Citrus Research and
Education Center (CREC) breeding program. Among all commercial scions, Sugar
Belle® is showing the best tolerance to HLB (Gmitter Jr et al., 2010). A sophisticated
tetraploid selection from the CREC rootstock improvement team, named here as AVO,
was chosen due to both resistance to Phytophthora ssp and for its the ability to transmit
HLB tolerance to grafted scions. AVO is the outcome from a cross of an autotetraploid
cybrid (cytoplasm of Citrus amblycarpa + tetraploid nucleus of Volkameriana) and a
tetrazyg somatic hybrid, named UFR-4 ([Nova + Hirado Butan Pumelo] X [Cleopatra +
Argentine Trifoliate orange]).
Plant hormones are a group of naturally occurring molecules that, in low
concentrations, modulate physiological processes of plant growth and development
(Moore, 1979). Endogenous phytohormones are classified based on their chemical
structure, as the five “classical” hormone groups: auxins, gibberellins, cytokinins,
abscisic acid and ethylene (Kende and Zeevaart, 1997), as well as jasmonates,
salicylates, brassinosterioids, polyamines and, strigolactones (El-Otmani et al., 1995;
Hayat and Ahmad, 2011; Rivas-San Vicente and Plasencia, 2011; Pieterse et al., 2012;
Waldie et al., 2014). As sessile individuals, plants face all types of environmental
stresses. Limiting growth factors, such as nutrients and water, and pathogen attacks,
are examples of abiotic and biotic stresses, respectively.
99
Unlike animals where hormones are produced in specific endocrine organs, the
biosynthesis of plant hormones is decentralized, as plant cells can produce the wide
range of endogenous hormones (Lacombe and Achard, 2016). The presence of a plant
hormones can stimulate or repress a morphological process at distal parts of the plant
(Kende and Zeevaart, 1997). Besides physiological responses for growth and
development, basal plant defenses are triggered by the activation of resistance
mechanism-, antioxidant biosynthesis-, abiotic- and/or biotic stress-related genes,
culminating in the regulation of biosynthesis pathways of plant hormones and/or growth
regulators (Ohme-Takagi et al., 2000; Kawano and Furuichi, 2007; Pieterse et al.,
2009).
Plant defense against pathogens consists of an arms race between the host and
pathogen, in two distinct branches of the plant immune system (Jones and Dangl,
2006). In one of the branches, plants use transmembrane pattern recognition receptors
(PPRs), to recognize microbial- or pathogen-associated molecular patterns (MAMPS or
PAMPs). One example of PPR, is a bacterial flagellin protein, moreover Candidatus
Liberibacter asiaticus genome encodes for a flagellin protein. Transient expression of
this flagellin protein in Nicotiana benthamiana caused cell death and callose deposition
in the sieve tubes, and this is an example of PAMP-triggered immunity (PTI) (Zou et al.,
2012). The other branch uses polymorphic nucleotide-binding leucine-rich repeated
domain (NB-LRR) proteins encoded by many resistance (R) genes in the host. In
effector-triggered immunity (ETI), effectors proteins released by the pathogen can
provoke an immune response if they interact with its correspondent NB-LRR protein in
the host. The SA-dependent pathway regulates plant immunity against biotrophic (Bari
100
and Jones, 2009). However, it is possible to enhance plant defense by activating both
SA-dependent and SA-independent pathways that involve JA and ET (van Wees et al.,
2000). Transgenic citrus plants overexpressing NPR1 gene (the non-citrus Arabidopsis
form), a dominant regulator of SA defense signaling, have shown resistance to CLas
compared to non-transgenic plants (Dutt et al., 2015). However, an HLB-resistant
individual is unknown in any non-transgenic citrus variety. It is known that CLas
encodes salicylate hydroxylase, which converts SA into catechol, thus suppressing SA
defense signaling (van Loon et al., 1998).
Activation of defense genes by plant hormones initiates a cascade of events to
limit pathogen spreading, known as the hypersensitive response (HR). Programmed cell
death (PCD), production of reactive oxygen species (ROS), and in the case HLB and
citrus, deposition of p-protein and callose in the sieve tubes of the phloem (Steffens et
al., 2006; Torres, 2010; Luna et al., 2011) are some examples of HR in plants. Through
phytohormone modulations, plants can re-prioritize necessary biological functions in
response to environmental disturbance. Abiotic and biotic stresses response pathways
crosstalk to accomplish phytohormone modulation (Spoel and Dong, 2008; Shigenaga
and Argueso, 2016).
Studies have found that plant hormones and their crosstalk modulate plant
response to CLas in genetically improved rootstocks grafted with Valencia compared to
commercially available Swingle (Citrus paradisi X Poncirus trifoliata) (Satpute, 2017).
Several other studies have reported changes in phytohormones in citrus varieties
infected with CLas specially to unveil host tolerance to the disease in commercially
101
available and citrus relatives (Cevallos-Cevallos et al., 2009; Rosales and Burns, 2011;
Wang et al., 2016; Killiny et al., 2017).
A second response in distal and uninfected parts of the plant is also part of the
hypersensitive response. In this natural plant defense system called systemic acquired
resistance (SAR), salicylic acid (SA) plays an essential role in the process. Tobacco
plants challenged with tobacco mosaic virus (TMV) show an increase of SA
concentration in intact distal leaves of the same plant (Malamy et al., 1990). Presence
of signals that lead to the expression of pathogenesis-related (PR) genes in distal parts
of the initial site of infection protects the plant from a secondary infection (Jones and
Dangl, 2006; Pieterse et al., 2012; Fu and Dong, 2013). Induction of the SAR response
was also triggered with foliar sprays of micronutrients, following mitigation of CLas titers
and an increase of leaf size over three years of application in citrus plants (Shen et al.,
2013). Several studies have shown the influence of phytohormones in nutrient signaling
(reviwed by Rubio et al., 2009); however little is known about the effects of micronutrient
overdoses in the phytohormones in HLB-affected plants. Controlled release fertilizers
(CRF) generally utilize coatings (clay or patented polymers) to slowly deliver
micronutrients, an alternative that delivers micronutrients to the entire tree instead of
just the scion as with foliar sprays. Moreover, the formulations are designed to acidify
the micro-environment rhizosphere to increase micronutrient uptake (Mortvedt, 1994;
Jacobs and Timmer, 2005).
Quantification of important plant development phytohormone modulators is
crucial to understand their functions in the plant metabolism and their participation in the
environment. Liquid chromatography, coupled with mass spectrometry detectors
102
emerged as a useful technique for hormonal quantification after decades of analysis
with immunoassays (Weiler, 1984), which had lower resolution and sensitivity (Hedden,
1993).
Our study objective addressed in this chapter was to quantify and profile the
presence of targeted phytohormones potentially involved in pathogen defense in
selected scion and rootstock combinations infected with HLB, grown with four distinct
CRF formulations. To the best of our knowledge, this is the first report studying the
interactions of nutrition, plant hormones, and different scion/rootstock combinations in
HLB-impacted citrus.
Material and Methods
Plant Material
A temperature-controlled greenhouse (20-25°C) at the University of Florida –
Citrus Research and Education Center (Lake Alfred, FL) was the location for this the
experiment. Figure 3-1 describes the experiment split-plot design with 120 plants. Three
scion varieties: Sugar Belle® tangelo, ‘Valencia’ sweet orange, and an experimental
line, Cybrid 304 mandarin hybrid ([‘Clementine’ X ‘Dancy’] X [‘Murcott’ + Cytoplasm of
G1 Satsuma]) previously confirmed as CLas infected were grafted in three distinct
rootstocks: Swingle, Cleopatra and AVO (Table 3-1). Each one of the composite trees
received a double-grafting: a cleft graft, with a bud-stick previously cleaned with soapy
water and soaked in 30% bleach solution for 15 minutes, paper dried and wrapped in
parafilm; and a traditional inverted “t” graft. Both grafts were done the same day and
secured with parafilm until the development of the lateral buds (Supplemental Figures
A-1-4). Once buds sprouted, 12 healthy Valencia grafted onto Swingle trees purchased
from BriteLeaf Nursery (Lake Panasoffkee, FL) were added to the 108 composite plants
103
from the nine scions/rootstocks combinations. CRF nutrition formulations enhanced for
micronutrients had four different levels, as described in Table 3-2. The first application
of CRF happened in August 2016, followed by sampling in October 2016. Each plant
had three mature, fully expanded leaves collected, individually identified, and stored at -
20oC until analysis.
Chemicals
Pure standards: benzoic acid (BA, cat. # 242381), salicylic acid (SA, cat. #
247588), trans-jasmonic acid (JA, cat. #14631), indole-3-acetic acid (IAA, cat. #I3750),
indole-3-propionic acid (IPA, cat. #57400), indole-3-butyric acid (IBA, cat. #57310),
abscisic acid (ABA, cat. # A1049), gibberellic acid (GA3, cat. #48880-1G-F), gibberellin
A4 (GA4, cat. # G7275), and anisic acid (AnA, cat. # W394505) were purchased from
Sigma-Aldrich (Saint Loius, MO, USA). Gibberellin A7 (GA7), trans-zeatin (tZ) and
trans-zeatin riboside (tZR), were purchased from Santa Cruz Biotechnology (sc-490116,
sc-222365, sc-208464; Santa Cruz, CA, USA). Pure methanol, isopropanol, glacial
acetic acid, sterile water, and 0.1% formic acid in acetonitrile were already available at
the laboratory.
Stock Solutions of Phytohormonal Compounds
Individual stock solutions of the phytohormones of interest and internal standard
were made as 2000 µg mL-1 in methanol (MeOH) and kept in the -20°C for storage. An
aliquot correspondent to a 200µg mL-1 of each one of the phytohormone stocks and
internal standard were pooled together in a 2.0 mL amber glass vial (final concentration
of 117 µg mL-1) and kept at -20°C until analysis. Extraction and quantification of the
citrus endogenous hormones in the test plants were performed at the Florida
Department of Citrus Laboratory Facility (Lake Alfred, FL).
104
Extraction of phytohormones from citrus leaves
The phytohormone extraction protocol was modified from Müller and Munné-
Bosch (2011) as follows: three fully expanded leaves from each plant collected in
October 2016 and ground under liquid nitrogen into a fine powder. Immediately before
extraction, 200 mg of ground material was weighed inside of previously cooled 15 mL
plastic conical tubes with a screw cap (Falcon, ref. 352099). The remaining plant
material was kept in the -20°C freezer. Five milliliters of the extraction solvent
(isopropanol: methanol: glacial acetic acid; 79:20:1 v/v/v) were added to each one of the
tubes, plus 10𝜇L of the 200 µg mL-1 of anisic acid (IS) in a ventilated hood. Extraction
was conducted for an hour in ice-cooled water (between 0 – 10°C) sonicator (FS30,
Fisher Scientific and B-220, Branson ultrasonic cleaner, SmithKline Co, Shelton, CT,
USA.). Tubes were placed diagonally in the rack; hence, the plant material was in
complete contact with the solvent. To maintain extraction of phytohormones at low
temperatures, removal of iced-water and addition of ice happened every 15 minutes.
After extraction, tubes were centrifuged at 4284 g, for 5 minutes at 4°C (Sorvall RC 6+
Centrifuge, Thermo Scientific). Supernatants were transferred to new 15 mL Falcon
tubes, allowed to dry under N2 stream and water bath (35-40°C) in a ventilated hood
(N-EVAP 111 Nitrogen evaporator, OA-SYS heating system, Organomation Associates,
Inc. Berlin, MA, USA). When the extracted volume reached approximately 500 µL, the
volume increased to approximately 1.5mL through the addition of 1ml of pure methanol.
Tube wells were washed to solubilize compounds of interest that potentially could have
dried. The extract was then transferred to a 1.5 mL microcentrifuge tube (Fisher
Scientific, Pittsburgh, PA, USA) and allowed to complete drying under the same
conditions. Following immediate addition of 200 µL of pure methanol, extracts were
105
vortexed for homogeneity for 15 seconds and filtered (SINGLE StEP nano filter Vial, 0.2
µm PTFE, Thomson Instrument Company) prior injection. Extracts were then
transferred to 300 µL silanized glass tube inserts (C4010-630TM, Thermo Scientific
Rockwood, TN, USA), inside a 1.5 mL amber glass vial, with snap-cap (C4011-6W 12 x
32mm, Thermo Scientific, Rockwood, TN, USA), and placed in the cooling drawer at
10°C prior 5µL injection.
UHPLC-MS/MS Analysis
The UHPLC system consisted of an Accela 1250 quaternary pump equipped with
an autosampler (Thermo Scientific, San Jose, CA, USA). For the reverse phase
chromatography, the column choice was the Hypersil Gold aQ (Thermo Scientific, San
Jose, CA USA) C18 column (100 x 2.1 mm, particle size 1.9 µm). Gradient elution
consisted of water and 0.1% of formic acid as solvent A and acetonitrile with 0.1%
formic acid as solvent B, at a constant 0.3 mL min-1 flow rate. Gradient profile was as
follows: (t (min), %A): (0,70), (2,70), (7, 55), (17, 20). At the end of the gradient, the flow
rate was increased to 400 µl per minute and re-equilibrated to initial conditions (8 min):
(25, 70).
A TSQ Quantum Ultra (Thermo Scientific, San Jose, CA, USA) mass
spectrometry did the measurements of phytohormones, and the settings were as follow:
capillarity voltage was -2.5kV and 3.5 kV for negative mode and positive mode
respectively, capillary temperature at 400°C, vaporizer temperature at 300°C, auxiliary
gas at 10 Arb, sheath gas pressure at 25 Arb, collision gas pressure at 1.5 mTorr.
Optimization of machinery settings for each one of phytohormones’ ions was
determined based on previews studies and summarized (Table 3-3).
106
Through the running of standard mixes before and after each sample batch, it
was possible the confirmation of retention time linearity and equipment sensitivity.
Statistical Analysis
Relative quantification of plant hormones was done comparatively to the known
concentration of internal standard (anisic acid) added to each one of the samples before
extraction. Integration under the peak curve was done by TraceFinder EFS LC (v.
3.1.416.19, Thermo Scientific), with a signal to noise ratio (S/N) set as 10 for the limit of
detection (LOD) and 3 for the limit of quantification (LOQ). Differences between
treatments and/or factors were calculated using proc glimmix two-way model analysis of
variance (ANOVA) type III of natural log (log) transformed responses scale, and Tukey-
Kramer least-square means (LSD) post hoc test, considered significant at 𝛼 ≤ 0.05 or
0.1, in SAS software (Version 8, SAS Institute Inc.). A model had the interaction
removed if the interaction was not significant for the two-way ANOVA.
Results
Given that they were barely detected, it is apparent that Gibberellins A4 and A7,
IPA and IAA, BA, SA and ABA were not extracted with the same efficiency as the other
plant hormones (data not shown). Trans-zeatin riboside had the highest concentration
extracted from citrus leaves. Among the auxins, indole-butyric acid was the only
phytohormone extracted. GA3, IBA, tZ, tZR and JA did not reach the minimum for
quantification for some samples, which does not mean absence in the sample. Along
with potentially low natural levels, machine sensitivity, matrix effect, and degradation
could be possible reasons for lack of detection (Taylor, 2005).
The natural logarithmical transformation was performed for the responses
because differences of variances for the hormone concentration in leaves were not
107
homogeneous. More negative values are correspondent to less hormone concentration
in leaves.
Scion/rootstock combinations were statistically significant (p-value < 0.05) for
GA3, IBA, JA, tZR, and tZ. Nutrition formulations were statistically significant for IBA, JA,
tZR and tZ. Degrees of freedom considered the missing data; therefore, each
phytohormone DF was calculated differently, based on its sample size. The calculation
of post-hoc means was unmanageable for non-quantified phytohormones for either a
complete set of samples of scion/rootstock combination or nutrition treatments.
Jasmonic Acid
Amongst the 120 samples, eight samples did not show the detection of jasmonic
acid. Scion/rootstock combination and nutrition factors were statistically significant (α =
0.05). Interaction between the scion/rootstock and nutrition was not significant,
therefore, not computed. Sugar Belle grafted onto AVO, had the lowest mean for JA,
while Sugar Belle grafted onto Cleopatra had the highest mean for JA (Table 3-4, Figure
3-2). Valencia, Cybrid 304 and Sugar Belle grafted onto the genetically improved
rootstock AVO was not statistically different between each other, and the healthy
combination of Valencia grafted on Swingle: however, all combinations with AVO as the
rootstock were statistically different from all scions grafted onto Swingle and Cleopatra
(Figure 3-2).
Florikan Advantage CRF blend treatment was statistically significant from all the
other nutrition treatments, as treated plants had the lowest amount of JA for all the
plants not overdosed (Table 3-4, Figure 3-3). Plants fertilized with two times the
recommended dose of manganese (N1) had statistically lower JA concentrarion than
the F+2x Mn + 2x B, however, not significantly different from plants treated with F + 2x
108
B. JA concentration in plants treated with the Florikan + 2x Mn +2x B were not
statistically different from those treated with F + 2x B, but plants fertilized with the 2x B
yielded higher JA concentration in citrus leaves compared to those treated with F + 2x
Mn and Florikan Advantage (Figure 3-3).
Gibberellin A3
Detection of gibberellin A3 occurred in 112 of 120 trees of this study, and the
scion/rootstock combination was the only statistically significant factor (α = 0.05).
Although the p-value was small, there was not a distinct difference between the
combinations (Table 3-5, Figure 3-4). Valencia grafted onto AVO had the highest GA3
concentration content, compared to Cybrid 304 grafted onto Swingle. Cybrid 304 grafted
onto all the rootstocks had the lowest concentration of GA3, in comparison to the
scattered means separation for all the other scion/rootstock combinations (Figure 3-4).
Indole Butyric Acid
The only auxin efficiently extracted from 111 of 120 trees was IBA.
Scion/rootstock combination and differences due to nutrition formulations were
statistically significant as independent factors with α = 0.1 (Table 3-6). However, due to
adjustments for small sample size, least-squares means for scion/rootstock
combinations in the post-hoc analysis were not significantly different (Figure 3-5). In
contrast, Florikan Advantage application yielded statistically significant lower IBA
concentration compared to the F + 2xMn formulation (Figure 3-6). Two times the
recommended dose of Mn with Florikan Advantage was statistically different from
Florikan + 2xB; however, IBA in the plants fertilized with Florikan + 2xMn + 2xB were
not statistically different from those with any of the other nutrition formulations (Figure 3-
6).
109
trans-Zeatin
Scion/rootstock combination was the only factor statistically different (α = 0.05)
for trans zeatin concentration (Table 3-7, Figure 3-7). All 120 plants had tZ quantified by
UHPLC – MS/MS. Cybrid 304 grafted onto Swingle had the highest concentration for tZ,
only significantly different from Sugar Belle grafted onto Cleopatra and AVO. Healthy
Valencia grafted onto Swingle tZ concentration was significantly higher than Sugar Belle
grafted onto AVO.
trans-Zeatin Riboside
All 120 plants had trans-Zeatin Riboside quantified. ANOVA of independent
factors showed scion/rootstock combination and nutrition statistically significant
(α=0.05) (Table 3-8). Sugar Belle grafted onto Swingle, Cleopatra and AVO had the
lowest tZR concentration, with SA and SC statistically different from VS (Figure 3-8).
Although tZR concentrations in the plants treated with the different nutrition treatments
were statistically different, there was not a noticeable difference in the means
separation. Plants fertilized with Florikan + 2xMn had the highest tZR concentration,
only significantly different from those fertilized with the Florikan Advantage control
(Figure 3-9).
