Upload
barnaby-montgomery
View
225
Download
1
Tags:
Embed Size (px)
Citation preview
RNAseq Applications in Genome StudiesAlexander Kanapin, PhD
Wellcome Trust Centre for Human Genetics,
University of Oxford
RNAseq Protocols Next generation sequencing protocol cDNA, not RNA sequencing Types of libraries available:
Total RNA sequencing polyA+ RNA sequencing Small RNA sequencing
Special protocols: DSN treatment Ribosomal depletion
Genome Study Applications transcriptome analysis identifying new transcribed regions expression profiling Resequencing to find genetic polymorphisms:
SNPs, micro-indels CNVs
cDNA Synthesis
Sequencing details Standard sequencing
polyA/total RNA Size slection Primers and adapters Single- and paired-end sequencing
Strand-specific sequencing Beta version Sequencing only + or – strand Mostly paired-end
Arrays vs RNAseq (1)
Correlation of fold change between arrays and RNAseq is similar to correlation between array platforms (0.73)
Technical replicates are almost identical, no need to run
Extra analysis: prediction of alternative splicing, SNPs
Low- and high-expressed genes do not match
Array vs RNAseq (2)
A bit of statistics Short reads distribution
Poisson Negative binomial Normal
Expression values normalization FPKM Normalized reads number VST (variance stabilized transformation)
Differential expression analysis Replicates vs non-replicates
Analysis Dataflow
Illumina Pipeline(FASTQ)
Alignment (BAM)
Expression
profiles/RNA
abundance
Splice variants
SNP analysis
FASTX Toolkit
(FASTQ/FASTA)
Software Short reads aligners
Stampy, BWA, Novoalign, Bowtie,… Data preprocessing (reads statistics, adapter clipping, formats
conversion, read counters) Fastx toolkit Htseq MISO samtools
Expression studies Cufflinks package RSEQtools R packages (DESeq, edgeR, baySeq, DEGseq, Genominator)
Alternative splicing Cufflinks Augustus
Commercial software Partek CLCBio
FASTQ: Sequence Data “FASTA with Qualities”
@HWI-EAS225:3:1:2:854#0/1 GGGGGGAAGTCGGCAAAATAGATCCGTAACTTCGGG +HWI-EAS225:3:1:2:854#0/1 a`abbbbabaabbababb^`[aaa`_N]b^ab^``a @HWI-EAS225:3:1:2:1595#0/1 GGGAAGATCTCAAAAACAGAAGTAAAACATCGAACG +HWI-EAS225:3:1:2:1595#0/1 a`abbbababbbabbbbbbabb`aaababab\aa_`
SAM(BAM): Alignment Data
Read IDBitwise flag Chr Pos MapQ CIGAR
Mate ref Mate pos
Insert size Sequence Scores
Extra tags
S35_42763_4 0X 15401991 25518M * 0 0CACACGATTCTCAAAGGT IIIIIIIIIIIIIIIIII XA:i:0
FPKM (RPKM): Expression Values
C= the number of reads mapped onto the gene's exonsN= total number of reads in the experimentL= the sum of the exons in base pairs.€
FPKM =109 ×C
NL
Cufflinks package http://cufflinks.cbcb.umd.edu/ Cufflinks:
Expression values calculation Transcripts de novo assembly
Cuffcompare: Transcripts comparison (de novo/genome
annotation) Cuffdiff:
Differential expression analysis
Cufflinks (Expression analysis)
gene_id bundle_id chr left right FPKM FPKM_conf_lo FPKM_conf_hi statusENSG00000236743 31390 chr1 459655 461954 0 0 0 OKENSG00000248149 31391 chr1 465693 688071 787.12 731.009 843.232 OKENSG00000236679 31391 chr1 470906 471368 0 0 0 OKENSG00000231709 31391 chr1 521368 523833 0 0 0 OKENSG00000235146 31391 chr1 523008 530148 0 0 0 OKENSG00000239664 31391 chr1 529832 532878 0 0 0 OKENSG00000230021 31391 chr1 536815 659930 2.53932 0 5.72637 OKENSG00000229376 31391 chr1 657464 660287 0 0 0 OKENSG00000223659 31391 chr1 562756 564390 0 0 0 OKENSG00000225972 31391 chr1 564441 564813 96.9279 77.2375 116.618 OKENSG00000243329 31391 chr1 564878 564950 0 0 0 OKENSG00000240155 31391 chr1 564951 565019 0 0 0 OK
Cuffdiff (differential expression)
Pairwise or time series comparison Normal distribution of read counts Fisher’s test
test_id gene locus sample_1 sample_2 status value_1 value_2 ln(fold_change) test_stat p_value significantENSG00000000003 TSPAN6chrX:99883666-99894988 q1 q2 NOTEST 0 0 0 0 1 noENSG00000000005 TNMD chrX:99839798-99854882 q1 q2 NOTEST 0 0 0 0 1 noENSG00000000419 DPM1 chr20:49551403-49575092 q1 q2 NOTEST 15.0775 23.8627 0.459116 -1.39556 0.162848 noENSG00000000457 SCYL3 chr1:169631244-169863408 q1 q2 OK 32.5626 16.5208 -0.678541 15.8186 0 yes
Cufflinks: Alternative splicing
trans_id bundle_id chr left right FPKM FMI frac FPKM_conf_lo FPKM_conf_hi coverage length effective_length status
