Roles and molecular mechanisms of antimicrobial efflux

Graduate Theses and Dissertations Iowa State University Capstones, Theses andDissertations

2012

Roles and molecular mechanisms of antimicrobialefflux systems in facilitating the adaptation ofCampylobacter jejuni to various environmentsZhangqi ShenIowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd

Part of the Animal Diseases Commons, Genetics Commons, and the Microbiology Commons

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State UniversityDigital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State UniversityDigital Repository. For more information, please contact [email protected].

Recommended CitationShen, Zhangqi, "Roles and molecular mechanisms of antimicrobial efflux systems in facilitating the adaptation of Campylobacter jejunito various environments" (2012). Graduate Theses and Dissertations. 12456.https://lib.dr.iastate.edu/etd/12456

http://lib.dr.iastate.edu/?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

http://lib.dr.iastate.edu/?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

https://lib.dr.iastate.edu/etd?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

https://lib.dr.iastate.edu/theses?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

https://lib.dr.iastate.edu/theses?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

https://lib.dr.iastate.edu/etd?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/918?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages



https://lib.dr.iastate.edu/etd/12456?utm_source=lib.dr.iastate.edu%2Fetd%2F12456&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

Roles and molecular mechanisms of antimicrobial efflux systems in facilitating the

adaptation of Campylobacter jejuni to various environments

by

Zhangqi Shen

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Genetics

Program of Study Committee:

Qijing Zhang, Major Professor

Cathy L. Miller

F. Chris Minion

Edward Yu

Lisa K. Nolan

Iowa State University

Ames, Iowa

2012

Copyright © Zhangqi Shen, 2012. All rights reserved.

ii

DEDICATIONS

To

my wife, Na Liu:

for her encouragement and patience.

To

my parents and Uncle Shen:

for their understanding and support.

iii

TABLE OF CONTENTS

LIST OF TABLES v

LIST OF FIGURES vi

CHAPTER 1. GENERAL INTRODUCTION 1

CHAPTER 2. LITERATURE REVIEW OF MULTIDRUG EFFLUX

TRANSPORTERS IN CAMPYLOBACTER 4

Introduction 4

CmeABC 5

CmeR 9

CmeDEF 12

CmeG 15

Acr3 16

Targeting efflux mechanisms to control Campylobacter 18

Conclusions and future directions 20

References 21

CHAPTER 3. SALICYLATE FUNCTIONS AS AN EFFLUX PUMP INDUCER

AND PROMOTES THE EMERGENCE OF FLUOROQUINOLONE-RESISTANT

CAMPYLOBACTER JEJUNI MUTANTS 33

Abstract 33

Introduction 34

Materials and Methods 36

Results 40

Discussion 48

Acknowlegments 53

iv

Author Contributions 53

Rreferences 53

CHAPTER 4. IDENTIFICATION OF A MEMBRANE TRANSPORTER

INVOLVED IN ARSENIC RESISTANCE IN CAMPYLOBACTER JEJUNI 59

Abstract 59

Introduction 60


Results 69

Discussion 75


References 80

CHAPTER 5. IDENTIFICATION OF A NOVEL MEMBRANE TRANSPORTER

MEDIATING RESISTANCE TO ORGANIC ARSENIC IN CAMPYLOBACTER

JEJUNI 87

Abstract 87

Introduction 88


Results 95

Discussion 105


References 109

CHAPTER 6. SUMMARY 115

ACKNOWLEDGEMENTS 117

v

LIST OF TABLES

CHAPTER 3

Table 1. Bacterial plasmids and strains used in this study 37

Table 2. Frequencies of emergence of fluoroquinolone-resistant C. jejuni mutants

under different selection pressures 47

CHAPTER 4

Table 1. Bacterial strains and plasmids used in this study 63

Table 2. PCR primers used in this study 65

Table 3. The MICs of roxarsone, arsenite and arsenate in various C. jejuni strains as

determined by the agar dilution method 73

Table 4. Distribution of arsB and acr3 in C. jejuni isolates of different origins 75

CHAPTER 5

Table 1. Key plasmids and bacterial strains used in this study 91

Table 2. Key primers used in this study 92

Table 3. Roxarsone MIC distributions in C. jejuni isolates of different origins 96

Table 4. Arsenite MIC distributions in C. jejuni isolates of different origins 96

Table 5. Arsenate MIC distributions in C. jejuni isolates of different origins 96

Table 6. The MICs of roxarsone, arsenite, and arsenate in various C. jejuni constructs 103

Table 7. Presence of arsP detected by PCR and its association with elevated

resistance to roxarsone 104

vi

LIST OF FIGURES

CHAPTER 3

Figure 1. Effects of salicylate on the growth of C. jejuni 11168 in the presence of

various antibiotics 41

Figure 2. Induction of the cmeABC operon in C. jejuni 11168 by salicylate. 43

Figure 3. Immunoblotting analysis of CmeA, CmeB, CmeC, Cj0561c, and MOMP

production in NCTC 11168 44

Figure 4. Effects of salicylate, taurocholate, and ampicillin on the formation of

CmeR-DNA complexes as determined by EMSA 45

Figure 5. Induction of cj0561c in C. jejuni 11168 by salicylate 46

Figure 6. Diagram depicting the molecular basis of salicylate-mediated induction of

CmeABC and Cj0561c 50

CHAPTER 4

Figure 1. The membrane topologies of ArsB predicted by TMHMM 70

Figure 2. Diagrams showing the genomic localizations and mutant generation of

various ars genes 71

Figure 3. Dose-dependent induction of arsB in 11168 by arsenite and arsenate 74

CHAPTER 5

Figure 1. Diagrams showing the genomic organization of arsP and cloning of the ars

genes into C. jejuni 11168 97

Figure 2. The membrane topologies of ArsP predicted by TMHMM 98

Figure 3. Sequence alignment of ArsP homologs in various bacterial species using

ClustalW 101

vii

Figure 4. Intracellular accumulation of roxarsone 105

Figure 5. Diagram illustrating the currently known arsenical detoxification

mechanisms in Campylobacter 106

1

CHAPTER 1. GENERAL INTRODUCTION

Introduction

Campylobacter jejuni is the leading bacterial cause of foodborne diseases in the

United States and other developed countries. As a zoonotic pathogen, C. jejuni is well

adapted in the food production environments, is prevalent in food producing animals, and

is transmitted to humans via unpasteurized milk, contaminated water, and undercooked

poultry meat. The extensive use of antibiotics for animal production and human medicine

has resulted in increasing prevalence of antibiotic resistant Campylobacter. Previously it

was shown that antimicrobial efflux transporters, such as CmeABC, play key roles in

both the intrinsic and acquired resistance to structurally diverse antimicrobials. However,

the roles of antimicrobial efflux systems in facilitating Campylobacter adaptation to

various environments and the associated molecular mechanisms remain to be determined.

In this project, we determined the role of salicylate-induced overexpression of cmeABC

in promoting the emergence of fluoroquinlone-resistant mutants in C. jejuni and

identified two new efflux transporters that are involved in Campylobacter resistance to

arsenic compounds. The entire project contains three sets of experiments. In the first set

of experiments, the induction of the CmeABC multidrug efflux pump by salicylate,

which is commonly present in medicine and food, was consistently shown by

transcriptional fusion assays, real time quantitative reverse transcription-PCR (RT-PCR),

and immunoblotting. The induction not only decreased the susceptibility of

Campylobacter to ciprofloxacin, but also resulted in an approximately 70-fold increase in

the observed frequency of emergence of fluoroquinolone-resistant mutants under

2

selection with ciprofloxacin. These findings suggest that exposure of C. jejuni to

salicylate could conceivably influence the development of antibiotic resistance in this

pathogenic organism. In the second set of experiments, we determined the role of ArsB, a

putative membrane efflux transporter, in the resistance of C. jejuni to arsenic compounds,

which exist in nature and are used as feed additives in poultry production. Inactivation of

arsB in C. jejuni 11168 resulted in 8- and 4-fold reduction in the MICs of arsenite and

arsenate, respectively, and complementation of the arsB mutant restored the MIC of

arsenite to the wild-type level. Additionally, overexpression of arsB in C. jejuni 11168

resulted in a 16-fold increase in the MIC of arsenite. These results indicate that ArsB is a

key player in mediating the resistance to inorganic arsenic in Campylobacter. In the third

set of experiments, we discovered a novel membrane transporter (named ArsP) that

contributes to Campylobacter resistance to roxarsone, organic arsenic used as an additive

in poultry feed. ArsP is predicted to be a membrane permease containing eight

transmembrane helices, a structural feature distinct from other known arsenic transporters.

Analysis of multiple C. jejuni isolates from various animal species revealed that presence

of arsP is associated with elevated resistance to roxarsone. In addition, inactivation of

arsP in C. jejuni resulted in a 4-fold reduction in the MIC of roxarsone compared to the

wild-type strain. Furthermore, cloning of arsP into a C. jejuni strain lacking a functional

arsP led to 8-fold increase in the MIC of roxarsone. Neither mutation nor overexpression

of arsP affected the MICs of inorganic arsenic including arsenite and arsenate in

Campylobacter. Moreover, acquisition of arsP gene in NCTC 11168 accumulated less

roxarsone than the wild type strain lacking arsP gene. These results indicate that ArsP

functions as an efflux transporter specific for extrusion of roxarsone and contributes to

3

the resistance to organic arsenic in C. jejuni. All together, findings in this project reveal

important roles of antimicrobial efflux transporters in facilitating Campylobacter

adaptation to various environments and provide new insights into the pathobiology of C.

jejuni as a major foodborne pathogen.

Dissertation Organization

This dissertation is organized into six chapters, including a general introduction, a

literature review, three chapters on research for publication, and a final summary.

Chapter 1 is a general introduction for the Ph.D. project. Chapter 2 is a literature review

of multidrug efflux transporters in Campylobacter. Chapter 3 has been published in

Applied and Environmental Microbiology. Chapter 4 and 5 are prepared to be submitted

to ASM journals. Chapter 6 is the summary of this project which includes the general

conclusions and future directions. The references of this dissertation are formatted in the

ASM journal style and are located at the end of chapter 2, 3, 4, and 5. All the tables,

figures, and legends in chapter 3, 4, and 5 are placed as close as possible to the original

text references.

4

CHAPTER 2. LITERATURE REVIEW OF MULTIDRUG EFFLUX

TRANSPORTERS IN CAMPYLOBACTER

Introduction

Campylobacter spp. are Gram-negative organisms that grow best at microaerobic

conditions. Morphologically, Campylobacter cells are spirally curved rods 0.2 to 0.8 µm

wide and 0.5 to 5 µm long. Campylobacter is recognized as a leading bacterial cause of

food-borne diseases in the United States and other developed countries (73) and

Campylobacter infections account for 400 to 500 million cases of diarrhea each year

worldwide (67). A recent CDC report indicated that campylobacteriosis is estimated to

affect over 0.84 million people every year in the United States (69). At present, there are

18 validly named Campylobacter species, including C. canadensis, C. coli, C. concisus,

C. curvus, C. fetus, C. gracilis, C. helveticus, C. hominis, C. hyointestinalis, C.

insulaenigrae, C. jejuni, C. lanienae, C. lari, C. mucosalis, C. rectus, C. showae, C.

sputorum, and C. upsaliensis. According to the published data, C. jejuni and C. coli are

the most common species associated with Campylobacter enteritis in human (20).

Typical symptoms of campylobacteriosis include diarrhea (bloody), fever, headache,

myalgia, nausea, vomiting, and abdominal pain. Usually, campylobacteriosis is self-

limited, and hospitalization and antibiotic treatments are only required in severe cases. In

addition, C. jejuni is the predominant preceding infection for Guillain-Barré syndrome

(GBS), which is the most common form of acute neuromuscular paralysis (32).

C. jejuni and C. coli are increasingly resistant to antimicrobials, which has

become a significant threat to public health (10-11, 14, 25, 35, 47-48, 60, 70, 74, 78). To

5

counteract the selection pressure from antimicrobials, Campylobacter has evolved

multiple mechanisms (77), which include (i) synthesis of enzymes to modify/inactivate

antibiotics (e.g. β-lactamase); (ii) alternation of antibiotic targets (e.g. mutations in gyrA

or 23S rRNA genes); (iii) protection of antibiotic targets (e.g. synthesis of protective

protein TetO); (iv) reduced permeability of cellular membranes to antibiotics; and (v)

active extrusion of antimicrobials out of Campylobacter cells through efflux transporters

(e.g. CmeABC). Campylobacter harbors multiple antibiotic efflux transporters and

several of them have been characterized. In this chapter, we will focus on the new

information concerning the function and regulation of these efflux transporters.

CmeABC

CmeABC is the predominant antibiotic efflux system in C. jejuni and belongs to

the resistance-nodulation-cell division (RND) superfamily of multidrug efflux

transporters. This efflux system is encoded by a three-gene operon including cmeA, cmeB,

and cmeC (41). CmeA is a membrane fusion protein, and its amino acid sequence shows

similarity to the membrane fusion component in other bacterial efflux systems, including

MtrC of Neisseria gonorrhoeae, MexA and MexC of Pseudomonas aeruginosa, and

AcrA of Escherichia coli. CmeB is an inner membrane transporter and exhibits sequence

homology to AcrB, AcrD, and AcrF of E. coli, MexB and MexF of P. aeruginosa, and

AcrB of Salmonella typhi. CmeC is an outer membrane protein and is similar to the

OprM and OprN of P. aeruginosa and TolC of E. coli (41).

Insertional mutation of cmeB in Campylobacter resulted in increased

susceptibility to structurally diverse antimicrobial compounds, including ciprofloxacin,

6

norfloxacin, nalidixic acid, cefotaxime, ampicillin, erythromycin, rifampin, tetracycline,

ethidium bromide, heavy metals(CoCl2 and CuCl2), acridine orange, SDS, tetracycline,

and bile salts (chenodeoxycholic acid, deoxycholic acid, cholic acid, and taurocholic acid)

(41, 58). Similar results were also observed with inactivation of cmeC (42), suggesting

that every component of the CmeABC system is required for conferring antibiotic

resistance. CmeABC functions synergistically with other mechanisms in conferring high-

level resistance to antibiotics. For example, mutation of cmeB resulted in a 8-fold

decrease in the minimum inhibitory concentration (MIC) of tetracycline in the

Campylobacter strains carrying tetracycline resistance gene tet(O) (41, 57); inactivation

of cmeABC in fluoroquinolone-resistant mutants (carrying specific GyrA mutations)

rendered the resistant mutants susceptible to ciprofloxacin and enrofloxacin (49); and the

MICs of erythromycin decreased 8- to 1024-fold upon inactivation of the cmeB gene in

the macrolide-resistant strains that carried the A2075G, A2074G, or A2074C mutation in

the 23S rRNA genes (6-7, 19, 43) or modifications in the L4 and L22 ribosomal proteins

(5). These examples illustrate the important role of CmeABC in the acquired resistance to

clinically important antibiotics such as macrolide and fluoroquinolone. Recent studies

also revealed that CmeABC efflux pump contributes to both intrinsic and acquired

resistance to bacteriocins, antimicrobial peptides produced by bacteria (28-29).

CmeABC efflux pump contributes not only to multidrug resistance but also to the

adaptation of Campylobacter in the intestinal tract of animal hosts. As an enteric

organism, Campylobacter must have the ability to deal with bile compounds, which are

normally present in the digestive system. Bile contains a group of detergent-like bile salts,

which exhibit potent bactericidal activity (22). In vitro susceptibility tests indicate that

7

inactivation of cmeABC resulted in dramatically decreased resistance in Campylobacter

to various bile salts, including cholic acid, chenodeoxycholic acid, taurocholic acid,

deoxycholic acid, dehydrocholic acid, glycocholic acid, taurodeoxyxholic acid, and

choleate (41-42). Additionally, Lin et al. demonstrated that CmeABC plays a critical role

in intestinal colonization of C. jejuni (39, 42). In the chicken model, the cmeABC mutants

failed to colonize any of the inoculated chickens, while complementation of the cmeABC

mutants in trans fully restored the colonization to the level of the wild-type strain (42).

These findings strongly suggest that facilitating adaptation in the intestinal tract is a

natural function of CmeABC.

cmeABC is conserved among different Campylobacter species and is widely

distributed in Campylobacter isolates (23). This efflux system has been functionally

characterized in C. jejuni (41-42, 58), C. coli (6, 18), C. lari, C. fetus, and C.

hyointestinals (23), and contributed to antibiotic resistance in all examined species. In

general, the sequences of cmeABC are highly conserved within a species, but significant

sequence polymorphisms are observed in the cmeABC genes among different

Campylobacter species (3, 16, 23, 54). In addition, analysis of published 8 whole

genomes of C. jejuni indicated that all of them contain the CmeABC efflux systems. The

result of Basic Local Alignment Search Tool (BLAST) against the gene database

indicated that this efflux system is spread widely in C. jejuni and C. coli as well as other

Campylobacter species, such as C. upsaliensis, C. fetus, C. lari, C. venerealis, C. gracilis,

C. showae, and C. rectus. Together, these observations indicate that CmeABC efflux

pump system is conserved at both the genomic and functional levels in different

Campylobacter Spp.

8

The expression of cmeABC is modulated by a transcriptional regulator named

CmeR (37). The cmeR gene (cj0368c) is located immediately upstream of the cmeABC

operon and encodes a 210-amino acid (aa) protein. The N-terminal sequence of CmeR

shows homology with the members of the TetR family of transcriptional repressors,

including QacR of S. aureus, AcrR of E. coli, and MtrR of N. gonorrhoeae (37). Several

studies demonstrated the increased expression of CmeABC in CmeR mutant strains (24,

37). CmeR functions as a repressor for cmeABC. Immunoblotting and transcriptional

fusion demonstrated a significant upregulation of cmeABC in the cmeR mutant

background compared to the wild-type strain (37). Furthermore, microarray and real-time

PCR data confirmed the results from immunoblotting and transcriptional fusion assays

(24). Electrophoretic mobility shift assays (EMSA) demonstrated that purified

recombinant CmeR binds specifically to an intergenic region (IT) between cmeR and

cmeABC (37). Specifically, the 16 bp inverted repeat (IR) sequence,

5’TGTAATAAATATTACA3’, located between cmeR and cmeABC operon, is the

operator site for CmeR binding and the IR is located between the predicted -10 and -35

sequences (37). Mutations in the IR or nearby the IR affect the binding of CmeR to the

promoter of cmeABC, resulting in overexpression of this efflux system (4, 37).

The cmeABC operon is inducible by bile salts and salicylate (39, 72).

Transcriptional fusion assays indicated that presence of various bile salts in culture media

induced the expression of cmeABC by 6- to 16-fold over the basal level of cmeABC

transcription (39). Moreover, a recent study revealed that salicylate functions as an

inducer for cmeABC as well. Presence of salicylate in Mueller-Hinton (MH) culture

resulted in increased expression of cmeABC as demonstrated by immunoblotting,

9

transcriptional fusion assay, and real-time PCR (72). The presence of bile salts or

salicylate did not alter the expression level of CmeR, suggesting that the induction was

via altering the function of CmeR. Indeed, EMSA assay and surface plasmon resonance

showed that the presence of bile salts or salicylate reduced the binding of CmeR to the

DNA of cmeABC promoter (39, 72). Recently, Lei et al. further confirmed the capacity of

CmeR to recognize bile acids using isothermal titration calorimetry and fluorescence

polarization. These findings indicate that certain substrates of CmeABC interact with

CmeR and induce the expression of the CmeABC efflux system.

CmeABC not only contributes to antibiotic resistance, but also affects the

frequency of emergence of fluoroquinolone (FQ) resistant Campylobacter mutants (72,

76). Inactivation of cmeB reduced the frequency of emergence, while overexpression of

cmeABC increased the frequency of emergence of FQ-resistant mutants under antibiotic

selection (72, 76). This is due to the fact that CmeABC functions synergistically with

GyrA mutations in conferring fluoroquinolone resistance. Without the function of

CmeABC, GyrA mutations alone are unable to confer the level of resistance that is

required for the mutants to survive the selection pressure (46, 76).

CmeR

In addition to regulating cmeABC, CmeR functions as a pleiotropic regulator and

modulates the expression of multiple genes in Campylobacter (24). Microarray data

revealed that inactivation of cmeR affected the transcription of at least 28 genes in C.

jejuni. Particularly, CmeR also represses the expression of Cj0035c (a transporter of the

major facilitator superfamily) and Cj0561c (encoding a periplasmic fusion protein). Two

10

CmeR binding sites (IRs) are identified in the promoter region of cj0561c and CmeR

directly controls the expression of Cj0561c (24). Both CmeR and Cj0561c are required

for optimal colonization in vivo as inactivation of either gene reduced the fitness of C.

jejuni in the intestinal tract of chickens.

Recently, the crystal structure of CmeR has been determined by Gu et al. (21).

Similar to other members of the TetR family, CmeR forms a dimeric structure with an

entirely helical architecture. Each subunit of CmeR is composed of ten α helices and

could be divided into two domains: an N-terminal DNA binding domain and a C-terminal

multiligand-binding domain. Distinct from the other members of the TetR family,

including TetR, QacR, CprB, and EthR, the crystal structure of CmeR revealed that the

α3 helix, involved in DNA recognition, was replaced by a random coil. To facilitate the

comparison with the structures of other TetR members, helices of CmeR are numbered

from the N terminus as α1 (7-29), α2 (36-43), α4 (57-81), α5 (88-104), α6 (106-118), α7

(a(125-136) and b(138-148)), α8 (152-170), α9 (172-180), and α10 (187-203), in which

helix α3 has been omitted. Therefore, the N-terminal DNA-binding domain contains

helices α1, α2, and a random loop (residues 47-53), and the C-terminal ligand-binding

domain includes helices from α4 to α10 (21, 66).

The overall structure of the N-terminal DNA-binding domain of CmeR is similar

to those of the TetR family members. However, CmeR displays some distinct features

compared with the rest of the TetR family members (21). The first helix of CmeR

consists of 23 amino acid residues which is relatively long among all structurally known

members of TetR family. For instance, the lengths of helices α1 in QacR, TetR, and EthR

11

are 16, 13, and 17 residues, respectively. As mentioned above, the lack of α3 helix in

CmeR is the most striking feature compared with other TetR family members. So far,

CmeR is the only regulator missing helix α3 among the TetR family. The helix α3

together with α2 in TetR regulators was considered to form a helix-turn-helix (HTH)

DNA-binding motif which plays an important role in recognizing target DNA (62). As a

regulator, CmeR might transform the flexible coil into a helix when bound to the target

DNA. Further, CmeR functions as a pleiotropic regulator of a large set of genes and the

flexibility of the DNA-binding domain might permit CmeR to recognize multiple DNA

sites (66).