Discussion
Jasmonic Acid Role in the Plant Defense
Jasmonic acid is known to be part of several physiological processes, including
sexual reproduction, growth control and secondary metabolism in plants (Li et al., 2004;
Yan et al., 2007; Pauwels et al., 2008; Brossa et al., 2011). Jasmonic acid is crucial to
protect the plant response against abiotic stress (osmotic stress, wounding, and
herbivore attack) and to increase of basal resistance to necrotrophic pathogens among
110
ethylene (van Wees et al., 2000; Lorenzo et al., 2003). Genetic modulation of the
jasmonic acid carboxyl methyltransferase gene, induced the responsible induced-
systemic response (ISR), in young leaves and fruits infected with HLB. Moreover,
jasmonic acid carboxyl methyltransferase induced the upregulation of secondary
metabolites in mature leaves and mitochondrial electron transport in HLB infected plants
(Martinelli et al., 2013).
In this experiment, different rootstocks grafted with CLas infected scions could
have influenced JA-regulated genes (Satpute, 2017), therefore, changing the JA
synthesis, as Sugar Belle grafted onto Cleopatra had the highest JA concentration in
leaves, whereas Sugar Belle grafted onto AVO yielded the lowest JA concentration. .
Moreover, AVO had a better JA synthesis to the presence of CLas in the phloem
vessels. In other words, Sugar Belle grafted onto AVO could reduce ISR in distal parts
of the plant, therefore, facilitating plant growth instead of inducing plant defense
(Denancé et al., 2013). Those results are distinct from Albrecht et al. (2012) as their
conclusions stated that distinct scion/rootstock combinations did not influence the
development of HLB in field-grown sweet oranges, although some selections showed
higher tolerance to HLB than others, and HLB symptoms were less severe in the older
tree than in young established plants.
Susceptible HLB varieties have been reported to have increased expression of
transcripts related to the JA synthesis pathway or JA signaling process to the induced
systemic response to CLas (Kim et al., 2009; Zheng and Zhao, 2013). The results of
this study agree with the previous reports, as Sugar Belle grafted onto Cleopatra, and
Swingle yielded the highest JA concentrations in leaves.
111
Gibberellins, DELLA Proteins and JA
Gibberellins are a class of tetracyclic diterpenoids produced by plants, fungi, and
bacteria, which functions include regulation of cell expansion and division, and
development, such as seed germination, flowering, and pollen maturation. Bioactive
gibberellins in plants are namely gibberellin A1 (GA1), gibberellic acid (GA3), gibberellin
A4 (GA4) and gibberellin A7 (GA7).
DELLA proteins regulate GA responses in a suppressive manner: when DELLA
proteins are absent, or non-functional, GA responses are activated. Several interactions
between DELLA proteins and transcription factors of JA and ET pathway are known, as
DELLA proteins stabilize repressor proteins of JA and ET signaling pathways, impeding
average growth in plants (Lor and Olszewski, 2015). The presence of GA triggers
proteasomes to degrade DELLA proteins, and, therefore, resume normal GA pathway
signaling. As Cybrid 304 grafted onto Swingle had the statistically lowest GA3
concentration, compared to Valencia and Sugar Belle grafted onto AVO, it is possible to
speculate that DELLA protein action has been stimulated in the Cybrid 304. Therefore,
growth and development could be decreased, along the JA and ET defense signaling
pathway (Figure 3-4). Rawat et al. (2015) proposed that GA signaling could, together
with distinct hormone modulations and gene regulation to fight the pathogen. Moreover,
GA3 could potentially co-ordinate the defense response in citrus hosts, as gibberellins
regulate energy and carbohydrate metabolism partially (Martinelli et al., 2012).
Auxins and Plant Defense
Amongst the three targeted auxin hormones (IAA, IBA, and IPA), just IBA could
be quantified by the developed methodology. Solely IBA detection could indicate a
highly efficient IBA storage on the citrus peroxisomes or could be because of low
112
activity of β-oxidases to convert IBA into IAA (Zolman et al., 2008). Auxin interactions
with the SA-JA/ET backbone are conflicting. In the presence of SA, negative auxin
regulators, namely AUX-IAA proteins, are stabilized, therefore repressing auxin
response factors (ARF) action, an antagonistic relationship between SA and auxin
pathways (Robert-Seilaniantz et al., 2011).
Moreover, elevated auxin signaling increased susceptibility to biotrophic
pathogens (Navarro et al., 2008). The interaction of auxins with JA has shown both
repression and induction of the defense signaling pathway (Robert-Seilaniantz et al.,
2011). Auxin signaling genes were affected differently by CLas presence, as reported
by Martinelli et al. (2013). Analyzing sequences of symptomatic immature and mature
fruits, and young and mature leaves, auxin signaling genes were downregulated for
immature fruits and mature leaves, while mature fruits have auxin-related genes
upregulated compared to asymptomatic healthy tissues. A similar trend was found in
symptomatic fruits, as GH3-like protein genes, related to auxin synthesis, were
upregulated (Martinelli et al., 2012). Root length increased in micro cuttings of
Eucalyptus globulus supplied with manganese, as Mn is involved in the cell elongation
process (Marschner, 1995), while IBA increased the taproot and lateral root formation in
citrus seedlings (Zhang et al., 2013). In this study, trees that received the 2x overdose
of manganese, and 2x Mn with 2x B formulations had higher IBA concentration, which
could be indicative of a synergistic relationship between the mineral nutrient and the
plant hormone (Figure 3-7). The increase in IBA could potentially increase root area and
density growth of the depleted root zone of infected citrus trees, and at the same time
Mn support of cell elongation, therefore, improving nutrient and water uptake. As IBA
113
concentration was higher in plants fertilized with 2x Mn, the same nutritional formulation
yielded the lowest concentration for JA, only differing from that of plants with the control
(no extra micronutrient) nutrition treatments. More evidence is needed to form a clear
conclusion about the interactions between IBA and JA in HLB-infected plants under
overdoses of micronutrients (Figure 3-6).
Cytokinins and the SA-JA/ET Backbone Plant Defense Mechanism
Cytokinins (CKs) were defined at first as substances that were able to induce
mitosis in plant cells (Miller et al., 1955; Letham, 1963). Later, besides cell division,
cytokinins role in the breakdown of seed dormancy of some species, control of bud
development and differentiation, delay of leaf senescence (Moore, 1979), development
of chloroplasts (Cortleven and Schmülling, 2015), and control of expression of several
genes (Schmülling et al., 1997) were determined. All naturally occurring cytokinins
derive from isopentenyl adenine. The most common cytokinins are the trans-Zeatin (tZ),
and its riboside (tZR) form. Tobacco cells had higher concentrations of tZR compared to
tZ, as tZR is considered the most bioactive cytokinin (Vankova et al., 1987). Relative
quantification of tZ and tZR against the internal standard yielded similar concentrations
in the various scion/rootstock combination and plants grown with the different nutrition
formulations, which is in agreement with Davey and van Staden (1976), whom reported
similar quantification for tZ and tZR in root exudate of tomato plants during flower bud
formation and flowering (Figures 3-7, 3-8 and 3-9).
During a biotrophic and hemibiotrophic attack in HLB-susceptible hosts, a
metabolically active site surrounded by senescence observed in leaves, known as the
‘green island,’ is the result of modulation of endogenous CKs by the pathogen. The
metabolically active site is necessary for redirection of nutrients towards the infection
114
site, and therefore, host cell death in response to infection is delayed in that area (Choi
et al., 2011). Although the interference of CLas in the CK modulation of an HLB-
susceptible host, the activation of CK and SA are synergistic. Application of exogenous
trans-Zeatin induced transient transcription of defense-related genes, such as SID2, SA
biosynthetic gene, PR1 gene, the SA signaling marker gene, and the transcription factor
WRKY18 gene (Choi et al., 2010), conferring resistance to biotrophic organisms.
Applications of trans-Zeatin blocked Pseudomonas syringae pv. Tabaci (Pst)
spreading in contrast to the application of its analog cis-Zeatin in tobacco plants
(Großkinsky et al., 2013). Although the synergic interaction between CKs and SA has
been reported previously, in CLas infected plants, SA-related genes are not upregulated
during infection in citrus leaves, whereas genes that belonged to the SA-JA plant
defense backbone were differentially expressed in symptomatic fruits as compared to
asymptomatic fruits (Kim et al., 2009; Martinelli et al., 2012). In this study, trans-Zeatin
and trans-Zeatin Riboside were present, while very low SA was quantified. Therefore, in
agreement with other studies, CLas appears to exhibit a necrotrophic behavior in citrus
plants, accumulating CKs, as the host response to the infection.
Phytohormones and the Oxidative Stress
An indirect defense mechanism which is present in all living organisms is the
production of molecules that scavenge the deadliest group of metabolites in the world:
reactive oxygen species (ROS). Hydrogen peroxidase (H2O2), oxygen superoxide (O2-)
and hydroxyl radical (HO-) are examples of ROS. ROS are natural products from plant
homeostasis, as the primary sources of ROS in normal conditions are photosynthesis
and respiration. However, ROS concentrations increase under stress, either abiotic or
biotic. A pathogen triggers the increase of ROS concentration by activating the PTI
115
process. Excess of ROS in the system induces programmed cell death (PCR), resulting
from membrane lipid peroxidation, protein oxidation, enzyme inhibition, and DNA and
RNA damage. In response to abiotic stress, ROS are produced mainly from NADPH
oxidases; however, ROS can induce host response in stress-related/defense pathways.
To remove the excess amount of harmful ROS molecules, plants have ROS-scavenging
mechanisms, including superoxide dismutase (SOD), ascorbate peroxidase (APX) and
catalases (CAT), which converts the ROS into a less toxic form. Besides the enzymes
listed, antioxidants such as ascorbic acid and glutathione are crucial for plant defense
against oxidative stress. A study suggested that the ratio between oxidized and reduced
antioxidants could be a signal for modulation of ROS-scavenging mechanisms (Mittler,
2002). Pitino et al. (2017) recently reported the mechanisms underlying the
accumulation of H2O2 and ATP in HLB infected citrus leaves. Their findings undercover
genetic regulation of antioxidants and ROS-scavenging molecules in gradually sicker
plants, as HLB infected leaves showed downregulation of SOD, CAT, and APX genes
and overexpression of RBOH (respiratory burst oxidase homolog). RBOH is responsible
for interceding ROS production and initiates a long-distance ROS signaling; therefore,
inducing basal resistance, plant immunity, and SAR (Baxter et al., 2014).
CLas can cause oxidative stress in citrus hosts, as a proteomic study showed an
upregulation of genes involved in the detoxification of ROS on HLB tolerant citrus
varieties (Martinelli et al., 2016). The study developed in this chapter did not explore the
differences of genetic modulation in the scion/rootstock combinations treated with
different nutritional formulations. Although several studies have found a reliable
connection between CLas infection and modulation of oxidative stress-related genes on
116
numerous varieties, this study reveals that tolerant AVO had the lowest induction of
jasmonic acid. Jasmonic acid and ethylene are intimately correlated phytohormones
during abiotic stress (Barah et al., 2013). Because of AVO's genetic diversity, including
Volkameriana as one of the varieties from one of the mothers, tolerance to HLB is
prominent. When infected with CLas Volkameriana showed an increase of reactive
oxygen species detoxification-related genes such as glutathione-S-transferase,
enzymes involved in the biosynthesis of peroxiredoxins, Cu/Zn superoxide dismutase,
and 2Fe-2S ferredoxin-like proteins (Martinelli et al., 2016). As explained in Chapter 2,
enzymes involved in the detoxification are crucial for the enhancement of the plant's
defense against the presence of toxic ROS. As this study lacked the quantification of
ethylene because of its gaseous form nature, it is possible to infer that AVO rootstock
transferred the capacity of detoxifying ROS from CLas presence to the scions (Figure 3-
2). As CLas destabilizes source-sink relationships, by inducing the plant to necrotrophic
stress, susceptible varieties are not fully equipped to process the excess of ROS
produced by the fastidious bacteria (Martinelli and Dandekar, 2017). In this study,
susceptible rootstocks grafted with both tolerant and susceptible scions had higher
quantification of JA, a possible response to the stress generated by the presence of the
bacteria, and, therefore, to stress (Table 3-4). The lack of SA quantification supports the
hypothesis that HLB susceptible trees respond to the disease in a necrotrophic fashion.
Additionally, in this study, susceptible varieties had a higher concentration of JA,
per the previous study that showed higher production of H2O2 in transgenic tobacco
plants infiltrated with JA (Bi et al., 1995), therefore configuring response to a abiotic
stress or a necrotrophic organism (Mur et al., 2006). Interpretation of the increase of JA
117
in susceptible plants can be due to a lower scion/rootstock adaptation to the presence
of the bacteria, as the plant attempts to impede CLas growth by increasing the pool of
oxidative stress-related molecules at the phloem sap. However, instead of killing the
bacteria, the excess of ROS harms the plant itself, as CLas has a peroxidase gene,
therefore, thriving survival in such a harmful environment. Nevertheless, scions grafted
onto the tolerant rootstock AVO did not show the same pattern, as JA levels were
amongst the lowest quantified in this study.
ROS, Boron and Manganese
Boron is involved with soluble antioxidants and recycling activities in the plant
physiological metabolism. In high dosages, as used in our study, boron can increase the
oxidative damage, affecting ascorbic acid recycling. Studies in water-stressed
Arabidopsis mutants, incapable of synthesizing JA (aos) show the reduction of the
malondialdehyde (MDA), a marker for oxidative damage (Arbona and Gomez-Cadenas,
2012). Modulation of MDA is influenced by B concentration, as B induces the synthesis
of SODs and APX.
The increase of ascorbate and glutathione (GSH), from the redox process, is
associated with the presence of JA. Arabidopsis mutant plants incapable of
accumulating ascorbate (vtc1) had no induction of antioxidant genes by the presence of
JA. It was because of the low supply of GDP-Man, a required substrate by the action of
JA (Brossa et al., 2011). When under water-stress, exogenous JA applied on Agropyron
cristatum pretreated with ibuprofen (IBU) prevented the accumulation of ascorbic acid,
GSH and total ascorbic acid-induced by IBU, and regulates ascorbate and glutathione
synthesis by regulating the redox state of ascorbic acid and GSH (Shan and Liang,
2010). Significantly higher values of JA in the Sugar Belle grafted onto Cleopatra could
118
be the response from the boron influence in the plant ascorbic acid recycling (Figure 3-
3). Ascorbic acid and glutathione are electron donors that regulate the cellular redox
status, and therefore increase the oxidative damage in plants. As a result, in citrus
plants infected with CLas, oxidative stress is added to the biotic stress, increasing the
plant machinery to fight different oxidative products within the cell. Low availability of B
in the soil translates in B deficiency in the leaf, inducing SODs and APX activities,
therefore, modulating the increase of MDA, improving the plant defense mechanism
against the products from CLas infection (Martinelli and Dandekar, 2017). However,
Zekri and Parsons (1992) reported that Cleopatra is one of the most tolerant rootstocks
for excess salt in the soil. Cleopatra was also shown to be metabolically distinct from
Carrizo citrange when water-stressed either from drought and flooding (Argamasilla et
al., 2014). Because AVO has both Cleopatra and trifoliate orange contributing to its
genetic makeup, it is possible to infer that positive traits were combined, increasing the
tolerance to abiotic stresses. Swingle citrange is in the middle range of tolerance (Zekri
and Parsons, 1992), and this study showed that the JA response all for scions grafted
onto Swingle was significantly different from that of Sugar Belle grafted onto AVO.
Lowest concentrations of JA in scions grafted onto AVO could be a response to the
genetic heritance from AVO parents, a rootstock effect.
An excess of manganese increases the activity of SOD, CAT, and GPX on
leaves (Arbona and Gomez-Cadenas, 2012), decreasing the pool of ROS, therefore,
protecting the cell from irreversible damage. Manganese in its ionic form (Mn+2) is a
cofactor for several reactions in the plant defense against pathogens. The presence of a
potential pathogen triggers the synthesis of pre-formed anti-microbe molecules, most of
119
them from the Shikimate pathway, which is dependent on an adequate supply of Mn
(Maeda and Dudareva, 2012). From the Shikimate pathway, chorismite, the precursor
for the tryptophan, phenylalanine/tyrosine pathways, is synthesized, leading to the
formation of indoles (auxins), salicylates, anthocyanins, and lignin. Florikan Advantage
+ 2x Mn +2x B yielded the highest JA concentration among the nutrition treatments
(Figure 3-3), leading to the hypothesis that an excess of Mn and B in the combination is
an alternative to induce the formation of antioxidants and molecules capable of
protecting the plant against the oxidative effects of ROS.
Plants that yielded lower concentrations of JA could be physiologically more
balanced regarding the split of energy directed between growth and disease defense
response. Among the nutrition formulations, the control (Florikan Advantage), when
statistically significant, always had the lowest amounts of the hormones tested, this
case IBA, JA, and tZR, which could be responsible for inadequate host response to the
disease.
Conclusion
The last decade was full of challenges for the citriculture, mainly upon the arrival
of the, still not fully understood, Huanglongbing (HLB) disease. Several studies have
reported the importance of understanding the intrinsic interactions between HLB
susceptible citrus host and the bacteria, along with the changes in the host global
homeostasis. Endogenous hormones are essential players in plant growth and
development, as well as necessary for the modulation of plant defense against
abiotic/biotic stresses. Transcriptional studies on the regulation of endogenous
hormones in HLB affected hosts ignited the questioning on the modulation of hormones
during CLas infection in citrus hosts. This study explicates that CLas infected plants
120
respond to the disease as an abiotic stress. JA, IBA, and CKs concentration in distinct
scion/rootstock combinations and overdose of micronutrients reveal a connection to
possible enhanced abiotic/oxidative stress pathways to fight the disease. Those
statements agree with other reports that suggest the parasitic behavior of CLas in citrus
hosts. Moreover, this study is the first to correlate ground applied nutrition, the genotype
of HLB affected trees, and targeted phytohormones. Manganese and boron overdose
applications as ground fertilizers in CLas infected plants emerge now as a reasonable
and accessible practice to recover profitable growth and development of HLB affected
citrus plants (Tabay Zambon et al., 2019). Choosing scion and rootstocks that also
improve the likelihood of achieving full tree development, good fruit yield, and juice
quality are crucial for the success of a citrus grove.
Understanding differences in targeted hormone concentrations between
commercially available varieties and improved varieties reported in our study will help
predict the performance of the next generation of trees in the field. Further studies
regarding genetic modulation of HLB infected plants under micronutrient overdose are
necessary to address the benefits of enhanced nutrition adequately.
Table 3-1. Acronyms of scion/rootstock combinations tested at an acclimated greenhouse (CREC/UF – Lake Alfred, Central Florida)
Rootstock Scion
Sugar Belle Cybrid 304 Valencia Healthy Valencia
Swingle SS CS VS -
Cleopatra SC CC VC -
AVO SA CA VA -
Healthy Swingle - - - H
121
Table 3-2. Nutrition formulations and amounts applied per plant every 6 months at an acclimated greenhouse (CREC/UF – Lake Alfred, Central Florida)
Nutrition FormulationX Amount Z Commercial names
Control 14-4-10 20.5 Florikan Advantage Florikan Advantage + 2x Mn
14-4-10 + 0.22% Mn
20.5 + 1.32 Florikan Advantage + TigerSul Manganese (MnSO4)
Florikan Advantage + 2x B
14-4-10 + 0.08% B
20.5 + 1.8 Florikan Advantage + Florikan Polycoated Sodium Borate (Na2[B4O5(OH)4])
Florikan Advantage + 2x Mn + 2x B
14-4-10 + 0.22% Mn + 0.08% B
20.5 + 1.32 +1.8
Florikan Advantage + TigerSul Manganese (MnSO4) + Florikan Polycoated Sodium Borate (Na2[B4O5(OH)4])
X Nitrogen-Phosphurus-Potassium (NPK) and micronutrient, Z Grams per tree.
