Role of pncA and rpsA Gene Sequencing in Diagnosis of 1

Pyrazinamide Resistance in Mycobacterium tuberculosis Isolates 2

from Southern China 3

Running title: Pyrazinamide Resistance Diagnosis with pncA and rpsA 4

Yaoju Tan,a Zuqiong Hu,

a Tianyu Zhang,

b# Xingshan Cai,

a Haobin Kuang,

a Yanwen 5

Liu, a Junyu Chen,

a Feng Yang,

b Ke Zhang,

b Shouyong Tan,

a# and Yanlin Zhao

c# 6

State Key Laboratory of Respiratory Diseases, Department of Clinical Laboratory, 7

Guangzhou Chest Hospital, Guangzhou, Chinaa; State Key Laboratory of Respiratory 8

Diseases, Guangzhou Institutes of Biomedicine and Health (GIBH), Chinese 9

Academy of Sciences (CAS), Guangzhou, Chinab; National Tuberculosis Reference 10

Laboratory, China Center for Disease Control and Prevention, Beijing, Chinac 11

1 12

13

14

15

16

17

18

19

20

21

22

23 1 Address correspondence to Tianyu Zhang, zhang_tianyu@gibh.ac.cn; Shouyong Tan,

tanshyo@163.com, or Yanlin Zhao, zhaoyanlin@chinatb.com

JCM Accepts, published online ahead of print on 16 October 2013J. Clin. Microbiol. doi:10.1128/JCM.01903-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

24

ABSTRACT 25

We sequenced pncA and rpsA genes plus flanking regions of 161 Mycobacterium 26

tuberculosis isolates and found 10 new pncA and 3 novel rpsA mutations in 27

pyrazinamide-resistant strains determined by the Bactec MGIT 960. The 3’ of rpsA 28

might be added as the target of molecular diagnosis of pyrazinamide susceptibility. 29

30

31

32

33

34

35

36

37

38

39

40

41

42

43

44

45

46

47

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

Pyrazinamide (PZA) is an indispensable first-line antituberculosis drug which 48

exhibits unique sterilizing activity for both drug sensitive and multidrug-resistant 49

tuberculosis. It can kill semi-dormant bacilli which persist in acidic-pH environments 50

inside macrophages (1), where other drugs may not act so well. It is a prodrug that 51

needs to be converted into its active form, pyrazinoic acid (POA), by the 52

Mycobacterium tuberculosis (MTB) pyrazinamidase (PZase) which is encoded by the 53

561 nucleotide (nt) pncA gene (2, 3). In 1996, the pncA gene was confirmed to be 54

strongly associated with the PZA resistance in MTB (3), and in the following year, 55

investigators found that pncA mutations constituted the primary mechanism of PZA 56

resistance (4). In 2011, through systematic review with meta-analyses, Chang KC et 57

al drew the conclusion that molecular assays based on the pncA mutations were 58

probably the way forward for detecting pyrazinamide resistance in MTB (5). 59

Molecular detection of PZA resistance-related mutations in pncA gene is indeed more 60

rapid than traditional mycobacterial susceptibility testing methods that depend on the 61

growth of MTB, and are hampered by the complication of testing PZA activity (3). 62

Shi et al recently confirmed that the ribosomal protein S1 (RpsA), encoded by rpsA 63

gene, was a target of POA which might be associated with the PZA resistance in 64

clinical MTB isolates (6), so it is worth investigating the molecular characterization of 65

rpsA gene mutations in both PZA-resistant and PZA-susceptible MTB clinical isolates. 66

However some reports suggested that rpsA gene sequencing might not play a role in 67

detecting PZA susceptibility with molecular method (7). 68

Rapid and accurate diagnosis of drug resistance contributes to early optimization of 69

MTB treatment, which is an effective way to further avoid the emergence of other 70

drug resistance and the potential PZA toxicity. However, the mutations in pncA are 71

highly diverse in different regions (8-10), which hampers the development and 72

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

application of molecular assays that are always based on the molecular 73

characterization of gene mutations. In southern China, there are no data so far 74

published describing pncA mutations in PZA-resistant clinical strains of MTB, so it is 75

necessary to analyze the profile of pncA and rpsA mutations of clinical MTB strains in 76

this region for the convenience of rapid and accurate diagnosis of PZA resistance. 77

Drug susceptibility profile of clinical isolates. It is well known that testing for the 78

PZA susceptibility (3) in vitro is very hard and the CLSI-recommended Bactec 460TB 79

radiometric system (460TB, Becton Dickinson, Sparks, MD) was replaced recently in 80

many laboratories by the nonradiometric Bactec MGIT 960 system (BT960, Becton 81

Dickinson, Sparks, MD) (11). In the present study, 161 clinical MTB strains isolated 82

from January 2011 to October 2012 from southern China, mostly (115 of 161) from 83

Guangdong province, were selected to determine their susceptibilities to PZA by 84