ENST00000503254 31391 chr1 465693 688071 787.12 1 1 731.009 843.232 124.849 1509 440.26 OKENST00000458203 31391 chr1 470906 471368 0 0 0 0 0 0 462 440.005 OKENST00000417636 31391 chr1 521368 523833 0 0 0 0 0 0 842 842 OKENST00000423796 31391 chr1 523008 530148 0 0 0 0 0 0 607 607 OKENST00000450696 31391 chr1 523047 529954 0 0 0 0 0 0 402 402 OKENST00000440196 31391 chr1 529832 530595 0 0 0 0 0 0 437 437 OKENST00000357876 31391 chr1 529838 532878 0 0 0 0 0 0 498 498 OKENST00000440200 31391 chr1 536815 655580 2.53932 1 1 0 5.72637 0.185236 413 413 OKENST00000441245 31391 chr1 637315 655530 0 0 0 0 0 0 629 629 OKENST00000419394 31391 chr1 639064 655574 0 0 0 0 0 0 480 480 OKENST00000448605 31391 chr1 639064 655580 0 0 0 0 0 0 274 274 OKENST00000414688 31391 chr1 646721 655580 0 0 0 0 0 0 750 750 OKENST00000447954 31391 chr1 655437 659930 0 0 0 0 0 0 336 336 OKENST00000440782 31391 chr1 657464 660287 0 0 0 0 0 0 2823 2823 OKENST00000452176 31391 chr1 562756 564390 0 0 0 0 0 0 802 802 OKENST00000416931 31391 chr1 564441 564813 96.9279 1 1 77.2375 116.618 21.1488 372 372 OKENST00000485393 31391 chr1 564878 564950 0 0 0 0 0 0 72 72 OKENST00000482877 31391 chr1 564951 565019 0 0 0 0 0 0 68 68 OK
R/bioconductor Packages Based on raw read counts per gene/transcript/genome
feature (miRNA) Differential expression analysis DESeq
http://www-huber.embl.de/users/anders/DESeq/ Negative binomial distribution
baySeq http://www.bioconductor.org/help/bioc-views/release/
bioc/html/baySeq.html Bayesian approach Choice of Poisson and negative binomial distribution
edgeR DEGSeq Genominator …
DESeq: Variance estimation
SCV: the ratio of the variance at base level to the square of the base meanSolid line: biological replicates noiseDotted line: full variance scaled by size factorsShot noise: dotted minus solid
DESeq: Differential Expression
id
B cells expression
IFG expression
log2FoldChange pValue
ENSG00000000971 1.566626326 23.78874526 3.924546167 2.85599311970997e-17
ENSG00000001036 5.999081213 33.49328888 2.481058581 9.8485739442166e-13
ENSG00000001084 23.3067067 156.2725598 2.745247408 4.38856094441354e-33
ENSG00000001461 46.14566905 18.67886919 -1.304788134 2.66197080043655e-07
ENSG00000001497 68.54035056 35.87868221 -0.933826668 3.36052669642687e-05
ENSG00000001630 13.86061772 55.92825318 2.012585716 1.27410028391540e-13
ENSG00000002549 27.33856924 1096.051286 5.325233754 1.97553508993745e-133
ENSG00000002587 15.64872305 2.223202568 -2.815333625 8.43968907932538e-10
ENSG00000002834 95.68814397 272.3502328 1.509051013 8.21570437569004e-16
ENSG00000003056 63.65513823 296.6257971 2.220295194 2.92583705156055e-30
ENSG00000003400 52.02308495 117.3028844 1.173014631 4.62918844505763e-08
ENSG00000003402 154.7003657 311.1815114 1.008279739 2.59997904482726e-08
ENSG00000003756 434.3712708 180.9106662 -1.263651217 3.58591978350734e-14
ENSG00000004399 1.199584318 56.96561073 5.569484777 9.87310306834046e-40
ENSG00000004455 145.4361806 331.8994483 1.190360014 3.17246841765643e-10
ENSG00000004468 17.27590102 128.1030372 2.89047182 1.99020901042234e-33
ENSG00000004534 331.0046525 176.1290195 -0.910218864 2.28719252897662e-07
ENSG00000004799 5.425570485 18.0426855 1.733567341 1.67150844663169e-06
ENSG00000004961 15.22078545 54.5536795 1.841633697 2.76802192307592e-11
ENSG00000005020 133.1474289 248.379817 0.899523377 3.00900687072175e-06
ENSG00000005022 86.49374889 154.5210394 0.837135513 3.79777250197792e-05
ENSG00000005238 0.818439748 8.567484894 3.387923626 7.38045118427266e-07
ENSG00000005249 1.442397316 17.22208291 3.577719117 2.69990749254895e-12
ENSG00000005379 25.15059092 4.02264298 -2.644376691 2.75953193496745e-12
ENSG00000005381 0.376344415 19.36188435 5.685021995 4.99727503015434e-18
ENSG00000005436 28.46288463 11.16816604 -1.349689587 4.23389957443192e-06
Visualization: Genome Viewers Web based:
Gbrowse (http://gmod.org/wiki/Gbrowse) UCSC Genome Browser (http://genome.ucsc.edu/)
Standalone Integrated Genome Viewer
(http://www.broadinstitute.org/software/igv/)
IGV: Differential Expression Visualization
An Introduction to ChIP-Sequencing analysis
Linda Hughes
What is ChIP-Seq? Chromatin-Immunoprecipitation (ChIP)-
Sequencing
ChIP - A technique of precipitating a protein antigen out of solution using an antibody that specifically binds to the protein.