122
Figure 3-1. Schematics of HLB infected and healthy composite plants and nutrition application placement in the greenhouse at the CREC/UF – Lake Alfred, FL. Scion and rootstock combinations: CA, Cybrid 304 grafted onto AVO; CC, Cybrid 304 grafted onto Cleopatra; CS, Cybrid 304 grafted onto Swingle; SA, Sugar Belle grafted onto AVO; SC, Sugar Belle grafted onto Cleopatra; SS, Sugar Belle grafted onto Swingle; VA, Valencia grafted onto AVO; VC, Valencia grafted onto Cleopatra; VS, Valencia grafted onto Swingle; H, healthy Valencia grafted onto healthy Swingle. Nutrition formulations: CT, Florikan Advantage; N1, Florikan Advantage + 2x Mn; N2, Florikan Advantage + 2x B; N3, Florikan Advantage + 2x Mn + 2x B.
N2 CT N1 N3 N2 N1 CT N3 N3 N2 N1 CT
SC CS SS H VA SS VS H SS CC VS SS
VA H VC VA SC VC SC SS VA SC CS SC
VS SA VS CA CA VA VA CC CA H H SA
VC SC H SC CS SC H SC SC VA CA VS
CS CA SC SS VC SA VC VA CS CA SA VC
H VA CA CC SA CC CA CS H VC SS H
CA VC VA VC H VS SS VS SA SS SC VA
SS SS CC CS CC H CC CA VS VS VC CS
CC VS CS VS SS CA CS SA CC CS CC CC
SA CC SA SA VS CS SA VC VC SA VA CA
Block 1 Block 2 Block 3
123
Table 3-3. Optimized UHPLC-MS/MS parameters listed in multiple reaction mode (MRM) for quantification of targeted plant hormones
Analyte and IS Parent atomic mass
Product atomic mass
Collision Energy (CE, eV)
Scan mode
t-Z 220.2 136.2 19 +
t-ZR 352 220 25 +
GA3 345.1 142.7 40 -
IBA 204.1 186 9 +
AnA (IS) 153 135 10 + t-Z, trans-Zeatin; tZR, trans-Zeatin Riboside; GA3, gibberellic acid; JA, jasmonic acid; IBA, indole-3-butyric acid; AnA, anisic acid (internal standard) Table 3-4. Mean relative quantification of jasmonic acid (JA) in three fully expanded
leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). Healthy plants were confirmed HLB negative by qPCR. Relative quantification mean with the same letter is not statistically different with alpha = 0.05 by Tukey-Kramer multiple means comparison. Experiment performed in an acclimated greenhouse in Lake Alfred, Central Florida.
Scion/Rootstock combination
JA (µg g-1) Group
SC 0.0292 A
SS 0.0269 AB
CS 0.0265 AB
CC 0.0209 A-C
VS 0.0163 A-C
VC 0.0133 A-D
VA 0.0091 B-E
H 0.0083 C-E
CA 0.0056 ED
SA 0.0051 E
Nutrition formulation JA (µg g-1) Group
TR3 0.02380 A
TR2 0.01521 AB
TR1 0.01356 B
CT 0.00678 C
124
Figure 3-2. Negative natural logarithmic of mean JA relative quantification for
scion/rootstock combinations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of JA concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each scion/rootstock combination.
0
1
2
3
4
5
6
CA CC CS H SA SC SS VA VC VS
-log [
JA
(µ
g g
-1)]
Scion - Rootstock combination
A
BCDE
E
AB
ABCD
CDE
ABC
DE
A ABC
125
Figure 3-3. Negative natural logarithmic of mean JA relative quantification for nutrition
formulations in October 2016 Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of JA concentration in µg g -1. Least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each nutrition formulations.
Table 3-5. Mean relative quantification of gibberellin A3 (GA3) in three fully expanded
leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). Healthy plants were confirmed HLB negative by qPCR. Relative quantification mean with the same letter is not statistically different with alpha = 0.05 by Tukey-Kramer multiple means comparison. Experiment performed in an acclimated greenhouse in Lake Alfred, Central Florida.
Scion/Rootstock combination GA3 (µg g-1) Group
VA 0.0033 A
SC 0.0032 A
SA 0.0027 AB
VC 0.0022 AB
H 0.0022 AB
SS 0.0021 AB
VS 0.0019 AB
0
1
2
3
4
5
6
CT N1 N2 N3
-log [
JA
(µ
g g
-1)]
Nutrition formulation
C
B AB
A
126
Table 3-5. Continued.
Scion/Rootstock combination GA3 (µg g-1) Group
CA 0.0016 AB
CC 0.0015 AB
CS 0.0012 B
Figure 3-4. Negative natural logarithmic of mean GA3 relative quantification for
scion/rootstock combinations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of GA3 concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each scion/rootstock combination.
0
1
2
3
4
5
6
7
8
CA CC CS H SA SC SS VA VC VS
-log [
GA
3(µ
g g
-1)]
Scion - Rootstock combination
A A AB AB AB AB AB
AB B AB
127
Table 3-6. Mean relative quantification of indole-3-butyric acid (IBA) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). Healthy plants were confirmed HLB negative by qPCR. Relative quantification mean with the same letter is not statistically different with alpha = 0.1 by Tukey-Kramer multiple means comparison. Experiment performed in an acclimated greenhouse in Lake Alfred, Central Florida.
Scion/Rootstock combination IBA (µg g-1) Group
SS 0.0239 A
CS 0.0228 A
SA 0.0168 A
SC 0.0162 A
CC 0.0142 A
H 0.0131 A
CA 0.0126 A
VS 0.0102 A
VA 0.0096 A
VC 0.0091 A
Nutrition formulation IBA (µg g-1) Group
TR1 0.0194 A
TR3 0.0162 AB
TR2 0.0114 B
CT 0.0111 B
128
Figure 3-5. Negative natural logarithmic of mean IBA relative quantification for
scion/rootstock combinations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of IBA concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.1 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each scion/rootstock combination.
0
1
2
3
4
5
6
CA CC CS H SA SC SS VA VC VS
-log [
IBA
(µ
g g
-1)]
Scion - Rootstock combination
A
A
A A
A
A
A A
A
A
129
Figure 3-6. Negative natural logarithmic of mean IBA relative quantification for nutrition
formulations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of IBA concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.1 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each nutrition formulations.
Table 3-7. Mean relative quantification of trans-Zeatin (tZ) in three fully expanded
leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). Healthy plants were confirmed HLB negative by qPCR. Relative quantification mean with the same letter is not statistically different with alpha = 0.05 by Tukey-Kramer multiple means comparison. Experiment performed in an acclimated greenhouse in Lake Alfred, Central Florida.
Scion/Rootstock combination tZ (µg g-1) Group
CS 0.0251 A
VA 0.0184 AB
H 0.0160 AB
VC 0.0155 ABC
VS 0.0144 ABC
SS 0.0123 ABC
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
5
CT N1 N2 N3
-log [
IBA
(µ
g g
-1)]
Nutrition formulation
B
A
B
AB
130
Table 3-7. Continued
Scion/Rootstock combination tZ (µg g-1) Group
CC 0.0113 ABC
CA 0.0082 ABC
SC 0.0074 BC
SA 0.0052 C
Figure 3-7. Negative natural logarithmic of mean tZ relative quantification for
scion/rootstock combinations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of tZ concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each scion/rootstock combination.
0
1
2
3
4
5
6
CA CC CS H SA SC SS VA VC VS
-log [
tZ (
µg g
-1)]
Scion - Rootstock combination
BC
AB
C
ABC ABC AB ABC
ABC
A
ABC
131
Table 3-8. Mean relative quantification of trans-Zeatin Riboside (tZR) in three fully expanded leaves of 112 plants, divided in 40 treatments (nutrition*scion/rootstock combination). Healthy plants were confirmed HLB negative by qPCR. Relative quantification mean with the same letter is not statistically different with alpha = 0.05 by Tukey-Kramer multiple means comparison. Experiment performed in an acclimated greenhouse in Lake Alfred, Central Florida.
Scion/Rootstock combination
tZR (µg g-1) Group
VS 0.0217 A
VC 0.0182 A
CS 0.0174 A
CC 0.0134 AB
H 0.0128 AB
VA 0.0106 AB
CA 0.0099 AB
SS 0.0087 AB
SC 0.0062 B
SA 0.0057 B
Nutrition formulation tZR (µg g-1) Group
TR1 0.0160 A
TR3 0.0114 AB
TR2 0.0099 AB
CT 0.0093 B
132
Figure 3-8. Negative natural logarithmic of mean tZR relative quantification for
scion/rootstock combinations in October 2016. Relative quantification means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent relative quantification of tZR concentration in µg g -1. Log transformed least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each scion/rootstock combination.
0
1
2
3
4
5
6
CA CC CS H SA SC SS VA VC VS
-log [
tZR
(µ
g g
-1)]
Scion - Rootstock combination
B
AB
B
A
A
AB
A
AB
A AB
133
Figure 3-9. Negative natural logarithmic of mean tZR relative quantification for nutrition
formulations in October 2016. Original means were log transformed for homogeneity of variance and presented as negative for clarity. Negative log is inversely proportional to the correspondent absolute tZR concentration in µg mg -1 of sample fresh weight (FW). Least square means (LSM) with the same letter are not statistically different at α = 0.05 by Tukey-Kramer multiple means comparison. Bar lines correspondent to standard error for each nutrition formulations.
0
1
2
3
4
5
6
CT N1 N2 N3
-log [
tZR
(µ
g g
-1)]
Nutrition formulation
B
A
ABAB
134
CHAPTER 4 GROUND APPLICATION OVERDOSES OF MANGANESE SHOW A THERAPEUTIC
EFFECT IN SWEET ORANGE TREES INFECTED WITH CANDIDATUS LIBERIBACTER ASIATICUS
Background
Plant nutrient management is one of the most basic practices for crop production
and environmental sciences. Acquisition of nutrients by feeder roots is crucial for the
survival of plants. Nutrient application, as chemical or organic fertilizers have been
routine for growers, and it is part of nutrient recycling. To reach maximum growth and
overcome stresses, plants developed a relationship with soil microbes (Navarro et al.,
2011; Chen et al., 2014; Jacoby et al., 2017). Soil microbes change the ionic status of
minerals that plants cannot uptake as molecular form, in a process called mineralization
(Sattelmacher et al., 1982). Presence of nutrients in ionic form, can lead to competition
for the same exchange soil colloid sites by similarly sized ions, interfering with the
absorption, adsorption, and transport of a specific ion and/or a similar chemical-physical
structure group (Fageria, 2001).
Citrus are among the most valuable crops grown worldwide. Since 2005, Florida
citrus production has been affected by the yellow dragon disease commonly known as
citrus greening or Huanglongbing (HLB, Halbert, 2005; USDA-NASS, 2017). HLB is
presumably caused by a fastidious bacterium (Candidatus Liberibacter asiaticus, CLas)
transmitted by the Asian Citrus Psyllid (Diaphorina citri). HLB symptoms include blotchy-
mottled leaves, starch accumulation in leaves, zinc-like deficiency symptoms,
misshapen fruit, low juice quality, high fruit drop rate, decreased root biomass, callose
and p-protein deposition in phloem sieve pores, and twig dieback (Bové, 2006;
Etxeberria et al., 2009; Kim et al., 2009; Cimò et al., 2013; Johnson et al., 2014). As
135
result of the presence of CLas, nutrient imbalance has been reported, aggravating the
functional/physiological status of an already photo assimilate-depleted plant (Spann and
Schumann, 2009; Nwugo et al., 2013b). Nutrient imbalance comes with several
drawbacks, especially with deficiency of micronutrients, known to be co-factors in
enzymatic reactions by protecting cell integrity (Hänsch and Mendel, 2009), from excess
of reactive oxygen species (ROS) when infected with CLas (Pitino et al., 2017).
Several approaches have been reported to improve the health status of HLB-
affected plants, such as overdose of foliar sprays with essentials nutrients (Morgan et
al., 2017) and soil acidification, resulting in a corresponding increase in root density and
yield (Graham, 2016). However, low mobility of some ions do not address localized
nutrient deficiency in roots infected with CLas (Johnson et al., 2014). The use of
polymer-coated or clay-coated products as an alternative to the traditional fertilizer
application (fertigation/dry granular fertilizer) has increased recently due to easy
application two times a year without the need of incorporation in the soil, synchrony of
release of nutrients and plant demand, and reduced loss of nutrients to the environment
(Obreza et al., 2006).
The study objective was to balance nutritional status and alleviate HLB
symptoms of field established sweet orange trees infected with CLas by supplementing
a traditional citrus fertilization program with ground-applied, slow-release enhanced
nutrition for selected micronutrients, including Mn and B at two and four times the
current recommended doses.
136
Material and Methods
Greenhouse Study
We also previously conducted a preliminary greenhouse experiment to
investigate the potential of micronutrient overdoses to improve the health of CLas-
infected trees (Grosser and Barthe, 2015). In the greenhouse, UFR-3 rootstock liners
(Nova+Hirado Buntan pummelo x Cleopatra+Argentine trifoliate orange) were budstick-
grafted with HLB-infected Valencia sweet orange. Treatments were established with 10
single-tree replications each. Control treatments received either 1) bi-annual Harrell’s®
16-5-10 nursery controlled-release fertilizer (CRF) mix, or 2) bi-weekly liquid fertilizer
(Peters). Experimental treatments received bi-annual treatments of Harrell’s CRF mix
supplemented with bi-annual treatments of 3x overdoses of individual polycoated
essential minor elements (Florikan®), TigerSul micronutrients® (sulfur plus the oxide
form of Fe, Zn, and Mn embedded in clay prills, and a blend of all 3 products as
recommended by A. Schumann, personal communication), or 2x overdoses of the
individual polycoated essential macronutrients. The experiment was carried out for one
year. Effects on tree health, tree growth, root mass, SPAD, leaf and root nutritional
analysis, and leaf and root Liberibacter titers were measured.
Field Study
Mature 10-year-old midseason ‘Vernia’ sweet oranges (Citrus sinensis (L.)
Osbeck), grafted onto Rough lemon (Citrus jambhiri Lush.) were used in this study
located at Lee Groves, St. Cloud, FL All trees were HLB scouted in the beginning of the
experiment by trained personal, and 100% were classified as HLB infected based on
visual observations. Tree density was 375 tree ha-1 planted at 4.6 m in row by 7.6 m
between rows on Myakka fine sand. The soil is classified as sandy soil with 96.5%
137
sand, 2.2% clay and 1.3% silt. Trees were grown with a standard soluble dry fertilizer
program (Supplemental Table B-1), four applications per year. Supplemental controlled
released fertilizer treatments (Table 4-2, Supplemental Table B-2) were made twice a
year, starting Fall 2015 and were continued through this study. Trees were irrigated with
microsprinklers. A traditional processing sweet orange spray program for pest
management (only one or two sprays of oil/pesticide per year) was done, not a full
psyllid control program. The experimental design was a randomized block with 12 plants
per treatment (nutrition), subdivided into 6 plants per replicate. Nutritional replicates
were randomly assigned to each subplot forming 2 replications per treatment (Figure 4-
5). A composite of 10 leaves from each of the trees was randomly sampled and sent for
quantitative polymerase chain reaction (qPCR) analysis at Southern Gardens Citrus
(Clewiston, FL) for confirmation of CLas in November 2017. Plants that showed Ct
(cycle threshold) values of 30 or below were considered HLB positive, negative at 32 or
higher, and inconclusive between both values. Soil and leaf samples were collected in
March 2017, September 2017 and May 2018 for tissue and soil nutrient concentration
analysis. Leaf samples were dried at 65oC for 72 hours until dry and ground with a 20-
mesh sieve. The tissue samples were sent to the Waters Ag Lab (Camila, GA) and
analyzed using the dry-ashing method and run on the Inductively Coupled Plasma-
Atomic Emission Spectroscopy (ICP-AES) for determining elemental concentrations of
selected nutrients. Tissue nutrient concentration was expressed as percentage of the
dry tissue biomass (%). Soil nutrients were extracted using the Mehlich III method and
analyzed using the ICP-AES method at the Waters Ag Lab (Camilla, GA). Nutrient
concentration was expressed as mass of nutrient per unit mass of soil (mg kg-1). Tree
138
canopy volume and trunk cross section area were measured in March 2017, September
2017 and May 2018. Trunk cross-sectional area of the trunk was calculated assuming a
circular shape by measuring the average trunk diameter in east-west and north-south
directions and calculating trunk cross-section area as: πr2, where r is the mean trunk
radius. The canopy volume was calculated based on the formula for the prolate
spheroid shape: (4/3)*(π)*(tree height/2)*(mean canopy radius)2 (Obreza and Rouse,
1993). The Brix/acid ratio of fruits harvested in January 2018 was measured at Citrus
Research and Education Center Processing Pilot Plant (Lake Alfred, FL) with a
commercial juice extractor (FMC Corp. Philadelphia, PA). Juice color analysis was done
with a GretagMacbeth Color-eye 3100, using Optiview – ProPallete software. Yield of all
treatments was collected per replicate plot by Lee Groves personnel for the 2016, 2017
and 2018 seasons and reported as boxes per acre (40.5 kg per box). R-Studio v.
1.1.456 was used for statistical analyses. One and two-way analysis of variance
(ANOVA) were performed by packages agricolae and lme4. Tukey’s honest significant
differences (HSD) means separation was performed as posthoc analysis with 𝛼 ≥ 0.05
when not specifically mentioned.
Results and Discussion
Preliminary Data
Preliminary greenhouse and field nutrient analyses were performed prior to the
main experiment reported herein showed that CLas-infected trees have higher levels of
micronutrient deficiencies in roots than in leaves, as compared to healthy trees (Figures.
4-1 and 4-2). Zinc (Zn), manganese (Mn) and iron (Fe) are the most impacted
micronutrients by HLB, especially in the roots of infected trees. Soil pH and
139
micronutrient concentration did not appear to be responsible for these deficiencies (data
not shown).
Several treatments tested in this study significantly improved tree growth and
health as compared with the control, especially the 3x TigerSul® Mn and 3x polycoated
sodium borate treatments. Visual examination (Figures. 4-3 and 4-4) and total root
length data generated using winRhizo image analysis (Table 4-1) showed improved
feeder root density and health in the two treatments containing the highest levels of
manganese, although not statistically different from the control.
Canopy Volume and Trunk Cross Section Area
Canopy volume and trunk cross section area means were not significantly
different between treatments, although 4x Mn treatment showed larger canopy volume
compared to Harrell’s® + 2x Mn + 2x B in March 2017 (Table 4-3.).
Soil Nutrient Analysis
Soil nutrient analysis showed differences in potassium (K) concentration between
months for all the treatments, possibly caused by the plant growth during summer and
beginning of fall. Potassium soil concentration during growing season in September
2017 was statistically significant between treatments as Harrell’s showed the highest
values. Overdoses of B and Mn treatments had the lowest K concentration in soil in
September 2017 possibly because B and Mn cations have greater valence (+2)
compared to the monovalent K and might have displaced K from exchange sites (Table
4-4). Another explanation would be the fact K has great ionic radius (280 pm) compared
to B and Mn (<100 pm) which might have resulted in greater propensity of the tree roots
to utilize the latter two leading cations to K losses in the root zone (Havlin et al., 2005).
A similar trend of reduced uptake of Mn and B with high concentrations of K was also
140
observed in rice (Ramadi and Kannan, 1974). A statistical interaction between treatment
and month was observed for Mn in soil (p-value= 0.000114, Figure 4-6.). The 4x Mn
treatment, as expected, had the highest value for Mn concentration in soil for
September 2017 and May 2018. Mn concentration for 4x B treatment was not
statistically different from the treatment with Harrell’s+2x B. However, 4xMn+4xB had
statistically higher Mn soil concentration in September 2017. The opposite can be seen
in Mn absolute values of Harrell’s® + 2x Mn and Harrell’s + 2x Mn + 2x B treatments,
although not statistically significant. It is possible that lower concentrations of Mn and B
(2 times the recommended dose) may interact differently when in higher concentrations
for soil Mn. Boron concentration in soil however did not have a significant difference, as
seen in Mn concentration, perhaps because of the nature of absorption of B by plants.