BT960 as recommended by the manufacturer with modified Middle brook 7H9 broth 85

(pH5.9) containing 100ȝg/ml PZA. Mycobacterium bovis BCG ATCC34540 and 86

MTB H37Rv ATCC27294 were used as PZA-resistant and PZA-susceptible controls, 87

respectively. The susceptibility of these isolates to rifampicin (RIF), isoniazide (INH), 88

ethambutol (EMB) and streptomycin (STR) were previously performed by BT960 89

when the patients were hospitalized in Guangzhou Chest Hospital, the biggest 90

tuberculosis treatment center located in southern China (12). Of the 161 MTB clinical 91

isolates, 109 isolates were PZA-susceptible and 52 were PZA-resistant.Their 92

susceptibilities to RIF, INH, EMB and STR are summarized in Table 1 and Table 2. 93

Sequencing pncA and rpsA genes of the clinical isolates. As pncA and rpsA genes 94

are the only known genes related to the PZA susceptibility and their corresponding 95

flanking regions (FR) may contain regulatory elements which may affect gene 96

expression, it is reasonable that mutation in FR may alter the mutants’ susceptibility 97

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

to PZA. We analyzed the pncA and rpsA genes and their corresponding FR. No 98

typical promoter was found in upstream of pncA gene from -1 to -358 nt including its 99

upstream gene Rv2044c. Though there are only 162 nts between rpsA and its upstream 100

gene (Rv1629), a typical putative prokaryotic promoter was found as: 101

CCGAGTTTGTCCAGCGTGTACCCGTCGAGTAGCCTCGTCAGGTACCAATC 102

(-90 to -41 nt of rpsA) which was predicted with online program 103

(http://www.fruitfly.org/seq_tools/promoter.html). The score was 0.86 with the total 104

score 1.0. The boxed G was supposed to be the transcription starting site. There were 105

only 25 nts between rpsA and its downstream gene and no regulatory element was 106

found. We designed primers to amplify and sequence the whole pncA and rpsA 107

genes+FR of the clinical strains according to sequences of the MTB H37Rv 108

(GenBank Accession No. NC000962) using the software Primer Premier 5.0 (Premier, 109

Canada). F1 and R1 for pncA gene+FR, F2 and R2 for rpsA gene+FR. Primers F1, 110

5'-TGCCACTCGCCGGTAACCGG (321 to 340 nt downstream of pncA) and R1, 111

5'-GGTGGCCGCCGCTCAGCTGG (-119 to -100 nt of pncA); primers F2, 112

5'-GGCCGCAGCTGGGACGCGGC (-192 to -173 nt of rpsA) and R2, 113

5'-CGGTCCAGCGCTCCGTCTGC (203 to 222 nt downstream of rpsA).The 114

additional rpsA sequencing primers (HC-0815-3-R1, 5'-GTCCTCATTGGCTTGC; 115

HC-0815-3-R2, 5'-CGTTGTTGCGGTTCTTGTC) and all other primers in this study 116

were synthesized at BGI,China, where DNA sequencing was performed. All the 117

PZA-resistant isolates that had no pncA+FR mutation were repeated for their 118

susceptibility testing and their rpsA genes and pncA genes were resequenced in a 119

double-blind form. The results were exactly the same as the first time. 120

Transcription of MTB pncA gene in a polycistron. Only 40 nts exist between pncA 121

and Rv2044c and 1 nt overlapped between pncA and its downstream gene (Rv2042c), 122

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

so we infered that pncA might be co-transcribed with its surrounding genes in a 123

polycistron (Fig. 1A). We thus carried out a reverse transcription PCR (RT-PCR) 124

experiment to prove this suggestion. Four pairs of primers were designed: 125

Af(5’-ATCCGCATCAGCACCG)-Ar(5’-CCCTCGCAGAAGTCGTTC),Cf(5’-GGC126

ACGCCACTGCTGAA)-Cr(5’-CGAACCCACCGGGTCTT) and 127

Df(5’-ATGACTTTAGGCGAGGATGA)-Dr(5’-TCGAACGGCTTATTGACC) for 128

amplifying the fragments spanning Rv2045c-Rv2044c-pncA, pncA-Rv2042c and 129

Rv2042c-Rv2041c, respectively; 130

Bf(5’-CAATCGAGGCGGTGTTC)-Br(5’-CAATGATCGGTGGCAATAC) were 131

used to amplify a fragment in pncA as a positive control. Total RNA was extracted 132

from MTB H37Ra or the clinical -11nt mutant at their log phases by the RNAiso Plus 133

kit. Then the samples were treated with recombinant DNase I to remove the possible 134

contaminated genomic DNA. RT-PCR was performed using the kit DRR036S. PCR 135

products amplified with the above 4 pairs of primers using the RT-PCR products from 136

MTB H37Ra as templates were electrophorised. All the reagents for these 137

experiments were from Takara, China and the corresponding procedures were carried 138

out according to the manufacture’s instructions. The sizes of the PCR products with 139

these 4 pairs of primers were all exactly as expected: Af-Ar, 543 bp; Bf-Br, 148 bp; 140

Cf-Cr: 356 bp and Df-Dr: 255 bp (Fig. 1B). The samples with templates from 141

RT-PCR produced without adding reverse transcriptase all produced no bands, so 142

there was no genomic DNA contamination after the treatment with recombinant 143

DNase I (Fig. 1B). We verified that the pncA gene was transcribed in a polycistron in 144