The C-terminal domain of CmeR consists of helices α4 through α10 and five of

them (α4, α5, α7, α8, and α10) form an anti-parallel five-helix bundle. The crystal

structure of CmeR indicated that helices α6, α8, α9, and α10 are involved in the

formation of the dimer (21, 66). The overall structure of the C-terminal domain of CmeR

is close to that of QacR. The distinct feature of CmeR in C-terminal domain is that the

helix α9, between the two anti-parallel helices α8 and α10, deviates from the direction of

α8 by 40°. Therefore, the bending of helix α9 toward the next subunit of the dimer

ensures the secure interaction between the dimer (21). One unique feature, not found in

other regulators of TetR family, is the large tunnel-like cavity in each subunit of CmeR.

This tunnel, surrounded by mostly hydrophobic residues of helices α4–α9 in the C-

terminal domain of CmeR, opens horizontally from the front to the back of each protomer.

Helices α7 and α8 from one subunit, and α9′ from the other subunit of the regulator make

the entrance of the tunnel, while helices α4–α6 form the end of this hydrophobic tunnel

(66).

12

This tunnel is approximately 20 Å in length and occupies a volume of about 1000

Å, which is distinctly larger than the binding pockets of many other members of the TetR

family (21). Unexpectedly, a fortuitous glycerol molecule was found to bind in the

binding tunnel of each monomer. Residues F99, F103, F137, S138, Y139, V163, C166,

T167, and K170 are responsible for forming this glycerol-binding site. The volume of the

ligand-binding tunnel of CmeR is large enough to accommodate a few of the ligand

molecules. The crystal structures of CmeR in complexes with taurocholate and cholate

were also elucidated, which indicated that these two ligands bind distinctly in the binding

tunnel. Residues I68, C69, H72, F103, A108, F111, I115, W129, Q134, F137, V163,

K170, H174, H175’, L176’, and L179’ are involved in taurocholate binding, whereas

residues L65, C69, F103, A108, F111, G112, I115, W129, F137, Y139, C166, K170,

P172’, H174, H175’, and L179’ interact with cholate in the tunnel. These quite distinct

binding manners highlighted the plasticity and promiscuity of the ligand-binding tunnel

of CmeR (36).

CmeDEF

CmeDEF is another RND-type efflux pump identified in C. jejuni. CmeD

(Cj1031) is an outer membrane protein of 424 aa, which shares low, but significant

sequence homology to HefA of H. pylori and TolC of E. coli, the outer membrane

components of antibiotic efflux systems (38). CmeE (Cj1032) is a membrane fusion

protein composed of 246 aa, which shares significant homology with the membrane

fusion protein of HefB in H. pylori. CmeF, similar to CmeB, is an inner membrane

transporter and is predicted to contain 12-transmembrane (TM) helical domain structure.

13

The sequence of CmeF (1,005 aa) shares homology with many other RND-type efflux

transporters, such as HefC of H. pylori, and AcrB, AcrD, and AcrF of E.coli (38, 59). The

low sequence identity between CmeDEF and CmeABC suggests these two efflux systems

may have different functions and abilities to extrude antibiotics and other toxic

compounds.

Several studies determined the contribution of cmeDEF to antimicrobial

resistance. Pumbwe et al. reported that insertional mutation of cmeF in Campylobacter

resulted in increased susceptibility to structurally unrelated antimicrobial compounds,

including ampicillin, ethidium bromide, acridine orange, SDS, sodium deoxycholate, bile,

detrimide, and triclosan (59). Akiba et al. also reported that the cmeF mutant of 11168

showed a 2-fold decrease in the resistance to ampicillin and ethidium bromide, but did

not observe any changes in the susceptibility to the other tested antimicrobials including

the bile salts (1). Another study by Ge et al. found that inactivation of cmeF in 81-176

had no effect on the susceptibility to ciprofloxaxin, erythromycin, tetracycline, and

chloramphenicol. Interestingly, inactivation of cmeF in some Campylobacter strains (81-

176, 21190, and 164) resulted in a 2-4 fold increase in the resistance to multiple

antimicrobials and toxic compounds, including ciprofloxacin, cefotaxime, rifampicin,

tetracycline, novobiocin, fusidic acid, ethidium bromide, acriflavine, SDS, triton X-100,

tween 20, empigen, and different bile salts (1). In order to examine if the expression of

CmeABC pump potentially masked the function of CmeDEF on antimicrobial resistance,

cmeB/cmeF double mutants in 81-176 and 22290 were generated. Compared with the 81-

176 cmeB mutant, the 81-176 cmeB/cmeF double mutant showed a 2-fold decrease in the

resistance to ciprofloxacin, tetracycline, fusidic acid, acriflavine, and a 2-16 fold decrease

14

in the resistance to various detergents and bile salts. Likewise, in comparison with the

21190 cmeB mutant, the 21190 cmeB/cmeF double mutant showed a 2-fold increase in

the susceptibility to fusidic acid, acriflavine, polymyxin B, novobiocin, and a 2-128 fold

increase in the susceptibility to detergents and bile salts (1). Together, these results

suggest that the CmeDEF plays a modest role in antibiotic resistance in a strain-

dependent manner and its function is normally masked by that of CmeABC.

One interesting finding is that either CmeABC or CmeDEF is required for

maintaining cell viability in certain Campylobacter strains (1). A single mutation of

either cmeB or cmeF did not affect the viability or growth characteristics of

Campylobacter (1, 42). However, the cmeB/cmeF double mutation in C. jejuni 81-176

showed decreased viability in the stationary phase (1). Additionally, repeated

experiments failed to generate the cmeB/cmeF double mutation in NCTC 11168,

suggesting that the double mutation is lethal to NCTC 11168 (1, 59). These results

suggest that CmeDEF has an important physiological function, which remains to be

determined in future studies.

The baseline expression of cmeDEF in Campylobacter is much lower than that of

cmeABC as determined by transcriptional fusion and immunoblotting assays (1). The

regulatory mechanism for cmeDEF is not known and the conditions that may induce the

expression of cmeDEF have not been determined. CmeR, the transcriptional repressor for

cmeABC, does not modulate the expression of cmeDEF.

15

CmeG

CmeG (Cj1375) is one of the predicted MFS (major facilitator superfamily)

transporters and is present in all the C. jejuni strains sequenced to date. Analysis of amino

acid sequence revealed that CmeG shows homology to Bmr of B. subtilis and NorA of S.

aureus (33). Both Bmr and NorA were demonstrated to contribute to multidrug resistance

in bacteria (33). In addition, CmeG is predicated to be an inner membrane protein and

possesses 12 transmembrane domains (TMs). Inactivation of cmeG significantly reduced

the resistance to various classes of antimicrobials including ciprofloxacin, erythromycin,

tetracycline, gentamicin, ethidium bromide, and cholic acid, while overexpression of

cmeG enhanced the resistance to various fluoroquinolone antimicrobials, including

ciprofloxacin, enrofloxacin, norfloxacin, and moxifloxacin, but not to the other

antibiotics tested in the study (33). Accumulation assays showed that the cmeG mutant

accumulated more ethidium bromide and ciprofloxacin than the wild-type strain (33).

These results indicate that CmeG is a functional efflux transporter in Campylobacter.

An important function of CmeG is its contribution to oxidative stress resistance in

Campylobacter. Mutation of cmeG increased the susceptibility of C. jejuni to hydrogen

peroxide and complementation restored the resistance to the wild-type level (33). This

finding clearly indicates the significant role of CmeG in oxidative stress response, but

how CmeG is involved in this process is unknown. Additionally, CmeG appears to be

important for bacterial viability as inactivation of cmeG in C. jejuni 11168 resulted in a

significant growth defect in conventional culture media and the growth defect was

completely restored by in trans complementation (33). Furthermore, a cmeG mutant

16

could not be generated from C. jejuni 81-176 and 81116 (18, 33), suggesting that cmeG is

an essential gene in certain Campylobacter strains. The expression of cmeG appears to be

regulated by Fur protein and iron concentrations as inactivation of Fur or depleting iron

resulted in up-regulated expression of cmeG (30, 55-56). The detailed mechanism for

cmeG regulation remains to be determined.

Acr3

Recently, an arsenic detoxification system has been identified in C. jejuni (75).

Arsenic compounds are commonly used in poultry industry for promoting growth and

control of diseases. Thus, the ability to resist the action of arsenic compounds is

necessary for Campylobacter adaptation in the poultry production environment. Indeed,

Campylobacter isolates from conventional poultry products had significantly higher

arsenic resistance than those isolates from antimicrobial-free poultry products (68). The

arsenic resistance and arsenic-sensing system identified in C. jejuni is encoded by a four-

gene operon and includes a putative membrane permease (ArsP), a transcriptional

repressor (ArsR), an arsenate reductase (ArsC), and an arsenite efflux protein (Acr3) (75).

There are two families of arsenite transporters: the ArsB family and the Acr3 family (65).

The ArsB family has been found only in bacteria and archaea, while the Acr3 family

exists in prokaryotes and fungi, as well as in plant genomes (17, 31, 64-65).

Acr3 in C. jejuni consists of 347 amino acids and contains 10 predicted

transmembrane helices. Presence of the acr3-containing operon is significantly associated

with elevated resistance to arsenite and arsenate in Campylobacter. Furthermore,

inactivation of acr3 led to 8- and 4-fold reductions in the MICs of arsenite and arsenate,

17

respectively, but mutation of acr3 did not affect the susceptibility to the different classes

of antibiotics tested, including erythromycin, tilmicosin, ciprofloxacin, enrofloxacin,

oxytetracycline, ceftiofur, and polymyxin B (75).

The expression of acr3 is directly regulated by ArsR, which is a transcriptional

regulator encoded by the second gene of the ars operon (75). ArsR is a small regulatory

protein containing a helix-turn-helix (HTH) DNA-binding motif. In-frame deletion of

arsR greatly increased the expression of the other three genes in the operon including

acr3, indicating that ArsR functions as a repressor. Analysis of the ars promoter region

indicated that there is an 18-bp inverted repeat forming a dyad structure, suggesting a

binding site for ArsR. Indeed, EMSA showed the direct binding of ArsR to the promoter

of the ars operon, specifically to the region containing the inverted repeat (75). The

expression of the ars operon is inducible by arsenite and arsenate and there is a conserved

metal binding motif (ELCVCDL) in the ArsR protein. Therefore, it is possible that

arsenic compounds induce the expression of the ars operon by inhibiting the interaction

of ArsR with the promoter. Indeed, EMSA demonstrated that arsenite, but not arsenate,

inhibited the binding of ArsR to the promoter DNA, providing an explanation for

arsenite-induced expression of the operon. Additionally, arsenate is reduced by ArsC to

arsenite in bacterial cells and thus is also able to induce the expression of the ars operon

in Campylobacter (75).

In addition to the Acr3 efflux pump, C. jejuni strains also contain putative ArsB

and ArsP transporters, which are associated with arsenic resistance. Our recent studies

showed that mutation of the arsB gene resulted in 8- and 4-fold reduction in the MICs of

18

arsenite and arsenate, respectively, compared to the wild-type strain, while inactivation of

arsP led to a 4-fold reduction in the MIC of roxarsone (an organic arsenic compound)

compared to the wild-type strains (71). Additionally, overexpression of arsB and cloning

of arsP to an arsP-negative strain resulted in 8 fold increase in the MICs of arsenite and

roxarsone, respectively (71). These findings indicate that Campylobacter harbors

multiple arsenic efflux transporters that confer resistance to both organic and inorganic

arsenic compounds.

Targeting efflux mechanisms to control Campylobacter

As discussed above, the antibiotic efflux transporters are not only key players in

the resistance to antibiotics and toxic compounds, but also have important physiological

functions in Campylobacter, providing promising targets for the control of antibiotic

resistant Campylobacter. This is especially true with CmeABC, which is essential for

Campylobacter adaptation in the intestinal tract (41-42). Thus, inhibition of CmeABC

will not only reduce antibiotic resistance, but also potentially prevent in vivo colonization.

Inhibition of antibiotic efflux in bacterial cells can be achieved by two different

approaches. The first one is to inhibit the function of multidrug efflux transporters by

using efflux pump inhibitors (EPIs) (40, 45, 61). Recently, a promising EPI, Phe-Arg β-

naphthyl-amide dihydrochloride (MC-207,110; PAβN), was found to target the inner

membrane drug transporter of RND-type efflux pumps and potentiate the activity of

antimicrobial agents in Pseudomonas aeruginosa (45). So far, PAβN has been

demonstrated to be effective in potentiating antibiotics against a variety of Gram-negative

bacteria (2, 8-9, 12-13, 27, 44, 50, 52, 63). Several studies have tried to inhibit CmeABC

19

and efflux in Campylobacter by using PAβN (15, 51-52, 61). The general findings are

that PAβN has a significant impact on Ery MICs (8 to >64-fold reduction) and that this

effect is largely due to the inhibition of CmeABC and is especially prominent in EryR

mutants that don't harbor known target mutations in the 23S RNA genes (61). This EPI

also showed good potentiating activities for other antimicrobials including rifampin,

novobiocin, fusic acid, and bile salts. In contrast to findings in other bacteria, multiple

studies have found that PAβN has limited or no effect on the MICs of FQ antimicrobials

in Campylobacter (26, 61). Thus PAβN appears to be an effective potentiating agent for

macrolide antibiotics, but not effective for potentiating FQ antimicrobials in

Campylobacter.

The second approach for targeting antibiotic efflux systems is to inhibit their

production. Recently, Jeon and Zhang reported the feasibility of using antisense peptide

nucleic acid (PNA) to inhibit the production of CmeABC in Campylobacter (34). PNA

agents are DNA-mimic synthetic polymers, carrying a pseudo-peptide backbone with

nucleic acid bases (53). PNA is neutrally charged due to the lack of a phosphodiester

backbone, giving high affinity to nucleic acids. In addition, the extreme resistance of

PNA to proteases and nucleases, and its stability in acidic pH have made PNA an ideal

candidate for various antisense applications (53). An anti-cmeA PNA was used to

specifically inhibit the expression of CmeABC in C. jejuni (34). The specific inhibition

was confirmed by immunoblotting using anti-CmeABC antibodies (34). Importantly, the

anti-cmeA PNA potentiated the anti-Campylobacter activity of erythromycin and

ciprofloxacin and resulted in 2- to > 64-fold reduction in their MICs (34). These results

20

clearly indicated that the feasibility of the PNA antisense technology in controlling

antibiotic-resistant Campylobacter.

Conclusions and future directions

The importance of multidrug efflux pumps in antibiotic resistance and

pathobiology is increasingly recognized in Campylobacter. It is well documented that the

antibiotic efflux systems have functions beyond extrusion of antibiotics, and evidence is

accumulating that they are intertwined with physiological pathways in Campylobacter.

Thus, it is likely that these efflux systems have uncharacterized functions. Future studies

should focus on understanding how the antibiotic efflux systems interact with various

physiological pathways and how they facilitate the adaptation of Campylobacter to

various niches. Additionally, targeting efflux systems has become a promising approach

for controlling antimicrobial resistance and preventing Campylobacter colonization in the

intestinal tract of animal hosts. PAβN has been shown to be effective in potentiating

macrolide antibiotics such as erythromycin, while anti-cmeA PNA sensitizes

Campylobacter to both macrolides and fluoroquinolones. To enhance the usefulness of

the approach, additional EPIs (both synthetic compounds and natural products) should be

evaluated to inhibit antibiotic efflux systems in Campylobacter. Combination of EPIs

with PNAs should be also explored to increase the potentiating effects on various

antibiotics. Additionally, enhanced efforts should be directed toward elucidating the

crystal structures and structure-function relationship of antibiotic efflux transporters,

which will eventually facilitate the design of small molecules to block the function of

efflux pumps.

21

References

1. Akiba, M., J. Lin, Y. W. Barton, and Q. Zhang. 2006. Interaction of CmeABC

and CmeDEF in conferring antimicrobial resistance and maintaining cell viability

in Campylobacter jejuni. J. Antimicrob. Chemother. 57:52-60.

2. Bina, X. R., J. A. Philippart, and J. E. Bina. 2009. Effect of the efflux

inhibitors 1-(1-naphthylmethyl)-piperazine and phenyl-arginine-beta-

naphthylamide on antimicrobial susceptibility and virulence factor production in

Vibrio cholerae. J. Antimicrob. Chemother. 63:103-8.

3. Cagliero, C., L. Cloix, A. Cloeckaert, and S. Payot. 2006. High genetic

variation in the multidrug transporter cmeB gene in Campylobacter jejuni and

Campylobacter coli. J. Antimicrob. Chemother. 58:168-72.

4. Cagliero, C., M. C. Maurel, A. Cloeckaert, and S. Payot. 2007. Regulation of

the expression of the CmeABC efflux pump in Campylobacter jejuni:

identification of a point mutation abolishing the binding of the CmeR repressor in

an in vitro-selected multidrug-resistant mutant. FEMS Microbiol. Lett. 267:89-94.

5. Cagliero, C., C. Mouline, A. Cloeckaert, and S. Payot. 2006. Synergy between

efflux pump CmeABC and modifications in ribosomal proteins L4 and L22 in

conferring macrolide resistance in Campylobacter jejuni and Campylobacter coli.

Antimicrob. Agents Chemother. 50:3893-6.

6. Cagliero, C., C. Mouline, S. Payot, and A. Cloeckaert. 2005. Involvement of

the CmeABC efflux pump in the macrolide resistance of Campylobacter coli. J.

Antimicrob. Chemother. 56:948-50.

22

7. Caldwell, D. B., Y. Wang, and J. Lin. 2008. Development, stability, and

molecular mechanisms of macrolide resistance in Campylobacter jejuni.


8. Cebrian, L., J. C. Rodriguez, I. Escribano, and G. Royo. 2005.

Characterization of Salmonella spp. mutants with reduced fluoroquinolone

susceptibility: importance of efflux pump mechanisms. Chemotherapy 51:40-3.

9. Chan, Y. Y., T. M. Tan, Y. M. Ong, and K. L. Chua. 2004. BpeAB-OprB, a

multidrug efflux pump in Burkholderia pseudomallei. Antimicrob. Agents

Chemother. 48:1128-35.

10. Chatre, P., M. Haenni, D. Meunier, M. A. Botrel, D. Calavas, and J. Y.

Madec. 2010. Prevalence and antimicrobial resistance of Campylobacter jejuni

and Campylobacter coli isolated from cattle between 2002 and 2006 in France. J.

Food Prot. 73:825-31.

11. Chen, X., G. W. Naren, C. M. Wu, Y. Wang, L. Dai, L. N. Xia, P. J. Luo, Q.

Zhang, and J. Z. Shen. 2010. Prevalence and antimicrobial resistance of

Campylobacter isolates in broilers from China. Vet. Microbiol. 144:133-9.

12. Chollet, R., J. Chevalier, A. Bryskier, and J. M. Pages. 2004. The AcrAB-

TolC pump is involved in macrolide resistance but not in telithromycin efflux in

Enterobacter aerogenes and Escherichia coli. Antimicrob. Agents Chemother.

48:3621-4.

13. Coban, A. Y., A. Birinci, B. Ekinci, and B. Durupinar. 2004. [Investigation of

the effects of efflux pump inhibitors on ciprofloxacin MIC values of high level

23

fluoroquinolone resistant Escherichia coli clinical isolates]. Mikrobiyol. Bul.

38:21-5.

14. Cody, A. J., L. Clarke, I. C. Bowler, and K. E. Dingle. 2010. Ciprofloxacin-

resistant campylobacteriosis in the UK. Lancet 376:1987.

15. Corcoran, D., T. Quinn, L. Cotter, and S. Fanning. 2005. Relative contribution

of target gene mutation and efflux to varying quinolone resistance in Irish

Campylobacter isolates. FEMS Microbiol. Lett. 253:39-46.

16. Fakhr, M. K., and C. M. Logue. 2007. Sequence variation in the outer

membrane protein-encoding gene cmeC, conferring multidrug resistance among

Campylobacter jejuni and Campylobacter coli strains isolated from different hosts.

J. Clin. Microbiol. 45:3381-3.

17. Fu, H. L., Y. Meng, E. Ordonez, A. F. Villadangos, H. Bhattacharjee, J. A.

Gil, L. M. Mateos, and B. P. Rosen. 2009. Properties of arsenite efflux

permeases (Acr3) from Alkaliphilus metalliredigens and Corynebacterium

glutamicum. J. Biol. Chem. 284:19887-95.

18. Ge, B., P. F. McDermott, D. G. White, and J. Meng. 2005. Role of efflux

pumps and topoisomerase mutations in fluoroquinolone resistance in

Campylobacter jejuni and Campylobacter coli. Antimicrob. Agents Chemother.

49:3347-54.

19. Gibreel, A., N. M. Wetsch, and D. E. Taylor. 2007. Contribution of the

CmeABC efflux pump to macrolide and tetracycline resistance in Campylobacter

jejuni. Antimicrob. Agents Chemother. 51:3212-6.

24

20. Gillespie, I. A., S. J. O'Brien, J. A. Frost, G. K. Adak, P. Horby, A. V. Swan,

M. J. Painter, and K. R. Neal. 2002. A case-case comparison of Campylobacter

coli and Campylobacter jejuni infection: a tool for generating hypotheses. Emerg.

Infect. Dis. 8:937-42.

21. Gu, R., C. C. Su, F. Shi, M. Li, G. McDermott, Q. Zhang, and E. W. Yu. 2007.

Crystal structure of the transcriptional regulator CmeR from Campylobacter

jejuni. J. Mol. Biol. 372:583-93.

22. Gunn, J. S. 2000. Mechanisms of bacterial resistance and response to bile.

Microbes Infect. 2:907-13.

23. Guo, B., J. Lin, D. L. Reynolds, and Q. Zhang. 2010. Contribution of the

multidrug efflux transporter CmeABC to antibiotic resistance in different

Campylobacter species. Foodborne Pathog. Dis. 7:77-83.

24. Guo, B., Y. Wang, F. Shi, Y. W. Barton, P. Plummer, D. L. Reynolds, D.

Nettleton, T. Grinnage-Pulley, J. Lin, and Q. Zhang. 2008. CmeR functions as

a pleiotropic regulator and is required for optimal colonization of Campylobacter

jejuni in vivo. J. Bacteriol. 190:1879-90.

25. Gupta, A., J. M. Nelson, T. J. Barrett, R. V. Tauxe, S. P. Rossiter, C. R.

Friedman, K. W. Joyce, K. E. Smith, T. F. Jones, M. A. Hawkins, B.