Through active transport against a concentration gradient, dissociated boric acid
requires a pH < 7 to be uptake, as H+ is co-absorbed, while Mn2+ needs a specific
protein transporter (Havlin et al., 2005). Except for the Harrell’s + 2x Mn treatment, leaf
Mn concentration remained at low (18-24 ppm) or deficient (<18 ppm) in the rest of the
treatments in March 2017 but remained in the optimum range (25-100 ppm) in
September 2017 and May 2018. This explains why it would be ideal to have Mn or
micronutrient thresholds for different times of the year because leaf nutrient
concentration tends to increase in the summer flush (July-September samples) and
decrease when trees remobilize nutrients to fruit and vegetative growth in late fall and
early spring, resulting in decreased leaf tissue nutrient concentrations (Mirsoleimani et
al., 2014).
141
Citrus roots are one of the first affected sites when infected with CLas before any
foliar symptom (Johnson et al., 2014), which occurs from 6 months to 3 years after initial
infection (Bové, 2006). Transcriptome of early infected citrus roots showed stress
related genes were differentially regulated (Zhong et al., 2015), as of downregulation of
genes related to oxidative stress (Mittler, 2002). Among the genes involved with
oxidative stresses, a mitochondria superoxidase dismutase is dependent of Manganese
availability to reduce the reactive oxygen species (ROS) pool in the cell (Alscher et al.,
2002). ROS are reducing agents known to damage the cells extensively, caused by
either biotic (a pathogen, CLas) or abiotic stresses (such as drought, wind, cold, heat
and nutrient deficiency). Enough presence of Mn in the rhizosphere is critical for
scavenging the deathly ROS produced by the presence of CLas. To be actively uptaken
by the roots, Mn must be in its reduced form (Mn+2) (Marschner, 1995; Gherardi and
Rengel, 2003; Pittman, 2005). Reduction of MnO2 happens by reducing rhizosphere pH,
moreover increasing microflora conditions in the rhizosphere assists in the reduction of
Mn to an available form (Jacoby et al., 2017).
Higher availability of Mn in the soil profile could have a positive effect in the roots
of HLB infected plants, by triggering defense responses against the pathogen, as HLB
infected plants have reduced root biomass (Graham et al., 2013). Lower root biomass
affects the entire process of water and nutrient uptake; moreover, HLB affected plants
responds to the disease by blocking phloem, therefore reducing the distribution of
several ions to new growth (Nwugo et al., 2013b).
Leaf Nutrient Analysis
Nitrogen (N), P, K and Mg concentrations were statistically different between
months (Table 5). Calcium (Ca), Mn, Fe and B concentrations were higher in
142
September, perhaps due to the summer flush during early fall. Boron had statistically
significant interaction between treatment and month (p-value = 2.01e-10). Although there
was no statistically significant interaction, Mn concentration differed by treatment over
the months.
Accumulation of Mn was measured for Harrell’s® + 2x Mn + 2x B and
Harrell’s®+2x Mn in September 2017, as increase of Mn concentration in leaves was
observed with overdose of B (2x). The 4x Mn could have led to toxicity, and therefore,
reduced uptake, compared to the control, and even Harrell’s® fertilizer (Figure 4-7).
Overdoses of 4 times the recommended dose of Mn and B also lowered Mn
concentration in leaves, while 2x B in Harrell’s treatment was quasilinear with respect to
accumulation of Mn in leaves overtime, a synergic environment for Mn allocation in
leaves when in the presence of 2x the recommended dose of B in the mix. The opposite
was seen in the accumulation of B overtime in the leaves. Four times the overdose of
Mn and B showed leaf B concentrations over 50% of the current Florida Guidelines
optimal range for B (200 mg kg-1, Figure 4-8). Nutrient accumulation from March 2017 to
May 2018, and utilization in new meristematic tissues can be the reason behind the high
values of B in leaves. Four times the recommended dose of Mn with B had a synergistic
effect for an increase of allocation of B in leaves, as 4x Mn alone had B concentrations
within the limits for B concentration in leaves.
Physiologically, boron plays a role in tissue growth and is necessary for vascular
tissue repair, which is compromised in CLas-infected plants, membrane stability and
metabolism of indole acetic acid, a plant hormone responsible for cell multiplication
(Blevins D.G., 1998). In squash root apices Mn-dependent IAA oxidase (IAAO) activity
143
is higher When B was deficient, when compared to well-supplied B root tips. The
increase in IAAO activity might be due to the interaction between B with the IAAO
cofactors: Mn and p-coumaric acid. As expected, lower activity of IAAO was observed in
B-sufficient plants. By supplementing Mn in B-sufficient squash root tips, IAAO activity
was stimulated, an indication that in presence of B more Mn is needed for enzyme
activity (Nguyen et al., 1993).
Statistically lower concentrations of B were found in March and September for 4x
Mn treatment, compared to other nutrition in the same month, indicating antagonistic
effect between B and Mn ions for allocation inside the cell and uses by the plant (Aref,
2012). It is important to notice that 4x Mn has the significant lowest values for B
concentration in leaves for all the months, which is crucial for normal meristematic
growth (Blevins D.G., 1998).
Juice Attributes and Yield Data
Juice attributes were not statistically significant across all treatments (Table 4-
6.). This could be due to an effect of overlapping root zones from neighboring trees in
different treatments, and therefore, the effect of nutrients on juice quality was negligible
(Castle, 1977; Castle, 1980). No differences in juice quality were found in similar
nutrition study with asymptomatic and symptomatic Hamlin, Midsweet and Valencia
juices analyzed in 2007 (Baldwin et al., 2010).
During fruiting formation of 2017 season, the experiment had a breakout of PFD
(post-bloom fruit drop) caused by Colletotrichum acutatum, that decreased yield data
across all treatments for that year (Fagan, 1979). Although yield data from 3 seasons
(2016, 2017 and 2018) were not statistically significant at the 95% CI among treatments
(Table 4-7.), treatments that received 4 times the recommended doses of Mn showed
144
statistically significant lower Ct values compared to the control (Table 4-8.). Over the
two-year trial period, the 12 trees included in the 4x Mn treatment produced more than
10 total field boxes compared to the control trees. A field box (40.8 kg fruit box-1) of fruit
with this quality is currently worth approximately $17 (USDA-NASS 2017). Extrapolating
this out to a per acre basis at 150 trees per acre would mean that the 4x Mn treatment
would have potential to provide more than $2,500 extra income per acre (using 2018
commercial figures) as compared to the control over the two-year trial period.
Soil pH
Nutrient solubility and availability are closely related the soil pH. Acidification can
interfere with oxidation/reduction processes on soil colloids. In an experiment with six
vegetable species, pH values ranging from 5.5 to 6.5 was ideal for maximum or near-
maximum growth (Islam et al., 1980). Florida’s irrigation water is naturally alkaline (pH >
7.0) with high levels of carbonates and bicarbonates of calcium and magnesium.
Constant application of alkaline groundwater sources can increase soil pH overtime,
altering availability/solubility of nutrients, specially micronutrients, directly affecting plant
growth (Albano et al., 2017). By neutralizing groundwater alkalinity, Albano et al (2017)
added sulfuric acid to levels of medium and low alkalinity (CaCO3 meq L-1 of 3 and 1,
respectively). In our experiment, acidification was achieved by the dissociation of
elemental sulfur to the soil moisture, as TigerSul Mn has 63% of sulfur in its
composition. The rising of S concentration in the soil in May 2018 can be observed in all
the treatments supplied with Mn (Table 4-4.), especially 4x Mn, adjusting the pH values
to the best range for nutrient availability (Figure 4-9.). All treatments with sodium borate
were below the best pH for citrus root growth in May, as the formation of boric acid is
145
increased by the excess of boron accumulated in the soil (Havlin et al., 2005). When in
combination with the elemental sulfur from TigerSul MnO2, pH decreases even more
HLB Confirmation
CLas detection was performed in November 2017 (Table 4-8.) for all the
treatments by qPCR at the Southern Gardens Laboratory. Plants under Control nutrition
had the lowest Ct values, meaning more copies of the bacteria being amplified each
cycle (Li et al., 2006; Wang et al., 2006). Plants that received 4x Mn treatments showed
the highest average for Ct value, significantly different from the control plants. Higher Ct
values, therefore, indicates lower genomic copies of the bacteria, suggesting that an
overdose Mn may limit bacterial growth within trees. Applications of four times the
recommended dose of Mn suggest a decrease of inoculum growth, but also, Mn could
have a role in plant recovery from biotic stress and root depletion due to CLas, as Mn is
crucial for enzymatic stress-related processes (Millaleo et al., 2010). High Ct values can
be interpreted as a therapeutic effect against CLas in sweet oranges when fertilized with
4x Mn, by the physiological roles played by Mn and B interaction (Tables 4-4 and 4-5) in
analyzed soil and leaves samples.
While accumulation of Mn in the soil in September 2017 and May 2018 can be
the rationale behind the therapeutic effect of the nutrient in HLB-affected trees in full
growth season, the accumulation of B in leaves in the 4x Mn treatment showed to be in
the range of optimum levels of the mineral element in citrus, which levels can be
reached nowadays just with regular foliar micronutrient sprays.
Conclusion
Root decline happens prior to any HLB symptom in the aerial part of the trees;
moreover, once infected, the plant proceeds into a fast tissue dieback. By supplying
146
mature plants with ground overdoses of micronutrients we could reduce the inoculum
multiplication compared to nutrient deprived plants, at the same time all the essential
mineral nutrients were balanced in the optimum range for a mature citrus plant, as
absolute yield data can corroborate for 4x Mn treatment. As mentioned, trees in this trial
are all on rough lemon rootstock. Ungrafted rough lemon trees have been shown to be
more tolerant of CLas infection, attributed to their ability to quickly regenerate new
phloem that bypasses phloem compromised by the infection (Fan et al., 2013). Data
from our field experiment suggests that enhanced root nutrition may increase the HLB
tolerance of sweet orange trees grafted to rough lemon rootstock, making it a viable
candidate for future plantings in areas where HLB is endemic. Testing the effects of
micronutrient overdoses (especially Mn) on HLB-impacted trees on other important
commercial rootstocks is underway.
To our knowledge, this is the first study that connects ground applied overdoses
of a micronutrient to suppressed CLas multiplication and improvement of nutritional and
health status of HLB-affected citrus trees. A constant supply of elevated levels of
secondary and micronutrients to roots of HLB-impacted trees clearly improves vascular
function and thus tree health. The data presented herein suggests the possibility of
providing levels of manganese to HLB-impacted citrus trees that could be toxic to CLas,
below levels that are toxic to the trees. We are now testing overdoses of polycoated
manganese sulfate (6-month release period, Florikan), with various secondary and
micronutrient packages, at multiple locations. Further studies regarding correlation
between Mn and B in the stress-related genes, and nutrient uptake channels in the
147
roots could elucidate the roles played by the two essential micronutrients in an HLB-era
of citriculture production.
Figure 4-1. Nutrient level means for leaf and root of CLas infected Valencia/Carrizo (Val/Czo) versus healthy greenhouse trees. Data (average of 10 trees) presented in % differences from levels in healthy tissues. CLas infections were validated using qPCR.
-100
-80
-60
-40
-20
0
20
N P K Mg Ca S Zn B Mn Fe Cu% d
iffe
rent fr
om
he
alth
y tis
su
es
Valencia grafted onto Carrizo - greenhouse trial
Root Leaf
148
Figure 4-2. Root nutrient level means of CLas infected field trees Valencia/Swingle (Val/SW) trees (6-10 years old) versus healthy trees. Nutrient concentration averaged of 10 trees presented in % differences from levels in healthy tissues. CLas infections were validated using qPCR.
Figure 4-3. CLas-infected Valencia/UFR-3 greenhouse trees after one year; left: control
standard liquid fertilizer; right: Harrell’s CRF + 3x TigerSul® manganese.
-80
-70
-60
-50
-40
-30
-20
-10
0
N P K Mg Ca S Zn B Mn Fe Cu% d
iffe
rent fr
om
he
alth
y tis
su
es
Root nutrient levels: Valencia grafted onto Swingle - field trial
149
Figure 4-4. CLas-infected Valencia/UFR-3 typical root systems. Left: control standard
Harrell’s CRF fertilizer; Right: Harrell’s CRF + 3x TigerSul® manganese.
Figure 4-5. Diagram of experimental design and relative tree locations.
150
Figure 4-6. Interaction plot of months and treatment for manganese concentration in soil. Statistically significant mean totals are presented. Means separation within months*treatment by Tukey HSD test at P ≤ 0.05.
0
20
40
60
80
100
120
140
160
180
200
Mar-17 Sep-17 May-18
Mn
co
nte
nt in
so
il (m
g k
g-1
)
4xB 4xMn
4xMn+4xB Control
Harrell's™ Harrell's™+2xB
Harrell's™+2xMn Harrell's™+2xMn+2xB
151
Figure 4-7. Manganese concentration in leaves for March and September 2017 and May 2018. Statistically significant mean totals are presented. Means separation within months by Tukey HSD test at P ≤ 0.05.
0
10
20
30
40
50
60
70
80
90
100
Mar-17 Sep-17 May-18
Mn
co
nte
nt in
lea
ve
s (
mg
kg
-1)
4xB 4xMn
4xMn+4xB Control
Harrell's™ Harrell's™+2xB
Harrell's™+2xMn Harrell's™+2xMn+2xB
152
Figure 4-8. Boron concentration in leaves for March and September 2017 and May 2018. Statistically significant mean totals are presented. Means separation within months*treatment by Tukey HSD test at P ≤ 0.05.
0
50
100
150
200
250
300
350
Mar-17 Sep-17 May-18
B c
onte
nt in
lea
ve
s (
mg
kg
-1)
4xB 4xMn
4xMn+4xB Control
Harrell's™ Harrell's™+2xB
Harrell's™+2xMn Harrell's™+2xMn+2xB
153
Figure 4-9. Mean pH (n=12) for all treatments in March and September 2017 and May 2018. Horizontal lines correspond to the best pH range for nutrient absorption, high and low as 6.5 and 5.5 respectively
154
Table 4-1. Effects of nutrient overdoses on CLas-infected Valencia/UFR-3 greenhouse trees following 1 year of treatments. Total root length (cm) was determined by winRhizo washed root image analysis.
Treatment N Meany Tukey Grouping
Harrell's + 3x TigerSul® Mn 10 2361 A
Harrell's + 3x Tiger®-Arnold’s Mix (Mn, Fe, Zn) 9 2270 A
Harrell's + 3x TigerSul®-Arnold's + Biochar 9 1955 AB
Harrell's + 3x TigerSul® Zinc Sulfur 10 1672 AB
Harrell's - Control 8 1670 AB
Harrell's + 3x Florikan® Sodium Borate 10 1554 AB
Harrell's + 3x TigerSul® Fe 7 1419 AB
Liquid Fertilizer Only - Control 6 1349 AB
Harrell's + 3x Florikan® Magnesium Sulfate 8 1315 AB
Harrell's + 2x Florikan® Ammonium Sulfate 8 1276 AB
Harrell's + 2x Florikan® Urea 8 1173 AB
Harell's + 3x Florikan® Iron Sulfate 7 1032 AB
Harell's + 3x Florikan® Super triple Phosphate 6 910 AB
Harrell's + 2x Florikan® potash 4 902 AB
Harrell's + Biochar 9 559 B
y Means separation by Tukey’s HSD test at P ≤ 0.05.
Table 4-2. Slow release treatments and dosages applied on 10-year-old ‘Vernia’ trees.
Treatment a Formulation Amount Z Product names
Control None 0 None Harrell’s 12-3-9 910 g Harrell’s® St. Helena Mix Harrell’s + 2x Mn
12-3-9 + 0.08% Mn 910 g + 90g
Harrell’s® St. Helena Mix + TigerSul® Manganese (MnO2)
Harrell’s + 2x B
12-3-9 + 0.22% B 910 g + 32g
Harrell’s® St. Helena Mix + Florikan® Polycoated Sodium Borate (Na2[B4O5(OH)4])
155
Table 4-2. Continued
Treatment a Formulation Amount Z Product names
Harrell’s + 2x Mn + 2x B
12-3-9 + 0.08% Mn + 0.22% B
910 g + 90 g + 32 g
Harrell’s® St. Helena Mix + TigerSul® Manganese + Florikan® Polycoated Sodium Borate
4x Mn 0.16% Mn 180 g TigerSul® Manganese 4x Mn + 4x B
0.16% Mn + 0.44% B
180g + 64 g
TigerSul® Manganese + Florikan® Polycoated Sodium Borate
a Treatments in addition to a standard citrus nutrition program (add formulation here)
Z Grams per tree
156
Table 4-3. Canopy volume (m3) and trunk cross-sectional area (cm2) for March and September 2017 and May 2018.
Treatment
March 2017 September 2017 May 2018 Total averaged (2 yrs)
Canopy vol. Trunk cross section area
Canopy vol.
Trunk cross section area
Canopy vol.
Trunk cross section area
Canopy vol.
Trunk cross section area
4x Mn 27.14 az Ay 172.1 a A 16 a C 147.0 a A 24.43 ab B 183.17 ab A 22.99 171.36 Harrell’s® + 2x Mn 25.84 ab A 149.6 a A 14.68 a C 168.2 a A 26.32 a B 176.07 ab A 24.34 167.48 Harrell’s® 25.5 ab A 148.4 a A 18.54 a C 180.3 a A 26.5 a B 160.05 ab A 24.26 162.2
Control 24.94 ab A 154.9 a A 19.69 a B 199.9 a A 24.95 ab AB
191.05 a A 23.63 184.22
Harrell’s® + 2x B 23.61 ab A 157.3 a B 23.39 a B 199.9 a A 25.00 ab B 173.4 ab AB
24.25 176.00
4x Mn + 4x B 20.85 ab A 154.7 a A 18.55 a A 200.2 a A 20.20 ab A 156.92 ab A 19.95 167.18 4x B 20.43 ab A 162.7 a A 21.82 a A 152.9 a A 23.72 ab A 185.77 ab A 22.42 171.78 Harrell’s® + 2x Mn + 2x B
17.61 b A 123.2 a A 20.84 a A 179.8 a A 19.8 b A 134.85 b A 19.51 143.17
y Means separation within months by Tukey’s HSD test at P ≤ 0.05 (lowercase)
z Means separation between months by Tukey’s HSD test at P ≤ 0.05 (uppercase)
W Weighted average of months: (March 2017*0.25+September 2017*0.25) + (May 2018*0.5)
157
Table 4-4. Soil nutrient concentration for March and September of 2017 and May 2018.