MTB. So accurate description of the mutations at -11 and nearby region should be 145

that the mutation is at putative upstream regulatory region of pncA gene, but not at its 146

promoter. 147

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

pncA mutations. There was no pncA mutation in all 109 PZA-susceptible isolates 148

(0%), but 44 out of 52 (84.6%) PZA-resistant isolates showed pncA mutations (Table 149

1), which showed the strong correlation between mutations in pncA and phenotypic 150

resistance to PZA, and supported the finding that pncA mutation could cause PZA 151

resistance in MTB (2). The pncA gene mutation frequency in the PZA phenotypic 152

resistant strains here is much higher than those reported previously in other provinces 153

of China (27 to 48.1%) (13-17), but similar to those from other countries (69% to 154

98.8%) in which the PZA phenotypic resistance was determined by BT960 or 460TB 155

system (18-21). It is well known that testing for the susceptibility of PZA in vitro is 156

very hard (3) because PZA only has very weak activity even in acid pH environment, 157

in which even the control without PZA could not grow well. Many factors, such as the 158

inoculum size and the metabolic state of the culture, can have a great influence on the 159

susceptibility testing results. In the previously published papers from China, absolute 160

concentration method was used to determine the PZA phenotypic susceptibility. This 161

method may have both higher false-positive and false-negative resistance results than 162

the BT960/460TB systems do, which may contribute to the disparities in mutation 163

frequencies in pncA, especially in the PZA phenotypic sensitive ones from different 164

regions. This is partially supported by the finding that obvious discrepancies existed 165

between BT960 and 460TB and even when they were manipulated by the same 166

persons working on the same samples (7, 11). Furthermore, a 90.5% pncA mutation 167

rate in the PZA-resistant strains in eastern China determined using BT960 system was 168

reported very recently, which was very similar to our finding here (22). 169

Among the 44 mutant isolates, 8 harbored deletions, 3 exhibited double point 170

mutations, while the remaining 33 isolates had single point mutations. The mutations 171

were randomly distributed almost along the entire 588 bp-long pncA gene, from nt 23 172

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

to nt 525 in the clinical isolates. This was similar to other reports (23-25) and similar 173

to the “all pncA mutations” collected and analyzed in the TB Drug Resistance 174

Database (http://www.tbdreamdb.com/PZA_Rv2043c_AllMutations.html) in which 175

mutations were randomly distributed from nt1 to nt 554. Only 13 of 44 (29.5%) 176

mutants in this study located in the clustering of mutations of G132-T142, P69-L85 177

found by previous investigators (25) , which showed the location of mutations in pncA 178

gene was more variable than expected before (25) and not clustered as in other genes 179

associated with drug resistance, such as the rpoB gene (12). None of the isolates with 180

identical pncA mutations epidemiologically linked, so the PZA resistant strains might 181

not be obtained from transmission. For the mutations in pncA, 23 types of point 182

mutations had been reported previously (8, 9, 21, 26-29) and, to our best knowledge, 183

10 novel types of mutations (13 strains) were first found in this study. The latter 184

included all the six types of the deletion mutations (L27, 91E, 111E, 122Q, 185

130-132VVG and 131V) and four types of amino acid substitutions (D8A, S18P, 186

F58S, and E174G+M175R double mutation) in PZases as summarized in Table 1. 187

Such novel mutants accounted for 25% (13 of 52) of all the PZA-resistant isolates. 188

The PCR-single-strand conformational polymorphism (PCR-SSCP) and line probe 189

assay (LiPA) developed previously (30, 31) could detect DNA mutations quickly, but 190

they could not tell if the mutation is synonymous or nonsynoonymous. No silent 191

mutations were found in pncA gene in our study, which indicated that PCR-SSCP and 192

LiPA might be used to detect PZA resistance quickly with high successful rate by 193

detecting the pncA mutation in southern China. 194

There were still 8 PZA-resistant MTB isolates that had no mutation in pncA gene. 195

Four of them didn’t harbor any mutation including FR, three of them showed an rpsA 196

single point mutation (see below), and one other strain had a point mutation in the 197

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

putative regulatory region (A-11G) of pncA gene which was a very common mutation 198

found in isolates from other countries (10, 23-25). To explore the possible reason why 199

this can affect PZA resistance, we checked the transcription levels of pncA genes in 200

this clinical isolate and the labortory control MTB H37Ra strain. RT-PCR products 201

were prepared as described in the section demonstrating transcription of pncA gene in 202

a polycistron. Real-time PCR with SYBR Green dye was used for detecting the initial 203

concentration of pncA mRNA with sigA as inner reference. The primers used were 204

Bf-Br for pncA and sigAF 205

(5’-CTCGACGCTGAACCAGACCT)-sigAR(5’-AGGTCTTCGTGGTCTTCGTC) 206

for sigA(32). Levene’s test for equality of variances and t-test for equality of means 207

were calculated using the software SPSS13.0 (SPSS Inc., Chicago, USA). This A-11G 208

mutation may not affect pncA expression at the transcription level, because it can still 209

be transcribed in a polycistron with flanking genes in the clinical -11 mutant (data not 210

shown) and its expression level showed no difference with MTB H37Ra. This 211

mutation however may disturb the translation of pncA gene by affecting the ribosome 212

movement, because the -11 nt is close to the ribosome binding site. 213

These new findings displayed the geographically regional disparities in pncA 214

mutations and the high diverse patterns in pncA mutations (4,5,22), which partially 215

make molecular diagnosis of PZA susceptibility difficult to be adopted worldwide. 216

