RNAi mediated gene silencing against betasatellite associatedwith Croton yellow vein mosaic begomovirus

Anurag Kumar Sahu • Avinash Marwal •

Chitra Nehra • Devendra Kumar Choudhary •

Pradeep Sharma • Rajarshi Kumar Gaur

Received: 18 March 2013 / Accepted: 27 July 2014

� Springer Science+Business Media Dordrecht 2014

Abstract Plant viruses encode suppressors of posttran-

scriptional gene silencing, an adaptive antiviral defense

responses that confines virus infection. Previously, we

identified single-stranded DNA satellite (also known as

DNA-b) of *1,350 nucleotides in length associated with

Croton yellow vein mosaic begomovirus (CYVMV) in

croton plants. The expression of genes from DNA-brequires the begomovirus for packaged, replication, insect

transmission and movement in plants. The present study

demonstrates the effect of the bC1 gene on the silencing

pathway as analysed by using both transgenic systems and

transient Agrobacterium tumefaciens based delivery. Plants

that carry an intron-hairpin construct covering the bC1

gene accumulated cognate small-interfering RNAs and

remained symptom-free after exposure to CYVMV and its

satellite. These results suggest that bC1 interferes with

silencing mechanism.

Keywords RNAi technology � Begomovirus � DNA-b �Silencing � Agro-infiltration

Introduction

Geminivirus, a large diverse family of plant viruses infect a

broad variety of plants and cause significant crop losses

worldwide. They are characterized by having genomes of

circular, single-stranded (ss) DNA encapsidated within

twinned quasi-isometric particles of about 18 9 30 nm in

size. Most of begomoviruses have genomes consisting only

two different circular ssDNA molecules (DNA-A and

DNA-B) each of about 2.6–2.8 kb essential for virus pro-

liferation, while a few truly monopartite begomoviruses

with genomes consisting of homologs of the DNA-A

molecules of bipartite viruses have been identified. In

recent years, monopartite begomovirus species associated

with betasatellites (DNA-b) have been shown to increase in

number and satellites depend on their helper viruses for

encapsidation, replication and insect transmission in plants

[1]. RNA interference (RNAi) or posttranscriptional gene

silencing (PTGS) occurs in a wide variety of organisms,

including animals, fungi and plants [2, 3]. Viruses derived

small-interfering RNAs (siRNAs) are the hallmark of an

innate immune response in plants that targets invading

viruses through PTGS. RNA silencing is a sequence-spe-

cific RNA degradation process that is triggered either by

the formation of dsRNA or alternatively by aberrant RNAs

associated with transgenes viruses and transposons [4].

RNAs with hairpin with a loop structures are particularly

actual inducers of PTGS in plants [5].

Transgene-induced silencing in plants is usually associ-

ated with methylation of nuclear DNA corresponding to the

transcribed region of the target RNA despite transcription

levels of the transgene remains unaffected [3]. Plant-specific

RNA-dependent RNA polymerase 6 (RDR6) and SGS3

proteins are required for viral immunity and assumed to

convert ssRNA transcripts of sense transgene and viral

Electronic supplementary material The online version of thisarticle (doi:10.1007/s11033-014-3653-0) contains supplementarymaterial, which is available to authorized users.

A. K. Sahu � A. Marwal � C. Nehra � D. K. Choudhary �R. K. Gaur (&)

Department of Science, Faculty of Arts, Science and Commerce,

Mody Institute of Technology and Science, Lakshmangarh,

Sikar 332311, India

e-mail: gaurrajarshi@hotmail.com

P. Sharma (&)

Division of Crop Improvement, Directorate of Wheat Research,

Karnal 132 001, India

e-mail: neprads@gmail.com

123

Mol Biol Rep

DOI 10.1007/s11033-014-3653-0

genomes into dsRNA. DICER-like proteins cleave the

resulting dsRNAs into siRNAs, which then assemble into

RNA-induced silencing complexes and guide cleavage of the

complementary viral transcripts conserved plant-specific

proteins and RDR6 may also be involved in secondary siR-

NA production from cleaved viral transcripts [6–11]. In

plants, PTGS has been widely studied using virus encoded

proteins as transgenes and viruses are both initiators and

targets of suppression of gene silencing [7, 12, 13]. Viruses

induced an RNA mediated defense in plants similar to PTGS

that is distinguished by sequence-specific resistance against

virus infection. siRNA is an important method for evaluating

gene functionality and are being exploited for the develop-

ment of new approaches to control plant viruses.