Month (F1)
Nutrient (mg kg-1)
Treatment (F2)
4x Mn + 4x B
4x B 4x Mn Harrell’s® Harrell’s® + 2x B
Harrell’s® + 2x Mn
Harrell’s® + 2x Mn + 2x B
Control
Mar 17
P
71.6 Cz ay 59.8 B a 63.5 B a 71.4 B a 84.4 B a 67.4 B a 63.4 B a 62.8 B a Sept 17 137.1 A a 138.6 A a 126.4 A a 132.6 A a 155.8 A a 139.0 A a 137.8 A a 138.4 A a May 18 108.6 A a 133.9 B a 134.4 A a 129.0 A a 124.0 A a 150.1 A a 120.0 A a 117.8 A a Total avg 106.5V 116.6 114.7 115.5 122.1 126.7 110.3 109.2
Mar 17
K
96.0 A a 93.8 A a 68.9 A a 67.0 A a 91.4 A a 80.1 A a 94.1 A a 77.7 A a Sept 17 25.6 A ab 23.3 B b 24.5 B b 42.8 A a 39.3 B ab 31.9 B ab 34.5 B ab 31.4 B ab May 18 44.8 A a 44.2 B a 45.4 B a 50.4 A a 43.9 B a 65.2 AB a 45.2 B a 47.8 AB a Total avg 52.8 51.4 46.1 52.7 54.6 60.6 54.8 51.2
Mar 17
Mg
.w . . . . . . . Sept 17 55.8 A a 45.0 A a 34.3 A a 35.6 A a 32.9 A a 23.4 B a 40.9 A a 60.1 A a May 18 58.0 A a 68.9 A a 55.5 A a 65.2 A a 55.5 A a 61.2 A a 72.5 A a 60.4 A a Total avg 56.9 57.0 44.9 50.4 44.2 42.3 56.7 60.3
Mar 17
Ca
382.7 A a 415.8 A a 284.7 A a 251.9 A a 306.7 A a 360.2 A a 301.7 A a 311.3 A a Sept 17 452.0 A a 386.4 A a 298.0 A a 286.9 A a 324.9 A a 244.4 A a 350.6 A a 474.6 A a May 18 414.0 A a 497.0 A a 372.7 A a 427.6 a 374.6 A a 364.9 A a 463.6 A a 409.9 A a Total avg 415.7 449.05 332.025 348.5 345.2 333.6 394.875 401.4
Mar 17
S
. . . . . . . . Sept 17 36.9 A a 26.4 A a 74.0 A a 39.0 A a 32.6 B a 31.9 B a 30.6 A a 21.8 A a May 18 36.4 A c 42.9 A c 114.9 A a 53.6 A bc 46.6 A bc 92.2 A ab 45.0 A c 37.9 A c Total avg 36.7 34.7 94.5 46.3 39.6 62.05 37.8 29.9
Mar 17
Zn
. . . . . . . . Sept 17 19.9 A ab 12.1 A b 12.7 A ab 21.6 A a 19.7 A ab 14.8 A ab 20.1 A ab 13.6 A ab May 18 14.8 A a 17.7 A a 14.0 A a 20.8 A a 15.1 A a 18.5 A a 18.5 A a 15.1 A a Total avg 17.35 14.9 13.35 21.2 17.4 16.65 19.3 14.35
Mar 17
Fe
. . . . . . . .
Sept 17 173.9 A a 162.4 A a 208.5 A a 172.3 A a 196.1 A a 187.4 A a 167.6 A a 157.4 A a
May 18 168.0 A ab 143.1 A b 196.7 A a 167.5 A ab 164.2 A ab
178.6 A ab
168.4 A ab
170.5 A ab
158
Table 4-4. Continued
Month (F1)
Nutrient (mg kg-1)
Treatment (F2)
4x Mn + 4x B
4x B 4x Mn Harrell’s® Harrell’s® + 2x B
Harrell’s® + 2x Mn
Harrell’s® + 2x Mn + 2x B
Control
Total avg 171.0 152.8 202.6 169.9 180.2 183.0 168.0 164.0
Mar 17
Cu
. . . . . . . . Sept 17 9.9 A a 10.5 A a 7.6 A a 8.2 a 8.3 A a 9.6 A a 8.1 A a 10.3 A a May 18 8.4 B a 10.7 A a 10.1 A a 9.7 a 7.3 A a 8.7 A a 7.6 A a 10.8 A a Total avg 9.15 10.6 8.85 8.95 7.8 9.15 7.85 10.55
Mar 17
Mn
44.1 44.1 42.1 35.5 50.8 52.1 67.3 45.6 Sept 17 128 78 170.9 72.5 72.9 70 B 92.3 76.8 May 18 117.2 121.9 185.2 125.5 114.4 162.1 130.9 122.9 Total avg 101.625 103.975 145.85 89.75 88.125 111.575 105.35 92.05
Mar 17
B
3.5 A ab 3.7 A ab 3.1 A b 3.4 A ab 3.6 A ab 3.9 A a 3.5 A ab 3.2 A b Sept 17 0.6 B a 0.7 B a 0.2 B a 0.2 C a 0.4 B a 0.2 B a 0.3 C a 0.3 B a May 18 0.6 B ab 0.7 B a 0.5 B b 0.5 B ab 0.5 B ab 0.5 B ab 0.6 B ab 0.5 B b Total avg 1.3 1.5 1.1 1.15 1.25 1.3 1.25 1.1
y Means separation within months by Tukey’s HSD test at P ≤ 0.05 (lowercase)
z Means separation between months by Tukey’s HSD test at P ≤ 0.05 (uppercase)
w Nutrients not measured for March 2017
V Weighted average of months: (March 2017*0.25+September 2017*0.25) + (May 2018*0.5)
159
Table 4-5. Leaf nutrient concentration for March and September 2017, and May 2018.
Month (F1)
Nutrient (mg kg-1)
Treatment (F2)
4x Mn + 4x B
4x B 4x Mn Harrell’s® Harrell’s® + 2x B
Harrell’s® + 2x Mn
Harrell’s® + 2x Mn +2x B
Control
Mar 17
N
2.8 Az ay 2.9 A a 2.9 A a 2.7 A a 2.6 A a 2.8 A a 2.6 A a 2.6 A a Sept 17 2.5 A a 2.4 B a 2.4 B a 2.4 B a 2.3 A a 2.4 A a 2.5 A a 2.4 A a May 18 2.5 A a 2.5 B a 2.8 A a 2.6 AB a 2.6 A a 2.6 A a 2.5 A a 2.4 A a Total avg 2.575V 2.575 2.725 2.575 2.525 2.6 2.525 2.45
Mar 17
P
0.2 A ab 0.2 A a 0.2 A ab 0.1 A b 0.1 A b 0.2 A ab 0.2 A ab 0.2 A ab Sept 17 0.1 AB a 0.1 B a 0.1 A a 0.1 A a 0.1 A a 0.1 A a 0.1 A a 0.2 A a May 18 0.1 B a 0.1 B a 0.1 A a 0.1 A a 0.1 A a 0.1 A a 0.1 A a 0.1 A a Total avg 0.125 0.125 0.125 0.1 0.1 0.125 0.125 0.15
Mar 17
K
1.3 A a 1.5 A a 1.3 A a 1.3 A a 1.1 A a 1.3 A a 1.2 A a 1.3 A a Sept 17 1.4 A a 1.4 A a 1.2 A a 1.1 A a 1.1 A a 1.3 A a 1.3 A a 1.4 A a May 18 1.3 A a 1.3 A a 1.4 A a 1.3 A a 1.3 A a 1.3 A a 1.3 A a 1.2 A a Total avg 1.325 1.375 1.325 1.25 1.2 1.3 1.275 1.275
Mar 17
Mg
0.3 B a 0.3 B a 0.3 B a 0.3 B a 0.3 A a 0.3 B a 0.3 B a 0.3 B a Sept 17 0.4 A a 0.4 A a 0.5 A a 0.4 AB a 0.4 A a 0.4 A a 0.4 A a 0.5 A a May 18 0.4 A a 0.4 A a 0.4 AB a 0.4 A a 0.4 A a 0.3 A a 0.4 A a 0.4 AB a Total avg 0.375 0.375 0.4 0.375 0.375 0.325 0.375 0.4
Mar 17
Ca
2.6 B a 2.5 B a 2.8 B a 2.8 A a 2.9 B a 2.9 B a 3.1 B a 2.8 C a Sept 17 4.5 A a 3.9 A a 4.2 A a 4.0 A a 4.2 A a 4.1 A a 4.4 A a 4.5 A a May 18 4.1 A a 3.8 A a 3.8 A a 3.5 A a 3.7 AB a 3.5 AB a 3.8 AB a 3.8 B a Total avg 3.825 3.5 3.65 3.45 3.625 3.5 3.775 3.725
Mar 17
S
- - - - - - - - Sept 17 0.6 A ab 0.5 A ab 0.6 A a 0.5 A ab 0.4 B b 0.5 A ab 0.5 A ab 0.5 A ab May 18 0.6 A a 0.5 A a 0.6 A a 0.5 A a 0.5 A a 0.6 A a 0.6 A a 0.6 A a Total avg 0.6 0.5 0.6 0.5 0.45 0.55 0.55 0.55
Mar 17 Zn
8.3 B a 6.1 C a 7.8 C a 7.0 C a 5.0 B a 8.6 B a 8.0 B a 3.6 C a Sept 17 13.3 B a 15.0 B a 17.8 B a 15.8 B a 12.7 B a 18.0 B a 17.8 B a 15.3 B a May 18 28.1 A a 25.8 A a 27.7 A a 33.6 A a 32.6 A a 31.5 A a 35.0 A a 24.8 A a
160
Table 4-5. Continued
Month (F1)
Nutrient (mg kg-1)
Treatment (F2)
4x Mn + 4x B
4x B 4x Mn Harrell’s® Harrell’s® + 2x B
Harrell’s® + 2x Mn
Harrell’s® + 2x Mn +2x B
Control
Total avg 19.45 18.175 20.25 22.5 20.725 22.4 23.95 17.125
Mar 17
Fe
27.2 B a 28.9 B a 44.7 A a 43.4 B a 48.4 B a 49.4 B a 47.5 B a 31.5 B a Sept 17 72.3 A a 67.3 A a 76.5 A a 79. 8 A a 86.8 A a 88.5 A a 85.3 A a 71.3 A a
May 18 60.0 A a 61.0 A a 84.3 A a 65.7 A a 60.5 AB a 59.4 B a 61.1 B a 51.8 AB a
Total avg 54.875 54.55 72.45 63.65 64.05 64.175 63.75 51.6
Mar 17
Cu
- - - - - - - - Sept 17 19.7 A a 18.3 A a 20 A a 17.8 A a 17.5 A a 18.5 A a 18.8 A a 18.3 A a May 18 19.7 A a 19.3 A a 20.3 A a 18.4 A a 19.5 A a 19.2 A a 18 A a 19.1 A a Total avg 19.7 18.8 20.15 18.1 18.5 18.85 18.4 18.7
Mar 17
Mn
6.7 B ab 10.2 B ab 20.1 B ab 10.3 B ab 14 B ab 25.2 B a 23 B ab 5.9 B b
Sept 17 34.3 A b 44.5 AB ab
63 A ab 45.8 A ab 51.5 A ab 89.8 A a 91.8 A a 37 A b
May 18 43.3 A ab 30.7 A b 48.8 AB ab
54.2 A ab 75 A a 77.5 A a 62.2 AB ab
26.5 A b
Total avg 31.9 29.025 45.175 41.125 53.875 67.5 59.8 23.375
Mar 17
B
85.3 B a 64.4 B ab 52.4 B b 73.9 B ab 83.1 B ab 82 C ab 83.8 C ab 57.3 C ab
Sept 17 331 A a 270 A ab 142 A d 178.5 A cd
228.3 A bc 181.3 A cd 267.5 A ab 161.3 A cd
May 18 311.9 A a 306.9 A a 115.6 A c 147.8 A bc
214.0 A b 126.0 B c 197.0 B bc 131.6 c B
Total avg 260.03 237.05 106.4 137 184.85 128.825 186.325 120.45 y Means separation within months by Tukey’s HSD test at P ≤ 0.05 (lowercase)
z Means separation between months by Tukey’s HSD test at P ≤ 0.05 (uppercase)
V Weighted average of months: (March 2017*0.25+September 2017*0.25) + (May 2018*0.5)
161
Table 4-6. Juice attributes for fruits harvested in January 2018
Treatment Sample weight (kg)
Juice weight (kg)
Juice per box1 (kg)
Acidity Total brix
Ratio Soluble solutes (kg)
Juice color
Harrell's® + 2x Mn
12.02 7.04 23.95 0.71 12.14 17.10 2.91 38.15
Control 11.93 6.90 23.65 0.71 12.26 17.28 2.90 37.6 4x Mn 11.34 6.53 23.52 0.76 12.51 16.58 2.94 37.95 Harrell's® + 2x Mn + 2x B
11.29 6.62 23.96 0.71 12.05 16.98 2.88 38.05
Harrell's® + 2x B
11.11 6.40 23.56 0.75 12.42 16.56 2.93 37.9
4x B 10.93 6.33 23.64 0.73 12.31 16.87 2.91 38 4x Mn + 4x B
10.89 6.28 23.57 0.74 12.18 16.58 2.87 37.7
Harrell's® 10.80 6.30 23.84 0.70 12.70 18.16 3.03 38.45 p-value z 0.957 0.924 0.788 0.625 0.80 0.25 0.838 0.535
1 A field box contains 40.82kg of fruit
Z Means separation between nutrition treatment by Tukey’s HSD test at P ≤ 0.05.
Table 4-7. Yield accumulation of ‘Vernia’ sweet oranges for 2015, 2016 and 2017
seasons.
Treatment Yield per year (boxes1 per tree)
2016 2017y 2018 Cumulative z p-value Treatment
Control 1.67 0.56 1.71 27.2 n.s Harrell’s® 1.5 1.02 1.75 33.2 n.s Harrell’s®+2xMn 1.5 0.83 1.54 28.4 n.s Harrell’s®+2xB 1.92 0.83 1.71 30.5 n.s Harrell’s®+2xMn+2xB 1.5 0.94 1.71 31.8 n.s 4xMn 1.75 0.92 2.21 37.6 n.s 4xB 1.58 0.44 1.63 24.8 n.s 4xMn+4xB 1.5 0.9 1.79 32.3 n.s p-value Year n.s n.s n.s n.s
1 A field box contains 40.82kg of fruit.
z Cumulative column provides the total number of boxes of fruit per 12 trees receiving each treatment produced during the 2017 and 2018 seasons after the treatments were implemented.
y 2017 yields were significantly reduced by a severe PFD (post-bloom fruit drop disease caused by Colletotrichum acutatum) infection.
162
Table 4-8. Cycle threshold (Ct) values of CLas detection in leaves, November 2017
Treatment Ct Value y
4x Mn 32.7 a
Harrell's® + 2x Mn + 2x B 30.3 ab
Harrell'®s + 2x B 29.5 abc
Harrell's® 29.3 abc
4x B 28.1 abc
Harrell's® + 2x Mn 27.6 abc
4x Mn + 4x B 23.8 bc
Control 23.2 c y Means separation by Tukey’s HSD test at P ≤ 0.05
163
CHAPTER 5 GENERAL CONCLUSIONS
Several factors that can influence plant defense are still unknown. Citrus plant
defense, as other crops, is regulated by an external agent, a pathogen presence, by
chemicals released upon the pathogen infection or by abiotic stresses. Plant defense is
well known to be regulated by plant hormones, as complex cross-talk between the
classic five classes of endogenous phytohormones (Jones and Dangl, 2006; Shigenaga
and Argueso, 2016). Citrus greening, or HLB is putatively caused by a bacterium that
proliferates inside the phloem sieve tubes, which depletes the trees’ physiological
condition, and has been causing devastating losses for citrus growers.
Primary disease control has focused on controlling of the insect vector,
Diaphorina citri (Boina and Bloomquist, 2015). However, enhanced tree nutrition has
emerged as an important and affordable tool to help achieve sustainable and profitable
groves in the now HLB-endemic Florida.
No HLB resistant selections have been identified amongst the citrus germplasm
and its relatives, and most commercial scions and rootstocks have limited or no
tolerance. Recently improved HLB tolerant genotypes used in this study were
developed at the University of Florida – Citrus Research and Education Center (UF-
CREC). Improved scions Sugar Belle mandarin hybrid and Cybrid 304, and a tetrazyg
rootstock AVO were chosen for the greenhouse studies included in this dissertation and
were tested against commercially available susceptible varieties Valencia sweet orange
scion, and commercial rootstocks Swingle citrumelo and Cleopatra mandarin.
Parameters investigated included CLas detection and titer monitoring, effects of
enhanced nutrition on disease expression, HLB-indexing and hormonal responses to
164
the disease. Therefore, the overall goal of the greenhouse studies was to analyze the
overall effects of distinct overdoses of micronutrients on HLB+ scion/rootstock
combinations and a healthy scion/rootstock combination (control) in a temperature-
controlled greenhouse that favored CLas replication.
The dissertation also includes a field study, examining the effects of enhanced
nutrition, including overdoses of manganese and boron, on established field trees of
Vernia sweet orange on rough lemon rootstock, at a field site receiving no psyllid
control.
The combined results from all the experiments conducted generally support the
hypothesis that the combination of improved genetics and enhanced nutrition can
successfully ameliorate HLB symptoms. The use of controlled release fertilizers
containing enhanced secondary and micronutrient packages had a positive impact on
greenhouse and field tree health, and increased yield in the field trees. The enhanced
nutrition also suppressed CLas replication over time in all the HLB+ trees studied,
resulting in reduced CLas titers, especially with the overdose of manganese in the field
trees. Enhanced micronutrient nutrition appears to be necessary for normal vascular
system function in HLB+ trees, and the new data reported herein suggests that
overdoses of micronutrients may be therapeutic.
Although the selected improved genotypes had a better performance regarding
reduction in CLas titers and overall health, Swingle was surprisingly the most vigorous
of the rootstocks for tree growth and development. This agrees with a previous study
that showed although Swingle is considered to be a susceptible rootstock, it has
capacity to develop tolerance under enhanced nutrition that helps balance the trees’
165
energy allocation between defense and required metabolism (Satpute, 2017). Without
enhanced micronutrient nutrition, trees on Swingle overreact to HLB, putting too much
energy into defense at the expense of routine metabolism. Nutrient concentration in
plants has been directly linked with the synthesis and structure of scavenging
antioxidant molecules, which only function is to detoxify reactive oxygen species (ROS)
produced by the plant under attack of a pathogen as part of plant defense mechanism
(Torres, 2010). CLas codifies a peroxidase, by which protects itself from the ROS
release by the plant, as a tentative to stop bacterial spreading (Jain et al., 2015). The
greenhouse study results show that the improved genotypes are more likely to maintain
leaf nutrient concentrations in the recommended optimum/high ranges, with a few
exceptions including boron and manganese.
Likewise, the improved rootstock AVO had the lowest jasmonic acid (JA)
concentration when grafted with UF-CREC improved scions Sugar Belle and Cybrid
304, regardless of the nutrition treatment. As the low JA concentration in HLB-affected
trees was not statistically different from a healthy combination, it is possible to conclude
that expenditure of energy towards disease is low compared to scions grafted onto the
commercial rootstocks Swingle and Cleopatra, which had high JA concentration,
although there was not a consistent trend of statistical differences for scion diameter
growth or Ct value between AVO and the other rootstocks. The presence of CLas was
expected to trigger a biotic SA-dependent stress response from citrus plants, however,
our work suggests the that the abiotic JA-ET pathway is activated in citrus plants
against CLas, in agreement of previous reports (Martinelli et al., 2013; Satpute, 2017).
This also supports recent findings that rootstocks previously selected for abiotic stress
166
tolerance (salinity tolerance) are performing exceptionally well in a high throughput
rootstock screening program to identify rootstocks that can transmit HLB tolerance to
grafted commercial scions (Jude W. Grosser, personal communication).
The study of established Vernia/rough lemon field trees showed that overdoses
of manganese applied over a 2-year period decreased CLas titers, especially with a 4x
dose of manganese. The same trend could be found in the greenhouse study as Ct
values were increasing (CLas titers decreasing) for all scion/rootstock combinations
over the tree-year period of micronutrient overdose application. A previous study that
used ground applied enhanced controlled released fertilizer has been proven to reduce
CLas titers in greenhouse trees (Satpute, 2017). These combined results suggest that
further research is needed to determine optimal micronutrient formulations for a
maximum therapeutic effect against CLas, and they may be different for different
scion/rootstock combinations and environmental conditions. It is also important to note
that these results were achieved without psyllid control and heavy HLB pressure. Thus,
it is quite possible that expensive and environmentally unfriendly psyllid control may not
be necessary for successful citrus production in Florida, if nutrition programs are
adequately optimized.