Therefore, systematic establishment of the relationship between the mutation 217

characterization of PZA resistance related genes and the PZA-resistance phenotype is 218

highly needed for development and application of rapid molecular assays. 219

68.4% (39/57) of MDR strains were PZA-resistant, but only 12.5% (13/104) of 220

non-MDR strains harbored such resistance. The former was significantly higher than 221

the latter (P<<0.01), which implied that the MDR strains were more likely to be 222

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

PZA-resistant than the drug sensitive ones. This result is similar to that in South 223

Africa and Thailand (4, 27). The importance of PZA in treating MDR-TB has been 224

proved recently in a murine model in that all PZA containing regimens tested showed 225

better activities than those corresponding regimens without PZA when combined with 226

second-line drugs (33). All these findings protruded rapid diagnosis of PZA resistance 227

in controlling MDR-TB. 228

rpsA mutations. Three PZA-resistant clinical isolates with wild type pncA (pncAWT

) 229

harbored single mutation of R474L, R474W and E433D, respectively. One 230

PZA-susceptible clinical isolates also contained one single mutation of Q162R. The 231

frequency of rpsA mutations showed no significant statistic difference (P=0.099) 232

between PZA-resistant and PZA-susceptible isolates, which may be because of the 233

small sample size of PZA-resistant isolates. The low frequency of rpsA mutation 234

proved again that the rpsA mutation was not the main mechanism of PZA resistance 235

in MTB, though it can affect the susceptibility to PZA (6). Alexander et al could not 236

find any rpsA mutation in PZA-resistant isolates but one RpsA protein mutation 237

(A364G) in 13 PZA sensitive strains was discovered. In addition, the rpsA gene+FR is 238

long and not very convenient for amplification and sequencing, so they concluded that 239

the analysis of the rpsA gene had no role in the diagnosis of pyrazinamide resistance 240

(7). This suggestion was further supported by Sami O. Simons and colleagues who 241

reported only 1 of 5 PZA-resistant isolates with pncAWT

had RpsA (V260I) mutation 242

(34) and that this so called mutation was even questionable according to the disparity 243

of the reported mutated codon and the amino acid it coded. However, in the current 244

study, 3 of 7 phenotypically PZAr but genotypically pncA

WT+FR

WT isolates had rpsA 245

mutations which were all clustered in the C terminal of RpsA protein (3’ of rpsA 246

gene). This was concordant with the findings by Shi et al (6) who reported that 247

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

deletion of amino acid 438 in the C-terminus of RpsA (Fig.2A) could cause PZA 248

resistance in a MTB clinical isolate with pncAWT

. We noticed that rpsA mutations in 249

the PZA sensitive strains found until now were mostly away from the C-terminal of 250

RpsA. We then made an alignment of C-terminal amino acid sequences of ribosomal 251

protein S1 (RpsA) from 33 strains of 28 mycobacterial species (Fig. 2A) and found 252

the same phenomenon as described by Shi et al (6) that, unlike other parts, 253

C-terminals of RpsA proteins were highly variable. At the same time, we drew a 254

phylogentic tree according to the C-terminal amino acid sequences of RpsAs from 255

these mycobacterial species (Fig. 2B) using Vector NTI Suite 7.0 (Invitrogen, USA). 256

It is similar to the phylogentic trees based on either nearly complete 16S rRNA gene 257

sequence or the concatenated hypervariable sequences of 16S rRNA, rpoB and hsp65 258

genes (35). Two different species, for example, the M. marinum and M. ulcerans have 259

identical RpsAs not only in the C terminal, while different strains of the same species, 260

for example, M. smegmatis MC2 155 and M. smegmatis JS263, or M. rhodesiae NBB3 261

and another strain, have very different RpsA C terminals but are even more close to 262

other species in the phylogentic tree. This is accordant with the fact that the genus 263

Mycobacterium has very limited interspecies genetic variability (35). In the current 264

study, we found that all the 3 mutated sites (E433, A438 and R474) were highly 265

conserved among all the Mycobacterium species. It is interesting that A438 deletion 266

that took place at AAA (436-438) had the same effect as A436 which seemed more 267

conserved than A438 did (Fig.2A). If E433 and R474 mutations did cause PZA 268

resistance as A438 deletion did, sequencing the C terminal of rpsA gene in isolates 269

with pncAwt

may be needful for more rapid and accurate diagnosis of PZA 270

susceptibility, especially in southern China, though the role of this region is modest. 271

86.5 % (45 of 52) phenotypically PZA- resistance could be predicted by only 272

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

sequencing pncA+FR and 92.3% (48 of 52) could be predicted if sequencing 3’ 273

terminal of rpsA was added in our study. In the meantime, it is needful to point out 274

that not all mutations at the C-terminals of RpsA may cause PZA resistance. For 275

example, M. bovis BCG has a nonfunctional pncA and an rpsA gene encoding mutated 276