Shiferaw, J. L. Beebe, D. J. Vugia, T. Rabatsky-Ehr, J. A. Benson, T. P. Root,

and F. J. Angulo. 2004. Antimicrobial resistance among Campylobacter strains,

United States, 1997-2001. Emerg. Infect. Dis. 10:1102-9.

25

26. Hannula, M., and M. L. Hanninen. 2008. Effect of putative efflux pump

inhibitors and inducers on the antimicrobial susceptibility of Campylobacter

jejuni and Campylobacter coli. J. Med. Microbiol. 57:851-5.

27. Hasdemir, U. O., J. Chevalier, P. Nordmann, and J. M. Pages. 2004.

Detection and prevalence of active drug efflux mechanism in various multidrug-

resistant Klebsiella pneumoniae strains from Turkey. J. Clin. Microbiol. 42:2701-

6.

28. Hoang, K. V., N. J. Stern, and J. Lin. 2011. Development and stability of

bacteriocin resistance in Campylobacter spp. J. Appl. Microbiol. 111:1544-50.

29. Hoang, K. V., N. J. Stern, A. M. Saxton, F. Xu, X. Zeng, and J. Lin. 2011.

Prevalence, development, and molecular mechanisms of bacteriocin resistance in

Campylobacter. Appl. Environ. Microbiol. 77:2309-16.

30. Holmes, K., F. Mulholland, B. M. Pearson, C. Pin, J. McNicholl-Kennedy, J.

M. Ketley, and J. M. Wells. 2005. Campylobacter jejuni gene expression in

response to iron limitation and the role of Fur. Microbiology 151:243-57.

31. Indriolo, E., G. Na, D. Ellis, D. E. Salt, and J. A. Banks. 2010. A vacuolar

arsenite transporter necessary for arsenic tolerance in the arsenic

hyperaccumulating fern Pteris vittata is missing in flowering plants. Plant Cell

22:2045-57.

32. Jacobs, B. C., A. v. Belkum, and H. P. Endtz. 2008. Guillain-Barré Syndrome

and Campylobacter Infection In: Nachamkin, I.; Szymanski, CM.; Blaser, MJ.,

editors. Campylobacter. Vol. 3. ASM Press; Washington DC, USA:p. 245-261.

26

33. Jeon, B., Y. Wang, H. Hao, Y. W. Barton, and Q. Zhang. 2011. Contribution

of CmeG to antibiotic and oxidative stress resistance in Campylobacter jejuni. J.


34. Jeon, B., and Q. Zhang. 2009. Sensitization of Campylobacter jejuni to

fluoroquinolone and macrolide antibiotics by antisense inhibition of the CmeABC

multidrug efflux transporter. J. Antimicrob. Chemother. 63:946-8.

35. Kim, H. J., J. H. Kim, Y. I. Kim, J. S. Choi, M. Y. Park, H. M. Nam, S. C.

Jung, J. W. Kwon, C. H. Lee, Y. H. Kim, B. K. Ku, and Y. J. Lee. 2010.

Prevalence and characterization of Campylobacter spp. isolated from domestic

and imported poultry meat in Korea, 2004-2008. Foodborne Pathog. Dis. 7:1203-

9.

36. Lei, H. T., Z. Shen, P. Surana, M. D. Routh, C. C. Su, Q. Zhang, and E. W.

Yu. 2011. Crystal structures of CmeR-bile acid complexes from Campylobacter

jejuni. Protein Sci. 20:712-23.

37. Lin, J., M. Akiba, O. Sahin, and Q. Zhang. 2005. CmeR functions as a

transcriptional repressor for the multidrug efflux pump CmeABC in

Campylobacter jejuni. Antimicrob. Agents Chemother. 49:1067-75.

38. Lin, J., M. Akiba, and Q. Zhang. 2005. Multidrug efflux systems in

Campylobacter, p.205-218. In J. M. Ketley and M. E. Konkel (ed.),

Campylobacter: Molecular and Cellular Biology. Horizon Bioscience, Norfolk,

United Kingdom.

27

39. Lin, J., C. Cagliero, B. Guo, Y. W. Barton, M. C. Maurel, S. Payot, and Q.

Zhang. 2005. Bile salts modulate expression of the CmeABC multidrug efflux

pump in Campylobacter jejuni. J. Bacteriol. 187:7417-24.

40. Lin, J., and A. Martinez. 2006. Effect of efflux pump inhibitors on bile

resistance and in vivo colonization of Campylobacter jejuni. J. Antimicrob.


41. Lin, J., L. O. Michel, and Q. Zhang. 2002. CmeABC functions as a multidrug

efflux system in Campylobacter jejuni. Antimicrob. Agents Chemother. 46:2124-

31.

42. Lin, J., O. Sahin, L. O. Michel, and Q. Zhang. 2003. Critical role of multidrug

efflux pump CmeABC in bile resistance and in vivo colonization of

Campylobacter jejuni. Infect. Immun. 71:4250-9.

43. Lin, J., M. Yan, O. Sahin, S. Pereira, Y. J. Chang, and Q. Zhang. 2007. Effect

of macrolide usage on emergence of erythromycin-resistant Campylobacter

isolates in chickens. Antimicrob. Agents Chemother. 51:1678-86.

44. Lister, I. M., C. Raftery, J. Mecsas, and S. B. Levy. 2012. Yersinia pestis

acrAB-tolC in antibiotic resistance and virulence. Antimicrob. Agents Chemother.

56:1120-3.

45. Lomovskaya, O., M. S. Warren, A. Lee, J. Galazzo, R. Fronko, M. Lee, J.

Blais, D. Cho, S. Chamberland, T. Renau, R. Leger, S. Hecker, W. Watkins,

K. Hoshino, H. Ishida, and V. J. Lee. 2001. Identification and characterization

28

of inhibitors of multidrug resistance efflux pumps in Pseudomonas aeruginosa:

novel agents for combination therapy. Antimicrob. Agents Chemother. 45:105-16.

46. Luangtongkum, T., B. Jeon, J. Han, P. Plummer, C. M. Logue, and Q. Zhang.

2009. Antibiotic resistance in Campylobacter: emergence, transmission and

persistence. Future Microbiol. 4:189-200.

47. Luangtongkum, T., T. Y. Morishita, A. J. Ison, S. Huang, P. F. McDermott,

and Q. Zhang. 2006. Effect of conventional and organic production practices on

the prevalence and antimicrobial resistance of Campylobacter spp. in poultry.

Appl. Environ. Microbiol. 72:3600-7.

48. Luangtongkum, T., T. Y. Morishita, L. Martin, I. Choi, O. Sahin, and Q.

Zhang. 2008. Prevalence of tetracycline-resistant Campylobacter in organic

broilers during a production cycle. Avian Dis. 52:487-90.

49. Luo, N., O. Sahin, J. Lin, L. O. Michel, and Q. Zhang. 2003. In vivo selection

of Campylobacter isolates with high levels of fluoroquinolone resistance

associated with gyrA mutations and the function of the CmeABC efflux pump.


50. Mamelli, L., J. P. Amoros, J. M. Pages, and J. M. Bolla. 2003. A

phenylalanine-arginine beta-naphthylamide sensitive multidrug efflux pump

involved in intrinsic and acquired resistance of Campylobacter to macrolides. Int.

J. Antimicrob. Agents 22:237-41.

29

51. Mamelli, L., V. Prouzet-Mauleon, J. M. Pages, F. Megraud, and J. M. Bolla.

2005. Molecular basis of macrolide resistance in Campylobacter: role of efflux

pumps and target mutations. J. Antimicrob. Chemother. 56:491-7.

52. Martinez, A., and J. Lin. 2006. Effect of an efflux pump inhibitor on the

function of the multidrug efflux pump CmeABC and antimicrobial resistance in

Campylobacter. Foodborne Pathog. Dis. 3:393-402.

53. Nielsen, P. E., M. Egholm, R. H. Berg, and O. Buchardt. 1991. Sequence-

selective recognition of DNA by strand displacement with a thymine-substituted

polyamide. Science 254:1497-500.

54. Olah, P. A., C. Doetkott, M. K. Fakhr, and C. M. Logue. 2006. Prevalence of

the Campylobacter multi-drug efflux pump (CmeABC) in Campylobacter spp.

Isolated from freshly processed Turkeys. Food Microbiol. 23:453-60.

55. Palyada, K., Y. Q. Sun, A. Flint, J. Butcher, H. Naikare, and A. Stintzi. 2009.

Characterization of the oxidative stress stimulon and PerR regulon of

Campylobacter jejuni. BMC Genomics 10:481.

56. Palyada, K., D. Threadgill, and A. Stintzi. 2004. Iron acquisition and regulation

in Campylobacter jejuni. J. Bacteriol. 186:4714-29.

57. Piddock, L. J., D. Griggs, M. M. Johnson, V. Ricci, N. C. Elviss, L. K.

Williams, F. Jorgensen, S. A. Chisholm, A. J. Lawson, C. Swift, T. J.

Humphrey, and R. J. Owen. 2008. Persistence of Campylobacter species, strain

types, antibiotic resistance and mechanisms of tetracycline resistance in poultry

flocks treated with chlortetracycline. J. Antimicrob. Chemother. 62:303-15.

30

58. Pumbwe, L., and L. J. Piddock. 2002. Identification and molecular

characterisation of CmeB, a Campylobacter jejuni multidrug efflux pump. FEMS

Microbiol. Lett. 206:185-9.

59. Pumbwe, L., L. P. Randall, M. J. Woodward, and L. J. Piddock. 2005.

Evidence for multiple-antibiotic resistance in Campylobacter jejuni not mediated

by CmeB or CmeF. Antimicrob. Agents Chemother. 49:1289-93.

60. Qin, S. S., C. M. Wu, Y. Wang, B. Jeon, Z. Q. Shen, Q. Zhang, and J. Z. Shen.

2011. Antimicrobial resistance in Campylobacter coli isolated from pigs in two

provinces of China. Int. J. Food Microbiol. 146:94-8.

61. Quinn, T., J. M. Bolla, J. M. Pages, and S. Fanning. 2007. Antibiotic-resistant

Campylobacter: could efflux pump inhibitors control infection? J. Antimicrob.


62. Ramos, J. L., M. Martinez-Bueno, A. J. Molina-Henares, W. Teran, K.

Watanabe, X. Zhang, M. T. Gallegos, R. Brennan, and R. Tobes. 2005. The

TetR family of transcriptional repressors. Microbiol. Mol. Biol. Rev. 69:326-56.

63. Ribera, A., J. Ruiz, M. T. Jiminez de Anta, and J. Vila. 2002. Effect of an

efflux pump inhibitor on the MIC of nalidixic acid for Acinetobacter baumannii

and Stenotrophomonas maltophilia clinical isolates. J. Antimicrob. Chemother.

49:697-8.

64. Rosen, B. P. 2002. Biochemistry of arsenic detoxification. FEBS Lett. 529:86-92.

65. Rosen, B. P. 1999. Families of arsenic transporters. Trends Microbiol. 7:207-12.

31

66. Routh, M. D., C. C. Su, Q. Zhang, and E. W. Yu. 2009. Structures of AcrR and

CmeR: insight into the mechanisms of transcriptional repression and multi-drug

recognition in the TetR family of regulators. Biochim. Biophys. Acta. 1794:844-

51.

67. Ruiz-Palacios, G. M. 2007. The health burden of Campylobacter infection and

the impact of antimicrobial resistance: playing chicken. Clin. Infect. Dis. 44:701-

3.

68. Sapkota, A. R., L. B. Price, E. K. Silbergeld, and K. J. Schwab. 2006. Arsenic

resistance in Campylobacter spp. isolated from retail poultry products. Appl.

Environ. Microbiol. 72:3069-71.

69. Scallan, E., R. M. Hoekstra, F. J. Angulo, R. V. Tauxe, M. A. Widdowson, S.

L. Roy, J. L. Jones, and P. M. Griffin. 2011. Foodborne illness acquired in the

United States--major pathogens. Emerg. Infect. Dis. 17:7-15.

70. Schweitzer, N., A. Dan, E. Kaszanyitzky, P. Samu, A. G. Toth, J. Varga, and

I. Damjanova. 2011. Molecular epidemiology and antimicrobial susceptibility of

Campylobacter jejuni and Campylobacter coli isolates of poultry, swine, and

cattle origin collected from slaughterhouses in Hungary. J. Food Prot. 74:905-11.

71. Shen, Z., T. Luangtongkum, J. Han, and Q. Zhang. 2011. Prevalence and

mechanisms of arsenic resistance in Campylobacter jejuni isolates of different

animal origins. CHRO 2011:98. A170 (Abstract).

32

72. Shen, Z., X. Y. Pu, and Q. Zhang. 2011. Salicylate functions as an efflux pump

inducer and promotes the emergence of fluoroquinolone-resistant Campylobacter

jejuni mutants. Appl. Environ. Microbiol. 77:7128-33.

73. Slutsker, L., S. F. Altekruse, and D. L. Swerdlow. 1998. Foodborne diseases.

Emerging pathogens and trends. Infect. Dis. Clin. North Am. 12:199-216.

74. Smith, J. L., and P. M. Fratamico. 2010. Fluoroquinolone resistance in

Campylobacter. J. Food Prot. 73:1141-52.

75. Wang, L., B. Jeon, O. Sahin, and Q. Zhang. 2009. Identification of an arsenic

resistance and arsenic-sensing system in Campylobacter jejuni. Appl. Environ.

Microbiol. 75:5064-73.

76. Yan, M., O. Sahin, J. Lin, and Q. Zhang. 2006. Role of the CmeABC efflux

pump in the emergence of fluoroquinolone-resistant Campylobacter under

selection pressure. J. Antimicrob. Chemother. 58:1154-9.

77. Zhang, Q., and P. J. Plummer. 2008. Mechnaisms of antibiotic resistance in

Campylobacter In: Nachamkin, I.; Szymanski, CM.; Blaser, MJ., editors.

Campylobacter. Vol. 3. ASM Press; Washington DC, USA:p. 263-276.

78. Zhao, S., S. R. Young, E. Tong, J. W. Abbott, N. Womack, S. L. Friedman,

and P. F. McDermott. 2010. Antimicrobial resistance of Campylobacter isolates

from retail meat in the United States between 2002 and 2007. Appl. Environ.


33

CHAPTER 3. SALICYLATE FUNCTIONS AS AN EFFLUX PUMP INDUCER

AND PROMOTES THE EMERGENCE OF FLUOROQUINOLONE-RESISTAN T

CAMPYLOBACTER JEJUNI MUTANTS

A paper published in Applied and Environmental Microbiology (AEM)

2011. Appl. Environ. Microbiol. 77:7128-33.

Zhangqi Shen1, Xiao-Ying Pu1,2, and Qijing Zhang1.

1Department of Veterinary Microbiology and Preventive Medicine, 1116 Veterinary

Medicine Complex, Iowa State University, Ames, IA 50011, USA. 2Microbiology

Laboratory, Hangzhou Center for Disease Control and Prevention, Hangzhou, Zhejiang

310006, PR China.

Abstract

Salicylate, a non-steroidal anti-inflammatory compound, has been shown to

increase the resistance of Campylobacter to antimicrobials. However, the molecular

mechanism underlying salicylate-induced resistance has not yet been established. In this

study, we determined how salicylate increases antibiotic resistance and evaluated its

impact on the development of fluoroquinolone-resistant Campylobacter mutants.

Transcriptional fusion assays, real time quantitative reverse transcription-PCR (RT-PCR),

and immunoblotting assays consistently demonstrated the induction of the CmeABC

multidrug efflux pump by salicylate. Electrophoretic mobility shift assay further showed

that salicylate inhibits the binding of CmeR (a transcriptional repressor of the TetR

family) to the promoter DNA of cmeABC, suggesting that salicylate inhibits the function

of CmeR. The presence of salicylate in the culture media not only decreased the

34

susceptibility of Campylobacter to ciprofloxacin but also resulted in an approximately

70-fold increase in the observed frequency of emergence of fluoroquinolone-resistant

mutants under selection with ciprofloxacin. Together, these results indicate that in

Campylobacter, salicylate inhibits the binding of CmeR to the promoter DNA and

induces expression of cmeABC, resulting in decreased susceptibility to antibiotics and in

increased emergence of fluoroquinolone-resistant mutants under selection pressure.

Introduction

Sodium salicylates are commonly used as nonsteroidal anti-inflammatory drugs

(NSAIDs). The acetyl form of salicylate, aspirin, is used widely in medicines and

cosmetics. It has been estimated that around 40,000 metric tons of aspirin are consumed

each year in the world (32). The main function of aspirin is to relieve minor aches and

pains and reduce fever. Aspirin also has functions in decreasing the incidence of strokes

and heart attacks (3). Salicylic acid and salicylate are the principal metabolites of aspirin

(11). Sodium salicylate is also as an antipyretic, antiphlogistic, and analgesic agent in

livestock and poultry (12). In addition, salicylic acid is a common compound in plants

and in numerous foods and beverages (13, 33). Therefore, salicylate is available to

humans and food-producing animals via multiple sources.

In addition to its effects in mammalian cells, salicylate also alters the

susceptibility of bacteria to antibiotics. Growth of several bacterial species in the

presence of salicylate induces nonheritable resistance to multiple antibiotics (25). In

Escherichia coli, the presence of salicylate increases resistance to multiple antibiotics,

including quinolones, cephalosporins, ampicillin, nalidixic acid, tetracycline, and

35

chloramphenicol (25, 27). Salicylate-induced multiple antibiotic resistance in E. coli is

mediated by increased transcription of the marRAB operon. Salicylate inhibits the binding

of the repressor protein MarR to marO, the operator region of the mar operon, which then

leads to overexpression of the transcriptional activator protein MarA (4). MarA

modulates the transcription of a number of genes, including decreased expression of

OmpF (a porin) and increased expression of multidrug efflux pump AcrAB-TolC, which

results in a multiple antibiotic resistance (2). Increased resistance to chloramphenicol and

enoxacin in Salmonella enterica serovar Typhimurium is also due to induction of mar

regulon by salicylate (31). In Klebsiella pneumoniae, salicylate-induced antibiotic

resistance is due to increased expression of a MarA homologue, RamA, and the reduced

production of two porins (5, 7).

Campylobacter is recognized as a leading bacterial cause of food-borne diseases

in the United States and other developed countries (30). According to a CDC report,

campylobacteriosis is estimated to affect over 0.84 million people every year in the

United States (29). Worldwide, Campylobacter infections account for 400-500 million

cases of diarrhea each year (28). Antibiotic treatment is recommended when the infection

by Campylobacter is severe or occurs in immunocompromised patients. However,

Campylobacter has become increasingly resistant to antimicrobials (18, 24). Among the

known antibiotic resistance mechanisms in Campylobacter, the CmeABC efflux pump is

an important player and confers resistance to structurally diverse antibiotics and toxic

compounds (17). It has been demonstrated that CmeABC belongs to the RND family of

efflux transporters and is regulated by a transcriptional repressor, CmeR, which binds to a

specific site in the promoter region of cmeABC (15, 17). Expression of CmeABC is

36

inducible by bile compounds, which interact with the ligand-binding domain of CmeR

and prevent binding of CmeR to the cmeABC promoter in Campylobacter jejuni (14, 16).

Furthermore, it has been shown that overexpression of CmeABC in Campylobacter

significantly increases the frequency of emergence of fluoroquinolone-resistant mutants

(35).

Previously, it was shown that growth of Campylobacter in the presence of

salicylate resulted in a small but statistically significant increase in the resistance to

ciprofloxacin, tetracycline, and erythromycin (26). Later, Hannula and Hanninen

confirmed a salicylate-induced increase in resistance to ciprofloxacin in almost all

examined Campylobacter strains (10). These studies indicated that salicylate modulates

Campylobacter resistance to antibiotics, but how salicylate influences antibiotic

resistance and if it affects the emergence of antibiotic resistant Campylobacter mutants

are unknown. Based on previous findings on salicylate and cmeABC regulation, we

hypothesized that salicylate modulates antibiotic resistance in Campylobacter by altering

the expression of the CmeABC efflux pump. To examine this hypothesis, we sought to

compare the expression levels of cmeABC with or without salicylate, to determine the

interaction of salicylate with the CmeR regulator, and to assess the impact of salicylate

on the emergence of fluoroquinolone-resistant Campylobacter mutants.

Materials and Methods

Bacterial strains and growth conditions. Bacterial strains and plasmids used in

this study are listed in Table 1. C. jejuni strains were cultured on Mueller-Hinton (MH)

agar or in MH broth at 42 °C microaerobically (5% O2, 10% CO2, and 85% N2) in a gas

37

incubator. C. jejuni strains with antimicrobial resistance markers were grown on

kanamycin (30 µg/ml) or chloramphenicol (4 µg/ml) when appropriate. All strains are

preserved as 30% glycerol stock at -80 °C.

Table 1. Bacterial plasmids and strains used in this study

Bacterial strain or plasmid

Description or relevant genotype Source or reference

Plasmids pMW10 Shuttle plasmid with promoterless lacZ (34) pABC11

pMW10 with the cmeABC promoter sequence cloned in front of lacZ

(1)

pMW561 pMW10 with the promoter of cj0561c inserted upstream of lacZ

(9)

C. jejuni strains NCTC 11168 Wild-type C. jejuni (22) 11168/pABC11 NCTC 11168 containing pABC11 (1) W7/pMW561 11168W7 containing pMW561 (9)

Antimicrobial susceptibility tests. The MICs of antibiotics against C. jejuni

NCTC 11168 were determined using either Campylobacter MIC Plates (TREK

Diagnostic Systems) or a broth microdilution method as described previously (17). All

assays were repeated at least three times.

Bacterial growth assays. Overnight culture of C. jejuni NCTC 11168 was diluted

100 times in fresh MH broth. Cultures were grown in 200-µl volumes in 96-well plate

and then supplemented with ciprofloxacin (0.125 µg/ml), erythromycin (0.125 µg/ml),

novobiocin (16 µg/ml), or tetracycline (0.031 µg/ml) alone or together with salicylate

(100 µg/ml). The plate was incubated at 42°C for 20 h in a microaerobic atmosphere, and

38

optical density at 600 nm was measured by use of FLUOstar Omega instrument (BMG

Labtech, Offenburg, Germany).