Sequencing – A technique to determine the order of nucleotide bases in a molecule of DNA.
Used in combination to study the interactions between protein and DNA.
ChIP-Seq Applications
Enables the accurate profiling of
Transcription factor binding sites Polymerases Histone modification sites DNA methylation
ChIP-Seq: The Basics
ChIP-Seq Analysis Pipeline
Sequencing
30-50 bpSequenc
es
Base Calling
Read quality
assessment
GenomeAlignme
nt
Enriched Regions
Peak Calling
Combine with gene
expression
Motif Discover
y
Visualisation with
genome browser
Differential peaks
ChIP-Seq: Genome Alignment Several Aligners Available
BWA NovoAlign Bowtie
Currently the Sequencing analysis pipeline uses the Stampy as the default aligner for all sequencing.
All aligner output containing information about the mapping location and quality of the reads are out put in SAM format
ChIP-Seq Peak Calling The main function of peak finding programs is
to predict protein binding sites
First the programs must identify clusters (or peaks) of sequence tags
The peak finding programs must determine the number of sequence tags (peak height) that constitutes “significant” enrichment likely to represent a protein binding site
ChIP-Seq: Peak Calling
Several ChIP-seq peak calling tools Available MACS PICS PeakSeq Cisgenome F-Seq
ChIP-Seq: Identification of Peaks Several methods to identify peaks but they mainly
fall into 2 categories: Tag Density Directional scoring
In the tag density method, the program searches for large clusters of overlapping sequence tags within a fixed width sliding window across the genome.
In directional scoring methods, the bimodal pattern in the strand-specific tag densities are used to identify protein binding sites.
ChIP-Seq: Determination of peak significance To account for the background signal, many
methods incorporate sequence data from a control dataset.
This is usually generated from fixed chromatin or DNA immunoprecipitated with a nonspecific antibody.
Calculate false discovery rate account the background signal in ChIP-sequence
tags Assess the significance of predicted ChIP-seq peaks
ChIP-Seq: Determination of peak significance More statistically sophisticated models developed
to model the distribution of control sequence tags across the genome.
Used as a parameter to assess the significance of ChIP tag peaks t-distribution Poisson model Hidden Markov model
Primarily used to assign each peak a significance metric such as a P-value FDR or posterior probability.
ChIP-Seq: Outputchr start end length summit tags -10*log10(pvalue)
fold_enrichment FDR(%)
chr1 13322611 13322934 324 101 16 58.38 6.95 73.89
chr1 14474379 14475108 730 456 63 63.73 5.98 73.81
chr1 23912933 23913336 404 155 19 57.86 8.49 73.33
chr1 24619496 24619679 184 92 44 449.34 34.00 94.12
chr1 24619857 24620057 201 100 73 780.66 56.41 100
chr1 26742705 26743590 886 252 69 132.27 7.52 69.25
chr1 26743625 26745342 1718 1422 165 141.40 4.34 70.36
chr1 33811805 33814279 2475 289 256 98.13 3.74 74.50
chr1 34516074 34517165 1092 496 206 59.13 5.22 74.42
chr1 34519503 34520082 580 334 58 53.56 4.74 70.59
chr1 34529691 34530276 586 286 40 77.33 6.12 74.63
chr1 34546832 34547631 800 311 208 233.96 5.56 73.01
chr1 34548528 34549155 628 343 39 81.43 5.75 75.15
chr1 34570690 34571225 536 267 31 98.69 7.15 74.50
ChIP-Seq: Output A list of enriched locations
Can be used: In combination with RNA-Seq, to determine the
biological function of transcription factors Identify genes co-regulated by a common
transcription factor Identify common transcription factor binding
motifs
ChIP-Seq: Need help?
http://seqanswers.com/
Good for: Publications Answering FAQ Troubleshooting Contacting the programs authors