RpsA (A440T) and is naturally resistant to PZA. M. smegmatis pncA and pzaA encode 277

proteins both with PZase activity and can transform PZA into POA. Introduction of M. 278

smegmatis pncA or pzaA into M. bovis BCG can restore its sensitivity to PZA (36). 279

Therefore, the resistance of M. bovis BCG to PZA is possibly because of the pncA 280

mutation but not rpsA mutation, and so the RpsA (A440T) may not play a role in PZA 281

resistance. Another strain, MTB CTRI-2 contained a mutated RpsA (M432T) at its 282

C-terminal and was PZA sensitive (37). In this regard therefore, the actual role of 283

E433 and R474 mutations of RpsA found here in PZA resistance need to be verified 284

further. 285

In conclusion, the pncA mutations were randomly dispersed along with the entire 286

gene and observed with high ratio in PZA-resistant clinical isolates in southern China. 287

28.9 % of clinical isolates with pncA+FR mutations (13 of 45) were new, which 288

displayed the high diversity of mutations in pncA gene in different regions. The pncA 289

gene was transcribed in a polycistron and the A-11G mutation of pncA did not affect 290

its expression at transcription level, which were first proved here. The 3’ of rpsA gene, 291

if not the whole rpsA gene +FR, should be added as the target for a two-step approach, 292

where only pncAWT

isolates from southern China are subjected to sequencing this 293

fragment. However, the influence of these rpsA mutations on the PZA susceptibility 294

needs to be proved further in the future as that of many pncA mutations. For more 295

accurate results, the phenotypic PZA susceptibility testing, especially using BT960 296

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

system, is needed for MTB, and in particular MDR MTB clinical isolates with no 297

known gene mutations. 298

299

ACKNOWLEDGMENTS. We are grateful to BGI for assistance in DNA 300

sequencing. This work was supported by the National Great Research Program of 301

China (2008zx10003-009). TZ was supported by the Chinese Academy of Sciences 302

'One Hundred Talents Program' (Category A) and the key layout program of the 303

Chinese Academy of Sciences (KSZD-EW-Z-006). We thank Dr. Wing Wai Yew at 304

The Chinese University of Hong Kong for helpful discussion. 305

306

REFERENCES 307

1. Heifets L, Lindholm-Levy P.1992. Pyrazinamide sterilizing activity in vitro 308 against semi-dormant Mycobacterium tuberculosis bacterial populations. Am. Rev. 309 Respir. Dis. 145:1223-1225. 310 2. Scorpio A, Zhang Y. 1996. Mutations in pncA, a gene encoding 311 pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug 312 pyrazinamide in tubercle bacillus. Nat. Med. 2:662-667. 313 3. Zhang Y, Mitchison D. 2003. The curious characteristics of pyrazinamide: a 314 review. Int. J. Tuberc. Lung Dis. 7:6-21. 315 4. Hirano K, Takahashi M, Kazumi Y, Fukasawa Y, Abe C. 1997. Mutation in 316 pncA is a major mechanism of pyrazinamide resistance in Mycobacterium 317 tuberculosis. Tuber. Lung Dis. 78:117-122. 318 5. Chang KC, Yew WW, Zhang Y. 2011. Pyrazinamide Susceptibility Testing in 319 Mycobacterium tuberculosis: a Systematic Review with Meta-Analyses. 320 Antimicrob.Agents Chemother. 55:4499-4505. 321 6. Shi W, Zhang X, Jiang X, Yuan H, Lee JS, Barry CE 3rd, Wang H, Zhang 322 W, Zhang Y. 2011. Pyrazinamide inhibits trans-translation in Mycobacterium 323 tuberculosis. Science. 333:1630-1632. 324 7. Alexander DC, Ma JH, Guthrie JL, Blair J, Chedore P, Jamieson FB. 2012. 325 Gene sequencing for routine verification of pyrazinamide resistance in 326 Mycobacterium tuberculosis: a role for pncA but not rpsA. J. Clin. Microbiol. 327 50:3726-3728. 328 8. Juréen P, Werngren J, Toro JC, Hoffner S. 2008. Pyrazinamide resistance and 329 pncA gene mutations in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 330 52:1852-1854. 331