β-galactosidase assay. To determine if salicylate induced the promoter activity of

cmeABC, C. jejuni 11168 containing pABC11 (Table 1) was grown in MH broth or MH

broth supplemented with salicylate (100 µg/ml) for 20 h, and the cells were harvested to

measure β-galactosidase activity as described in a previous study (1). Since cj0561c is

also regulated by CmeR (9), we further analyzed the promoter activity of cj0561c in the

presence of salicylate. The promoter fusion construct for cj0561c was described by Guo

et al. (9) and is listed in Table 1. All β-galactosidase assays were repeated three times.

Real-time qRT-PCR. To further assess if cmeABC operon is subject to induction

by salicylate, C. jejuni NCTC 11168 was cultured in MH broth, with or without salicylate,

for 20 h. The final concentrations of salicylate in the cultures were 0, 100, and 200 µg/ml.

Total RNA was extracted from each of the cultures by use of a RNeasy mini kit (Qiagen,

Valencia, CA) according to the protocol supplied with the product and was further treated

with a Turbo DNA-free kit (Ambion, Austin, TX) to eliminate DNA contamination.

Real-time quantitative reverse transcription-PCR (qRT-PCR) analyses were conducted

using an iScript one-step RT-PCR kit with SYBR green (Bio-Rad) along with a MyiQ

iCycler real-time PCR detection system (Bio-Rad, Hercules, CA) as described previously

(16). The primer sets used to detect the transcription level of cmeB (9) and cmeR (16)

were described in previous publications. The 16S rRNA gene was used for the

normalization. The qRT-PCR experiment was repeated three times using RNA samples

prepared from three independent experiments.

39

SDS-PAGE and immunoblotting assay. In order to determine if salicylate alters

cmeABC expression at the protein level, C. jejuni 11168 was grown overnight in MH

broth containing 0, 100, and 200 µg/ml of salicylate. Bacterial cells were harvested from

the cultures, and whole cell proteins were analyzed by SDS–PAGE and western blotting,

using anti-CmeA, anti-CmeB, anti-CmeC, anti-Cj0561c, and anti-Momp antibodies as

described previously (9, 17).

EMSA. To examine if salicylate inhibits CmeR binding to the promoter DNA of

cmeABC, an electrophoretic mobility shift assay (EMSA) was performed using the

EMSA Kit (Invitrogen, Carlsbad, CA). Briefly, primers GSF and GSR1 (15) were used to

amplify the 170-bp promoter region of cmeABC. The purified PCR products in 30-ng

aliquots with 120 ng of purified recombinant protein (rCmeR) carrying the C69S and

C166S changes (15, 21) in 10 µl of binding buffer containing 250 mM KCl, 0.1 mM

dithiothreitol, 0.1 mM EDTA, and 10 mM Tris. The reaction mixtures were

supplemented with salicylate (10 and 100 µg), taurocholate (10 and 100 µg), or

ampicillin (10 and 100 µg) and then incubated for 20 min at room temperature. The

reactions mixtures were then subjected to electrophoresis on a nondenaturing 6% (wt/vol)

polyacrylamide gel in 0.5 × TBE (44 mM Tris, 44 mM boric acid, 1 mM EDTA [pH 8.0])

at 200 V for 45 min. The gel was stained in 1× TBE containing 1× SYBR Gold nucleic

acid staining solution for 20 min. After washing the gel in 150 ml of distilled H2O for 10

s, the DNA bands were visualized under UV light at 254 nm.

Detection of spontaneous fluoroquinolone-resistant mutants. The emergence

of spontaneous fluoroquinolone-resistant Campylobacter mutants in the presence or

40

absence of salicylate was detected as described previously (35). Briefly, strain NCTC

11168 was grown on MH agar plates for 20 h under microaerobic conditions. The cells

were collected and suspended in 1 ml MH broth. The total CFU in the concentrated

culture were determined by serial dilutions and plating on MH plates. Equal amounts of

bacterial concentrate were plated onto salicylate-free and salicylate-containing MH plates

that contained three different concentrations of ciprofloxacin. The concentrations of

ciprofloxacin used for enumerating the mutants were 0.625, 1.25 and 4 µg/ml, which

were 5-, 10-, and 16-fold higher, respectively, than the MIC for wild-type NCTC 11168.

The frequency of emergence of fluoroquinolone-resistant mutants was calculated as the

ratio of the CFU on ciprofloxacin-containing MH agar plates to the CFU of the

inoculated culture concentrate. This experiment was repeated three times. The

significance of differences in the frequencies of emergence of fluoroquinolone-resistant

mutants between salicylate-treated cultures and nontreated cultures was determined by

Student’s t test.

Results

Salicylate increases Campylobacter resistance to several antibiotics. To verify

if salicylate affects antimicrobial susceptibility of Campylobacter, we measured the MICs

of different antibiotics in the absence and presence of salicylate (100 µg/ml). Growth of

C. jejuni NCTC 11168 with salicylate resulted in a moderate (2-fold) but reproducible

increase in the MIC of ciprofloxacin in multiple experiments. This result is consistent

with previous findings reported by others (10, 26). In this study, salicylate did not affect

the MICs of other examined antimicrobials including azithromycin, gentamicin,

41

florfenicol, nalidixic acid, clindamycin, rifampin, cefotaxime, and streptomycin.

However, presence of salicylate increased the growth rate of 11168 in the presence of

various antibiotics, including ciprofloxacin, erythromycin, novobiocin, and tetracycline at

their corresponding MIC (Fig. 1). Together, these results confirmed that salicylate

decreased the susceptibility of Campylobacter to antibiotics. It should be pointed out that

the enhanced resistance induced by salicylate was not inheritable. After removing

salicylate from the medium, the MIC of ciprofloxacin for strain 11168 returned to the

baseline level (data not shown).

Figure 1. Effects of salicylate (100 µg/ml) on the growth of C. jejuni 11168 in the

presence of various antibiotics, including ciprofloxacin (0.125 µg/ml), erythromycin

(0.125 µg/ml), novobiocin (16 µg/ml), and tetracycline (0.031 µg/ml). The bars represent

the means and standard deviations of triplicate samples from a single representative

experiment.

42

Salicylate induces the expression of cmeABC in Campylobacter. To determine

if salicylate induces the expression of cmeABC, we measured β-galactosidase activity of

strain 11168/pABC11 grown in the presence or absence of salicylate. Compared to the

basal level of transcription in MH broth, addition of salicylate (100 µg/ml) to the culture

resulted in a 3-fold increase in the expression of cmeABC (Fig. 2A). We further examined

the levels of the cmeB transcript in Campylobacter cultures grown with different

concentrations of salicylate (0, 100, and 200 µg/ml), using real-time qRT-PCR. As shown

in Fig. 2B, salicylate induced the transcription of cmeB 2- to 3-folds, in a dose-dependent

manner. An immunoblotting assay using anti-CmeABC antibodies further confirmed the

induction of CmeABC by salicylate (Fig. 3). According to densitometric analysis (data

not shown), the amounts of CmeABC proteins increased 1.5 to 3 fold in the presence of

salicylate compared to the baseline control (in MH broth). The major outer membrane

protein (MOMP) band, which was used as an internal control, did not show any changes

among the samples (Fig. 3). The protein data and the transcriptional results all indicated

that salicylate is an inducer for CmeABC.

Since expression of CmeABC is controlled by CmeR (15), we further determined

if salicylate affected the transcription of cmeR using qRT-PCR. Results from three

independent experiments did not reveal any significant changes in the transcription level

of cmeR in the presence of salicylate (data not shown), indicating that salicylate did not

alter the expression of cmeR. Thus, the enhanced expression of cmeABC by salicylate is

unlikely to be due to a change in cmeR transcription.

Figure 2. Induction of the

Transcriptional fusion (β-

cmeABC in the presence of salicylate (100 µg/ml). The bars represent the means

standard deviations of triplicate samples from a single representative experiment. (B)

qRT-PCR results showing the increased transcript level of

200 µg/ml). Bacterial cells grown in MH broth alone were used as the control for

baseline expression. The bars represent the mean

independent experiments.

43

Figure 2. Induction of the cmeABC operon in C. jejuni 11168 by salicylate.

-galactosidase assay) demonstrating the increase

in the presence of salicylate (100 µg/ml). The bars represent the means


PCR results showing the increased transcript level of cmeB with salicylate (100 and


baseline expression. The bars represent the mean and standard deviations

independent experiments.

11168 by salicylate. (A)

galactosidase assay) demonstrating the increased expression of

in the presence of salicylate (100 µg/ml). The bars represent the means and


licylate (100 and


s of three

44

Figure 3. Immunoblotting analysis of CmeA, CmeB, CmeC, Cj0561c, and

MOMP production in NCTC 11168 grown in 0 (lanes 1, 4, and 7), 100 (lanes 2, 5, and 8)

or 200 (lanes 3, 6, and 9) µg/ml of salicylate. Whole-cell proteins were used for

immunoblotting with specific antibodies against the indicated proteins. The position of

each protein is indicated by an arrow. MOMP is used as an internal control.

Salicylate interferes with CmeR binding to the cmeABC promoter. Since

salicylate induced expression of CmeABC, but did not alter the transcription of cmeR, we

hypothesized that salicylate might affect the function of CmeR by reducing its affinity to

the promoter DNA. To test this hypothesis, we determined the effect of salicylate on the

binding of CmeR to cmeABC promoter by using EMSA. The results showed that

salicylate produced a dose-dependent inhibition of CmeR binding to the cmeABC

promoter DNA (Fig. 4). Taurocholate is a known inducer of cmeABC and was used as a

control for inhibition of CmeR binding. Although the inhibition by salicylate was not as

45

strong as that by taurocholate, the inhibitory effect of salicylate on CmeR binding was

clearly evident (Fig. 4). In contrast, ampicillin, which is not an inducer of cmeABC, did

not inhibit the binding of CmeR to the cmeABC promoter DNA (Fig. 4).

Figure 4. Effects of salicylate, taurocholate, and ampicillin on the formation of

CmeR-DNA complexes as determined by EMSA. Each reaction mixture contains 30 ng

cmeABC promoter DNA and 120 ng rCmeR (except lane 1). The amounts of chemicals

used in the assay are indicated at the top.

Salicylate induces the expression of Cj0561c. In addition to the control of

cmeABC expression, CmeR also functions as a repressor for Cj0561c (a putative

periplasmic protein) in Campylobacter by specifically binding to the cj0561c promoter

(9). Since salicylate inhibited the function of CmeR, we suspected that it might also

induce the expression of Cj0561c in Campylobacter. To examine this possibility, we

46

evaluated the promoter activity of cj0561c by using a transcriptional fusion construct

(pMW561) (Table 1). The β-galactosidase activity of strain W7/pMW561 grown in MH

broth supplemented with 100 µg/ml of salicylate increased 2.5-fold compared with that

for growth in MH broth without salicylate (Fig. 5). An immunoblotting assay using anti-

Cj0561c antibodies further confirmed the induction of Cj0561c by salicylate (Fig. 3).

This induction result for Cj0561c is consistent with the result that salicylate interferes

with the function of CmeR in Campylobacter.

Figure 5. Induction of cj0561c in C. jejuni 11168 by salicylate (100 µg/ml), as

determined by transcriptional fusion (β-galactosidase assay). The bars represent the

means and standard deviations of triplicate samples from a single representative

experiment.

47

Salicylate increases the frequency of emergence of fluoroquinolone-resistant

Campylobacter mutants. Since salicylate induced the expression of CmeABC, we

further examined if the presence of salicylate modulates the emergence of

fluoroquinolone-resistant Campylobacter. The results are shown in Table 2. When 0.625

or 1.25 µg/ml ciprofloxacin were used in the selection plates for enumeration of mutants,

C. jejuni 11168 exhibited similar frequencies of emergence of fluoroquinolone-resistant

mutants, regardless of presence of salicylate in the growth medium (~10-6; P ≥ 0.05).

However, at a ciprofloxacin concentration of 4 µg/ml, incubation of strain 11168 with

salicylate resulted in a 70-fold increase in the frequency of emergence of ciprofloxacin-

resistant mutants and the difference was statistically different (P < 0.05). These findings

indicate that salicylate increases the frequency of emergence of fluoroquinolone-resistant

mutants on plates with a high concentration of ciprofloxacin.

Table 2. Frequencies of emergence of fluoroquinolone-resistant C. jejuni mutants under different selection pressures

Ciprofloxacin levels (µg/ml)

Frequency of mutant emergencea No salicylate Salicylate (100 µg/ml)

0.625 3.33±1.58×10-6 4.60±2.70×10-6 1.25 3.77±0.74×10-6 4.16±2.96×10-6 4 4.24±1.42×10-8 3.23±1.55×10-6* a Data are mean ± standard deviations of three independent experiments. *, the difference from the no-salicylate control is statistically significant (p < 0.05).

48

Discussion

Results from this study revealed that salicylate-mediated decreases in the

susceptibility of Campylobacter to antibiotics are due at least partially to induction of

expression of the CmeABC efflux pump. This conclusion is based on multiple pieces of

experimental evidence derived from transcriptional fusion assay (Fig. 2A), real time

qPCRs (Fig. 2B), and immunoblotting assay (Fig. 3). We further showed that salicylate

inhibits the binding of CmeR to its target promoters (Fig. 4), leading to enhanced

expression of CmeABC and Cj0561c in the presence of salicylate (Figs. 2, 3, and 5).

Together, these results provide a molecular basis for salicylate-induced resistance to

antibiotics in Campylobacter.

CmeABC efflux system plays an important role in the resistance to antibiotics and

toxic compounds in Campylobacter (17), and the expression of this efflux pump is

modulated by CmeR (15). Previous studies demonstrated that overexpression of

CmeABC results in a modest increases in the MICs to antibiotics, including ciprofloxacin,

erythromycin, novobiocin, tetracycline, cefotaxime, and fusidic acid (15-16). In this

study, we found that salicylate caused a small but reproducible increase in the MIC of

ciprofloxacin and facilitated the growth of Campylobacter in the presence of inhibitory

concentrations of antibiotics (Fig. 1). This finding is consistent with the results from

previous studies using salicylate (10, 26).

CmeR is a pleiotropic regulator and functions as a transcriptional repressor for

cmeABC and cj0561c (9, 15). Cj0561c is a periplasmic protein and is tightly controlled

by CmeR due to the presence of two CmeR binding sites in the promoter sequence of

49

Cj0561c (9). Although the exact function of Cj0561c is unknown, a previous study

showed it contributes to the in vivo fitness of Campylobacter in chickens (9). In this study,

we found that salicylate induced the expression of both CmeABC and Cj0561c. This

induction can be explained by the fact that salicylate inhibited the binding of CmeR to

promoter DNA, as shown by EMSA (Fig. 4). Compared with that by bile salts, which are

strong inhibitors of CmeR binding (16), the inhibition by salicylate was relatively weak,

but was visually apparent (Fig. 4). This finding suggests that salicylate releases the

repression of CmeR on cmeABC and cj0561, leading to increased expression of the two

genes.

Salicylate inhibits the function of CmeR, not the expression level of this

regulatory protein. This conclusion is based on the fact that qRT-PCR did not detect

altered transcription of cmeR in the presence of salicylate (data not shown). How

salicylate modulates the function of CmeR is unclear at present, but it is known that

CmeR has a DNA-binding motif in the N-terminal region and a flexible ligand-binding

pocket in the C-terminal region (8). It is possible that salicylate interacts with the ligand-

binding pocket and triggers a conformational change in the DNA-binding domain,

preventing CmeR binding to promoter DNA. This possibility remains to be examined in

future studies. Based on results from this study and previously known information on

CmeR regulation, we present a model that depicts the induction mechanisms of salicylate

in Campylobacter (Fig.6). The binding of salicylate to CmeR appears to be reversible,

since removal of salicylate from the culture medium restored cmeABC expression to the

basal level (data not shown).

50

Figure 6. Diagram depicting the molecular basis of salicylate-mediated induction

of CmeABC and Cj0561c. (A) Baseline expression of the genes in the absence of

salicylate. Transcription of cmeABC and cj0561c is at a low level due to inhibition by

CmeR. (B) Induction of the genes by salicylate. When salicylate is present, it inhibits the

binding of CmeR and ameliorates the repression on cmeABC and cj0561c, leading to

overexpression of CmeABC and Cj0561c.

51

Salicylate not only increases antibiotic resistance but also promotes the

emergence of spontaneous fluoroquinolone-resistant Campylobacter under selection

pressure. In Campylobacter, fluoroquinolone resistance is mediated by target

modification (GyrA mutations) and by the efflux function of CmeABC (6, 20, 23). A

single point mutation in the quinolone resistance-determining region of gyrA DNA is

sufficient to significantly increase the resistance of Campylobacter to fluoroquinolone

antimicrobials (6, 18-19, 24). The T86I substitution in GyrA confers high-level resistance

to fluoroquinolones, while the T86K, A70T, and D90N substitutions are associated with

moderate resistance to fluoroquinolones (18, 24). It is important to point out that

CmeABC functions synergistically with GyrA mutations in conferring fluoroquinolone

resistance and that without CmeABC, GyrA mutants are unable to maintain the resistance

phenotype (18, 35). Thus, the expression level of CmeABC affects the frequency of

emergence of fluoroquinolone-resistant mutants in Campylobacter (35). In this study, we

showed that addition of salicylate in the culture media resulted in a 70-fold increase in

the frequency of emergence of ciprofloxacin-resistant mutants at a higher concentration

of the antibiotic (4 µg/ml) (Table 2). This result is consistent with our previous finding

with a cmeR mutant, in which CmeABC was overexpressed, for which the frequency of

emergence of fluoroquinolone-resistant mutants increased significantly (35).

For Campylobacter, it is known that different GyrA mutations confer different

levels of resistance, and the measured frequencies of emergence of resistant mutants vary

with the concentration of ciprofloxacin in the plates (35). The presence of salicylate in

the medium did not alter frequencies of emergence of fluoroquinolone-resistant mutants

(~10-6) when the concentrations of ciprofloxacin in the selection plates were 5 times

52

(0.625 µg/ml) and 10 times (1.25 µg/ml) higher than the MIC (Table 2). This result can

be explained by the fact that the base-level expression of CmeABC is sufficient and

overexpression of this efflux pump is not required for the GyrA mutants to survive at low

selection pressure (0.625 and 1.25 µg/ml) (35). In contrast, with 4 µg/ml of ciprofloxacin,

those GyrA mutants with lower MICs would require overexpression of cmeABC to

survive the selection pressure, resulting in a difference in the numbers of detected

mutants with and without salicylate. These results indicate that salicylate does not affect

the spontaneous mutation rate but facilitates the emergence of fluoroquinolone-resistant

mutants under antibiotic selection by inducing the expression of cmeABC. Similar

findings were obtained in a previous study in which mutation of cmeR (CmeABC

overexpressed) led to increased emergence of ciprofloxacin-resistant mutants for

selection with ciprofloxacin at 4 µg/ml but not at 0.625 and 1.25 µg/ml (35).

In summary, this study identified the molecular mechanism underlying salicylate-

induced antibiotic resistance in Campylobacter and revealed that salicylate promotes the

emergence of fluoroquinolone-resistant Campylobacter mutants under selection pressure.

Although these findings were made under laboratory experiments, they might be

applicable to the ecological niches occupied by C. jejuni under natural conditions.

Considering the common presence of salicylate in plant and food as well as its

widespread use in veterinary and human medicine, it is possible that C. jejuni is exposed

to salicylate in animal reservoirs and in the human host. Such exposure would

conceivably influence the development of antibiotic resistance in this pathogenic

organism. Those treating Campylobacter infections with fluororquinolones should

53

consider this possibility and avoid simultaneous use of salicylate-containing medicine or

salicylate-rich nutrients.

Acknowlegments

We thank Orhan Sahin for critical readings of the manuscript.

This work was supported by NIH grant RO1DK063008 and the National

Research Initiative Competitive Grants Program Grant 2007-35201-18278 from the

USDA National Institute of Food and Agriculture.

Author Contributions

Conceived and designed the experiments: ZS QZ. Performed the experiments: ZS

XYP. Analyzed the data: ZS XYP QZ. Contributed reagents/materials/analysis tools: QZ.

Wrote the paper: ZS QZ.

Rreferences

1. Akiba, M., J. Lin, Y. W. Barton, and Q. Zhang. 2006. Interaction of CmeABC

and CmeDEF in conferring antimicrobial resistance and maintaining cell viability

in Campylobacter jejuni. J. Antimicrob. Chemother. 57:52-60.

2. Alekshun, M. N., and S. B. Levy. 1997. Regulation of chromosomally mediated

multiple antibiotic resistance: the mar regulon. Antimicrob. Agents Chemother.

41:2067-75.

3. Baigent, C., L. Blackwell, R. Collins, J. Emberson, J. Godwin, R. Peto, J.

Buring, C. Hennekens, P. Kearney, T. Meade, C. Patrono, M. C. Roncaglioni,

and A. Zanchetti. 2009. Aspirin in the primary and secondary prevention of

54

vascular disease: collaborative meta-analysis of individual participant data from

randomised trials. Lancet 373:1849-60.

4. Cohen, S. P., S. B. Levy, J. Foulds, and J. L. Rosner. 1993. Salicylate induction

of antibiotic resistance in Escherichia coli: activation of the mar operon and a

mar-independent pathway. J. Bacteriol. 175:7856-62.

5. Domenico, P., T. Hopkins, and B. A. Cunha. 1990. The effect of sodium

salicylate on antibiotic susceptibility and synergy in Klebsiella pneumoniae. J.


6. Ge, B., P. F. McDermott, D. G. White, and J. Meng. 2005. Role of efflux

pumps and topoisomerase mutations in fluoroquinolone resistance in

Campylobacter jejuni and Campylobacter coli. Antimicrob. Agents Chemother.

49:3347-54.

7. George, A. M., R. M. Hall, and H. W. Stokes. 1995. Multidrug resistance in

Klebsiella pneumoniae: a novel gene, ramA, confers a multidrug resistance

phenotype in Escherichia coli. Microbiology 141 ( Pt 8):1909-20.

8. Gu, R., C. C. Su, F. Shi, M. Li, G. McDermott, Q. Zhang, and E. W. Yu. 2007.

Crystal structure of the transcriptional regulator CmeR from Campylobacter

jejuni. J. Mol. Biol. 372:583-93.

9. Guo, B., Y. Wang, F. Shi, Y. W. Barton, P. Plummer, D. L. Reynolds, D.

Nettleton, T. Grinnage-Pulley, J. Lin, and Q. Zhang. 2008. CmeR functions as

a pleiotropic regulator and is required for optimal colonization of Campylobacter

jejuni in vivo. J. Bacteriol. 190:1879-90.