Small circular ssDNA satellites encode a single open

reading frame, ORF (termed as bC1) have been found to be

associated with various plant diseases exclusively caused by

monopartite begmoviruses in the Old World. Typically, bC1

gene has the capacity to encode a 13 kDa protein in the

complementary strand of their genome and contains an A-rich

region of nearly 240 nucleotides (nts) as well as a satellite

conserved region of nearly 220 nts, which is highly conserved

among all betasatellites known today [14, 15]. Previously, we

have characterized the Croton yellow vein mosaic begomo-

virus (CYVMV) and its associated betasatellite from croton

infested weeds, however the precise function of betasatellite

and its encoded bC1 protein in pathogenesis is unknown, even

though it has been suggested that DNA-b play a direct or an

indirect role in replication, pathogenicity, facilitating move-

ment, or countering host defense response.

Here, we first demonstrate effective gene silencing of

croton yellow vein mosaic betasatellite encoded bC1 in

Nicotiana benthamiana infiltrated with Agrobacterium tum-

efaciens that harbours the intron-hairpin RNA (ihpRNA)

construct aimed at the bC1. In addition, we also showed that

N. benthamiana engineered by Agrobacterium mediated

transformation in which Agrobacterium harbouring binary

vector construct carrying bC1 gene in sense and anti-sense

orientations with short-intron, to produce siRNAs in plant

targeting the mRNA of croton yellow vein mosaic betasat-

ellite encoded bC1. Hairpin RNA derived strategy of

expressing Rep (AC1) gene confirms immunity when directed

against viruses [16]. The main objective of the present study

was to investigate RNA-mediated resistance against CYVMV

infection. Croton is a common weed, which acts as reservoir

for viruses commonly encountered near the crop fields in

northern India. A mixed viral infection is common phenom-

enon in many crops, hence development of transgenic plants

with resistance to multiple viruses or viral strains are instantly

required. The work described in this review has both funda-

mental and practical implications, as resistance to ssDNA

viruses provides a strategy to concurrently control multiple

viruses with different genomic structures.

Materials and methods

Construction of plant expression plasmids

For stable expression and efficient transformation analysis,

we used the N. benthamiana plants. Susceptibility to CY-

VMV has not been studied earlier.

For the plant expression plasmid containing ihpRNA

targeted to bC1 gene of croton yellow vein mosaic betasat-

ellite was constructed (Fig. 1). Approximately *750 nts

fragment corresponding to the croton yellow vein

mosaic betasatellite (GenBank Accession No. HQ631430)

was cloned in sense and anti-sense orientation with short

intron. Primers used to amplify the full length bC1 region

were designed as detailed in Table 1. The BamHI and XbaI

restriction site was introduced in upstream and downstream

of the primers for sense orientation and XhoI and NcoI as

antisense orientation. The resulted amplicons were cloned in

the binary vector pCAMBIA1300 driven by a strong Cauli-

flower mosaic virus (CaMV) 35S promoter and PolyA signal

near right border of plasmid (Fig. 1a) kindly provided by

Ikegami, Tohoku University, Japan. To monitor silencing,

down-regulation of GUS protein expression was followed

using binary pBin121-GUS construct (Fig. 1b). This plas-

mid was also used to make pBin121-GUS-bC1 construct

(Fig. 1c). For this, bC1 gene ligated downstream to GUS

gene in the SacI–PstI site of pBin121-GUS.

Plant transformation

The resultant binary construct developed was introduced into

A. tumefaciens strain LBA4404 through electroporation with

a Gene Pulser (Eppendorf, USA). The transgenic N. benth-

amiana plants were developed by using leaf disk transfor-

mation method [13]. Fresh leaves of tobacco were sterilized

by immersion in 10 % Clorox for 10 min, followed by

washing with distilled water. The leaf disks were co-culti-

vated on the MS shooting medium and incubated for 2 days at

26 �C in dark at tissue culture room (pre-incubation) after

submerging it in the bacterial culture for 30–40 s. In vitro

shoots were revived in MS medium supplemented with

100 mg/l kanamycin. Regenerated shoots were excised and

transferred to the MS rooting medium containing naphthalene

acetic acid (0.15 mg/l). Plantlets were transferred to soil and

acclimatized under greenhouse conditions.