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

9. Rodrigues Vde F, Telles MA, Ribeiro MO, Cafrune PI, Rossetti ML and 332 Zaha A. 2005. Characterization of pncA mutations in pyrazinamide-resistant 333 Mycobacterium tuberculosis in Brazil. Antimicrob. Agents Chemother.49:444-446. 334 10. Portugal I, Barreiro L, Moniz-Pereira J, Brum L. 2004. PncA mutations in 335 pyrazinamide-resistant Mycobacterium tuberculosis isolates in Portugal. 336 Antimicrob.Agents Chemother.48: 2736-2738. 337 11. Chedore P, Bertucci L, Wolfe J, Sharma M, Jamieson F. 2010. Potential for 338 erroneous results indicating resistance when using the bactec MGIT 960 system for 339 testing susceptibility of Mycobacterium tuberculosis to pyrazinamide. J. Clin. 340 Microbiol. 48:300-301. 341 12. Tan Y, Hu Z, Zhao Y, Cai X, Luo C, Zou C, Liu X. 2012. The beginning of the 342 rpoB gene in addition to the rifampin resistance determination region might be needed 343 for identifying rifampin/rifabutin cross-resistance in multidrug-resistant 344 Mycobacterium tuberculosis isolates from southern China. J. Clin. Microbiol. 345 50:81-85. 346 13. Huang TS, Lee SSJ, Tu HZ, Tu HZ, Huang WK, Chen YS, Huang CK, 347 Wann SR, Lin HH, Liu YC. 2003. Correlation between pyrazinamide activity and 348 pncA mutations in Mycobacterium tuberculosis isolates in Taiwan. 349 Antimicrob.Agents Chemother. 47:3672-3673. 350 14. Jiang Y, Peng J, Yang F, Yu L, Wang Y, Jin Q. 2007. Molecular basis of 351 Mycobacterium tuberculosis to pyrazinamide resistance. Prog in Microbiol Immunol 352 (in Chinese). 35:5-9. 353 15. Sun B, Yu H, Zhang K. 2007. Detection of pyrazinamide-resistant gene pncA of 354 Mycobacterium tuberculosis isolates in Qingdao area. Acta academiae medicinae 355 Qingdao universitatis (in Chinese). 43:125-127 turn to131. 356 16. WU X, Zhang J, Zhong M, Yu W, Ding B, Zhang J, Jia S. 2000. Studies on 357 pncA gene mutations in Mycobacterium tuberculosis isolates. Chin J TubercRespir 358 Dis (in Chinese). 23:40-42. 359 17. Xu L, Yu H, Sun B, Zhou B, Zhang W. 2009. Detection of pncAgene mutation 360 in Mycobacterium tuberculosis. Acta academiae medicinae Qingdao universitatis (in 361 Chinese). 45:424-426. 362 18. McCammon MT, Gillette JS, Thomas DP, Ramaswamy SV, Rosas II, 363 Graviss EA, Vijg J, Quitugua TN. 2005. Detection by denaturing gradient gel 364 electrophoresis of pncA mutations associated with pyrazinamide resistance in 365 Mycobacterium tuberculosis isolates from the United States-Mexico border region. 366 Antimicrob. Agents Chemother. 49: 2210-2217. 367 19. Mirabal NC, Yzquierdo SL, Lemus D, Madruga M, Milián Y, Echemendía 368 M, Takiff H, Martin A, Van der Stuyf P, Palomino JC, Montoro E. 2010. 369 Evaluation of colorimetric methods using nicotinamide for rapid detection of 370 pyrazinamide resistance in Mycobacterium tuberculosis. J. Clin. Microbiol. 371 48:2729-2733. 372

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

20. Muthaiah M, Jagadeesan S, Ayalusamy N, Sreenivasan M, Prabhu SS, 373 Muthuraj U, Senthilkumar K, Veerappan S. 2010. Molecular epidemiological 374 study of pyrazinamide-resistance in clinical isolates of Mycobacterium tuberculosis 375 from South India. Int. J. Mol. Sci. 11: 2670-2680. 376 21. Zimic M, Sheen P, Quiliano M, Gutierrez A, Gilman RH. 2010. Peruvian and 377 globally reported amino acid substitutions on the Mycobacterium tuberculosis 378 pyrazinamidase suggest a conserved pattern of mutations associated to pyrazinamide 379 resistance. Infect Genet Evol.10: 346-349. 380 22. Cui Z, Wang J, Lu J, Huang X, Zheng R, Hu Z. 2013. Evaluation of drug 381 susceptibility testing methods of clinical Mycobacterium tuberculosis isolates to 382 pyrazinamide. J. Clin. Microbiol.51:1374-1380. 383 23. Marttila HJ, Marjamäki M, Vyshnevskaya E, Vyshnevskiy BI, Otten TF, 384 Vasilyef AV, Viljanen MK. 1999. pncA Mutations in pyrazinamide-resistant 385 Mycobacterium tuberculosis isolates from northwestern Russia. Antimicrob.Agents 386 Chemother.43:1764-1766. 387 24. Park SK, Lee JY, Chang CL,Lee MK, Son HC, Kim CM, Jang HJ, Park HK, 388 Jeong SH. 2001. pncA mutations in clinical Mycobacterium tuberculosis isolates 389 from Korea. BMC Infect. Dis. 1:4. 390 25. Scorpio A, Lindholm-Levy P, Heifets L,Gilman R, Siddiqi S, Cynamon M, 391 Zhang Y. 1997. Characterization of pncA mutations in pyrazinamide-resistant 392 Mycobacterium tuberculosis. Antimicrob Agents Chemother. 41:540-543. 393 26. Jonmalung J, Prammananan T, Leechawengwongs M, Chaiprasert A. 2010. 394 Surveillance of pyrazinamide susceptibility among multidrug-resistant 395 Mycobacterium tuberculosis isolates from Siriraj Hospital, Thailand. BMC Microbiol. 396 10:223-228. 397 27. Mphahlele M, Syre H, Valvatne H, Stavrum R, Mannsåker T, Muthivhi T, 398 Weyer K, Fourie PB, Grewal HM. 2008. Pyrazinamide resistance among South 399 African multidrug-resistant Mycobacterium tuberculosis isolates. J. Clin. Microbiol. 400 46:3459-3464. 401