55

10. Hannula, M., and M. L. Hanninen. 2008. Effect of putative efflux pump

inhibitors and inducers on the antimicrobial susceptibility of Campylobacter

jejuni and Campylobacter coli. J. Med. Microbiol. 57:851-5.

11. Hartog, E., O. Menashe, E. Kler, and S. Yaron. 2010. Salicylate reduces the

antimicrobial activity of ciprofloxacin against extracellular Salmonella enterica

serovar Typhimurium, but not against Salmonella in macrophages. J. Antimicrob.


12. Huff, G. R., W. E. Huff, J. M. Balog, N. C. Rath, and R. S. Izard. 2004. The

effects of water supplementation with vitamin E and sodium salicylate (Uni-Sol)

on the resistance of turkeys to Escherichia coli respiratory infection. Avian Dis.

48:324-31.

13. Janssen, P. L., P. C. Hollman, D. P. Venema, W. A. van Staveren, and M. B.

Katan. 1996. Salicylates in foods. Nutr. Rev. 54:357-9.

14. Lei, H. T., Z. Shen, P. Surana, M. D. Routh, C. C. Su, Q. Zhang, and E. W.

Yu. 2011. Crystal structures of CmeR-bile acid complexes from Campylobacter

jejuni. Protein Sci. 20:712-23.

15. Lin, J., M. Akiba, O. Sahin, and Q. Zhang. 2005. CmeR functions as a

transcriptional repressor for the multidrug efflux pump CmeABC in

Campylobacter jejuni. Antimicrob. Agents Chemother. 49:1067-75.




56



31.

18. Luangtongkum, T., B. Jeon, J. Han, P. Plummer, C. M. Logue, and Q. Zhang.

2009. Antibiotic resistance in Campylobacter: emergence, transmission and

persistence. Future Microbiol. 4:189-200.

19. Luo, N., S. Pereira, O. Sahin, J. Lin, S. Huang, L. Michel, and Q. Zhang.

2005. Enhanced in vivo fitness of fluoroquinolone-resistant Campylobacter jejuni

in the absence of antibiotic selection pressure. Proc. Natl. Acad. Sci. USA

102:541-6.

20. Luo, N., O. Sahin, J. Lin, L. O. Michel, and Q. Zhang. 2003. In vivo selection

of Campylobacter isolates with high levels of fluoroquinolone resistance

associated with gyrA mutations and the function of the CmeABC efflux pump.


21. Oakland, M., B. Jeon, O. Sahin, Z. Shen, and Q. Zhang. 2011. Functional

Characterization of a Lipoprotein-Encoding Operon in Campylobacter jejuni.

PLoS One 6:e20084.

22. Parkhill, J., B. W. Wren, K. Mungall, J. M. Ketley, C. Churcher, D. Basham,

T. Chillingworth, R. M. Davies, T. Feltwell, S. Holroyd, K. Jagels, A. V.

Karlyshev, S. Moule, M. J. Pallen, C. W. Penn, M. A. Quail, M. A.

Rajandream, K. M. Rutherford, A. H. van Vliet, S. Whitehead, and B. G.

57

Barrell. 2000. The genome sequence of the food-borne pathogen Campylobacter

jejuni reveals hypervariable sequences. Nature 403:665-8.

23. Payot, S., L. Avrain, C. Magras, K. Praud, A. Cloeckaert, and E. Chaslus-

Dancla. 2004. Relative contribution of target gene mutation and efflux to

fluoroquinolone and erythromycin resistance, in French poultry and pig isolates of

Campylobacter coli. Int. J. Antimicrob. Agents 23:468-72.

24. Payot, S., J. M. Bolla, D. Corcoran, S. Fanning, F. Megraud, and Q. Zhang.

2006. Mechanisms of fluoroquinolone and macrolide resistance in Campylobacter

spp. Microbes Infect. 8:1967-71.

25. Price, C. T., I. R. Lee, and J. E. Gustafson. 2000. The effects of salicylate on

bacteria. Int. J. Biochem. Cell Biol. 32:1029-43.

26. Randall, L. P., A. M. Ridley, S. W. Cooles, M. Sharma, A. R. Sayers, L.

Pumbwe, D. G. Newell, L. J. Piddock, and M. J. Woodward. 2003. Prevalence

of multiple antibiotic resistance in 443 Campylobacter spp. isolated from humans

and animals. J. Antimicrob. Chemother. 52:507-10.

27. Rosner, J. L. 1985. Nonheritable resistance to chloramphenicol and other

antibiotics induced by salicylates and other chemotactic repellents in Escherichia

coli K-12. Proc. Natl. Acad. Sci. USA 82:8771-4.



3.

58




30. Slutsker, L., S. F. Altekruse, and D. L. Swerdlow. 1998. Foodborne diseases.

Emerging pathogens and trends. Infect. Dis. Clin. North Am. 12:199-216.

31. Sulavik, M. C., M. Dazer, and P. F. Miller. 1997. The Salmonella typhimurium

mar locus: molecular and genetic analyses and assessment of its role in virulence.

J. Bacteriol. 179:1857-66.

32. Warner, T. D., and J. A. Mitchell. 2002. Cyclooxygenase-3 (COX-3): filling in

the gaps toward a COX continuum? Proc. Natl. Acad. Sci. USA 99:13371-3.

33. Wood, A., G. Baxter, F. Thies, J. Kyle, and G. Duthie. 2011. A systematic

review of salicylates in foods: estimated daily intake of a Scottish population. Mol.

Nutr. Food Res. 55 Suppl 1:S7-S14.

34. Wosten, M. M., M. Boeve, M. G. Koot, A. C. van Nuenen, and B. A. van der

Zeijst. 1998. Identification of Campylobacter jejuni promoter sequences. J.

Bacteriol. 180:594-9.

35. Yan, M., O. Sahin, J. Lin, and Q. Zhang. 2006. Role of the CmeABC efflux

pump in the emergence of fluoroquinolone-resistant Campylobacter under

selection pressure. J. Antimicrob. Chemother. 58:1154-9.

59

CHAPTER 4. IDENTIFICATION OF A MEMBRANE TRANSPORTER

INVOLVED IN ARSENIC RESISTANCE IN CAMPYLOBACTER JEJUNI

A paper to be submitted to Applied and Environmental Microbiology (AEM)

Zhangqi Shen, Jing Han, Yang Wang, Orhan Sahin, Qijing Zhang.

Department of Veterinary Microbiology and Preventive Medicine, 1116 Veterinary

Medicine Complex, Iowa State University, Ames, IA 50011, USA

Abstract

Arsenic, a toxic metalloid, exists in the natural environment and its organic form

is frequently used as a feed additive for animal production. Campylobacter isolates from

poultry were highly resistant to arsenic compounds and a 4-gene ars operon (containing

arsP, arsR, arsC, and acr3) was previously found to be associated with arsenic resistance

in Campylobacter. However, this 4-gene operon is not present in all Campylobacter

isolates and other arsenic resistance mechanisms in C. jejuni have not been characterized.

In this study, we determined the role of ArsB, ArsC2 and ArsR3 in arsenic resistance in C.

jejuni and found that ArsB, but not the other two genes, contributes to the resistance to

arsenite and arsenate. ArsB is predicted to be a membrane permease with 11

transmembrane segments. Inactivation of arsB in C. jejuni 11168 resulted in 8- and 4-

fold reduction in the MICs of arsenite and arsenate, respectively, and complementation of

the arsB mutant restored the MIC of arsenite to the wild-type level. Additionally,

overexpression of arsB in C. jejuni 11168 resulted in a 16-fold increase in the MIC of

arsenite. PCR analysis of C. jejuni isolates from different animals hosts indicated that

arsB and acr3 are widely distributed in various C. jejuni strains, and Campylobacter

60

requires at least one of the two genes for adaptation to arsenic-containing environments.

These results identify ArsB as a new membrane efflux transporter contributing to arsenic

resistance in C. jejuni and provide new insights into the adaptative mechanisms of

Campylobacter in the food producing environments.

Introduction

Arsenic is a wildly distributed toxic metalloid in water, soil, and air from natural

and anthropogenic sources, and exists in both inorganic and organic forms (3, 11, 24).

The most prevalent inorganic forms of arsenic include trivalent arsenite [AS(III)] and

pentavalent arsenate [AS(V)]. The trivalent form is more toxic than the pentavalent form

(3, 11). AS(III) impairs the functions of many proteins by reacting with their sulfhydryl

groups, while AS(V) is a molecular analog of phosphate, which inhibits oxidative

phosphorylation and harms the main energy-generation system (24, 44). In order to

survive arsenic toxicity, microorganisms have developed different mechanisms for

arsenic detoxification, including reduction of AS(V) to AS(III) by arsenate reductases

and methylation or extrusion of AS(III) by efflux transporters (26-27, 39).

The genes encoding arsenic detoxification systems are found on both plasmids

and chromosomes. Usually, the ars genes are organized as operons, such as arsRBC,

arsRABC, and arsRDABC, but some ars genes exist singly (4-6, 10, 20, 34, 36, 39). ArsC

is a small-molecular mass arsenate reductase, which converts AS(V) to AS(III) in the

cytoplasm (15, 27). As(III) is extruded by AS(III)-specific transporters, such as ArsB and

Acr3 (27, 39). The activity of ArsB can be ATP-independent or requires the help of ArsA,

an ATPase (9, 32). A recent study identified a new arsenic detoxification mechanism

61

mediated by ArsM, an AS(III) S-adenosylmethionine methyltransferase, which

methylates AS(III) to volatile trimethylarsine (26). In addition, there are other Ars

proteins involved in arsenic resistance. ArsR, a transcription regulator, modulates the

expression of arsenic resistance genes (22, 29, 39, 42, 48). ArsD, an arsenic

metallochaperone, transfers As(III) to ArsA and increases the rate of arsenic extrusion (2,

19, 26, 45). ArsH, an NADPH-flavin mononucleotide oxidoreductase, also contributes to

arsenic resistance, and its detoxification mechanism is probably through oxidation of

arsenite to the less toxic arsenate or reduction of trivalent arsenicals to volatile arsines

that escape from cells (23, 47).

Campylobacter is considered a leading bacterial cause of food-borne diseases in

the United States and other developed countries (35). Campylobacter infections account

for 400 to 500 million cases of diarrhea each year worldwide (30). According to a recent

CDC report, campylobacteriosis is estimated to affect over 840,000 people every year in

the United States (35). As a zoonotic pathogen, Campylobacter is highly prevalent in

food producing animals, including both livestock and poultry (14), and is frequently

exposed to antimicrobials used in animal agriculture. Roxarsone (4-hydroxy-3-nitro-

phenylarsonic acid), an organoarsenic compound, is extensively used as a feed additive to

improve weight gain, feed utilization and pigmentation, and control of coccidiosis in the

poultry industry (7). It has been estimated that approximately 70% of the U.S. broiler

production units utilizes roxarsone (7), and the total arsenic concentration in the litter is

approximately 29 mg/kg (12). Given that poultry is the major reservoir for

Campylobacter, it must be able to deal with the toxicity of arsenic compounds used for

poultry production.

62

Recently, Wang et al. identified a 4-gene ars operon, which is associated with

high-level arsenic resistance in Campylobacter (39). This operon encodes a putative

membrane permease (ArsP), a transcriptional repressor (ArsR), an arsenate reductase

(ArsC), and an efflux protein (Acr3). The expression of the whole operon is directly

regulated by ArsR and is inducible by AS(III) and As(V) (39). However, this ars operon

is not present in all Campylobacter isolates and how those strains without this ars operon

adapt to arsenic selection is unknown. According to the genomic annotation of C. jejuni

NCTC 11168 (http://www.lshtm.ac.uk/pmbu/crf/Cj_updated.art), which lacks the

previously characterized ars operon (25, 39), three putative ars genes are present on the

chromosome. These include cj0258 (an arsR homolog), cj0717 (an arsC homolog), and

cj1187c (an arsB homolog), but their functions remain unknown. In this study, we

determine the roles of these putative ars genes in arsenic resistance and found that

cj1187c (arsB) contributes to the resistance to AS(III). In addition, we investigated the

presence of the arsB and acr3 genes in various Campylobacter isolates. The results

suggest that Campylobacter requires at least one of the two genes for adaptation to

arsenic-containing environment.


Bacterial strains and growth conditions. The key bacterial strains and plasmids

used in this study are listed in Table 1. Escherchia coli DH5α used for genetic

manipulation was grown in Luria-Bertani (LB) broth or on Mueller-Hinton (MH) agar.

When required, kanamycin (30 µg/ml), chloramphenicol (10 µg/ml), or ampicillin (100

µg/ml) was added to the culture media. C. jejuni strains were cultured on MH agar or in

63

MH broth at 42oC microaerobically (5% O2, 10% CO2, and 85% N2). Kanamycin

(30µg/ml) or chloramphenicol (4 µg/ml) was supplemented to the media when needed.

Table 1. Bacterial strains and plasmids used in this study



Plasmids pUOA18 E. coli-C. jejuni shuttle vector (40) pUC19 Cloning vector (46) pMW10 Promoterless lacZ plasmid (41) pArsB pUC19+arsB This study pArsBcat pUC19+arsB::cat This study pRRK pRR::aphA3 (21) pRRKarsB pRRK+arsB This study pC2M1 pUC19+arsC2M1 This study pC2M1M2 pUC19+arsC2M1+arsC2M2 This study pC2M1M2Kan pUC19+arsC2M1+aphA3+arsC2M2 This study pR2M1 pUC19+arsR3M1 This study pR2M1M2 pUC19+arsR3M1+arsR3M2 This study pR2M1M2Kan pUC19+arsR3M1+aphA3+arsR3M2 This study strains DH5α Plasmid propagation E.coli strain Invitrogen NCTC 11168 Wild-type C. jejuni (25) 11168∆arsB NCTC 11168 derivative, ∆arsB::Cmr This study 11168∆arsC2 NCTC 11168 derivative, ∆arsC2:: aphA3 This study 11168∆arsR3 NCTC 11168 derivative, ∆arsR3:: aphA3 This study 11168∆arsB∆arsC2 NCTC 11168 derivative, ∆arsB::Cmr,

∆arsC:: aphA3 This study

11168+arsB NCTC 11168 derivative, rrs::arsB This study 11168∆arsB+arsB 11168∆arsB derivative, rrs::arsB This study ATCC 33560 Wild-type C. jejuni ATCC 33560∆arsB ATCC 33560 derivative, ∆arsB::Cmr This study CB5-28 Wild-type C. jejuni (39) CB5-28∆arsB CB5-28 derivative, ∆arsB::Cmr This study CB5-28∆arsC CB5-28 derivative, ∆arsC:: aphA3 (39) CB5-28∆arsB∆arsC CB5-28 derivative, ∆arsB::Cmr ∆arsC::

aphA3 This study

64

Chemical compounds and antibiotics. The chemicals and antibiotics used in this

study were purchased from Sigma-Aldrich Co. LLC (arsenite, arsenate, chloramphenicol,

kanamycin, ampicillin, copper sulfate, erythromycin, tetracycline, ethidium bromide,

azithromycin, ciprofloxacin, florfenicol, and clindamycin), Thermo Fisher Scientific Inc.

( roxarsone, mercury bichloride, and telithromycin), and Alfa Aesar (antimonite).

Antimicrobial susceptibility tests. The MICs of various arsenic compounds and

antibiotics against C. jejuni strains were determined using either the agar dilution

antimicrobial susceptibility testing method according to the protocol from CLSI (1) or the

broth microdilution method as described previously (18). Each MIC test was repeated at

least three times.

Insertional mutation of arsB. Primers arsB1929F and arsB1929R (Table 2) were

used to amplify a 1929 bp arsB fragment with the SwaI and XbaI restriction sites in the

middle region of the fragment. The PCR fragment was cloned into the pUC19 between

the EcoRI and SalI sites, resulting in the construction of pArsB. Primers arsBCat-F and

arsBCat-R (Table 2) were used to amplify the chloramphenicol resistance cat gene from

pUOA18 using the Phusion High-Fidelity DNA Polymerase (NEB). After the XbaI

digestion, the cat cassette was ligated to the SwaI and XbaI digested pARSB to obtain

plasmid pArsBcat, which was then transformed into E. coli DH5α. Suicide vector

pArsBcat was introduced into C. jejuni NCTC 11168 using an electroporator (Gene

Pulser Xcell System; Bio-Rad Laboratories). Transformants were selected on MH agar

containing chloramphenicol at 4 µg/ml. The insertion of cat cassette into the arsB gene of

C. jejuni 11168 was confirmed by PCR analysis.

65

Table 2. PCR primers used in this study

Primers Sequence (5’→3’) arsB1929F ACAAGGAATTCATGGCTATGATTTAGGGC arsB1929R ATCATGTCGACCCATAACTTGTCCTTTCG arsBCat-F CGGTTCTAGATGGAGCGGACAACGAGTAAA arsBCat-R GCTTGGATCAGTGCGACAAACTGGGATT comarsB-F GCCGCTAGCAAGGAGATTTAAATGCTTGCTTTTTTTATTTTTTT comarsB-R GGTGCTAGCTTAGACAATAAGAGCAAAAAGAGAA gidAKanF TATGGTACCCGCTTATCAATATATCTATAGAATG gidAKanR AGCTCTAGAGATAATGCTAAGACAATCACTAAA arsBgidAF CATCATAAACCTCCAACCATT arsBgidAR AAGAACTATCCCAAACCAAG arsR3M1-F TGGGAATTCGAGGCTTTAATCAACACTTA arsR3M1-R TAAGGTACCTTTCATCGGCATTTTCACAT arsR3M2-F CGATCTAGATGTGAAAATGCCGATGAAAA arsR3M2-R ATTCTGCAGACCATGCACTAGCAAAGGAA arsC2M1-F TGGGAATTCTTACGATTGTTCAGCTCACA arsC2M1-R GCTGGTACCAAGCATCCATAGCTTTCTTT arsC2M2-F TTGTCTAGACCAAGTTGTATTAAGCGTCCT arsC2M2-R AATCTGCAGCCATGATCTGTCATAGCCAC 16sarsB-F ATCGTAGATCAGCCATGCTA 16sarsB-R GATAATCAACCCAACCAAAGT arsB-F1 AGGATAATCAACCCAACCAAAGT arsB-R1 CGTCCATGGAATTTACCTATTTG arsB56F GGAATTTACCTATTTGGGTAT arsB1185R ATATTAATGCCTTTTCTAGCC cje1733F ATGTTAGGTTTTATCGATAGAT cje1733R TCATGAGGCTTGATTCATTTTT

Insertional mutagenesis of arsC2 (cj0717). Primers arsC2M1-F and arsC2M1-R

were used to amplify the 5’ part of arsC2 and its upstream region (arsC2M1), while

Primers arsC2M2-F and arsC2M2-R were used to amplify the 3’ part of arsC2 and its

downstream region (arsC2M2). After EcoRI and KpnI digestion, the arsC2M1 PCR

product was cloned into the EcoRI and KpnI digested pUC19, resulting in the

construction of pC2M1. The digested arsC2M2 PCR product was cloned into the XbaI

66

and PstI digested pC2M1, resulting in the construction of pC2M1M2. Primers gidAKanF

and gidAKanR (Table 2) were used to amplify the aphA3 gene encoding kanamycin

resistance from pMW10 using the Phusion High-Fidelity DNA Polymerase (NEB). After

the KpnI and XbaI digestion, the Kanr cassette was ligated to the KpnI and XbaI digested

pC2M1M2 to obtain plasmid construct pC2M1M2Kan, which was then transformed into

E. coli DH5α. Suicide vector pC2M1M2Kan was then electroporated into C. jejuni

NCTC 11168. Transformants were selected on MH agar plates containing 30 µg/ml of

kanamycin. The insertion of the aphA3 gene into arsC2 in the transformants was

confirmed by PCR using primers arsC2M1-F and arsC2M2-R.

Insertional mutagenesis of arsR3 (cj0258). Primers arsR3M1-F and arsR3M1-R

were used to amplify the 5’ part of arsR3 and its upstream region (arsR3M1), while

primers arsR3M2-F and arsR3M2-R were used to amplify the 3’ part of arsR3 and its

downstream region (arsR3M2). After EcoRI and KpnI digestion, the arsR3M1 PCR

product was cloned into the EcoRI and KpnI digested pUC19, resulting in the

construction of pR3M1. The digested arsR3M2 PCR product was cloned into the XbaI

and PstI digested pR3M1, resulting in the construction of pR3M1M2. As mentioned

above, primers gidAKanF and gidAKanR (Table 2) were used to amplify the aphA3 gene

encoding kanamycin resistance from pMW10 using the Phusion High-Fidelity DNA

Polymerase (NEB). After the KpnI and XbaI digestion, the Kanr cassette was ligated to

the KpnI and XbaI digested pR3M1M2 to obtain plasmid construct pR3M1M2Kan,

which was then transformed into E. coli DH5α. Suicide vector pR3M1M2Kan was then

electroporated into C. jejuni NCTC 11168. Transformants were selected on MH agar

67

plates containing 30 µg/ml of kanamycin. The insertion of the aphA3 gene into arsR3 in

the transformants was confirmed by PCR using primers arsR3M1-F and arsR3M2-R.

Complementation of the ∆arsB::Cmr mutant. The ∆arsB::Cmr mutant was

complemented by inserting a wild-type copy of arsB between the 16S and 23S rRNAs as

described by Muraoka and Zhang (21). Briefly, primers comarsB-F and comarsB-R were

used to amplify the intact arsB gene including its ribosome binding site. The amplicon

was digested with XbaI and cloned into the pRRK plasmid, which contains an aphA3

cassette in the opposite orientation to the ribosomal genes, to obtain plasmid construct

pRRKarsB. The direction of the insertion was confirmed by primers 16sarsB-F and

16sarsB-R. The construct with arsB in the same transcriptional direction as the ribosomal

genes was selected and used as the suicide vector to insert the arsB gene into the

chromosome of the arsB mutant. The complemented strains were selected on MH agar

containing 30 µg/ml of kanamycin and were confirmed by PCR.

Overexpression of arsB in C. jejuni NCTC 11168. The suicide plasmid

pRRKarsB constructed for complementation was electroporated into wild-type C. jejuni

NCTC 11168 wild type strain, resulting in the insertion of an extra copy of arsB in the

chromosome. Transformants were selected on MH agar plates containing 30 µg/ml of

kanamycin and confirmed by PCR.

Real-time qRT-PCR. To determine if the arsB gene is inducible by arsenic

compounds, C. jejuni NCTC 11168 was cultured in MH broth with or without added

arsenite and arsenate for 20 h. The final concentrations of arsenite and arsenate in the

culture were 0.125, 0.25, and 0.5 times of their corresponding MIC in NCTC 11168.