Agroinfiltration

Agrobacterium tumefaciens LBA4404 strain was used for

all the T-DNA construct as described earlier [17]. The

bacterial strains were cultured in LB liquid medium con-

taining kanamycin 100 mg/ml and grown overnight at

28 �C. An aliquot transferred to fresh LB medium without

Mol Biol Rep

123

antibiotics and grown to OD600 = 0.5. Subsequently, bac-

terial cells were precipitated and resuspended in a solution

containing 10 mM MgCl2, 10 mM MES pH 5.6 and

20 mg/l acetosyringone to a low OD600 of about 0.5.

Agroinfiltration of the culture was done at the abaxial side

of 6-week-old non-transformed and transformed leaves of

N. benthamiana. Plants were kept at in the growth chamber

at 25 �C for 48–76 h. Detection of GUS gene expression

was done by histo-chemical GUS staining.

Screening of transformed plants using PCR

and Southern blot analysis

Total genomic DNA from the young leaves of transgenic

plants was extracted by CTAB method [18]. PCR analysis was

carried out in a thermal cycler (Eppendorf) using with specific

primer forward 50-ACCACACAGACACCTTCAAAGG-30

and reverse 50-TCTCTGTGAACTATAT CTTCT-30 for

confirmation of transgene. Approximately 200 ng of genomic

DNA was amplified for 35 cycles (30 s at 94 �C, 30 s at 52 �C,

45 s at 72 �C) and the amplicon were monitored by 1 %

agarose gel (Low EEO) electrophoresis staining with ethi-

dium-bromide and photographed in Gel Documentation sys-

tem (Systems and Controls).

For Southern blot hybridization analyses, total DNA iso-

lated from transformed and non-transformed young leaves

were digested with restriction endonuclease SmaI. Further,

the analysis was performed as described elsewhere [19].

siRNA detection by northern-blot analysis

RNA was extracted from the leaves of transgenic plant by

using Ambion RNA extraction kit (Invitrogen Bioservices

India Pvt. Ltd., Bangalore, India) as per the manufactured

instructions. RNA was separated on a 15 % polyacrylamide

gel, transferred to nylon membrane and analyzed by northern-

blot. For the detection of siRNA Digoxin-labeled CYVM-

bC1 specific probe was used. The signals were envisaged by

autoradiography after performing the hybridization.

Results

Validation of transgenic plant

Presence of transgene in transformed N. benthamiana

plants 14 days after inoculation was detected by PCR with

expected (*750 bp) amplicon of bC1 gene (Fig. 2a),

Fig. 1 (a) T-DNA maps:

schematic diagram of the binary

construct contain bC1 gene in

sense and antisense orientation

used for plant transformation.

LB left border, RB right border.

( b) The pBin121-GUS, where

GUS expression is driven by the

CaMV 35S promoter. (c) The

pBin121-GUS-bC1, a derivative

plasmid of pBin19-GUS, where

the CYVMV bC1 was inserted

in frame with the GUS to

produce a fused protein when

expressed in agroinfiltration

experiments

Table 1 Primers used in the PCR amplification

Primers Sequence (50–30)a Target

CYVMV-bC1.F

CYVMV-bC1.R

ATGGATCCACCACACAGACACCTTCAAAGG

GTATTCTAGATCTCTGTGAACTATATCTTCT

Sense bC1 strand

CYVMV-bC1.F

CYVMV-bC1.R

GTATCTCGAGTCTGTGAACTATATCTTCT

TAAAAACCATGGAGACACCTTCAAACGACAAC

Antisense bC1 strand

F forward primers, R reverse primersa Underlined sequences are restriction sites introduced to the 50 end of the four primers

Mol Biol Rep

123

similar to positive control, no such amplicon (Fig. 2b) were

obtained in negative control (wild type-N. benthamiana).