28. Simons SO, Van Ingen J, Van der Laan T襯Mulder A, Dekhuijzen PN, 402

Boeree MJ, Van Soolingen D.2012. Validation of pncA gene sequencing in 403 combination with the mycobacterial growth indicator tube method to test 404 susceptibility of Mycobacterium tuberculosis to pyrazinamide. J. Clin. Microbiol. 405 50:428-434. 406 29. Louw GE, Warren RM, Donald PR, Murray MB, Bosman M, Van Helden 407 PD, Young DB, Victor TC. 2006. Frequency and implications of pyrazinamide 408 resistance in managing previously treated tuberculosis patients. Int J Tuberc Lung 409 Dis.10:802-807. 410

30. Sekiguchi JI襯Nakamura T, Miyoshi-Akiyama T,Kirikae F, Kobayashi I, 411

Augustynowicz-Kopec E, Zwolska Z, Morita K, Suetake T, Yoshida H, Kato S, 412

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

Mori T , Kirikae T. 2007. Development and evaluation of a line probe assay for 413 rapid identification of pncA mutations in pyrazinamide-resistant Mycobacterium 414 tuberculosis strains. J. Clin. Microbiol. 45:2802-2807. 415 31. Sheen P, Méndez M, Gilman RH, Peña L, Caviedes L, Zimic MJ, Zhang Y, 416 Moore DAJ, Evans CA. 2009. Sputum PCR–single-strand conformational 417 polymorphism test for same-day detection of pyrazinamide resistance in tuberculosis 418 patients. J. Clin. Microbiol. 47:2937-2943. 419 32. Pelly S, Bishai WR, Lamichhane G.2012. A screen for non-coding RNA in 420 Mycobacterium tuberculosis reveals a cAMP-responsive RNA that is expressed 421 during infection. Gene. 500:85-92. 422 33. Ahmad Z, Tyagi S, Minkowski A, Peloquin CA, Grosset JH, Nuermberger 423 EL. 2013. Contribution of Moxifloxacin or Levofloxacin in Second-line Regimens 424 with or without Continuation of Pyrazinamide in Murine Tuberculosis. Am J Respir 425 Crit Care Med. 188:97-102 426 34. Simons SO, Mulder A, Van Ingen J, Boeree MJ, Van Soolingen D. 2013. Role 427 of rpsA Gene sequencing in diagnosis of pyrazinamide resistance. J. Clin. 428 Microbiol.51:382. (Letter.) 429 35. Tortoli E. 2012. Phylogeny of the genus Mycobacterium: Many doubts, few 430 certainties. Infect Genet Evol.12:827-831 431 36. Guo M, Sun ZH, Zhang Y. 2000. Mycobacterium smegmatis has two 432 pyrazinamidase enzymes, PncA and PzaA. J Bacteriol. 182:3881-3884. 433 37. Ilina EN, Shitikov EA, Ikryannikova LN, Alekseev DG, Kamashev DE, 434 Malakhova MV, Parfenova TV, Afanas'ev MV, Ischenko DS, Bazaleev NA, 435 Smirnova TG, Larionova EE, Chernousova LN, Beletsky AV, Mardanov AV, 436 Ravin NV, Skryabin KG, Govorun VM. Comparative Genomic Analysis of 437 Mycobacterium tuberculosis Drug Resistant Strains from Russia. PLoS One. 438 8:e56577. 439 440 Figure legends 441 442 FIG.1. A. The diagram of pncA gene and its surrounding genes at the MTB 443 chromosome. Af-Ar, Bf-Br, Cf-Cr and Df-Dr were primer pairs for the amplication 444 of the corresponding regions. B. The electrophoresis results of the reverse 445 transcription PCR experiments. Lane1: DNA marker (bp); Lane 2,4,6,8: reverse 446 transcription PCR products with primer pairs A, B,C,D using the cDNA as templates, 447 respectively; Lane 3,5,7,9: PCR products with primer pairs A, B,C,D using the 448 reverse transcription products without adding the reverse transcriptase as control 449 templates, respectively. 450 451

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

FIG.2. A. Alignment of C-terminal amino acid sequences of ribosomal protein S1 452 (RpsA) from different mycobacterial species. Species are represented as below with 453 GenBank accession numbers indicated in the brackets: MTB1, M. tuberculosis H37Rv 454 (NP_216146.1); MTB2, M. tuberculosis CTRI-2 (YP_005916702.1); MCT1, M. 455 canettii CIPT 140070008 (YP_007287527.1); MBV, M. bovis AF2122/97 456 (NP_855309); BCG, M. bovis BCG Pasteur 1173P2 (NP_855309.1); MCT2, M. 457 canettii CIPT 140070010 (YP_007264352.1) ; MLP, M. leprae TN (NP_301983.1); 458 MMR, M. marinum M (YP_905584.1); MUR, M. ulcerans Agy99 (YP_905584.1); 459 MAV, M. avium subsp. paratuberculosis K-10 (NP_960259); MIC1, M. 460 intracellulare 13950 (YP_005338525.1); MIC2, M. intracellulare 461 (WP_009954955.1); MCL, M. colombiense CECT 3035 (WP_007776137.1); MPF, M. 462 parascrofulaceum (WP_007169711.1); MAB, M. abscessus (YP_001703031.1); 463 WP_007169711.1MML, M.massiliense GO 06 (YP_006520985.1); MIG, M. 464 immunogenum MTCC 9506 (YP_006730099.1); MFL, M. franklinii (AEI54876.1); 465 MCN, M. chelonae (AEI54878.1); MRS2, M. rhodesiae NBB3 (YP_005002313.1); 466 MFT, M. fortuitum (WP_003884756); MSM1, M. smegmatis MC