Planting Choices: Although the studies performed show conclusive and positive
results for the combination of improved genetics and enhanced nutrition, a single choice
of scion/rootstock combination to be planted or and an enhanced nutrition program to
be implemented/administrated in citrus groves is not universal. As studies move forward
and the scientific community continues to learn, the interaction between scion and
rootstock genotypes will play an increasingly important role in new planting choices.
167
Choices will also be dependent on the grower’s planting situation. As mentioned, results
of this study show that overdoses of micronutrients on field-established trees contribute
to improved tree health and increased productivity within a couple of years. For new
plantings, a good strategy may be to start using enhanced nutrition containing
overdoses of specific micronutrients right from the start. Research is underway to
validate this approach. A very complex interaction between scion and rootstock
genotypes (in both directions), has an intrinsic importance in the success of a citrus
grove. Improved scion and rootstock varieties that can grow and develop under HLB-
pressure are the future for growers and for the worldwide citrus industry. Nutrition
carries the foundation of a sustainable cultural practice, and, moreover, has shown a
strong influence on the modulation of plant hormones responsible for plant defense.
Since all of this is breaking new ground, growers planning to plant new groves
will have to pay close attention to research results as needed to make the most lucrative
scion and rootstock choices, and the best available nutrition program for their specific
location/soil type. Overall, results from this dissertation have contributed to the
development of powerful new tools that can be used to defeat HLB. Further studies are
needed to fine-tune optimized nutrition programs for successful citriculture in HLB-
endemic areas, along with an increase in the use of emerging new more HLB-tolerant
scions and rootstocks that react more quickly and more robustly to enhanced nutrition.
The combination of improved genetics and enhanced nutrition should help pave the way
forward for sustainable and profitable citriculture in the HLB era.
168
APPENDIX A SUPPLEMENTAL MATERIAL FOR CHAPTER 2 AND 3
Figure A-1. Grafting union and shoot growth of composite plants treated with Florikan Advantage (Control) in January
2016. Photos A and B: Cybrid 304 grafted in Cleopatra; C and D: Cybrid 304 in Swingle; E and F: Sugar Belle in Cleopatra; G and H: Sugar Belle in Swingle; I and J: Valencia in Cleopatra; K and L: Valencia in Swingle.
169
Figure A-2. Grafting union and shoot growth of composite plants treated with Florikan
Advantage + 2x TigerSul Mn (N1) in January 2016. Photos A and B: Cybrid 304 grafted in Cleopatra; C and D: Cybrid 304 in Swingle; E and F: Sugar Belle in Cleopatra; G and H: Sugar Belle in Swingle; I and J: Valencia in Cleopatra; K and L: Valencia in Swingle.
170
Figure A-3. Grafting union and shoot growth of composite plants treated with Florikan
Advantage + 2x Sodium Borate (N2) in January 2016. Photos A and B: Cybrid 304 grafted in Cleopatra; C and D: Cybrid 304 in Swingle; E and F: Sugar Belle in Cleopatra; G and H: Sugar Belle in Swingle; I and J: Valencia in Cleopatra; K and L: Valencia in Swingle.
171
Figure A-4. Grafting union and shoot growth of composite plants treated with Florikan
Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3) in January 2016. Photos A and B: Cybrid 304 grafted in Cleopatra; C and D: Cybrid 304 in Swingle; E and F: Sugar Belle in Cleopatra; G and H: Sugar Belle in Swingle; I and J: Valencia in Cleopatra; K and L: Valencia in Swingle.
172
Figure A-5. Cybrid 304 grafted onto AVO trees in February 2017. Trees treated with
Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
173
Figure A-6. Sugar Belle grafted onto AVO trees in February 2017. Trees treated with
Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
174
Figure A-7. Valencia grafted onto AVO trees in February 2017. Trees treated with
Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
175
Figure A-8. Cybrid 304 grafted onto Cleopatra trees in February 2017. Trees treated with Florikan Advantage (CT),
Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
176
Figure A-9. Sugar Belle grafted onto Cleopatra trees in February 2017. Trees treated
with Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
177
Figure A-10. Valencia grafted onto Cleopatra trees in February 2017. Trees treated
with Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
178
Figure A-11. Cybrid 304 grafted onto Swingle trees in February 2017. Trees treated
with Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
179
Figure A-12. Sugar Belle grafted onto Swingle trees in February 2017. Trees treated
with Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
180
Figure A-13. Valencia grafted onto Swingle trees in February 2017. Trees treated with
Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment.
181
Figure A-14. Healthy Valencia grafted onto healthy Swingle trees in February 2017.
Trees treated with Florikan Advantage (CT), Florikan Advantage + 2x TigerSul Mn (N1), Florikan Advantage + 2x Sodium Borate (N2) and Florikan Advantage + 2x TigerSul Mn + 2x Sodium Borate (N3). On the left side, side by side comparison, on the right side, detail of each nutrition treatment
Table A-1. Liquid fertilizer composition used as base for micronutrient dose
requirements – 20-10-20 Peat Lite JR Peters, Allentown, PA)
Nutrient Percent
Total Nitrogen 20 % Nitrate Nitrogen 12% Ammoniacal Nitrogen 8%
Available Phosphate (P2O5)* 10%
Soluble Potash (K2O)* 20%
Magnesium (Mg) 0.15% 0.15% Water Soluble Magnesium (Mg)
Boron (B) 0.02%
Copper (Cu) 0.1%
182
Table A-1. Continued 0.1% Chelated Copper (Cu)
Iron (Fe) 0.1%
0.1% chelated Iron
Manganese (Mn) 0.05%
0.05% chelated Manganese
Molybdenum (Mo) 0.01%
Zinc (Zn) 0.05%
0.05% chelated Zinc
Derived from: ammonium nitrate, potassium phosphate, potassium nitrate, boric acid, magnesium sulfate, iron EDTA, manganese EDTA, zinc EDTA, copper EDTA, ammonium molybdate.
183
APPENDIX B SUPPLEMENTAL MATERIAL FOR CHAPTER 4
Table B-1. Fertilizer and psyllid control spray schedule for 2016, 2017 and 2018 seasons – Lee Groves Alligator Grove – Mathew Block, St. Cloud, Florida
Dry soluble fertilizer
Application date Chemical composition Dose (kg ha-1) Oct. 2015 12-0-15 (0.25 Mn) 415 Feb. 2016 18-0-18 269 May 2016 15-0-15 (1.23 Mn + 0.075 B) 426 Nov. 2016 15-0-17 (0.5 Mn + 0.5 B) 352 Feb. 2017 11-1-11 (1.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 725 May 2017 11-1-11 (1.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 738 Oct. 2017 11-1-11 (1.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 367 Feb. 2018 11-1-11 (2.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 514 June 2018 11-1-11 (2.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 573 Sept. 2018 11-1-11 (2.0 Mn + 0.06 B + 2.5 Mg + 0.15 Fe) 449
Spray (psyllid control) - recommended dose Application date Mix composition
Oct. 2015 Mustang + K Nitrate + 435 oil April 2015 Post bloom spray (Mustang + humectant + 435 oil) June 2017 Actara + humectant + 435 oil June 2017 Mustang + humectant + 435 oil June 2018 Mustang + humectant + 435 oil
184
Table B-2. Harrell’s® St. Helena Mix formulation (12-3-9)
Nutrient Percent
Total Nitrogen 12.0000% Nitrate Nitrogen * 6.8289% Ammoniacal Nitrogen* 4.3620% Urea Nitrogen * 0.8100%
Available Phosphate (P2O5)* 3.0000%
Soluble Potash (K2O)* 9.0000%
Calcium (Ca) 4.5270%
Magnesium (Mg) 0.7920% 0.792% Water Soluble Magnesium (Mg)
Boron (B) 0.0750%
Iron (Fe) 1.0880% 0.088% Water Soluble Iron (Fe)
0.32% Chelated Iron (Fe)
Manganese (Mn) 0.9200% 0.065% Water Soluble Manganese (Mn)
Molybdenum (Mo) 0.0060%
Zinc (Zn) 0.7130% 0.038% Water Soluble Zinc (Zn)
Derived From: Polymer Coated Ammonium Nitrate, Polymer Coated Calcium Nitrate, Polymer Coated Monoammonium Phosphate, Polymer Coated Murlate of Potash, Polymer Coated Sulfate of Potash, Polymer Coated Urea, Calcium Borate, Ferric Oxide, Ferrous Sulfate, Iron EDTA, Iron Humate, Iron Sucrate, Manganese Oxide, Polymer Coated Iron EDTA, Polymer Coated Magnesium Sulfate, Polymer Coated Manganese Sulfate, Polymer Coated Sodium Molybdate, Polymer Coated Zinc Sulfate, Sodium Borate, Sulfate of Potash-Magnesia, Zinc Oxide
12% coated slow release Nitrogen (N), 3% coated slow release available Phosphate (P2O5) and 8.712% coated slow release Soluble Potash (K2O) Chlorine (Cl), no more than 2.2490%
185
LIST OF REFERENCES
Abbate L, Tusa N, Fatta Del Bosco S, Strano T, Renda A, Ruberto G (2012) Genetic improvement of citrus fruits: new somatic hybrids from Citrus sinensis (L.) Osb. and Citrus limon (L.) Burm. F. Food Res Int 48: 284–290
Albano JP, Altland J, Merhaut DJ, Winson SB, Wilson PC (2017) Irrigation water acidification to neutralize alkalinity for nursery crop production: substrate pH, electrical conductivity, nutrient concentrations, and plant nutrition and growth. HortScience 52: 1401–1405
Albrecht U, Bowman KD (2012a) Transcriptional response of susceptible and tolerant citrus to infection with Candidatus Liberibacter asiaticus. Plant Sci 185–186: 118–130
Albrecht U, Bowman KD (2008) Gene expression in Citrus sinensis (L.) Osbeck following infection with the bacterial pathogen Candidatus Liberibacter asiaticus causing Huanglongbing in Florida. Plant Sci 175: 291–306
Albrecht U, Bowman KD (2012b) Tolerance of trifoliate citrus rootstock hybrids to Candidatus Liberibacter asiaticus. Sci Hortic (Amsterdam) 147: 71–80
Albrecht U, McCollum G, Bowman KD (2012) Influence of rootstock variety on Huanglongbing disease development in field-grown sweet orange (Citrus sinensis [L.] Osbeck) trees. Sci Hortic (Amsterdam) 138: 210–220
Albrecht U, Tripathi I, Kim H, Bowman KD (2019) Rootstock effects on metabolite composition in leaves and roots of young navel orange (Citrus sinensis L. Osbeck) and pummelo (C. grandis L. Osbeck) trees. Trees - Struct Funct 33: 243–265
Aleza P, Juárez J, Cuenca J, Ollitrault P, Navarro L (2010) Recovery of citrus triploid hybrids by embryo rescue and flow cytometry from 2x × 2x sexual hybridisation and its application to extensive breeding programs. Plant Cell Rep 29: 1023–1034
Allen JF, de Paula WBM, Puthiyaveetil S, Nield J (2011) A structural phylogenetic map for chloroplast photosynthesis. Trends Plant Sci 16: 645–655
Alscher RG, Erturk N, Heath LS (2002) Role of superoxide dismutases (SODs) in controlling oxidative stress in plants. J Exp Bot 53: 1331–1341
Alvarez-tinaut MC, Leal A, Nez LRM (1980) Iron-manganese interaction and its relation to boron levels in tomato plants. Plant Soil 55: 377–388
Arbona V, Gomez-Cadenas A (2012) Antioxidant system in citrus under nutrient stress conditions: latest developments. In AK Srivastava, ed, Adv. Citrus Nutr. Springer, pp 13–24
186
Aref F (2012) Manganese, iron and copper contents in leaves of maize plants (Zea mays L.) grown with different boron and zinc micronutrients. African J Biotechnol 11: 896–903
Argamasilla R, Gómez-Cadenas A, Arbona V (2014) Metabolic and regulatory responses in citrus rootstocks in response to adverse environmental conditions. J Plant Growth Regul 33: 169–180
Auler PAM, Neves CSVJ, Fidalski J, Pavan MA (2011) Calagem e desenvolvimento radicular, nutrição e produção de laranja ’Valência; sobre porta-enxertos e sistemas de preparo do solo. Pesqui Agropecu Bras 46: 254–261
Baldwin E, Plotto A, Manthey J, Mccollum G, Bai J, Irey M, Cameron R, Luzio G (2010) Effect of liberibacter infection (Huanglongbing disease) of citrus on orange fruit physiology and fruit/fruit juice quality: Chemical and physical analyses. J Agric Food Chem 58: 1247–1262
Barah P, Winge P, Kusnierczyk A, Tran DH, Bones AM (2013) Molecular signatures in Arabidopsis thaliana in response to insect attack and bacterial infection. PLoS One. doi: 10.1371/journal.pone.0058987
Bari R, Jones JDG (2009) Role of plant hormones in plant defence responses. Plant Mol Biol 69: 473–488
Baxter A, Mittler R, Suzuki N (2014) ROS as key players in plant stress signalling. J Exp Bot 65: 1229–1240
Benjamin G, Tietel Z, Porat R (2013) Effects of rootstock/scion combinations on the Ffavor of citrus fruit. J Agric Food Chem 61: 11286–11294
Bi Y ‐M, Kenton P, Mur L, Darby R, Draper J (1995) Hydrogen peroxide does not function downstream of salicylic acid in the induction of PR protein expression. Plant J 8: 235–245
Blamey FPC, Joyce DC, Edwards DG, Asher CJ (1986) Role of trichomes in sunflower tolerance to manganese toxicity. Plant Soil 91: 171–180
Blevins D.G. LKM (1998) Boron in plant structure and function. Ann Rev Plant Physiol Plant Mol Biol 49: 36–41
Boaretto RM, Quaggio JA, De Assis Alves Mourão Filho F, Giné MF, Boaretto AE (2008) Absorption and mobility of boron in young citrus plants. Commun Soil Sci Plant Anal 39: 2501–2514
Boina DR, Bloomquist JR (2015) Chemical control of the Asian citrus psyllid and of huanglongbing disease in citrus. Pest Manag Sci 71: 808–823
187
Bové J-M (2006) Huanglongbing: a destructive, newly-emerging, century-old disease of citrus. J. Plant Pathol.
Brossa R, López-Carbonell M, Jubany-Marí T, Alegre L (2011) Interplay between abscisic acid and jasmonic acid and its role in water-oxidative stress in wild-type, ABA-deficient, JA-deficient, and ascorbate-deficient Arabidopsis plants. J Plant Growth Regul 30: 322–333
Cao J, Cheng C, Yang J, Wang Q (2015) Pathogen infection drives patterns of nutrient resorption in citrus plants. Sci Rep 5: 14675
Castle WS (1980) Fibrous root distribution of “Pineapple” orange trees on rough lemon rootstock at three tree spacings. J Am Soc Hortic Sci 105: 478–480
Castle WS (1977) Root System Characteristics of Citrus Nursery Trees. Proc Fla State Hort Soc 90: 39–44
Castle WS, Grosser JW, Bowman KD, Stover E (2015) An HLB-tolerant citrus rootstock: What exactly does that mean? Citrus Ind 16–19
Castle WS, Nunnallee J, Manthey JA (2009) Screening citrus rootstocks and related selections in soil and solution culture for tolerance to low-iron stress. HortScience 44: 638–645
Cen H, Weng H, Yao J, He M, Lv J, Hua S, Li H, He Y (2017) Chlorophyll fluorescence imaging uncovers photosynthetic fingerprint of citrus huanglongbing. Front Plant Sci 8: 1–11
Cevallos-Cevallos JM, Rouseff R, Reyes-De-Corcuera JI (2009) Untargeted metabolite analysis of healthy and Huanglongbing-infected orange leaves by CE-DAD. Electrophoresis 30: 1240–1247
Chen C, Grosser JW, Ćalović M, Serrano P, Pasquali G, Gmitter J, Gmitter FG (2008) Verification of mandarin and pummelo somatic hybrids by expressed sequence tag–simple sequence repeat marker analysis. J Am Soc Hortic Sci 133: 794–800
Chen XD, Stelinski LL (2017) Resistance management for asian citrus psyllid, Diaphorina citri Kuwayama, in Florida. Insects 8: 1–10
Chen YY, Hu CY, Xiao JX (2014) Effects of arbuscular mycorrhizal inoculation on the growth, zinc distribution and photosynthesis of two citrus cultivars grown in low-zinc soil. Trees - Struct Funct 28: 1427–1436
Choi J, Choi D, Lee S, Ryu CM, Hwang I (2011) Cytokinins and plant immunity: Old foes or new friends? Trends Plant Sci 16: 388–394
188
Choi J, Huh SU, Kojima M, Sakakibara H, Paek K-H, Hwang I (2010) The cytokinin-activated transcription factor ARR2 promotes plant immunity via TGA3/NPR1-dependent salicylic acid signaling in Arabidopsis. Dev Cell 19: 284–295
Cimò G, Bianco R Lo, Scienze V, Gonzalez P, Bandaranayake W, Etxeberria E, Syvertsen JP (2013) Carbohydrate and nutritional responses to stem girdling and drought stress with respect to understanding symptoms of huanglongbing in citrus. HortScience 48: 920–928
Coletta-Filho HD, Targon MLPN, Takita MA, De Negri JD, Pompeu J, Machado MA, do Amaral AM, Muller GW (2004) First report of the causal agent of huanglongbing (“Candidatus Liberibacter asiaticus”) in Brazil. Plant Dis 88: 1382–1382
Cortleven A, Schmülling T (2015) Regulation of chloroplast development and function by cytokinin. J Exp Bot 66: 4999–5013
Dala-Paula BM, Plotto A, Bai J, Manthey JA, Baldwin EA, Ferrarezi RS, Gloria MBA (2019) Effect of Huanglongbing or Greening Disease on Orange Juice Quality, a Review. Front Plant Sci 9: 1–19
Dambier D, Benyahia H, Pensabene-Bellavia G, Kaçar YA, Froelicher Y, Belfalah Z, Lhou B, Handaji N, Printz B, Morillon R, et al (2011) Somatic hybridization for citrus rootstock breeding: An effective tool to solve some important issues of the Mediterranean citrus industry. Plant Cell Rep 30: 883–900
Davey JE, van Staden J (1976) Cytokinin translocation: changes in zeatin and zeatin-riboside levels in the root exudate of tomato plants during their development. Planta 69–72
Denancé N, Sánchez-Vallet A, Goffner D, Molina A (2013) Disease resistance or growth: the role of plant hormones in balancing immune responses and fitness costs. Front Plant Sci 4: 155
Deng H, Achor D, Exteberria E, Yu Q, Du D, Stanton D, Liang G, Gmitter Jr. FG (2019) Phloem regeneration is a mechanism for huanglongbing-tolerance of “Bearss” lemon and “LB8-9” Sugar Belle® mandarin. Front Plant Sci 10: 1–13
Dubey AK, Sharma RM (2016) Effect of rootstocks on tree growth, yield, quality and leaf mineral composition of lemon (Citrus limon (L.) Burm.). Sci Hortic (Amsterdam) 200: 131–136
Dursun A, Turan M, Ekinci M, Gunes A, Ataoglu N, Aslihan E, Yildirim E (2010) Effects of boron fertilizer on tomato, pepper, and cucumber yields and chemical composition. Commun Soil Sci Plant Anal 41: 1576–1593
189
Dutt M, Barthe G, Irey M, Grosser J (2015) Transgenic citrus expressing an arabidopsis NPR1 gene exhibit enhanced resistance against Huanglongbing (HLB; Citrus greening). PLoS One 10: 1–17
Ehsani R, Reyes-De-Corcuera JI, Khot L (2013) The potential of thermotherapy in combatting HLB. Citrus Ind 18–20
El-Otmani M, Lovatt CJ, Coggins CW, Agusti M (1995) Plant growth regulators in citriculture: factors regulating endogenous levels in citrus issues. CRC Crit Rev Plant Sci 14: 367–367
Etxeberria E, Gonzalez P, Achor D, Albrigo G (2009) Anatomical distribution of abnormally high levels of starch in HLB-affected Valencia orange trees. Physiol Mol Plant Pathol 74: 76–83
Fagan HJ (1979) Postblossom fruit drop, a new disease of citrus associated with a form on Colletotrichum gloeosporioides. Ann. Appl. Biol. 91:
Fageria NK, Rabelo NA (1987) Tolerance of rice cultivars to iron toxicity. J Plant Nutr 10: 653–661
Fageria VD (2001) Nutrient interactions in crop plants. J Plant Nutr 24: 1269–1290
Fan J, Chen C, Achor DS, Brlansky RH, Li ZG, Gmitter FG (2013) Differential anatomical responses of tolerant and susceptible citrus species to the infection of “Candidatus Liberibacter asiaticus.” Physiol Mol Plant Pathol 83: 69–74
Fan J, Chen C, Yu Q, Khalaf A, Achor DS, Brlansky RH, Moore G a, Li Z-G, Gmitter FG (2012) Comparative transcriptional and anatomical analyses of tolerant rough lemon and susceptible sweet orange in response to “Candidatus Liberibacter asiaticus” infection. Mol Plant Microbe Interact 25: 1396–407
Ference CM, Gochez AM, Behlau F, Wang N, Graham JH, Jones JB (2018) Recent advances in the understanding of Xanthomonas citri ssp. citri pathogenesis and citrus canker disease management. Mol Plant Pathol 19: 1302–1318
Florida Department of Agriculture and Consumer Services (2018) Citrus budwood: Annual Report 2017-2018.