These lines of plant were grown in green-house for the

evaluation of their silencing against begomovirus associ-

ated with DNA-b. Southern blot reveals the strong signal of

hybridization (Fig. 2c) confirming the presence of bC1

gene in the transformants.

Silencing of GUS-bC1 in agroinfiltered plants

Two different pBin121 derived construct: pBin121-GUS

and pBin121-Gus-bC1 were constructed to study the RNA

silencing in N. benthamiana. Gus expression was con-

firmed by agroinfiltrated pBin121-GUS and pBin121-Gus-

bC1 in N. benthamiana leaves. After 1 day incubation,

expressions of the fused GUS-bC1 were detected using

GUS staining (Fig. 3a). For the silencing effect the N.

benthamiana, leaves were first agroinfilterated with

pCAMBIARNAibC1 harboring Agrobacterium and incu-

bated at 25 �C for 76 h followed by infiltration of the

pBin121-GUS-bC1. The results showed the complete

shutdown of GUS expression after the 24 h infiltration

(Fig. 3b) may be due to its fusion to the bC1, confirmed by

infiltrating pCAMBIARNAibC1 followed by pBin121-

Fig. 2 PCR analysis with

DNA-b specific primer

of (a) transformed (Tr) plant,

(b) non-transformed control

plant and (c) presence of the

DNA-b in transformed plant

(Tr1–2) as determined by

Southern blot analysis of leaf

DNA Tr1 and Tr2 show positive

signals and W1–3 non-

transformed plant show

negative signals with control

plant (?)

Mol Biol Rep

123

GUS. GUS expression was also observed in infiltrated leaf

as in Fig. 3c. However, GUS-expression was no detected

when infiltrated alone with pCAMBIARNAibC1 (Fig. 3d).

Resistance to the virus

RNA isolated from non-transgenic and transgenic plant

(challenged with 20–30 viruliferous whiteflies per plant

and after 3-week post inoculation (wpi)) were subjected to

siRNA detection by northern blot analysis using specific

probe corresponding to bC1 transgene. We detected resis-

tance in 8 out of the 24 transgenic lines and showed no

symptoms over a period of 24 days (Fig. 4a). Six lines

showed delayed and/or reduced response as compared to

control N. benthamiana (Table S2 in electronic supple-

mentary material). The siRNA was absent in the non-

transgenic plant showing disease symptoms (Fig. 4b, c).

The resistance lines were further self-fertilized for seed

production and resistance analysis in the progeny.

The progeny of resistance lines were subjected to

inoculate with CYVMV-viruliferous whiteflies for assess-

ing the inheritance of resistance. In N. benthamiana plants,

all the T1 lines showed the maximum resistance to CY-

VMV. Resistance lines were symptomless during the

experiments. Ten out of 20 T1 plants showed symptomless

at 7 wpi with CYVMV-viruliferous whiteflies while 8 T1

plants exhibited moderate resistance to CYVMV two plants

developed resistance mild symptoms after 2 wpi (Table S2

in electronic supplementary material). All the non-symp-

tomatic plants were checked with PCR by using CYVMV

coat protein degenerated primers. The predicted amplicon

of 600 bp were only amplified in transgenic plants with

symptoms and the control plants (data not shown). Out of

10 T1 transformants, only 5 were selected and further

advanced. In T2 generation, only four lines displayed the

same amplicon as compared to T1 and showed 80 %

resistance (Table S2 in electronic supplementary material).

Discussion

Numbers of plant viruses consist of associated satellite and

their replication; movement and encapsidation are depen-

dent on the helper virus. Some satellites are known to

induce or intensify viral symptoms. Begomoviruses con-

tain satellite DNA-b molecules code functional bC1 gene

which plays a vital role in inducing leaf curling, vein

yellowing, growth stunting in different economically

important crops and ornamental plants [3, 14, 15, 20, 21].

The DNA-b have three conserved sequences region: an

A-rich region, a conserved region (SCR), and a single ORF

(the putative coding region of gene C1). The SCR region

has a stem-loop hairpin structure with the NS TAATAT-

TAC sequence [22]. Several studies for resistant to multi-

ple RNA viruses were conducted by using construct of

several viral fragments at sense [23, 24] and hairpin RNA

constructs [25, 26]. Accumulations of siRNAs in the

resistant lines show the PTGS silencing mechanism [27].