2 155 467

(YP_888124.1); MVB, M. vanbaalenii PYR-1 (YP_954159.1); MPL, M. phlei 468 (WP_003884756.1); MTR, M. thermoresistibile (WP_003923841.1); MRS1, M. 469 rhodesiae (WP_005149060); MSM2, M. smegmatis JS623 (YP_007292760.1); 470 MCB1, M.chubuense NBB4 (YP_006453027.1); MGV, M. gilvum PYR-GC 471 (YP_001134823.1); MTC, M. tusciae (WP_006246193.1); MVC, M. vaccae 472 (WP_003931928.1); MHC, M. hassiacum (WP_005627902.1) and MXP, M. xenopi 473 (WP_003920384.1). Amino acid numbers are indicated on the top according to the 474 order of RpsA from MTB. The identical amino acids from all species are highlighted 475 in dark gray and the similar resides are highlighted in light gray, respectively. B. The 476 phylogentic tree drawn according to the C-terminal amino acid sequences of 477 RpsA from above mycobacterial species. t, type strains; n, non-type strains;?, Not 478 sure if they are type stains or not according to the web sources 479 (http://www.bacterio.net/( updated and expanded on 09-Jul-2013) and 480 http://www.atcc.org). 481

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

TABLE 1 Drug susceptibility and genotypic characteristics of PZA-resistant clinical isolates.

Resistance toa pncA+FR

b mutation(s) rpsA+FR

b mutation No. of Isolates

INH,RIF D8Ac (GACൺGCC) — 1

INH,RIF Q10P(CAGൺCCG) — 1

INH,RIF F13L(TTCൺCTC) — 1

INH,RIF S18Pc (TCGൺCCG) /P54L(CCGൺCTG) — 1

INH,RIF G24D(GGCൺGAC) — 2

INH,RIF L27c deletion — 1

INH,RIF T47A(ACCൺGCC) — 1

INH,RIF H57Y (CACൺTAC) — 2

INH,RIF F58Sc (TTCൺTCC) — 1

INH,RIF S66P(TCGൺCCG) — 1

INH,RIF T76P(ACTൺCCT) — 2

INH,RIF F81V (TTCൺGTC) — 1

INH,RIF H82R(CATൺCGG) — 1

INH,RIF E91 deletionc — 1

INH,RIF F94L(TTCൺCTC) — 2

INH,RIF F94S(TTCൺTCC) — 1

INH,RIF K96E(AAGൺGAG) — 2

INH,RIF E111 deletionc — 1

INH,RIF Q122 deletionc — 2

INH,RIF VVG130-132 deletionc — 1

INH,RIF V131 deletionc — 2

INH,RIF G132A(GGTൺGCT) — 1

INH,RIF T135P(ACCൺCCC) — 2

INH,RIF D136G(GATൺGGT) — 2

INH,RIF V139G(GTGൺGGG) — 1

INH,RIF V139A(GTGൺGCG) — 1

INH,RIF V139L(GTGൺCTG) — 1

STR,RIF Q141P(CAGൺCCG) — 1

INH,RIF L159R(CTGൺCGG) — 1

INH,STR,EMB G162D(GGTൺGAT) — 1

INH T168P(ACCൺCCC) — 3

INH,RIF E174Gc (GAGൺGGG)/ — 2

M175Rc (ATGൺAGA)

INH,RIF — R474W(CGGൺTGG) 1

INH — R474L(CGGൺCTG) 1

STR ᥊11(AൺG) — 1

INH,STR,EMB — E433D(GAGൺGAC) 1

STR — — 4

Total 45 3 48+4 a INH, isoniazid; RIF, refampin; STR, streptomycin; EMB, ethambutol.

b FR, flanking region, which means the upstream and downstream regions of the gene. —, means no mutation.

c first found nonsynonymous mutations of pncA.

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from

TABLE 2 Drug susceptibility and genotypic characteristics of PZA-sensitive clinical isolates.

Resistance to a pncA+FR

b mutation(s) rpsA+FR

b mutation No. of Isolates

— — — 57

INH,RIF — — 17

INH,RIF — Q162R(CAGൺCGG) 1

INH,STR — — 8

INH — — 6

RIF — — 4

STR — — 14

EMB — — 1

INH,STR,EMB — — 1

Total 108 1 109

a INH, isoniazid; RIF, refampin; STR, streptomycin; EMB, ethambutol.

b FR, flanking region, which means the upstream and downstream regions of the gene. —, means no mutation.

on March 27, 2021 by guest

http://jcm.asm

.org/D

ownloaded from