Foy CD, Weidner JR (1987) Effects of excess soil manganese on stomatal function in two soybean cultivars. J Plant Nutr 10: 749–760
Fu ZQ, Dong X (2013) Systemic acquired resistance: turning local infection into global defense. Annu Rev Plant Biol 64: 839–63
190
Gasparoto MCG, Coletta-Filho HD, Bassanezi RB, Lopes SA, Lourenço SA, Amorim L (2012) Influence of temperature on infection and establishment of “Candidatus Liberibacter americanus” and “Candidatus Liberibacter asiaticus” in citrus plants. Plant Pathol 61: 658–664
Gherardi MJ, Rengel Z (2003) Genotypes of lucerne (Medicago sativa L.) show differential tolerance to manganese deficiency and toxicity when grown in bauxite residue sand. Plant Soil 249: 287–296
Ginzburg BZ (1961) Evidence for a protein gel structure cross-linked by metal cations in the intercellular cement of plant tissue. J Exp Bot 12: 85–107
Gmitter Jr FG, Castle WS, Grosser JW (2010) Mandarin tree named “LB8-9.” 1–7
Gonzalez P, Reyes-De-Corcuera J, Etxeberria E (2012) Characterization of leaf starch from HLB-affected and unaffected-girdled citrus trees. Physiol Mol Plant Pathol 79: 71–78
Graham JH, Johnson EG, Gottwald TR, Irey MS (2013) Presymptomatic fibrous root decline in citrus trees caused by huanglongbing and potential interaction with Phytophthora spp. Plant Dis 97: 1195–1199
Grosser J, Graham J, Hoyte A (2007) Continued development of rootstocks tolerant of the phytophthora-diaprepes complex via greenhouse screening. Proc Fla State Hortic … 103–109
Grosser JW (2017) Citrus rootstock named “UFR-4.”
Grosser JW, Barthe GA (2015) Soil applied controlled release fertilizer (CRF) treatments impact the health and growth of HLB infected trees - results from greenhouse and field experiments. Int. Res. Conf. HLB IV
Grosser JW, Barthe GA, Castle B, Gmitter FG, Lee O (2015) The development of improved tetraploid citrus rootstocks to facilitate advanced production systems and sustainable citriculture in Florida. Acta Hortic 1065: 319–328
Grosser JW, Calovic M, Gmitter FG (2012) In vitro breeding facilitates conventional breeding for scion and rootstock improvement in citrus. Acta Hortic 961: 27–34
Grosser JW, Gmitter FG (1990) Somatic hybridization of citrus with wild relatives for germplasm enhancement and cultivar development. HortScience 25: 147–151
Grosser JW, Gmitter FG (2011) Protoplast fusion for production of tetraploids and triploids: Applications for scion and rootstock breeding in citrus. Plant Cell Tissue Organ Cult 104: 343–357
Grosser JW, Gmitter FG, Castle WS (2016) Breeding citrus rootstocks to mitigate Huanglongbing (HLB, or citrus greening disease). Acta Hortic 1127: 83–88
191
Grosser JW, Gmitter FG, Sesto F (1992) Six new somatic citrus hybrids and their potential for cultivar improvement. J Am Soc Hortic Sci 117: 169–173
Grosser JW, Graham JH, CM M, A H, HM R, DB B, Chandler JL (2003) Development of “Tetrazyg” rootstocks tolerant of the Diaprepes/Phytophthora complex under greenhouse conditions. Proc Fla State Hort Soc 116: 262–267
Grosser JW, Mourao-Fo FAA, Gmitter FG, Louzada ES, Jiang J, Baergen K, Quiros A, Cabasson C, Schell JL, Chandler JL (1996) Allotetraploid hybrids between citrus and seven related genera produced by somatic hybridization. Theor Appl Genet 92: 577–582
Grosser JW, Ollitrault P, Olivares-Fuster O (2000) Somatic hybridization in citrus: An effective tool to facilitate variety improvement. Vitr Cell Dev Biol - Plant 36: 434–449
Großkinsky DK, Edelsbrunner K, Pfeifhofer H, van der Graaff E, Roitsch T (2013) Cis- and trans-zeatin differentially modulate plant immunity. Plant Signal Behav 8: e24798
Grubb CD, Abel S (2006) Glucosinolate metabolism and its control. Trends Plant Sci 11: 89–100
Guo WW, Prasad D, Serrano P, Gmitter FG, Grosser JW (2004) Citrus somatic hybridization with potential for direct tetraploid scion cultivar development. J Hortic Sci Biotechnol 79: 400–405
Guo WW, Xiao SX, Deng XX (2013) Somatic cybrid production via protoplast fusion for citrus improvement. Sci Hortic (Amsterdam) 163: 20–26
Gupta AS, Webb RP, Holaday AS, Allen RD (1993) Overexpression of superoxide dismutase protects plants from oxidative stress (induction of ascorbate peroxidase in superoxide dismutase-overexpressing plants). Plant Physiol 103: 1067–1073
Halbert S (2005) The discovery of huanglongbing in Florida. Proc. Second Int. Citrus Canker Huanglongbing Res. Work. Orlando, Florida, p 50
Hänsch R, Mendel RR (2009) Physiological functions of mineral micronutrients (Cu, Zn, Mn, Fe, Ni, Mo, B, Cl). Curr Opin Plant Biol 12: 259–266
Hass ARC (1945) Boron in citrus trees. Plant Physiol 20: 323–343
Havlin JL, Tisdale SL, Nelson WL, Beaton JD (2005) Soil fertility and fertilizers: An introduction to nutrient management. Pearson prentice hall, New Jersey
Hawkesford MJ, De Kok LJ (2006) Managing sulphur metabolism in plants. Plant, Cell Environ 29: 382–395
192
Hayat S, Ahmad A (2011) Brassinosteroids: a class of plant hormone. doi: 10.1007/978-94-007-0189-2
Hedden P (1993) Modern methods for the quantitative analysis of plant hormones. Annu Rev Plant Physiol Plant Mol Biol 107–129
Hell R (1997) Molecular physiology of plant sulfur metabolism. Planta 202: 138–148
Hepler PK (2005) Calcium: a central regulator of plant growth and development. Plant Cell 17: 2142–2155
Hesse H, Hoefgen R (2003) Molecular aspects of methionine biosynthesis. Trends Plant Sci 8: 259–262
Hewitt EJ (1948) Relation of manganese and some other metals to the iron status of plants. Nature 161: 489–490
History of Florida citrus timeline (2000) History of Florida citrus timeline. Florida Grow 29
Hohmann-Marriot MF, Blakenship RE (2011) Evolution of photosynthesis. Annu Rev Plant Biol 62: 515–548
Hu J, Jiang J, Wang N (2018) Control of citrus huanglongbing via trunk Injection of plant defense activators and antibiotics. Phytopathology 108: 186–195
Hu MJ, Guo YP, Shen YG, Guo DP, Li DY (2009) Midday depression of photosynthesis and effects of mist spray in citrus. Ann Appl Biol 154: 143–155
Huber DM, Haneklaus S (2007) Managing nutrition to control plant disease. Landbauforsch Volkenrode 57: 313–322
Huber DM, Jones JB (2012) The role of magnesium in plant disease. Plant Soil 368: 73–85
Huot B, Yao J, Montgomery BL, He SY (2014) Growth–defense tradeoffs in plants: a balancing act to optimize fitness. Mol Plant 7: 1267–1287
Hutchison D (1974) Swingle Citrumelo—A promising rootstock hybrid. Proc Florida State Hortic Soc 87: 89–91
Ilyas A, Ashraf MY, Hussain M, Ashraf M, Ahmed R, Kamal ALI (2015) Effect of micronutrients (Zn, Cu and B ) on photosynthetic and fruit yield attributes of Citrus reticulata. 47: 1241–1247
Islam a. KMS, Edwards DG, Asher CJ (1980) pH optima for crop growth. Plant Soil 54: 339–357
193
Jacobs DF, Timmer VR (2005) Fertilizer-induced changes in rhizosphere electrical conductivity: Relation to forest tree seedling root system growth and function. New For 30: 147–166
Jacoby R, Peukert M, Succurro A, Koprivova A, Kopriva S (2017) The Role of Soil Microorganisms in Plant Mineral Nutrition—Current Knowledge and Future Directions. Front Plant Sci 8: 1–19
Jagoueix S, Bové J-M, Garnier M (1994) The phloem-limited bacterium of greening disease of citrus is a member of the alpha subdivision.pdf. 379–386
Jain M, Fleites LA, Gabriel DW (2015) Prophage-encoded peroxidase in ‘Candidatus Liberibacter asiaticus’ is a secreted effector that suppresses plant defenses. Mol Plant-Microbe Interact 28: 1330–1337
Jensén P, König T (1982) Development of regulation mechanisms for SO42- influx in spring wheat roots. Physiol Plant 55: 459–464
Johnson EG, Wu J, Bright DB, Graham JH (2014) Association of ‘Candidatus Liberibacter asiaticus’ root infection, but not phloem plugging with root loss on huanglongbing-affected trees prior to appearance of foliar symptoms. Plant Pathol 63: 290–298
Jones JDG, Dangl JL (2006) The plant immune system. Nature 444: 323–329
De Jong W, Mise K, Ahlquist P (1994) The multigenic nature of RNA virus adaptation to plants. Trends Microbiol 2: 29–31
Juan-Blasco M, Qureshi JA, Urbaneja A, Stansly PA (2012) Predatory mite, Amblyseius swirskii (Acari: Phytoseiidae), for biological control of Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Florida Entomol 95: 543–551
Kadyampakeni DM, Morgan KT, Nkedi-Kizza P, Kasozi GN (2015) Nutrient management options for Florida citrus: a review of NPK application and analytical methods. J Plant Nutr 38: 568–583
Kawano T, Furuichi T (2007) Salicylic acid as a defense-related plant hormone. Salicylic Acid A Plant Horm. Springer Netherlands, Dordrecht, pp 277–321
Kende H, Zeevaart JAD (1997) The five “classical” plant hormones. Plant Cell 9:
Kieu NP, Aznar A, Segond D, Rigault M, Simond-Côte E, Kunz C, Soulie MC, Expert D, Dellagi A (2012) Iron deficiency affects plant defence responses and confers resistance to dickeya dadantii and botrytis cinerea. Mol Plant Pathol 13: 816–827
194
Killiny N, Valim MF, Jones SE, Omar AA, Hijaz F, Gmitter FG, Grosser JW (2017) Metabolically speaking: possible reasons behind the tolerance of ‘Sugar Belle’ mandarin hybrid to huanglongbing. Plant Physiol Biochem 116: 36–47
Kim J-S, Sagaram US, Burns JK, Li J-L, Wang N (2009) Response of sweet orange (Citrus sinensis) to “Candidatus Liberibacter asiaticus” infection: microscopy and microarray analyses. Phytopathology 99: 50–57
Knight H, Knight MR (2001) Abiotic stress signalling pathways: specificity and cross-talk. Trends Plant Sci 6: 262–267
Koh EJ, Zhou L, Williams DS, Park J, Ding N, Duan YP, Kang BH (2012) Callose deposition in the phloem plasmodesmata and inhibition of phloem transport in citrus leaves infected with “Candidatus Liberibacter asiaticus.” Protoplasma 249: 687–697
Kumagai LB, LeVesque CS, Blomquist CL, Madishetty K, Guo Y, Woods PW, Rooney-Latham S, Rascoe J, Gallindo T, Schnabel D, et al (2013) First report of Candidatus Liberibacter asiaticus associated with citrus huanglongbing in California. Plant Dis 97: 283–283
Kunta M, Sétamou M, Skaria M, Rascoe JE, Li W, Nakhla MK, da Graça J V. (2012) First report of citrus huanglongbing in Texas. Providence, RI
Labanaukas CK, Jones WW, Embleton TW (1959) Seasonal changes in concentration of micronutrients (Zinc, Copper, Boron, Manganese, and Iron) in leaves of Washington Navel orange. Proc Am Soc Hortic Sci 74: 300–307
Lacombe B, Achard P (2016) Long-distance transport of phytohormones through the plant vascular system. Curr Opin Plant Biol 34: 1–8
Laino P, Russo MP, Guardo M, Reforgiato-Recupero G, Valè G, Cattivelli L, Moliterni VMC (2015) Rootstock-scion interaction affecting citrus response to CTV infection: A proteomic view. Physiol Plant. doi: 10.1111/ppl.12395
Lallement PA, Brouwer B, Keech O, Hecker A, Rouhier N (2014) The still mysterious roles of cysteine-containing glutathione transferases in plants. Front Pharmacol 5 AUG: 1–22
Lenth R (2019) emmeans: Estimated Marginal Means, aka Least-Squares Means.
Leonard CD, Stewart I (1959) Soil application of manganese for citrus. Florida State Hortic. Soc. pp 38–45
Letham DS (1963) Regulators of cell division in plant tissues. New Zeal J Bot 1: 336–350
195
Li L, Zhao Y, McCaig BC, Wingerd BA, Wang J, Whalon ME, Pichersky E, Howe GA (2004) The tomato homolog of CORONATINE-INSENSITIVE1 is required for the maternal control of seed maturation, jasmonate-signaled defense responses, and glandular trichome development. Plant Cell 16: 126–143
Li Q, Chen L-S, Jiang H-X, Tang N, Yang L-T, Lin Z-H, Li Y, Yang G-H (2010a) Effects of manganese-excess on CO2 assimilation, ribulose-1,5-bisphosphate carboxylase/oxygenase, carbohydrates and photosynthetic electron transport of leaves, and antioxidant systems of leaves and roots in Citrus grandis seedlings. BMC Plant Biol 10: 42
Li W, Hartung JS, Levy L (2006) Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. J Microbiol Methods 66: 104–15
Li X, Xie R, Lu Z (2010b) The origin of cultivated citrus as inferred from internal transcribed spacer and chloroplast dna sequence and amplified fragment length polymorphism fingerprints. 135: 341–350
Liu SR, Li WY, Long D, Hu CG, Zhang JZ (2013) Development and characterization of genomic and expressed SSRs in citrus by genome-wide analysis. PLoS One. doi: 10.1371/journal.pone.0075149
van Loon LC, Bakker PAHM, Pieterse CMJ (1998) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36: 453–483
López-Buenfil JA, Ramírez-Pool JA, Ruiz-Medrano R, Montes-Horcasitas M del C, Chavarin-Palacio C, Moya-Hinojosa J, Trujillo-Arriaga FJ, Lira-Carmona R, Xoconostle-Cázares B (2017) Dynamics of huanglongbing-associated bacterium candidatus liberibacter asiaticus in citrus aurantifolia Swingle (Mexican lime). Pakistan J Biol Sci 20: 113–123
López-Millán AF, Ellis DR, Grusak MA (2005) Effect of zinc and manganese supply on the activities of superoxide dismutase and carbonic anhydrase in Medicago truncatula wild type and raz mutant plants. Plant Sci 168: 1015–1022
Lor VS, Olszewski NE (2015) GA signalling and cross-talk with other signalling pathways. Essays Biochem 58: 49–60
Lorenzo O, Piqueras R, Sánchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 15: 165–178
Louzada ES, Grosser JW, Gmitter FG (1993) Intergeneric somatic hybridization of sexually incompatible parents: Citrus sinensis and Atalantia ceylanica. Plant Cell Rep 12: 687–690
196
Luna E, Pastor V, Robert J, Flors V, Mauch-Mani B, Ton J (2011) Callose deposition: a multifaceted plant defense response. Mol Plant Microbe Interact 24: 183–193
Maeda H, Dudareva N (2012) The Shikimate pathway and aromatic amino acid biosynthesis in plants. Annu Rev Plant Biol 63: 73–105
Mafra V, Martins PK, Francisco CS, Ribeiro-Alves M, Freitas-Astúa J, Machado M a (2013) Candidatus Liberibacter americanus induces significant reprogramming of the transcriptome of the susceptible citrus genotype. BMC Genomics 14: 247
Malamy J, Carr JP, Klessig DF, Raskin I (1990) Salicylic acid: a likely endogenous signal in the resistance response of Tobacco to viral infection. Science (80- ) 250: 1002–1004
Marschner H (1995) Mineral nutrition of higher plants. Academic Press, London
Marschner H (1991) Mechanisms of adaptation of plants to acid soils. Plant Soil 134: 1–20
Martinelli F, Dandekar AM (2017) Genetic mechanisms of the devious intruder Candidatus Liberibacter in citrus. Front Plant Sci. doi: 10.3389/fpls.2017.00904
Martinelli F, Reagan RL, Dolan D, Fileccia V, Dandekar AM (2016) Proteomic analysis highlights the role of detoxification pathways in increased tolerance to Huanglongbing disease. BMC Plant Biol 16: 1–14
Martinelli F, Reagan RL, Uratsu SL, Phu ML, Albrecht U, Zhao W, Davis CE, Bowman KD, Dandekar AM (2013) Gene regulatory networks elucidating huanglongbing disease mechanisms. PLoS One 8: e74256
Martinelli F, Uratsu SL, Albrecht U, Reagan RL, Phu ML, Britton M, Buffalo V, Fass J, Leicht E, Zhao W, et al (2012) Transcriptome profiling of citrus fruit response to huanglongbing disease. PLoS One. doi: 10.1371/journal.pone.0038039
Medina-Urrutia V, Madera KFL, Serrano P, Ananthakrishnan G, Grosser JW, Guo W (2004) New intergeneric somatic hybrids combining Amblycarpa mandarin with six trifoliate/trifoliate hybrid selections for lime rootstock improvement. HortScience 39: 355–360
de Mendiburu F (2019) agricolae: Statistical Procedures for Agricultural Research.