During the last two decades, several groups have sought

application of pathogen derived resistance for developing

Fig. 3 Histochemical GUS-assay demonstrates the silencing of GUS

expression by siRNA in agroinfilterated N. benthamiana. (a) GUS-

bC1 after GUS staining showing positive signal. (b) N. benthamiana

leaves with pCAMBIARNAibC1 harboring agro-stains followed by

infiltrated with pBin121-GUS-bC1 showed knockout of GUS expres-

sion. (c) Infiltrating with pCAMBIARNAibC1 harboring agro-strain

followed by infiltration with pBin121-GUS. (d) pCAMBIARNAibC1,

when infiltrated alone, showed no GUS expression

Mol Biol Rep

123

genetically engineered resistance against geminiviruses

[28, 29]. However, none of these technologies were able to

provide resistance in the field, implicating those new

technologies may be evolved to develop resistance against

begomoviruses. RNAi has been found to be the robust

technology for silencing of genes at transcriptional as well

as post-transcriptional levels. It has been already studied

that the inverted repeat in the transcribed region show high

efficiency PTGS in plants [30, 31]. The usefulness of RNAi

for developing resistance against DNA viruses has been

sought by many researchers. Among DNA viruses, gem-

iniviruses, RNAi has been targeted a group of DNA viruses

with ssDNA circular DNA genome. The rationale of the

approach is based on the fact that DNA viruses transcribe

mRNA from DNA and silencing those mRNA would result

in resistance against geminiviruses.

In this investigation, we used most common model

system N. benthamiana which is easy to handle and

transform and easy to express the viral proteins. To quote

this question, N. benthamiana were inoculated with the

whiteflies accessed to CYVMV infected croton plants.

After 48 h of acquisition access periods, the plants showed

severe symptoms of yellow vein mosaic (Table S2 in

electronic supplementary material). Subsequently, N.

benthamiana shows the inhibition of bC1 protein produc-

tion when challenged with the virus through siRNA as a

result preventing systemic infection. Further, we showed

that the hairpin-construct potentially silence the bC1

expression of CYVMV through agroinfiltrate (Fig. 3a). Our

result showed that the expression of ihpRNA-producing

gene was inhibited even after the 72 h, prior to the intro-

duction of the GUS-bC1 construct (Fig. 3b). Some of the

leaves showed the GUS signal which may be explain that

they received only GUS-bC1 expressing construct, and

lack ihpRNA plasmid. This suggested that generation of

siRNA took place during the 72h period and silences the

expression GUS-bC1 mRNA transcript.

The presence of transgene was detected by PCR in

transformed N. benthamiana plant showing the expected

size (*750 bp) amplicon of bC1 gene (Fig. 2a), similar to

positive control, no such amplicon (Fig. 2b) were obtained

in negative control (wild type N. benthamiana). These lines

of plant were grown in green house for the evaluation of

their silencing against begomovirus associated with DNA-

b. Southern blot reveals the strong signal of hybridization

(Fig. 2c) confirming the presence of bC1 gene in the

transformants.

The available data and our results reveal the parallel

importance of bC1 gene in bipartite begomoviruses life

cycle. Producing siRNA in N. benthamiana plants may be

significantly important for producing antiviral resistance.

We evaluated the silencing of bC1 in transgenic plant, by

the analysis siRNA. RNA isolated from wild type N.

benthamiana plant and from transgenic plant (challenged

with over 30 viruliferous whiteflies per plant and after

3 wpi) and subjected to siRNA detection by northern blot

hybridization by using specific probe to bC1 transgene.

This led to easy detection of resistance in these transgenic

Fig. 4 Accumulation of siRNA

in selected transformed and wild

type plants. Leaves from

sensitive wild type (a) show

typical disease symptoms,

tolerant transgenic plants

(b) show resistance, 3-week

after inoculation. Northern blot

hybridization of total RNA of

wild type and transgenic plant

N. benthamiana with CYVMV-

bC1 specific probe showing

(c) positive signal of siRNA

accumulation in lanes 2 and 3

(transgenic) while no signal in

case of lane 1 (wild type), lane

M, 21- nt end-labeled oligo is

shown as molecular size

markers

Mol Biol Rep

123

lines i.e., no symptoms (Fig. 3a). The siRNA was absent in

the non-transgenic plant show disease symptoms (Fig. 3b,

c).