68

Total RNA was extracted from three biological replicate cultures using the RNeasy mini

kit (Qiagen) according to the protocol supplied with the product and further treated with

the Turbo DNA-free kit (Ambion) to eliminate DNA contamination in each preparation.

For real-time quantitative reverse transcription-PCR (qRT-PCR), primers arsB-F1 and

arsB-R1 (Table 2) specific for arsB were designed using the Primer3 online interface

(http://frodo.wi.mit.edu/). Real-time qRT-PCR analyses were conducted using the iScript

one-step RT-PCR kit with SYBR green (Bio-Rad) along with the MyiQ iCycler real-time

PCR detection system (Bio-Rad, Hercules, CA), and the16S rRNA gene was used for

normalization as described in a previous publication (17).

Analysis of ars gene distribution by PCR. To determine the distribution of the

arsB and acr3 genes in various C. jejuni isolates, arsB-specific primers (arsB56F and

arsB1185R) and acr3-specific primers (cje1733F and cje1733R) (39) were designed from

the genomic sequence of C. jejuni NCTC 11168 and RM1221, respectively, and used in

PCR analyses with the genomic templates of different C. jejuni strains and the Ex Taq

polymerase (TaKaRa Bio Inc., Japan). These C. jejuni isolates were derived from human,

chicken, and turkey. PCR was performed in a volume of 50 µl containing 0.2 µM of

primers, 250 µM of deoxynucleoside triphosphates, and 1.25 U of TaKaRa Ex Taq

polymerase. Annealing temperature at 50oC and elongation time for 1 min 10 sec were

used for the PCR reactions.

69

Results

Genetic features of arsB, arsC2, and arsR3. arsB encodes a putative arsenic

efflux membrane protein (428 amino acids) and shows amino acid sequence homology to

ArsB in Shewanella sp. ANA-3 (32% identity; E=8e-55) (31), Staphylococcus aureus (33%

identity; E=2e-65) (16), Escherichia coli (32% identity; E=3e-54) (8, 33, 37), and

Acidithiobacillus caldus (33% identity; E=1e-57) (38). ArsB contains eleven probable

transmembrane helices predicted by TMHMM2.0 (Fig. 1). Analysis of several published

genome sequences of C. jejuni strains showed that the arsB gene is immediately

downstream of the gidA gene (Fig. 2A), which encodes a putative tRNA uridine 5-

carboxymethylaminomethyl modification enzyme (13). RT-PCR (using primers

arsBgidAF and arsBgidAR) amplified a transcript spanning both gidA and arsB,

suggesting that these two genes form an operon and are co-transcripted. cj0717 encodes a

small protein (109 aa), which is predicted to belong to the arsenate reductase (ArsC)

family and the Yffb subfamily. Yffb is an uncharacterized bacterial protein encoded by

the yffb gene, marginally similar to the amino-acid sequences of classical arsenate

reductases (ArsC) (Fig. 2B). cj0258 encodes an ORF of 81 aa, which is predicted to

contain a helix-turn-helix motif at aa 35-56 and belongs to the arsR family (13, 25). To

differentiate cj0258 from the asrR gene and cj0717 from the arsC gene indentified in a

previous study (39), we named them as arsR3 and arsC2 in this study, respectively (Fig.

2B and C).

70

Figure 1. The membrane topologies of ArsB predicted by TMHMM. The

transmembrane domains are shaded in red. The blue line indicates loops facing inside

(cytoplasma), while the pink line depicts loops facing outside (periplasmic space). The

numbers at the bottom indicate the amino acid numbers in ArsB.

71

Figure 2. Diagrams showing the genomic localizations and mutant generation of

various ars genes. (A) Genomic organization of arsB and inactivation of arsB by

insertion of a choramphenicol resistance cassette. (B) Genomic localization of arsC2 and

inactivation of this gene by insertion of a kanamycin resistance cassette. (C) arsR3 and its

flanking gene. Inactivation of arsR3 was accomplished by insertion of a kanamycin

resistance cassette. (D) Complementation of the arsB mutant by insertion of an extra

copy of the arsB gene downstream of 16S rRNA. (E) The ars operon identified in C.

jejuni CB5-28 and inactivation of arsC by insertion of a kanamycin resistance cassette.

72

Role of arsB, arsC2, and arsR3 in arsenic resistance. To define the role of arsB,

arsC2, and arsR3 in arsenic resistance in Campylobacter, their insertional mutants were

compared with the wild-type strain NCTC 11168 for susceptibility to arsenic compounds.

According to the MIC results from the agar dilution method, inactivation of arsB resulted

in 8- and 4-fold reduction in the MICs of arsenite and arsenate, respectively, while

mutation of arsC2 or arsR3 did not affect the MICs of arsenite and arsenate (Table 3).

All three mutants showed no changes in the MIC of roxarsone. Chromosomal

complementation of arsB restored the MIC of arsenite to wild type, and over-expression

of arsB showed 16-fold increase in the MIC of arsenite compared to the wild-type strain.

Interestingly, chromosomal complementation could not restore the MIC of arsenate to the

wild-type level and over expression of arsB showed no change in the MIC of arsenate

compared to the wild-type strain. Furthermore, we transferred the arsB mutation to two

additional Campylobacter strains (ATCC 33560 and CB5-28) by natural transformation.

Inactivation of arsB in ATCC 33560 resulted in 8-fold reduction in the MICs of arsenite

and had no affect on the MIC of arsenate and roxarsone (Table 3). Inactivation of arsB in

CB5-28, which harbors a 4-gene ars operon as described in a previous study (39), did not

affect the MICs of arsenite, arsenate, and roxarsone, suggesting the function of arsB in

CB5-28 is masked by the fully functional ars operon.

73

Table 3. The MICs of roxarsone, arsenite and arsenate in various C. jejuni strains as determined by the agar dilution method*

MIC (µg/ml) Strains Arsenite Arsenate Roxarsone NCTC 11168 8 512 8 11168∆arsB 1(↓8) 128(↓4) 8 11168∆arsC2 8 512 8 11168∆arsR3 8 512 8 11168∆arsB∆arsC2 1(↓8) 128(↓4) 8 11168∆arsB+arsB 128 128 8 11168+arsB 128(↑16) 512 8 ATCC 33560 8 32 8 33560∆arsB 1(↓8) 32 8 CB5-28 64 1024 64 CB5-28∆arsB 64 1024 64 CB5-28∆arsC 8 64 64 CB5-28∆arsB∆arsC 4(↓2) 64 64 * the numbers in parentheses indicate fold-changes, either increase (↑) or decrease (↓)

Mutation of the arsB did not affect the susceptibility to the other antibiotics.

To examine if arsB, arsC2, and arsR3 are associated with resistance to other heavy

metals and antibiotics, we compared the susceptibilities of the arsB, arsC2, and arsR3

mutants with the wild-type strain to antimonate, copper sulfate, mercury bichloride,

erythromycin, tetracycline, ethidium bromide, azithromycin, ciprofloxacin, florfenicol,

telithromycin, and clindamycin. The results showed no differences between the wild type

and mutants in the susceptibilities to these compounds (data not shown), indicating that

these genes do not confer resistance to other heavy metals and antibiotics.

The arsB is inducible by arsenite and arsenate. To determine if the expression

of the arsB is inducible by arsenic compounds, strain NCTC11168 was cultured in MH

broth with different concentrations of arsenite and arsenate. The transcription levels of

74

arsB in these cultures were compared with those grown in MH broth without arsenic

compounds using real time qRT-PCR. As shown in Figure 3, the expression of arsB was

induced in a dose-dependent manner. At 0.5 times of MIC, both arsenite and arsenate

produced approximately 16-fold induction in the expression of arsB. This result clearly

indicates that the arsB gene in Campylobacter is inducible by both arsenite and arsenate.

Figure 3. Dose-dependent induction of arsB in 11168 by arsenite and arsenate.

The concentrations of the arsenic compounds supplemented into the culture media are

labeled at the bottom of the panel.

75

Distribution of arsB and acr3 genes in Campylobacter isolates. Data described

above indicated that ArsB contributes to arsenic resistance in C. jejuni. Additionally,

Acr3 is associated with high-level of arsenic resistance in certain Campylobacter strains

(39). We determined the distribution of the arsB and acr3 genes in various

Campylobacter isolates of different animal origins. As shown in Table 4, arsB was

present in 76 of the 98 isolates examined in this study, while acr3 were present in 58 of

the 98 isolates. Interestingly, all the tested strain contains at least one of the two genes.

Furthermore, arsB is more prevalent in chicken (97.1%) and human (92.0%) isolates than

in turkey isolates (50.0%) (p < 0.0001 and p < 0.005), while the prevalence of acr3 is

higher in turkey isolates (84.2%) than in chicken (45.7%) (p < 0.005) and human (40.0%)

(p < 0.005) isolates.

Table 4. Distribution of arsB and acr3 in C. jejuni isolates of different origins

Source of isolates

Total number

arsB-positive acr3-positive Positive with both arsB and acr3

Positive with either arsB or acr3

Chicken 35 34 (97.1%) 16 (45.7%) 15 (42.9%) 35 (100.0%) Turkey 38 19 (50.0%) 32 (84.2%) 13 (34.2%) 38 (100.0%) Human 25 23 (92.0%) 10 (40.0%) 8 (32.0%) 25 (100.0%) total 98 76 (77.6%) 58 (59.2%) 36 (36.7%) 98 (100.0%)

Discussion

The results from this study identified ArsB as a membrane transporter involved in

arsenic resistance in C. jejuni. This conclusion is based on the following findings. First,

inactivation of arsB resulted in reduced resistance to both arsenite and arsenate. Second,

complementation of the arsB mutant restored the MIC of arsenite (but not arsenate) to

that of the wild-type strain. Third, overexpression of arsB in C. jejuni 11168 increased

76

the MIC of arsenite by 16-fold, but did not affect the MIC of arsenate. These results

suggest that ArsB in C. jejuni is a specific efflux transporter for arsenite, but not for

arsenate. However, arsenate can be converted to arsenite by ArsC in bacteria including C.

jejuni, where arsenite can be subsequently extruded by ArsB and Acr3 (39). Thus, ArsB

contributes to the resistance to arsenate in an indirect manner. These results are consistent

with the arsB findings on in other bacterial species.

The ArsB in C. jejuni shares homology with the other members of the ArsB

family. The ArsB transporter is employed by many bacteria as an arsenic detoxification

method and is proposed to have 12 membrane-spanning regions (43). ArsB appears to be

an uniporter which extrudes As(III) at a moderate rate using membrane potential. In some

cases, with the help from ArsA (ATPase), ArsB can extrude As(III) more efficiently (27).

Several previous studies also showed that Sb(III) is a substrate for certain ArsB

transpoters (28). In this study, we found that the ArsB in C. jejuni does not play a role in

the resistance to other heavy metals and antibiotics. The inability of C. jejuni ArsB to

extrude Sb(III) is different from the result reported in other bacteria (28) and suggests

that the ArsB in C. jejuni is more or less unique. Indeed, the predicted transmembrane

topology of the ArsB in C. jejuni contains 11 transmembrane domains, instead of 12 of

typical ArsB proteins, which might explain the difference in substrate specificities.

The contributions of arsB to arsenic resistance vary in different Campylobacter

strains. The role of ArsB in mediating arsenic resistance to As(III) is more prominent in

those strains that lack the ars operon, such as NCTC 11168 and ATCC 33560 (Table 3).

On the contrary, inactivation of arsB in the highly resistant CB5-28 strain (containing an

77

ars operon) did not change the MIC of arsenite (Table 3). To test if the function of ArsB

is masked by the presence of the ars operon, we constructed an arsB and arsC double

knockout strain (CB5-28∆arsB∆arsC) in the CB5-28∆arsC background (39). Compared

to CB5-28∆arsC, CB5-28∆arsB∆arsC showed 2-fold reduction in the MIC of arsenite,

but not 8-fold reduction as observed in NCTC 11168 (Table3). This could be explained

by the fact that the polar effect caused by the arsC mutation did not totally inactivate the

function of acr3, as qRT-PCR showed, that the transcript of acr3 was reduced 10-fold in

the arsC mutant compared with that in the wild-type strain (39). Thus, the reduced

expression of acr3 still plays a role in arsenite resistance. These results suggest that the

function of arsB is most likely masked in those C. jejuni strains harboring a fully

functional ars operon.

The level of arsenic resistance mediated by ArsB in C. jejuni is not as high as that

mediated by the ars operon. This could be explained for two reasons. The published data

in other bacteria indicated that ArsB functions more efficiently when facilitated by ArsA

(ATPase) (9, 27). However, analysis of the whole genomes of C. jejuni did not identify

an arsA homology in these strains. Thus, the lack of arsA in C. jejuni might reduce the

efflux ability of ArsB. In addition, the expression level of arsB might be another factor

affecting its contribution to arsenic resistance. As show in Table 3, artificial

overexpression of arsB in C. jejuni NCTC 11168 resulted in a drastic increase in the

resistance to arsenite, to a level that is even higher than the resistance conferred by the

ars operon. These findings suggest that ArsB mediated arsenic resistance level in

Campylobacter is mainly dependent on the expression level of arsB.

78

The putative arsR (arsR3) genes did not contribute to arsenic resistance in C.

jejuni NCTC 11168. As a transcriptional repressor, ArsR modulates the expression of ars

genes through interaction with the arsenite substrate (39). In this study, the induction

experiment revealed that addition of arsenite or arsenate in culture media induced the

expression of arsB, and the induction was dose-dependent (Fig. 3). Thus, we speculated

that the expression of arsB is modulated by an ArsR like regulator. However, inactivation

of arsR3, which is separated from the arsB gene on chromosome, did not affect the

expression of arsB in C. jejuni NCTC 11168, suggesting that the expression of arsB is

not modulated by arsR3 and is likely regulated by an unknown mechanism.

The putative arsC (arsC2) genes did not contribute to arsenic resistance C. jejuni

NCTC 11168. Conversion of AS(V) to AS(III) by arsenate reductase and then extrusion

by arsenite transporters is an important detoxification mechanism used by many bacterial

organisms (15, 39). The previously characterized ars operon in C. jejuni contains an arsC,

which mediates arsenic resistance in Campylobacter (39). Inactivation of arsC2 in C.

jejuni NCTC 11168 did not change the susceptibility to arsenic compounds. Additionally,

we inactivated arsC2 in the arsB mutant background of C. jejuni NCTC 11168, and the

the arsB and arsC double knockout did not further alter the resistance to arsenate

compared to the arsB mutant (data not shown), further suggesting that arsC2 is not

involved in arsenic resistance in Campylobacter.

Since arsenic compounds are extensively used as feed additives in the poultry

industry, Campylobacter is frequently exposed to arsenic toxicity. In order to survive the

selection pressure, Campylobacter has acquired detoxification mechanisms. A previous

79

study identified a four-gene ars operon contributing to arsenic resistance in

Campylobacter. However, not all the Campylobacter strains harbor this system (39). In

this study, we identified an additional membrane transporter contributing to arsenic

resistance in Campylobacter, suggesting that there are at least two arsenic efflux systems

(Acr3 and ArsB) in Campylobacter. Interestingly, the prevalence of both arsB and acr3

in human isolates is similar to those in chicken isolates, but differ from those in turkey

isolates (Table 4). According to a report from American Meat Institute on April 2009, per

capita consumption of chicken was five times more than that of turkey in 2007. In

addition, poultry is the main reservoir for human C. jejuni infections. Thus, the big

portion of Campylobacter infections is probably caused by consumption of chicken. This

might explain that the presence of ars genes in human isolates is similar to those in

chicken isolates. Furthermore, the results revealed a broad distribution of arsB and acr3

genes (ars operon) in C. jejuni isolates of different animal origins (Table 4) and suggest

that at least one of the two genes is required for the adaptation of Campylobacter in

arsenic-rich niches. These findings provide new insights into the adaptative mechanisms

of Campylobacter in the poultry production system.



JH YW OS. Analyzed the data: ZS JH QZ. Contributed reagents/materials/analysis tools:

QZ. Wrote the paper: ZS QZ.

80

References

1. 2006. Clinical and Laboratory Standards Institute. Performance standards for

antimicrobial susceptibility testing; 16th informational supplement. CLSI M100-

S16. Clinical and Laboratory Standards Institute, Wayne, PA.

2. Ajees, A. A., J. Yang, and B. P. Rosen. 2011. The ArsD As(III)

metallochaperone. Biometals 24:391-9.

3. Basu, A., J. Mahata, S. Gupta, and A. K. Giri. 2001. Genetic toxicology of a

paradoxical human carcinogen, arsenic: a review. Mutat. Res. 488:171-94.

4. Butcher, B. G., S. M. Deane, and D. E. Rawlings. 2000. The chromosomal

arsenic resistance genes of Thiobacillus ferrooxidans have an unusual

arrangement and confer increased arsenic and antimony resistance to Escherichia

coli. Appl. Environ. Microbiol. 66:1826-33.

5. Butcher, B. G., and D. E. Rawlings. 2002. The divergent chromosomal ars

operon of Acidithiobacillus ferrooxidans is regulated by an atypical ArsR protein.

Microbiology 148:3983-92.

6. Cai, J., K. Salmon, and M. S. DuBow. 1998. A chromosomal ars operon

homologue of Pseudomonas aeruginosa confers increased resistance to arsenic

and antimony in Escherichia coli. Microbiology 144 ( Pt 10):2705-13.

7. Chapman, H. D., and Z. B. Johnson. 2002. Use of antibiotics and roxarsone in

broiler chickens in the USA: analysis for the years 1995 to 2000. Poult. Sci.

81:356-64.

81

8. Chen, C. M., T. K. Misra, S. Silver, and B. P. Rosen. 1986. Nucleotide

sequence of the structural genes for an anion pump. The plasmid-encoded

arsenical resistance operon. J. Biol. Chem. 261:15030-8.

9. Dey, S., and B. P. Rosen. 1995. Dual mode of energy coupling by the oxyanion-

translocating ArsB protein. J. Bacteriol. 177:385-9.

10. Diorio, C., J. Cai, J. Marmor, R. Shinder, and M. S. DuBow. 1995. An

Escherichia coli chromosomal ars operon homolog is functional in arsenic

detoxification and is conserved in Gram-negative bacteria. J. Bacteriol. 177:2050-

6.

11. Flora, S. J. 2011. Arsenic-induced oxidative stress and its reversibility. Free

Radic. Biol. Med. 51:257-81.

12. Garbarino, J. R., A. J. Bednar, D. W. Rutherford, R. S. Beyer, and R. L.

Wershaw. 2003. Environmental fate of roxarsone in poultry litter. I. Degradation

of roxarsone during composting. Environ. Sci. Technol. 37:1509-14.

13. Gundogdu, O., S. D. Bentley, M. T. Holden, J. Parkhill, N. Dorrell, and B. W.

Wren. 2007. Re-annotation and re-analysis of the Campylobacter jejuni

NCTC11168 genome sequence. BMC Genomics 8:162.

14. Humphrey, T., S. O'Brien, and M. Madsen. 2007. Campylobacters as zoonotic

pathogens: a food production perspective. Int. J. Food. Microbiol. 117:237-57.

82

15. Ji, G., and S. Silver. 1992. Reduction of arsenate to arsenite by the ArsC protein

of the arsenic resistance operon of Staphylococcus aureus plasmid pI258. Proc.

Natl. Acad. Sci. USA 89:9474-8.

16. Ji, G., and S. Silver. 1992. Regulation and expression of the arsenic resistance

operon from Staphylococcus aureus plasmid pI258. J. Bacteriol. 174:3684-94.






31.

19. Lin, Y. F., A. R. Walmsley, and B. P. Rosen. 2006. An arsenic

metallochaperone for an arsenic detoxification pump. Proc. Natl. Acad. Sci. USA

103:15617-22.

20. Lopez-Maury, L., F. J. Florencio, and J. C. Reyes. 2003. Arsenic sensing and

resistance system in the cyanobacterium Synechocystis sp. strain PCC 6803. J.

Bacteriol. 185:5363-71.

21. Muraoka, W. T., and Q. Zhang. 2011. Phenotypic and Genotypic Evidence for

L-Fucose Utilization by Campylobacter jejuni. J. Bacteriol. 193:1065-75.

83

22. Murphy, J. N., and C. W. Saltikov. 2009. The ArsR repressor mediates arsenite-

dependent regulation of arsenate respiration and detoxification operons of

Shewanella sp. strain ANA-3. J. Bacteriol. 191:6722-31.

23. Neyt, C., M. Iriarte, V. H. Thi, and G. R. Cornelis. 1997. Virulence and arsenic

resistance in Yersiniae. J. Bacteriol. 179:612-9.

24. Oremland, R. S., and J. F. Stolz. 2003. The ecology of arsenic. Science

300:939-44.







26. Qin, J., B. P. Rosen, Y. Zhang, G. Wang, S. Franke, and C. Rensing. 2006.

Arsenic detoxification and evolution of trimethylarsine gas by a microbial arsenite

S-adenosylmethionine methyltransferase. Proc. Natl. Acad. Sci. USA 103:2075-

80.


28. Rosen, B. P. 1999. Families of arsenic transporters. Trends Microbiol. 7:207-12.

84

29. Rosenstein, R., K. Nikoleit, and F. Gotz. 1994. Binding of ArsR, the repressor

of the Staphylococcus xylosus (pSX267) arsenic resistance operon to a sequence

with dyad symmetry within the ars promoter. Mol. Gen. Genet. 242:566-72.



3.

31. Saltikov, C. W., A. Cifuentes, K. Venkateswaran, and D. K. Newman. 2003.

The ars detoxification system is advantageous but not required for As(V)

respiration by the genetically tractable Shewanella species strain ANA-3. Appl.


32. Saltikov, C. W., and B. H. Olson. 2002. Homology of Escherichia coli R773

arsA, arsB, and arsC genes in arsenic-resistant bacteria isolated from raw sewage

and arsenic-enriched creek waters. Appl. Environ. Microbiol. 68:280-8.

33. San Francisco, M. J., L. S. Tisa, and B. P. Rosen. 1989. Identification of the

membrane component of the anion pump encoded by the arsenical resistance

operon of R-factor R773. Mol. Microbiol. 3:15-21.

34. Sato, T., and Y. Kobayashi. 1998. The ars operon in the skin element of Bacillus

subtilis confers resistance to arsenate and arsenite. J. Bacteriol. 180:1655-61.




85

36. Suzuki, K., N. Wakao, T. Kimura, K. Sakka, and K. Ohmiya. 1998.

Expression and regulation of the arsenic resistance operon of Acidiphilium

multivorum AIU 301 plasmid pKW301 in Escherichia coli. Appl. Environ.