Mendum M Lou, Gupta SC, Goldsbrough PB (1990) Effect of glutathione on phytochelatin synthesis in tomato cells. Plant Physiol 93: 484–488
Mesquita GL, Zambrosi FCB, Tanaka FAO, Boaretto RM, Quaggio JA, Ribeiro R V., Mattos D (2016) Anatomical and physiological responses of citrus trees to varying boron availability are dependent on rootstock. Front Plant Sci 7: 1–12
197
Miles GP, Stover E, Ramadugu C, Keremane ML, Lee RF (2017) Apparent tolerance to huanglonging in citrus and citrus-related germplasm. HortScience 52: 31–39
Millaleo R, Reyes- Diaz M, Ivanov A., Mora M., Alberdi M (2010) Manganese as essential and toxic element for plants: transport, accumulation and resistance mechanisms. J soil Sci plant Nutr 10: 470–481
Miller CO, Skoog F, Saltza MH Von, Strong FM (1955) Kinetin, a cell division factor from deoxyribonucleic acid. J Amer Ghent Soc 77: 1392
Mirsoleimani A, Shahsavar AR, Kholdebarin B (2014) Seasonal changes of mineral nutrient concentrations of leaves and stems of “Kinnow” mandarin trees in relation to alternate bearing. Int J Fruit Sci 14: 117–132
Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci 7: 405–410
Moore TC (1979) Biochemistry and physiology of plant hormones, 1st ed. Springer-Verlag, New York
Morgan KT, Rouse RE, Ebel RC (2017) Foliar applications of essential nutrients on growth and yield of ‘Valencia’ sweet orange infected with huanglongbing. HortScience. doi: 10.21273/hortsci11026-16
Mortvedt JJ (1994) Needs for controlled-availability micronutrient fertilizers. Fertil Res 38: 213–221
Mudge K, Janick J, Scofield S, Goldschmidt EE (2009) A history of grafting. Hortic Rev (Am Soc Hortic Sci) 35: 437–493
Müller M, Munné-Bosch S (2011) Rapid and sensitive hormonal profiling of complex plant samples by liquid chromatography coupled to electrospray ionization tandem mass spectrometry. Plant Methods 7: 37
Mur L a J, Kenton P, Atzorn R, Miersch O, Wasternack C (2006) The outcomes of concentration-specific interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol 140: 249–262
Murata MM, Omar AA, Mou Z, Chase CD, Grosser JW, Graham JH (2019) Novel plastid-nuclear genome combinations enhance resistance to citrus canker in cybrid grapefruit. Front Plant Sci 9: 1–13
Navarro JM, Andujar S, Garcia-Olmos B, Rodriguez-Morán M, Pérez-Tornero O, Morte A (2011) Arbuscular mycorrhizal fungi influence the response of citrus rootstock seedlings to salinity. Acta Hortic 922: 245–252
198
Navarro L, Bari R, Achard P, Lisón P, Nemri A, Harberd NP, Jones JDG (2008) DELLAs control plant immune responses by modulating the balance of jasmonic acid and salicylic acid signaling. Curr Biol 18: 650–655
Nguyen MN, Lukaszewsk KM, Blevins DG (1993) IAA oxidase activity in squash root may be regulated by boron and manganese interaction. Plant Physiol 102: S.7
Nwugo CC, Duan Y, Lin H (2013a) Study on citrus response to Huanglongbing highlights a down-regulation of defense-related proteins in lemon plants upon “Ca. Liberibacter asiaticus” Infection. PLoS One 8: 1–13
Nwugo CC, Lin H, Duan Y, Civerolo EL (2013b) The effect of “Candidatus Liberibacter asiaticus” infection on the proteomic profiles and nutritional status of pre-symptomatic and symptomatic grapefruit (Citrus paradisi) plants. BMC Plant Biol 13: 59
Obreza TA, Rouse R, Hanlon EA (2006) Advancements with controlled-release fertilizers for Florida citrus production : 1996 -2006. SL-243. Univ. Florida Inst. Food Agric. Sci.
Obreza TA, Sartain JB (2010) Improving nitrogen and phosphorus fertilizer use efficiency for Florida’s horticultural crops. Horttechnology 20: 23–33
Ohme-Takagi M, Suzuki K, Shinshi H (2000) Regulation of ethylene-induced transcription of defense genes. Plant Cell Physiol 41: 1187–1192
Omar AA, Murata M, Yu Q, Gmitter FG, Chase CD, Graham JH, Grosser JW (2017) Production of three new grapefruit cybrids with potential for improved citrus canker resistance. Vitr Cell Dev Biol - Plant 53: 256–269
Pandey N, Verma P (2017) Boron deficiency and toxicity and their tolerance in plants : a review. J Glob Biosci 6: 4958–4965
Papadakis IE, Giannakoula A, Therios IN, Bosabalidis AM, Moustakas M, Nastou A (2007) Mn-induced changes in leaf structure and chloroplast ultrastructure of Citrus volkameriana (L.) plants. J Plant Physiol 164: 100–103
Pauwels L, Morreel K, Witte E De, Lammertyn F, Montagu M Van, Boerjan W, Inze D, Goossens A (2008) Mapping methyl jasmonate-mediated transcriptional reprogramming of metabolism and cell cycle progression in cultured Arabidopsis cells. PNAS 105: 1380–1385
Pieterse CMJ, Van der Does D, Zamioudis C, Leon-Reyes A, Van Wees SCM (2012) Hormonal Modulation of Plant Immunity. Annu Rev Cell Dev Biol 28: 489–521
Pieterse CMJ, Leon-Reyes A, Van der Ent S, Van Wees SCM (2009) Networking by small-molecule hormones in plant immunity. Nat Chem Biol 5: 308–316
199
Pietersen G, Arrebola E, Breytenbach JHJ, Korsten L, le Roux HF, la Grange H, Lopes SA, Meyer JB, Pretorius MC, Schwerdtfeger M, et al (2010) A survey for ‘Candidatus Liberibacter’ species in south Africa confirms the presence of only ‘ Ca. L. africanus’ in commercial citrus. Plant Dis 94: 244–249
Pitino M, Armstrong CM, Duan Y (2017) Molecular mechanisms behind the accumulation of ATP and H2O2 in citrus plants in response to ‘Candidatus Liberibacter asiaticus’ infection. Hortic Res 4: 17040
Pittman JK (2005) Managing the manganese: molecular mechanisms of manganese transport and homeostasis. New Phytol 167: 733–742
Qamar-uz-Zaman, Schumann AW (2006) Nutrient management zones for citrus based on variation in soil properties and tree performance. Precis Agric 7: 45–63
Qureshi JA, Kostyk BC, Stansly PA (2014) Insecticidal suppression of asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae) vector of huanglongbing pathogens. PLoS One 9: 1–22
R Core Team (2018) R: A language and environment for statistical computing.
Rainey PB (1999) Adaptation of Pseudomonas fluorescens to the plant rhizosphere. Environ Microbiol 1: 243–257
Ramadi S, Kannan S (1974) Effects of certain cations on Manganese absorption by excised rice roots. Commun Soil Sci Plant Anal 435–439
Ravet K, Pilon M (2013) Copper and iron homeostasis in plants: the challenges of oxidative stress. Antioxid Redox Signal 19: 919–932
Rawat N, Kiran SP, Du D, Gmitter FG, Deng Z (2015) Comprehensive meta-analysis, co-expression, and miRNA nested network analysis identifies gene candidates in citrus against Huanglongbing disease. BMC Plant Biol 15: 184
Razi MFUD, Khan I a., Jaskani MJ (2011) Citrus plant nutritional profile in relation to Huanglongbing prevalence in Pakistan. Pakistan J Agric Sci 48: 299–304
Reuther W, Webber HJ (1967) The Citrus industry. University of California, Division of Agricultural Sciences, [Berkeley]
Ribeiro R V., Machado EC (2007) Some aspects of citrus ecophysiology in subtropical climates: Re-visiting photosynthesis under natural conditions. Brazilian J Plant Physiol 19: 393–411
Rivas-San Vicente M, Plasencia J (2011) Salicylic acid beyond defence: its role in plant growth and development. J Exp Bot 62: 3321–3338
200
Robert-Seilaniantz A, Grant M, Jones JDG (2011) Hormone crosstalk in plant disease and defense: more than just jasmonate-salicylate antagonism. Annu Rev Phytopathol 49: 317–343
Rosales R, Burns JK (2011) Phytohormone changes and carbohydrate status in sweet orange fruit from huanglongbing-infected trees. J Plant Growth Regul 30: 312–321
Rouse R (2013) Rehabilitation of HLB infected citrus trees using severe pruning and nutritional sprays. Proc. Florida State Horicultural Sci. pp 51–54
Rouse RE, Ozores-Hampton M, Roka FM, Roberts P (2017) Rehabilitation of Huanglongbing-affected citrus trees using severe pruning and enhanced foliar nutritional treatments. HortScience. doi: 10.21273/hortsci11105-16
Rubio V, Bustos R, Irigoyen ML, Cardona-López X, Rojas-Triana M, Paz-Ares J (2009) Plant hormones and nutrient signaling. Plant Mol Biol 69: 361–373
Rucker B, Gannon M (2007) The new history of Florida. J South Hist 63: 456
Saito K (2004) Sulfur assimilatory metabolism. The long and smelling road. Plant Physiol 136: 2443–2450
Samet H, Cikili Y, Dursun S (2015) The role of potassium in alleviating boron toxicity and combined effects on nutrient contents in pepper (Capsicum annuum L.). Bulg J Agric Sci 21: 64–70
Satpute A (2017) Differential effect of improved citrus rootstocks and nutrition on gene expression in Candidatus Liberibacter asiaticus (CaLas) - infected “Valencia” sweet orange trees. University of Florida
Sattelmacher B, Gerendds J, Thoms K, Marumoto T, Anderson JPE, Domsch KH (1982) Mineralization of nutrients from soil microbial biomass. Soil Biol Biochem 33: 469–475
Sauer AV, Zanutto CA, Nocchi PTR, Machado MA, Bock CH, Nunes WMC (2015) Seasonal variation in populations of ‘ Candidatus Liberibacter asiaticus’ in citrus trees in Paraná state, Brazil. Plant Dis 99: 1125–1132
Schmülling T, Schäfer S, Romanov G (1997) Cytokinins as regulators of gene expression. Physiol Plant 100: 505–519
Scora RW (1975) On the history and origin of citrus. Bull Torrey Bot Club 102: 369–375
Shan C, Liang Z (2010) Jasmonic acid regulates ascorbate and glutathione metabolism in Agropyron cristatum leaves under water stress. Plant Sci 178: 130–139
201
Sharkey TD (1985) Photosynthesis in intact leaves of C3 plants: Physics, Physiology and Rate Limitations. Bot Rev 51: 53–105
Shen W, Cevallos-Cevallos JM, Nunes da Rocha U, Arevalo HA, Stansly PA, Roberts PD, van Bruggen AHC (2013) Relation between plant nutrition, hormones, insecticide applications, bacterial endophytes, and Candidatus Liberibacter Ct values in citrus trees infected with Huanglongbing. Eur J Plant Pathol 137: 727–742
Sheng O, Zhou G, Wei Q, Peng S, Deng I (2010) Effects of excess boron on growth, gas exchange, and boron status of four orange scion-rootstock combinations. J Plant Nutr Soil Sci 173: 469–476
Shigenaga AM, Argueso CT (2016) No hormone to rule them all: Interactions of plant hormones during the responses of plants to pathogens. Semin Cell Dev Biol 56: 174–189
Singaram P, Prabha K (1997) Calcium boron interaction studies in tomato grown in a calcareous soil. In T Ando, ed, Plant Nutr. Sustain. Food Prod. Environ. Kluwer Academic, Dordrecht, The Netherlands, pp 640–650
Soliman MF, Kostandi SF, van Beusichem ML (1992) Influence of sulfur and nitrogen fertilzer on the uptake of iron, manganese, and zinc by corn plants grown in calcareous soil. Commun Soil Sci Plant Anal 23: 1289–1300
Spann TM, Schumann AW (2009) The role of plant nutrients in disease development with emphasis on citrus and huanglongbing. Proc Florida State Horicultural Sci 122: 169–171
Spiegel-Roy P, Goldschmidt EE (1996) Biology of Citrus. doi: 10.1017/CBO9780511600548
Spoel SH, Dong X (2008) Making sense of hormone crosstalk during plant immune responses. Cell Host Microbe 3: 348–351
Steffens B, Wang J, Sauter M (2006) Interactions between ethylene, gibberellin and abscisic acid regulate emergence and growth rate of adventitious roots in deepwater rice. Planta 223: 604–612
Stephan UW, Schmidke I, Stephan VW, Scholz G (1996) The nicotianamine molecule is made-to-measure for complexation of metal micronutrients in plants. BioMetals 9: 84–90
Stover E, Inch S, Richardson ML, Hall DG (2016) Conventional citrus of some scion/tolerance under high huanglongbing disease pressure. HortScience 51: 127–132
202
Tabay Zambon F, Kadyampakeni DM, Grosser JW (2019) Ground application of overdoses of manganese have a therapeutic effect on sweet orange trees infected with Candidatus Liberibacter asiaticus. HortScience 54: 1077–1086
Tabay Zambon F, Plant K, Etxeberria E (2017) Leaf-disc grafting for the transmission of Candidatus Liberibacter Asiaticus in citrus (Citrus sinensis ; Rutaceae) seedlings. Appl Plant Sci 5: 1600085
Talon M, Gmitter FG (2008) Citrus genomics. Int J Plant Genomics 2008: 528361
Tariq M, Mott CJB (2007) Effect of boron on the behavior of nutrients in soil-plant systems - A review. Asian J Plant Sci 6: 195–202
Taylor BK, Dimsey RT (1993) Rootstock and scion effects on the leaf nutrient composition of citrus trees. Aust J Exp Agric 33: 363–371
Taylor PJ (2005) Matrix effects: The Achilles heel of quantitative high-performance liquid chromatography-electrospray-tandem mass spectrometry. Clin Biochem 38: 328–334
Texeira DC, Ayres J, Kitajima EW, Danet L, Jagoueix-Eveillard S, Saillard C, Bové JM (2005) First report of a huanglongbing-like disease of citrus in Sao Paulo state, Brazil and association of a new Liberibacter species, "Candidatus Liberibacter americanus”, with the disease. Plant Dis 89: 107–107
Tobergte DR, Curtis S (2016) Costs and benefits of insecticide and foliar nutrient applications to HLB-infected citrus trees. J Chem Inf Model 53: 1689–1699
Torres MA (2010) ROS in biotic interactions. Physiol Plant 138: 414–429
USDA-NASS (2019) Florida citrus statistics 2017-2018. Tallahassee, FL
USDA-NASS (2017) Statistics of fruits, tree nuts, and horticultural specialties. Agric. Stat. 2017
USDA (2017) Quarantined areas; citrus greening and Asian Citrus Psyllid.
Vankova R, Kaminek M, Eder J, Vanek T (1987) Dynamics of production of trans-Zeatin and trans-Zeatin Riboside by immobilized cytokinin-autonomous and cytokinin-dependent Tobacco cells. J Plant Growth Regul 6: 147–157
Waldie T, McCulloch H, Leyser O (2014) Strigolactones and the control of plant development: Lessons from shoot branching. Plant J 79: 607–622
Wang Y, Zhou L, Yu X, Stover E, Luo F, Duan Y (2016) Transcriptome profiling of huanglongbing (HLB) tolerant and susceptible citrus plants reveals the role of basal resistance in HLB tolerance. Front Plant Sci 7: 1–13
203
Wang Z, Yin Y, Hu H, Yuan Q, Peng G, Xia Y (2006) Development and application of molecular-based diagnosis for “Candidatus Liberibacter asiaticus”, the causal pathogen of citrus huanglongbing. Plant Pathol 55: 630–638
Warden BT, Reisenauer HM (1991) Manganese-iron interactions in the plant-soil system. J Plant Nutr 14: 7–30
Webber HJ, Batchelor LD (1943) The citrus industry. Vol. I. History, botany and breeding. University of California Press, Berkeley and Los Angeles
Wedderburn RWM (1974) Quasi-likelihood functions, generalized linear models, and the Gauss—Newton method. Biometrika 61: 439–477
van Wees SC, de Swart E a, van Pelt J a, van Loon LC, Pieterse CM (2000) Enhancement of induced disease resistance by simultaneous activation of salicylate- and jasmonate-dependent defense pathways in Arabidopsis thaliana. Proc Natl Acad Sci U S A 97: 8711–8716
Weiler EW (1984) Immunoassay of plant growth regulators. Ann Rev Plant Physiol 35: 85–95
Xia Y, Ouyang G, Sequeira R a., Sequeira R, Sequeira Y, Baez I, Chen J (2011) A Review of Huanglongbing (citrus greening) management in citrus using nutritional approaches in China. Plant Heal Prog. doi: 10.1094/PHP-2010-1003-01-RV
Yan Y, Stolz S, Chételat A, Reymond P, Pagni M, Dubugnon L, Farmer EE (2007) A downstream mediator in the growth repression limb of the jasmonate pathway. Plant Cell 19: 2470–2483
Yang C, Powell CA, Duan Y, Shatters RG, Lin Y, Zhang M (2016) Mitigating citrus huanglongbing via effective application of antimicrobial compounds and thermotherapy. Crop Prot 84: 150–158
Yasin Ashraf M, Ashraf M, Akhtar M, Mahmood K, Saleem M (2013) Improvement in yield, quality and reduction in fruit drop in Kinnow (Citrus reticulata Blanco) by exogenous application of plant growth regulators, potassium and zinc. Pakistan J Bot 45: 433–440
Yruela I (2009) Copper in plants: acquisition, transport and interactions. Funct Plant Biol 36: 409
Zaka SM, Zeng XN, Holford P, Beattie GAC (2010) Repellent effect of guava leaf volatiles on settlement of adults of citrus psylla, Diaphorina citri Kuwayama, on citrus. Insect Sci 17: 39–45
Zekri M, Koo RCJ (1992) Use of controlled-release fertilizers for young citrus trees. Sci Hortic (Amsterdam) 49: 233–241
204
Zekri M, Obreza T (2013) Calcium (Ca) and sulfur (S) for citrus trees - SL382. Univ Florida Inst Food Agric Sci 1–5
Zekri M, Parsons LR (1992) Salinity tolerance of citrus rootstocks: Effects of salt on root and leaf mineral concentrations. Plant Soil 147: 171–181
Zhang D, Xia R, Cao X, Shu B, Chen C (2013) Root hair development of Poncirus trifoliata grown in different growth cultures and treated with 3-indolebutyric acid and ethephon. Sci Hortic (Amsterdam) 160: 389–397
Zhang M, Guo Y, Powell CA, Doud MS, Yang C, Duan Y (2014) Effective antibiotics against “Candidatus Liberibacter asiaticus” in HLB-affected citrus plants identified via the graft-based evaluation. PLoS One 9: 17–21
Zhong Y, Cheng CZ, Jiang NH, Jiang B, Zhang YY, Wu B, Hu ML, Zeng JW, Yan HX, Yi GJ, et al (2015) Comparative transcriptome and iTRAQ proteome analyses of citrus root responses to candidatus liberibacter asiaticus infection. PLoS One 10: 1–21
Zolman BK, Martinez N, Millius A, Adham AR, Bartel B (2008) Identification and characterization of Arabidopsis indole-3-butyric acid response mutants defective in novel peroxisomal enzymes. Genetics 180: 237–251
Zou H, Gowda S, Zhou L, Hajeri S, Chen G, Duan Y (2012) The destructive citrus pathogen, “Candidatus Liberibacter asiaticus” encodes a functional flagellin characteristic of a pathogen-associated molecular pattern. PLoS One. doi: 10.1371/journal.pone.0046447
(2019) Dictionary by Merriam-Webster. https://www.merriam-webster.com/
205
BIOGRAPHICAL SKETCH
Flavia Tabay Zambon was born in Piracicaba, a city two and half hours from the
capital of the state, Sao Paulo City. In 2013, she obtained her baccalaureate degree in
Agricultural Engineering and her license to teach agricultural sciences from the
prestigious Luiz de Queiroz College of Agriculture – University of Sao Paulo (ESALQ-
USP), Piracicaba, Brazil. For six months, Flavia taught two agricultural courses
concomitantly at a technical school in Limeira (Sao Paulo state). In the spring of 2014,
Flavia was admitted to the Ph.D. program at the Horticultural Science Department at
University of Florida. She received her Ph.D. in Horticultural Sciences from University of
Florida in the spring of 2020.