Seeds from T1 lines grown in the insect-free cages were

inoculated with the viruliferous whiteflies till the 24 h of

inoculation period. The plant show the resistant to CY-

VMV even after 2 months while non-transgenic showed

severe symptoms of vein yellow after 15 days of inocula-

tion (Table S2 in electronic supplementary material). Some

of the transgenic line lacks the resistance which may be

explained by well known RNA-mediated DNA methylation

of the siRNA-generating DNA construct [7, 32]. Further

support was provided by the siRNAs accumulations

(Fig. 3c) which were confirmed by northern blot analysis to

prevent systemic infection. In T2 generation, we were able

to get four lines resistance to CYVMV which could be

beneficial for CYVMV management. Our result also

revealed that the resistance towards CYVMV is more sta-

ble and increased in T2 generation.

Acknowledgments The authors are thankful to Department of

Science and Technology (DST Project no. SR/FT/LS-042/2009), and

Department of Biotechnology (DBT Project no. BT/PR13129/GBD/

27/197/2009), India for financial support. The authors are also

grateful to Prof. Thomas Hohn, Switzerland, Dr. Indu Sharma, Dr.

Ajay Kumar Chaubey and Dr. Narendra Kumar for their valuable

suggestions.

References

1. Mansoor S, Briddon RW, Zafar Y, Stanley J (2003) Geminivirus

disease complexes: an emerging threat. Trends Plant Sci 8:

128–134

2. Bass BL (2000) Double-stranded RNA as a template for gene

silencing. Cell 101:235–238

3. Saunders K, Norman A, Gucciardo S, Stanley J (2004) The DNA-

b satellite component associated with ageratum yellow vein

disease encodes an essential pathogenicity protein (bC1). Virol-

ogy 324:37–47

4. Vaucheret H (2006) Post-transcriptional small RNA pathways in

plants: mechanisms and regulations. Genes Dev 20:759–771

5. Ikegami M, Kon T, Sharma P (2011) RNA silencing and viral

encoded silencing suppressors. In: Gaur RK, Gafni Y, Gupta VK,

Sharma P (eds) RNAi technology. CRC Press, USA, pp 209–240

6. Chapman EJ, Prokhnevsky AI, Gopinath K, Dolja VV, Carring-

ton JC (2004) Viral RNA silencing suppressors inhibits the

microRNA pathway at an intermediate step. Genes Dev 18:

1179–1186

7. Mourrain P, Beclin C, Elmayan T, Feuerbach F, Godon C, Morel

JB, Jouette D, Lacombe AM, Nikic S, Picault N, Remoue K,

Sanial M, Vo TA, Vaucheret H (2000) Arabidopsis SGS2 and

SGS3 genes are required for posttranscriptional gene silencing

and natural virus resistance. Cell 101:533–542

8. Smith NA, Singh SP, Wang MB, Stoutjesdijk PA, Green AG,

Waterhouse PM (2000) Gene expression: total silencing by

intron-spliced hairpin. Nature 407:319–320

9. Vaistij FE, Jones L, Baulcombe DC (2002) Spreading of RNA

targeting and DNA methylation in RNA silencing requires

transcription of the target gene and a putative RNA-dependent

RNA polymerase. Plant Cell 14:857–867

10. Vaucheret H, Fagard M (2001) Transcriptional gene silencing in

plants: targets, inducers and regulators. Trends Genet 17:29–35

11. Zamore PD (2004) Plant RNAi: how a viral silencing suppressor

inactivates siRNA. Curr Biol 14:R198–R200

12. Covey SN, Al-Kaff NS, Langara A, Turner DS (1997) Plants

combat infection by gene silencing. Nat (Lond) 385:781–782

13. Ratcliff FG, Harrison BD, Baulcombe DC (1997) A similarity

between viral defense and gene silencing in plants. Science

276:1558–1560

14. Saunders K, Bedford ID, Yahara T, Stanley J (2003) The earliest

recorded plant virus disease. Nature 422:831

15. Zhou XP, Xie Y, Tao XR, Zhang ZK, Li ZH, Fauquet CM (2003)

Characterization of DNA b associated with begomoviruses in

China and evidence for co-evolution with their cognate viral

DNA-A. J Gen Virol 84:237–247

16. Sijen T, Kooter JM (2000) Post-transcriptional gene-silencing:

RNAs on the attack or on the defense. BioEssays 22:520–531

17. Nagel R, Elliot A, Masel A, Birch RG, Manners JM (1990)

Electroporation of binary Ti plasmid vector into Agrobacterium

tumefaciens and Agrobacterium rizogenes. FEMS Microbiol Lett

67:325–328

18. Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW

(1984) Ribosomal DNA spacer-length polymorphisms in barley:

Mendelian inheritance, chromosomal location and population

dynamics. Proc Natl Acad Sci USA 81:8014–8018

19. Kon T, Dolores LM, Bajet NB, Hase S, Takahashi H, Ikegami

M (2003) Molecular Characterization of a strain of squash

leaf curl China virus from the Philippines. J Phytopathol 151:

535–539

20. Briddon RW, Mansoor S, Bedford ID, Pinner MS, Saunders K,

Stanley J, Zafar Y, Malik KA, Markham PG (2001) Identification

of DNA components required for induction of cotton leaf curl

disease. Virology 285:234–243

21. Jose J, Usha R (2003) Bhendi yellow vein mosaic disease in India

is caused by association of a DNAb-satellite with a begomovirus.

Virology 305:310–317

22. Hafner GJ, Stafford MR, Wolter LC, Harding RM, Dale JL

(1997) Nicking and joining activity of banana bunchy top virus

replication protein in vitro. J Gen Virol 78:1795–1799

23. Bai QR, Zhu JH, Liu XL, Zhu CX, Song YZ, Wen FJ (2005)

Production of transgenic tobacco plants resistant to two viruses

via RNA-mediated virus resistance. Acta Phytopathol Sin

35:148–154

24. Jan FJ, Fagoaga C, Pang SZ, Gonsalves D (2000) A single chi-

meric transgene derived from two distinct viruses confers multi-

virus resistance in transgenic plants through homology-dependent

gene silencing. J Gen Virol 81:2103–2109

25. Bucher E, Lohuis D, van Pieter M, Poppel JA, Geerts Dimitria-

dou C, Goldbach R, Prins M (2006) Multiple virus resistance at a

high frequency using a single transgene construct. J Gen Virol

87:3697–3701

26. Zhu CX, Song YZ, Yin GH, Wen FJ (2009) Induction of RNA-

mediated multiple virus resistance to Potato virus Y, Tobacco

mosaic virus and Cucumber mosaic virus. J Phytopathol

157:101–107

27. Pandolfini T, Molesini B, Avesani L, Spena A, Polverari A

(2003) Expression of self-complementary hairpin RNA under the

control of the rolC promoter confers systemic disease resistance

to plum pox virus without preventing local infection. BMC

Biotechnol 3:7–21

28. Duan YP, Powell CA, Purcifull DE, Broglio P, Hiebert E (1997)

Phenotypic variation in transgenic tobacco expressing mutated

geminivirus movement/pathogenicity (BC1) proteins. Mol Plant

Microbe Interact 10:1065–1074

Mol Biol Rep

123

29. Kunik T, Salomon R, Zamir D, Navot N, Zeidan M, Michelson I,

Gafni Y, Czosnek H (1994) Transgenic tomato plants expressing

the tomato yellow leaf curl virus capsid protein are resistant to the

virus. Biotechnology (NY) 12:500–504

30. Baulcombe D (2002) Viral suppression of systemic silencing.

Trends Microbiol 10:306–308

31. Hamilton A, Voinnet O, Chappell L, Baulcombe D (2002) Two

classes of short interfering RNA in RNA silencing. EMBO J

21:4671–4679

32. Mathieu O, Bender J (2004) RNA-directed DNA methylation.

J Cell Sci 117:4881–4888

Mol Biol Rep

123