37. Tisa, L. S., and B. P. Rosen. 1990. Molecular characterization of an anion pump.

The ArsB protein is the membrane anchor for the ArsA protein. J. Biol. Chem.

265:190-4.

38. Tuffin, I. M., P. de Groot, S. M. Deane, and D. E. Rawlings. 2005. An unusual

Tn21-like transposon containing an ars operon is present in highly arsenic-

resistant strains of the biomining bacterium Acidithiobacillus caldus.





40. Wang, Y., and D. E. Taylor. 1990. Chloramphenicol resistance in

Campylobacter coli: nucleotide sequence, expression, and cloning vector

construction. Gene 94:23-8.

41. Wosten, M. M., M. Boeve, M. G. Koot, A. C. van Nuenen, and B. A. van der

Zeijst. 1998. Identification of Campylobacter jejuni promoter sequences. J.

Bacteriol. 180:594-9.

42. Wu, J., and B. P. Rosen. 1991. The ArsR protein is a trans-acting regulatory

protein. Mol. Microbiol. 5:1331-6.

86

43. Wu, J., L. S. Tisa, and B. P. Rosen. 1992. Membrane topology of the ArsB

protein, the membrane subunit of an anion-translocating ATPase. J. Biol. Chem.

267:12570-6.

44. Yang, H. C., J. Cheng, T. M. Finan, B. P. Rosen, and H. Bhattacharjee. 2005.

Novel pathway for arsenic detoxification in the legume symbiont Sinorhizobium

meliloti. J. Bacteriol. 187:6991-7.

45. Yang, J., S. Rawat, T. L. Stemmler, and B. P. Rosen. 2010. Arsenic binding

and transfer by the ArsD As(III) metallochaperone. Biochemistry 49:3658-66.

46. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage

cloning vectors and host strains: nucleotide sequences of the M13mp18 and

pUC19 vectors. Gene 33:103-19.

47. Ye, J., H. C. Yang, B. P. Rosen, and H. Bhattacharjee. 2007. Crystal structure

of the flavoprotein ArsH from Sinorhizobium meliloti. FEBS Lett. 581:3996-4000.

48. Zhang, Y. B., S. Monchy, B. Greenberg, M. Mergeay, O. Gang, S. Taghavi,

and D. van der Lelie. 2009. ArsR arsenic-resistance regulatory protein from

Cupriavidus metallidurans CH34. Antonie. Van. Leeuwenhoek. 96:161-70.

87

CHAPTER 5. IDENTIFICATION OF A NOVEL MEMBRANE TRANSPORTER

MEDIATING RESISTANCE TO ORGANIC ARSENIC IN CAMPYLOBACTER

JEJUNI

A paper to be submitted to Journal of Bacteriology (JB)

Zhangqi Shen,1 Taradon Luangtongkum,1,2 Zhiyi Qiang,3 Byeonghwa Jeon1,

Qijing Zhang1

Department of Veterinary Microbiology and Preventive Medicine, 1116 Veterinary

Medicine Complex, Iowa State University, Ames, IA 50011, USA,1 Department of

Veterinary Public Health, Chulalongkorn University, Bangkok, 10330, Thailand,2

Department of Food Science and Human Nutrition, 220 MacKay, Iowa State University,

Ames, Iowa 50011, USA3

Abstract

Roxarsone (4-hydroxy-3-nitro-phenylarsonic acid), an organo arsenical, is used as

a feed additive in the poultry industry for growth promotion. Campylobacter jejuni, a

major foodborne pathogen causing gastroenteritis in humans, is highly prevalent in

poultry and is reportedly resistant to arsenic compounds. Although bacterial mechanisms

involved in the resistance to inorganic arsenic have been well understood, the molecular

basis for organic arsenic resistance has not been described. In this study, we report the

identification of a novel membrane transporter (named ArsP) that contributes to organic

arsenic resistance in Campylobacter. ArsP is predicted to be a membrane permease

containing eight transmembrane helices, distinct from other known arsenic transporters.

Analysis of multiple C. jejuni isolates from various animal species revealed that the

88

presence of an intact arsP gene is associated with elevated resistance to roxarsone. In

addition, inactivation of arsP in C. jejuni resulted in a 4-fold reduction in the MIC of

roxarsone compared to the wild-type strain. Furthermore, cloning of arsP into a C. jejuni

strain lacking a functional arsP led to 8-fold increase in the MIC of roxarsone. Neither

mutation nor overexpression of arsP affected the MICs of inorganic arsenic including

arsenite and arsenate in Campylobacter. Moreover, acquisition of arsP gene in NCTC

11168 accumulated less roxarsone than the wild type strain lacking arsP gene. Together,

these results indicate that ArsP functions as an efflux transporter specific for extrusion of

roxarsone and contributes to the resistance to organic arsenic in C. jejuni.

Introduction

Campylobacter, a Gram-negative microaerobic bacterium, is a leading bacterial

cause of food-borne diseases and Campylobacter infections account for 400 to 500

million cases of diarrhea each year in developed and developing countries countries (22).

A recent estimate from CDC indicated that campylobacteriosis account for 9% of

foodborne illness (over 840,000 people) every year in the United States (26). C. jejuni

and Campylobacter coli are the two most important species that cause food-borne

infections of humans, and raw poultry meat is the main source of these two pathogens

(11). Roxarsone (4-hydroxy-3-nitro-phenylarsonic acid), an organoarsenic compound, is

extensively used as a feed additive in poultry industry to control bacterial and coccidial

infections and improve weight gain, feed utilization and pigmentation (6). It has been

estimated that roxarsone was utilized in approximately 70% of the U.S. broiler

production units (6), and the concentrations of roxarsone used in feed formulations vary

89

from 22.7 to 45.4 g/ton (9). Roxarsone is excreted into fresh litter, and then converted to

inorganic arsenate [As(V)] in composted litter via the bioconversion processes (9, 28).

The total arsenic concentration in the litter ranges from 15 to 48 mg/kg (9, 12, 28).

In bacteria, several mechanisms for arsenic detoxification have been characterized,

including reduction of AS(V) to AS(III) by arsenate reductases and extrdusion or

methylation of AS(III) (19-20, 30). The arsenic detoxification systems are encoded by

various ars genes including arsA, arsB, arsC, arsD, arsH, arsM, and arsR. These ars

genes can be organized as operons, such as arsRBC, arsRABC, and arsRDABC, or exist

singly on bacterial chromosome (3-5, 8, 15, 25, 29-30). ArsA functions as an ATPase,

which is an energy source for ArsB (7, 23), while ArsB functions an AS(III)-specific

transporter (20, 30). As arsenate reductase, ArsC converts As(V) to AS(III) in the

cytoplasm (13, 20), and then As(III) is extruded by other AS(III)-specific transporters (20,

30). ArsD is an arsenic metallochaperone which transfers As(III) to ArsA and increases

the rate of arsenic extrusion (2, 14, 19, 32). ArsH is an NADPH-flavin mononucleotide

oxidoreductase, and the detoxification mechanism is probably through oxidation of

arsenite to the less toxic arsenate or reduction of trivalent arsenicals to volatile arsines

that escape from cells (17, 35). ArsM is an AS(III) S-adenosylmethionine

methyltransferase, which methylates AS(III) to volatile trimethylarsine (19). ArsR

functions as a transcription regulator, which controls the expression of other ars genes

(16, 21, 30-31, 36).

Campylobacter is well adapted in the poultry production system and must have

means to overcome the toxic effects of arsenic compounds. Recently, a four-gene ars

90

operon associated with high-level resistance to inorganic arsenic was identified in

Campylobacter (30). This operon encodes a putative membrane permease (ArsP), a

transcriptional repressor (ArsR), an arsenate reductase (ArsC), and an efflux protein

(Acr3). The expression of this operon is directly regulated by ArsR, which binds to the

ars promoter DNA and controls the expression of the ars genes. Insertional mutation of

acr3 and arsC revealed that the two genes contribute to arsenite and arsenate resistance,

but had no effects on the MIC of roxarsone in Campylobacter.(30). However, the

function of ArsP has not been characterized. In general, the molecular mechanisms

directly involved in organic arsenic (roxarsone) resistance have not been described in any

bacteria. In this study, we identify ArsP as a specific mechanism for roxarsone resistance

in Campylobacter. Analysis of multiple C. jejuni isolates from various animal species

revealed that presence of an intact arsP gene is associated with elevated resistance to

roxarsone. In addition, inactivation of arsP in C. jejuni resulted in a 4-fold reduction in

the MIC of roxarsone compared to the wild-type strain. Furthermore, cloning of arsP into

a C. jejuni strain lacking a functional arsP led to 8-fold increase in the MIC of roxarsone.

Moreover, acquisition of arsP gene in NCTC 11168 accumulated less roxarsone than the

wild type strain lacking arsP gene. Together, these results indicate that ArsP functions as

an efflux transporter specific for roxarsone and contributes to the resistance to organic

arsenic in C. jejuni.


Bacterial strains and growth conditions. The key bacterial strains and plasmids

used in this study are listed in Table 1. Escherichia coli DH5α used for genetic

91

manipulation was grown in Luria-Bertani (LB) broth or on LB agar supplemented with

kanamycin (30 µg/ml), chloramphenicol (10 µg/ml), or ampicillin (100 µg/ml). C. jejuni

strains were cultured on Mueller-Hinton (MH) agar or in MH broth at 42oC

microaerobically (5% O2, 10% CO2, 85% N2). When needed, kanamycin (30 µg/ml) or

chloramphenicol (4 µg/ml) was supplemented into the media.

Table 1. Key plasmids and bacterial strains used in this study



Plasmids pUC19 Cloning vector (33) pDRH265 pUC19 with 1.4 kb cat-rpsL cassette (10) pArsPC pUC19+arsP+cat-rpsL This study pRY112 Shuttle vector (34) pRY112+arsP pRY112+arsP This study pRY112+4ars pRY112 containing the 4-gene ars operon This study Strains DH5α Plasmid propagation E.coli strain Invitrogen NCTC 11168 Wild-type C. jejuni (18) 11168+arsP NCTC 11168 derivative, pRY112+arsP This study 11168+4ars NCTC 11168 derivative, pRY112+4ars This study CB5-28 Wild-type C. jejuni (30) CB5-28∆arsC CB5-28 derivative, ∆arsC::Kanr (30) CB5-28∆arsP CB5-28 derivative, ∆arsP::cat-rpsL This study

Chemical compounds and antibiotics. The chemicals and antibiotics used in this

study were purchased from Sigma-Aldrich Co. LLC (arsenite, arsenate, chloramphenicol,

kanamycin, streptomycin, and ampicillin) and Thermo Fisher Scientific Inc. (roxarsone).

Antimicrobial susceptibility tests. The MICs of various arsenic compounds and

antibiotics against C. jejuni strains were determined using the agar dilution antimicrobial

92

susceptibility testing method according to the protocol from CLSI (1) with modifications.

Every MIC test was repeated at least three times. C. jejuni ATCC 33560 was used as a

quality control organism in this study.

Construction of the arsP mutant. Primers AspT-F and ArsPT-R (Table 2) were

used to amplify a 1.8 kb arsP fragment with two PsiI sites in the middle region of the

fragment. The PCR fragment was cloned into the pUC19 in the SmaI sites, resulting in

the construction of pArsP. The chloramphenicol resistance cat::rpsL cassette was

prepared by digesting pDRH265 (10) with SmaI and subsequent purification with agarose

gel extraction (QIAquick gel extraction kit; Qiagen, Valencia, CA). The cassette was then

ligated into the PsiI site of arsP in pArsP to yield the pArsPC plasmid. Suicide vector

pArsPC was introduced into C. jejuni CB5-28 using electroporation. Transformants were

selected on MH agar containing chloramphenicol at 4 µg/ml. The insertion of cat-rpsL

cassette into the arsP gene was confirmed by PCR analysis.

Table 2. Key primers used in this study

Primers Sequence (5’→3’)

S1730-F GTTCCTGTTCTACCATACCG S1730-R TAGCCACGCCTAAAATAATC Ars1-F CATTCATTTTAGAGTTATTGCGTATAAAACATACT ArsPN-R CCATGTTTAAGAGCTCTTGTAGATCAC ArsPT-F CATCCATATACAAACTTCCAATACCCC ArsPT-R CCTGCGGAAAATACTTCGATATCTATGCC ArsPW-F ACATACTGGTTCTAAATTTCTGATCAAACG ArsPW-R AATCCAGAAAGCAAGGACTATCAACCT

93

Cloning of the arsP and the ars operon into C. jejuni NCTC 11168. The entire

arsP gene including its promoter region was amplified from strain CB5-28 by PCR using

primers Ars1-F and ArsPN-R (Table 2). The PCR product was cloned into the SmaI-

digested plasmid to construct pRY112+arsP. The constructed plasmid pRY112+arsP

was sequenced and confirmed that no mutations in the cloned sequence occurred. The

shuttle plasmid, pRY112+arsP, was transferred into NCTC 11168 by conjugation. The

strain was named 11168+arsP. The entire ars operon including arsP, arsR, arsC, and

acr3 was amplified from strain CB5-28 by PCR using primers ArsPW-F and ArsPW-R.

The PCR product was cloned into the SmaI-digested pRY112 plasmid to construct

pRY112+4ars. The constructed plasmid pRY112+4ars was sequenced and confirmed

that no mutations in the cloned sequence occurred. The shuttle plasmid pRY112+4ars

was transferred into NCTC 11168 by conjugation. The strain was named 11168+4ars.

PCR and sequence analysis of arsP. To detect the distribution of arsP with in

various C. jejuni isolates, the S1730-F and S1730R primers (Table 2) were used to

amplify an intragenic region of the arsP gene. Since the arsP gene in some strains (C.

jejuni NCTC 11168) are pseudogenes, if a positive PCR product was obtained, the whole

coding region of arsP was amplified using another pair of primers, ArsPW-F and

ArsPW-R, and the product was then sequenced in the DNA facility at Iowa State

University. PCR was performed in a volume of 50 µl containing 0.2 µM of primers, 250

µM of deoxynucleoside triphosphates, and 1.25 U of TaKaRa Ex Taq polymerase.

Annealing temperature at 51oC and elongation time for 1 min were used for the primer

pair of S1730-F and S1730R, while annealing temperature at 55oC and elongation time

for 4 min were used for the primer pair of ArsPW-F and ArsPW-R.

94

Roxarsone accumulation assay. To determine if ArsP contributes to reduce

intracellular concentration of roxarsone, accumulation assay was conducted using C.

jejuni NCTC 11168 and 11168+arsP. NCTC 11168 and 11168+arsP were inoculated on

MH agar plates and incubated microaerobically for 24 h. Bacterial cells were collected

from the plates, inoculated into fresh MH broth (200 ml), and then incubated at 42oC with

shaking at 160 rpm. After 4-5 h incubation, the cells were harvested by centrifugation,

washed once in PBS buffer, and then resuspended in PBS to 1010~11 CFU/ml. Three

different tubes were prepared for each sample. After incubation at 37oC for 10 min,

roxarsone was added to a final concentration of 500 µg/ml. Aliquots (1.0 ml) were taken

after 15 min, and immediately mixed with 5.0 ml of ice-cold PBS. Bacterial cells were

harvested by centrifugation at 4oC at 6000 g for 5 min, and washed twice with 10 ml of

ice-cold PBS. The cells were resuspended in 0.5 ml PBS and then disrupted by

ultrasonication. The supernatant was taken after centrifugation at 15,000 x g for 5 min

and filtered with a 0.45 µm filter. HPLC analysis was performed on a Beckman Coulter

126 HPLC, equipped with a photodiode array detector (model 168) and a model 508

autosampler (Beckman Coulter, Inc., Brea, CA). The mobile phase was monopotassium

phosphate (0.05 M) : acetic acid (10%) : methanol = 90 : 7 : 3 (V/V/V) at a flow rate of

1.0 ml/min. A universal reversed phase Supelcosil ABZ+Plus column

(150 mm × 4.6 mm × 5 µm, Supelco, Bellefonte, PA) was used at room temperature. A

standard curve was prepared by measuring the peak area from PBS containing serially

diluted roxarsone and used to determine the concentration of roxarsone in the samples.

95

Results

Arsenic resistance varies in Campylobacter strains of different animal origins.

To determine if arsenic resistance in Campylobacter is associated with the origin of

isolation, we examined the MICs of various arsenic compounds in C. jejuni isolates from

different animal species. In total, 131 C. jejuni isolates (35 from chicken, 27 from human,

35 from sheep, and 34 from turkey) were evaluated by the agar dilution method (Tables 3,

4, and 5). In general, MICs of roxarsone, arsenite, and arsenate ranged from 4 to 256

µg/ml, 1 to 256 µg/ml, and 16 to >1024 µg/ml, respectively. The MIC50 of roxsarone for

the isolates from sheep is lower than those for the isolates from chicken, human, and

turkey (Table 3); the MIC50 of arsenite for the isolates from sheep is equal to those from

human and turkey, but lower than that from chicken (Table 4); and the MIC50 of arsenate

for isolates from sheep is lower than those from human, turkey, and chicken (Table 5). A

similar trend was also observed with the MIC90 of the three tested arsenic compounds.

Statistical analysis with the Kruskal-Wallis Test (Nonparametric ANOVA) indicated that

the MICs of C. jejuni from different animal species are significantly different in the

resistance to roxarsone (p < 0.005), arsenite (p < 0.002), and arsenate (p < 0.0001).

Further Dunn’s Multiple Comparisons Test indicated that the MICs of roxarsone for the

sheep isolates are significantly lower than those of the human (p < 0.01), chicken (p <

0.05), and turkey isolates (p < 0.05); the MICs of arsenite for the sheep isolates were

significantly lower than those of the chicken isolates (p < 0.001); the MICs of arsenate

for the sheep isolates are significantly lower than those of the chicken (p < 0.001) and

turkey isolates (p < 0.001); and the MICs of roxarsone, arsenite, and arsenate for the

human, chicken, and turkey isolates are not significantly different.

96

Table 3. Roxarsone MIC distributions in C. jejuni isolates of different origins

Isolates Total number

Numbers of isolates inhibited by ROX (µg/ml)

MIC50/MIC90

(µg/ml) 4 8 16 32 64 128 256 512

Chicken 35 2 11 7 4 11 0 0 0 16/64

Human 27 5 4 4 5 5 3 1 0 32/128

Sheep 35 1 23 6 3 2 0 0 0 8/32

Turkey 34 0 7 18 7 0 1 1 0 16/32

Table 4. Arsenite MIC distributions in C. jejuni isolates of different origins


Numbers of isolates inhibited by AS(III) (µg/ml) MIC50/MIC90

(µg/ml) 1 2 4 8 16 32 64 128 256

Chicken 35 0 2 1 8 9 7 8 0 0 16/64

Human 27 2 0 3 9 6 0 5 2 0 8/64

Sheep 35 0 0 8 23 0 4 0 0 0 8/32

Turkey 34 0 1 10 9 5 2 6 0 1 8/64

Table 5. Arsenate MIC distributions in C. jejuni isolates of different origins


Numbers of isolates inhibited by AS(V) (µg/ml) MIC50/MIC90

(µg/ml) 16 32 64 128 256 512 1024 >1024

Chicken 35 0 5 10 1 9 6 4 0 256/1024

Human 27 6 6 4 1 4 4 0 2 64/512

Sheep 35 6 19 2 2 6 0 0 0 32/256

Turkey 34 1 4 4 13 3 3 3 3 128/1024

Genetic features of arsP. arsP (cje1730) is the first gene in the 4-gene ars

operon and encodes a putative transmembrane permease (315 aa) (Fig. 1A). As predicted

by TMHMM 2.0, ArsP has eight putative transmembrane helices (TMS) and a large

hydrophilic loop (67 aa) in the central portion (between the fourth and fifth helices) of t

protein (Fig. 2). The large central hydrophilic loop is predicted to be outside the inner

membrane, facing the periplasmic space. Thus

different from that of ArsB and Acr3. Additionally, ArsP shares little sequen

with ArsB or Acr3, which are transporters for As(III) extrusion. These observatio

suggest that ArsP may have the

GeneBank database, there are ArsP homologs in other bacterial

functions remain unknown. The amino acid lengths of analyzed ArsP homologues from

~300 to ~350 and all of them contain 8 TMS with hydrophilic loops between the fourth

and fifth TMSs, ranging from 49 to 100

likely that ArsP also plays a role in arsenic resistance in

Figure 1. Diagrams showing the genomic organization of

ars genes into C. jejuni 11168

of arsP by insertion of a choramphenicol resistance cassette. (

CB5-28 to the shuttle plasmid pRY112, which

by conjugation. (C) Cloning of the

pRY112, which was then transferred

97

hydrophilic loop (67 aa) in the central portion (between the fourth and fifth helices) of t

2). The large central hydrophilic loop is predicted to be outside the inner

membrane, facing the periplasmic space. Thus, the predicted topology of ArsP is quite

different from that of ArsB and Acr3. Additionally, ArsP shares little sequen

with ArsB or Acr3, which are transporters for As(III) extrusion. These observatio

suggest that ArsP may have the distinct substrate specificity. Based on Blast search of the

GeneBank database, there are ArsP homologs in other bacterial species (Fig

unknown. The amino acid lengths of analyzed ArsP homologues from


and fifth TMSs, ranging from 49 to 100 amino acids. Since arsP is in the

likely that ArsP also plays a role in arsenic resistance in Campylobacter.

Figure 1. Diagrams showing the genomic organization of arsP and cloning of the

11168. (A) The ars operon in C. jejuni CB5-28, and i

choramphenicol resistance cassette. (B) Cloning of

28 to the shuttle plasmid pRY112, which was finally transferred into NCTC11168

ing of the ars operon from CB5-28 to the shuttle plasmid

was then transferred into NCTC11168 by conjugation.

hydrophilic loop (67 aa) in the central portion (between the fourth and fifth helices) of the

2). The large central hydrophilic loop is predicted to be outside the inner

the predicted topology of ArsP is quite

different from that of ArsB and Acr3. Additionally, ArsP shares little sequence homology

with ArsB or Acr3, which are transporters for As(III) extrusion. These observations

ty. Based on Blast search of the

species (Fig. 3), but their

unknown. The amino acid lengths of analyzed ArsP homologues from


is in the ars operon, it is

.

and cloning of the

28, and inactivation

ing of arsP from

into NCTC11168

the shuttle plasmid

98

Figure 2. The membrane topologies of ArsP predicted by TMHMM. The

transmembrane domains are shaded in red. The blue line indicates loops facing inside

(cytoplasma), while the pink line depicts loops facing outside (periplasmic space). The

numbers at the bottom indicate the amino acid numbers in ArsP. A large hydrophilic loop

(67 aa) is in the central portion (between the fourth and fifth helices) of the ArsP.

99

100


ClustalW. The lengths of

with C. jejuni, the identities are greater than 36% (>3E

conserved at the N- and C

region of the proteins, which corresponds to the large hydrophil

The colors of the residues indicate their physicochemical properties. Red represents small

(small and hydrophobic (include aromatic except Y)

AVFPMILW. Blue represents acid

represents basic amino acids

sulfhydryl, amine, and G acid amino acids, including STYHCNGQ.

residues in that column are identical in all sequences in the alignment. ":" me

conserved substitutions have been observed. "." means that semi

are observed.

101


The lengths of these proteins range from 298 to 357 amino acids

, the identities are greater than 36% (>3E-56). The sequences are more

and C-terminal regions, while large deletions occur in the middle

region of the proteins, which corresponds to the large hydrophilic loop shown in Fig. 2.

residues indicate their physicochemical properties. Red represents small

(include aromatic except Y)) amino acids, including

AVFPMILW. Blue represents acidic amino acids, including DE. Magenta color

represents basic amino acids except H, including RK. Green color represents hydroxyl,

sulfhydryl, amine, and G acid amino acids, including STYHCNGQ. "*" means that the

residues in that column are identical in all sequences in the alignment. ":" me

conserved substitutions have been observed. "." means that semi-conserved substitutions


mino acids. Compared

56). The sequences are more

terminal regions, while large deletions occur in the middle

ic loop shown in Fig. 2.

residues indicate their physicochemical properties. Red represents small

) amino acids, including

ta color

, including RK. Green color represents hydroxyl,

"*" means that the

residues in that column are identical in all sequences in the alignment. ":" means that

conserved substitutions

102

Contribution of arsP to the arsenic resistance in C. jejuni. To determine the

role of arsP in arsenic resistance in C. jejuni, insertional mutagenesis was used to

construct an isogenic mutant. The arsP mutant was compared with the parent strain CB5-

28 as well as CB5-28∆arsC for the susceptibility to arsenic compounds using the agar

dilution method (Fig. 1A). According to MIC results from the agar dilution method,

inactivation of arsP resulted in a 4-fold reduction in the MICs of roxarsone, arsenite, and

arsenate, respectively, while inactivation of the downstream arsC gene resulted in 4-fold

and 32-fold reductions in the MICs of arsenite and arsenate, respectively, but did not

affect the MIC of roxarsone (Table 6). This finding suggests that arsP is associated with

roxarsone resistance in Campylobacter. Since the arsP mutation causes a polar effect on

the expression of the downstream genes in the ars operon, we further analyzed the

function of arsP by cloning the gene into NCTC 11168, which lacks arsP and does not

contain a functional ars operon. According to MIC results from the agar dilution method,

acquisition of the single arsP gene in NCTC 11168 resulted in an 8-fold increase in the

MICs of roxarsone, but not in the MICs of arsenite or arsenate (Table 6). When the entire

ars operon was cloned into NCTC 11168, it resulted in 4-fold, 8-fold, and 2-fold increase

in the MICs of roxarsone, arsenite, and arsenate, respectively. These results indicate that

arsP specifically contributes to the resistance to roxarsone, but not to arsenite or arsenate.

103

Table 6. The MICs of roxarsone, arsenite, and arsenate in various C. jejuni constructs (µg/ml)*

Strains Roxarsone Arsenite Arsenate 11168 16 16 1024 11168+arsP 128(↑8) 16 1024 11168+4ars 64(↑4) 128(↑8) 2048(↑2) CB5-28 32 64 2048 CB5-28∆arsP 8(↓4) 16(↓4) 512(↓4) CB5-28∆arsC 32 16(↓4) 64(↓32) * the numbers in parentheses indicate fold-changes, either increase (↑) or decrease (↓)

Correlation of arsP with increased resistance to roxarsone in different C.

jejuni strains. To examine the association between arsP and the enhanced resistance to

roxarsone, the presence of arsP in different C. jejuni isolates were determined using PCR.

In total, 10 C. jejuni strains were used for this purpose. Statistical analysis of the PCR

and MIC data with Wilcoxon rank sum test with continuity correction indicated that the

presence of an intact arsP is significantly (p < 0.01) associated with elevated resistance to

roxarsone (Table 7), further confirming that arsP encodes a roxarsone-resistant

transporter in various C. jejuni strains. The PCR results also showed that an intact arsP

gene is not always linked with arsC and acr3 as reported in a previous study (30). For

example, strains CB4-4, CB1-17, CT3-2, and Clev9100 contain an intact arsP gene;

however, they do not have the arsC and acr3 genes. On the contrary, strains CB7-22,

CB3-6, CB7-22 do not contain an arsP gene from PCR amplification, while they have

both arsC and acr3. Strains RM1221 and CB5-28 are the two strains that contain the 4-

gene ars operon including arsP, arsR, arsC, and acr3 (Table 7). These results further

confirm that arsP is associated with roxarsone resistance in C. jejuni.

104

Table 7. Presence of arsP detected by PCR and its association with elevated resistance to roxarsone

Strains MICs (µg/ml) Presence of intact arsP

RM1221 128 + CB5-28 64 + CB4-4 256 + CB1-17 64 + CT3-2 64 + Clev9100 128 + NCTC11168 16 -a CB7-22 16 -b CB3-6 16 -b CT3-7 16 -b a arsP is a pseudogene in NCTC11168 b absence of arsP by PCR detection “-” indicates frame shift mutations in arsP, or lack of arsP

The arsP gene is not inducible by roxarsone. To determine if the transcriptional

level of arsP gene is inducible by roxarsone, CB5-28 strain was cultured in MH broth

with different concentrations of roxarsone. The transcriptional level of arsP in cultures

supplemented with or without roxarsone did not differ as measured by qTR-PCR (data

not shown). This result suggests that arsP is not inducible by roxarsone.

ArsP reduces intracellular accumulation of roxarsone. An accumulation assay

using HPLC was performed to assess whether ArsP functions as an efflux transporter for

roxarsone. The wavelength was 337 nm and the retention time was 5.2 min for roxarson

(Fig. 4B). The linear regression equation was y = (x – 287.54) / 11176 with R2 of 0.9999,

where y is the concentration of roxarsone, and x is the peak area of the sample. The

NCTC 11168 wild type, which does not have a functional arsP gene, accumulated 44.8%

more roxarsone than 11168+arsP (containing an intact arsP gene) (Fig. 4A). This result

suggests that ArsP functions as an efflux transporter, extruding roxarsone out of

Campylobacter cells.

Figure 4. Intracellular accumulation of roxarsone

in NCTC 11168 WT and 11168

deviation of triplicate samples in one representative experiment (

Chromatogram of the HPLC test to determine roxarsone accumulation in

This chromatogram shows the absorbance levels of light at

at 5.2 min represents the detection

Discussion

The results from this study identify ArsP as a novel membrane transporter

mediating resistance to organic arsenic in

multiple pieces of evidence. Inactivation of

105

that ArsP functions as an efflux transporter, extruding roxarsone out of

Figure 4. Intracellular accumulation of roxarsone. (A) Accumulation of roxarsone

in NCTC 11168 WT and 11168arsP. Each bar represents the mean and standard

deviation of triplicate samples in one representative experiment (p < 0.02

HPLC test to determine roxarsone accumulation in

This chromatogram shows the absorbance levels of light at 337 nm over time.

the detection of roxarsone.


mediating resistance to organic arsenic in C. jejuni. This conclusion is supported by

multiple pieces of evidence. Inactivation of arsP resulted in 4-fold reduction in the MIC

that ArsP functions as an efflux transporter, extruding roxarsone out of

Accumulation of roxarsone

. Each bar represents the mean and standard

2). (B)

HPLC test to determine roxarsone accumulation in Campylobacter.

nm over time. The peak


This conclusion is supported by

fold reduction in the MIC

106

of roxarsone, while cloning of a functional arsP into a C. jejuni strain lacking a

functional arsP showed 8-fold increase in the MIC of roxarsone, but not to arsenite and

arsenate. Additionally, ArsP reduced intracellular accumulation of roxarsone in C. jejuni

and is associated with elevated resistance to roxarsone in various strains. These findings

indicate that ArsP is a resistance mechanism specific for organic arsenic. Based on the

results from this study and previously known information regarding arsenic resistance in

Campylobacter, the various mechanisms involved in arsenical detoxification mechanisms

are summarized in Figure 5.

Figure 5. Diagram illustrating the currently known arsenical detoxification

mechanisms in Campylobacter. Campylobacter has an arsenic reductase (ArsC), which

converts arsenate to arsenite, two types of arsenite transporters (ArsB and Acr3), and

another transporter specifically extruding roxarsone out of the cells.

107

Due to the use of roxarsone in poultry production, Campylobacter spp. in poultry

must be able to deal with the toxicity and selective pressure from arsenic compounds. A

previous study indicated that the Campylobacter isolates from conventional poultry

products had significantly higher roxarsone MICs than those isolated from antimicrobial-

free poultry products, suggesting that the association of the roxarsone use in conventional

poultry facilities with the development of high-level roxarsone resistance in

Campylobacter spp. in poultry (24). In this study, we demonstrated that the presence of

an intact arsP is associated with increased resistance to roxarsone, but not to arsenite and

arsenate, in various C. jejuni isolates (Table 7). This observation plus the findings from

the mutagenesis and cloning experiments established ArsP as a key resistance mechanism

for roxarsone, providing a molecular explanation for the prevalence of roxarsone-

resistant Campylobacter in poultry. Although arsP is found to be in the same operon with

arsC and acr3 in certain C. jejuni strains, it is functionally distinct from the other two

genes which confer resistance to arsenite and arsenate (30). Additionally, it is also found

that arsP does not have to be associated with arsC and acr3 (Table 7) (30) and may

function independently in mediating roxarsone resistance. These findings suggest that

arsP is evolved differently from other ars genes.

In this study, we tested the MICs of arsenic compounds for the C. jejuni isolates

from chicken, turkey, human, and sheep. An interesting finding is that the MICs of

roxarsone for sheep isolates were significantly lower than those isolates from human,

chicken, and turkey. This is probably due to the fact that the sheep industry does not use

roxarsone as a feed additive, while roxarsone is extensively used on chicken and turkey

farms. Interestingly, human C. jejuni isolates showed similar roxarsone resistance to

108

those isolates from turkey and chicken. This could be explained by the fact that poultry is

the main reservoir for human C. jejuni infections. Thus the roxarsone resistance in the

human isolates might be originated from poultry. These observations suggest that the use

of roxarsone selects for arsenic-resistant Campylobacter that may be subsequently

transmitted to humans.

Although ArsP contributes to roxarsone resistance, its expression is not inducible

by roxarsone. Previously it is revealed that arsP is regulated by ArsR, which is encoded

in the same ars operon as arsP, arsC and acr3 (30). The induction of the ars operon is

through the inhibition of ArsR binding to the promoter DNA, which is mediated by

conformational change in ArsR triggered by arsenite binding (27). Thus, arsenite is the

true inducer of ArsR, and the arsenate-mediated induction is via bioconversion of

arsenate to arsenite by ArsC reductase in Campylobacter. In this study, the presence of

roxarsone in culture did not induce the expression of arsP. This result indicates that

roxarsone does not directly induce the ars operon. However, roxarsone can be converted

to organic arsenic in chicken litter through biological processes (9) and is a potential

indirect inducer for the ars operon in the poultry production environment. Additionally,

the MICs of roxarsone for the isolates containing the arsP genes range from 64 to 256

µg/ml (Table 7). The wide range of MICs suggests the differential expression of arsP and

the existence of unknown regulatory mechanisms for arsP in those isolates. This

possibility remains to be determined in future studies.

109



TL ZQ BJ. Analyzed the data: ZS QZ. Contributed reagents/materials/analysis tools: QZ.

Wrote the paper: ZS QZ.

References

1. 2006. Clinical and Laboratory Standards Institute. Performance standards for

antimicrobial susceptibility testing; 16th informational supplement. CLSI M100-

S16. Clinical and Laboratory Standards Institute, Wayne, PA.

2. Ajees, A. A., J. Yang, and B. P. Rosen. 2011. The ArsD As(III)

metallochaperone. Biometals 24:391-9.

3. Butcher, B. G., S. M. Deane, and D. E. Rawlings. 2000. The chromosomal

arsenic resistance genes of Thiobacillus ferrooxidans have an unusual

arrangement and confer increased arsenic and antimony resistance to Escherichia

coli. Appl. Environ. Microbiol. 66:1826-33.

4. Butcher, B. G., and D. E. Rawlings. 2002. The divergent chromosomal ars

operon of Acidithiobacillus ferrooxidans is regulated by an atypical ArsR protein.


5. Cai, J., K. Salmon, and M. S. DuBow. 1998. A chromosomal ars operon

homologue of Pseudomonas aeruginosa confers increased resistance to arsenic

and antimony in Escherichia coli. Microbiology 144 ( Pt 10):2705-13.

110

6. Chapman, H. D., and Z. B. Johnson. 2002. Use of antibiotics and roxarsone in

broiler chickens in the USA: analysis for the years 1995 to 2000. Poult. Sci.

81:356-64.

7. Dey, S., and B. P. Rosen. 1995. Dual mode of energy coupling by the oxyanion-

translocating ArsB protein. J. Bacteriol. 177:385-9.

8. Diorio, C., J. Cai, J. Marmor, R. Shinder, and M. S. DuBow. 1995. An

Escherichia coli chromosomal ars operon homolog is functional in arsenic

detoxification and is conserved in Gram-negative bacteria. J. Bacteriol. 177:2050-

6.

9. Garbarino, J. R., A. J. Bednar, D. W. Rutherford, R. S. Beyer, and R. L.

Wershaw. 2003. Environmental fate of roxarsone in poultry litter. I. Degradation

of roxarsone during composting. Environ. Sci. Technol. 37:1509-14.

10. Hendrixson, D. R., B. J. Akerley, and V. J. DiRita. 2001. Transposon

mutagenesis of Campylobacter jejuni identifies a bipartite energy taxis system

required for motility. Mol. Microbiol. 40:214-24.

11. Humphrey, T., S. O'Brien, and M. Madsen. 2007. Campylobacters as zoonotic

pathogens: a food production perspective. Int. J. Food. Microbiol. 117:237-57.

12. Jackson, B. P., and P. M. Bertsch. 2001. Determination of arsenic speciation in

poultry wastes by IC-ICP-MS. Environ. Sci. Technol. 35:4868-73.

111

13. Ji, G., and S. Silver. 1992. Reduction of arsenate to arsenite by the ArsC protein

of the arsenic resistance operon of Staphylococcus aureus plasmid pI258. Proc.

Natl. Acad. Sci. USA 89:9474-8.

14. Lin, Y. F., A. R. Walmsley, and B. P. Rosen. 2006. An arsenic

metallochaperone for an arsenic detoxification pump. Proc. Natl. Acad. Sci. USA

103:15617-22.

15. Lopez-Maury, L., F. J. Florencio, and J. C. Reyes. 2003. Arsenic sensing and

resistance system in the cyanobacterium Synechocystis sp. strain PCC 6803. J.

Bacteriol. 185:5363-71.

16. Murphy, J. N., and C. W. Saltikov. 2009. The ArsR repressor mediates arsenite-

dependent regulation of arsenate respiration and detoxification operons of

Shewanella sp. strain ANA-3. J. Bacteriol. 191:6722-31.

17. Neyt, C., M. Iriarte, V. H. Thi, and G. R. Cornelis. 1997. Virulence and arsenic

resistance in Yersiniae. J. Bacteriol. 179:612-9.







19. Qin, J., B. P. Rosen, Y. Zhang, G. Wang, S. Franke, and C. Rensing. 2006.

Arsenic detoxification and evolution of trimethylarsine gas by a microbial arsenite

112

S-adenosylmethionine methyltransferase. Proc. Natl. Acad. Sci. USA 103:2075-

80.


21. Rosenstein, R., K. Nikoleit, and F. Gotz. 1994. Binding of ArsR, the repressor

of the Staphylococcus xylosus (pSX267) arsenic resistance operon to a sequence

with dyad symmetry within the ars promoter. Mol. Gen. Genet. 242:566-72.



3.

23. Saltikov, C. W., and B. H. Olson. 2002. Homology of Escherichia coli R773

arsA, arsB, and arsC genes in arsenic-resistant bacteria isolated from raw sewage

and arsenic-enriched creek waters. Appl. Environ. Microbiol. 68:280-8.

24. Sapkota, A. R., L. B. Price, E. K. Silbergeld, and K. J. Schwab. 2006. Arsenic

resistance in Campylobacter spp. isolated from retail poultry products. Appl.


25. Sato, T., and Y. Kobayashi. 1998. The ars operon in the skin element of Bacillus

subtilis confers resistance to arsenate and arsenite. J. Bacteriol. 180:1655-61.




113

27. Shi, W., J. Dong, R. A. Scott, M. Y. Ksenzenko, and B. P. Rosen. 1996. The

role of arsenic-thiol interactions in metalloregulation of the ars operon. J. Biol.

Chem. 271:9291-7.

28. Stolz, J. F., E. Perera, B. Kilonzo, B. Kail, B. Crable, E. Fisher, M.

Ranganathan, L. Wormer, and P. Basu. 2007. Biotransformation of 3-nitro-4-

hydroxybenzene arsonic acid (roxarsone) and release of inorganic arsenic by

Clostridium species. Environ. Sci. Technol. 41:818-23.

29. Suzuki, K., N. Wakao, T. Kimura, K. Sakka, and K. Ohmiya. 1998.

Expression and regulation of the arsenic resistance operon of Acidiphilium

multivorum AIU 301 plasmid pKW301 in Escherichia coli. Appl. Environ.





31. Wu, J., and B. P. Rosen. 1991. The ArsR protein is a trans-acting regulatory

protein. Mol. Microbiol. 5:1331-6.

32. Yang, J., S. Rawat, T. L. Stemmler, and B. P. Rosen. 2010. Arsenic binding

and transfer by the ArsD As(III) metallochaperone. Biochemistry 49:3658-66.

33. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage

cloning vectors and host strains: nucleotide sequences of the M13mp18 and

pUC19 vectors. Gene 33:103-19.

114

34. Yao, R., R. A. Alm, T. J. Trust, and P. Guerry. 1993. Construction of new

Campylobacter cloning vectors and a new mutational cat cassette. Gene 130:127-

30.

35. Ye, J., H. C. Yang, B. P. Rosen, and H. Bhattacharjee. 2007. Crystal structure

of the flavoprotein ArsH from Sinorhizobium meliloti. FEBS Lett. 581:3996-4000.

36. Zhang, Y. B., S. Monchy, B. Greenberg, M. Mergeay, O. Gang, S. Taghavi,

and D. van der Lelie. 2009. ArsR arsenic-resistance regulatory protein from

Cupriavidus metallidurans CH34. Antonie. Van. Leeuwenhoek. 96:161-70.

115

CHAPTER 6. SUMMARY

In this dissertation, the specific induction of CmeABC by salicylate was

demonstrated, and the induction was shown to reduce the susceptibility of C. jejuni to

fluoroquinolone antibiotics and promote the emergence of antibiotic resistant mutants.

Additionally, our studies identified ArsB and ArsP as new efflux transporters for arsenite

and roxarsone, respectively, which contribute significantly to arsenic resistance in C.

jejuni. These findings significantly enhance our knowledge about the functions of

antimicrobial efflux systems in Campylobacter and indicate that these systems are

important players in facilitating Campylobacter adaptation to various niches.

Despite the fact that these findings were made under laboratory conditions, they

may be extrapolated to the natural environments occupied by Campylobacter. For

example, salicylate is commonly present in plant and food, and is widely used in

veterinary and human medicine. Exposure of Campylobacter to salicylate is expected

during host colonization and transmission through the food chain. Since salicylate

induces the expression of CmeABC, such exposure may have an unwanted consequence

in promoting the development of antibiotic resistance. Likewise, arsenic compounds are

present in nature and are used as feed additives for poultry production. As Campylobacter

is highly prevalent in poultry, arsenic usage would select for arsenic-resistant

Campylobacter and influence the ecology and evolution of Campylobacter in animal

reservoirs. At this stage, acquisition of arsenic resistance is not found to influence the

susceptibility of Campylobacter to clinically important antibiotics, but it is unknown if

arsenic resistance mechanisms confer cross resistance to biocides and disinfectants. This

116

possibility awaits further investigation in future studies. Additionally, future attention

should be given to understanding the interaction between the antimicrobial efflux systems

and other physiological pathways as such efforts will likely discover novel physiological

functions of these efflux transporters. Ultimately, the knowledge gained on antimicrobial

efflux systems will potentially facilitate the development of rationalized strategies to

control Campylobacter and its antibiotic resistance in clinical settings or in animal

reservoirs.

117

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my major professor, Dr. Qijing Zhang,

for his support, guidance, and patience throughout my Ph.D. project and the writing of

this thesis. I am sure it would have not been possible without his help.

I would also like to thank my committee members, Dr. Cathy L. Miller, Dr. F.

Chris Minion, Dr. Edward Yu, and Dr. Lisa K. Nolan, for their time, guidance, and

contributions to this my Ph.D. study.

I am truly indebted and thankful to all the previous and current members of Dr.

Zhang’s laboratory for their technical and scientific assistance. Dr. Jing Han, Dr. Orhan

Sahin, and Dr. Byeonghwa Jeon helped me a lot when I started my Ph.D. study. Dr.

Xiaoying Pu performed a number of of the immunoblotting assays and Dr. Taradon

Luangtongkum made several mutants which were used in this project. Our previous

Laboratory Manager, Rachel Sippy, and our current Laboratory Manager, Nada Pavlovic,

ordered reagents and provided other supports for me. I would like to thank my other co-

workers including but not limited to Dr. Paul Plummer, Dr. Yang Wang, Dr. Haihong

Hao, Dr. Qingqing Xia, Dr. Wayne Muraoka, Dr. Zuowei Wu, Dr. Lei Dai, Samantha A.

Terhorst, and Tara Grinnage-Pulley.

Special thanks are given to Vern Hoyt and Liz Westberg for their coordination

and efforts during my graduate study.

Finally, I want to thank Dr. Zhiyi Qiang for his help with HPLC assay.

This project was supported by grants from NIH and USDA.

Documents

Roles and molecular mechanisms of antimicrobial efflux