THE JOURNAL OF B~OIJJGICAL. CHEMWCRY 0 1990 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 265, No. 29, Issue of October 15, pp. 17627-17636,199O Printed in U, S. A.

RNA Primary Sequence or Secondary Structure in the Translational Initiation Region Controls Expression of Two Variant Interferon-p Genes in Escherichia coli*

(Received for publication, October 24, 1989)

Gerhard Gross*, Christian Mielke, Inge Hollatz, Helmut BliickerQ, and Ronald Franks From the Gesellschaft fiir Biotechnologische Forschung, Abteilung Genetik, and the §DNA-Synthese-Gruppe, 3300 Braunschweig, Federal Republic of Germany

Efficient expression in Escherichia coli (E. coli) of the human interferon-@ gene (IFN-8) gene and of a chemically synthesized IFN-@ gene variant (506 base pairs; synIFN-8) adapted to the E. coli codon usage, both fused to the E. coli atpE ribosome-binding site, is controlled either by primary sequence or by mRNA secondary-structure in the translational initiation re- gion. High level expression of the natural human atpE/ IFN-8 gene fusion is governed by the nucleotide com- position preceding the initiator codon AUG. A single U + C exchange in the -2 or -1 position preceding the initiator codon AUG reduces the translational effi- ciency from 18% of total cellular protein to only 8% or 4%, respectively, while both U + C substitutions re- duce IFN+ expression below 1%. These sequence al- terations interfere with efficient ribosome binding as revealed by toeprinting. They provide further evi- dence for the influence of the anticodon-flanking re- gions of tRNAmeL upon the initiation rate of transla- tion. In contrast, translation of the synthetic variant atpE/synIFN-8 gene fusion is controlled by a moder- ately stable stem-loop structure (AG = -4 kcal/mol; 37 “C) located within the coding region and overlap- ping the 30 S ribosomal subunit attachment site. That the stability of the hairpin interferes with the initiation of translation is inferred from site-directed mutagen- esis and toeprint analyses. mRNA half-life in these variants is positively correlated with the rate of trans- lation and involves two major endonucleolytic cleavage sites 5’-upstream of the Shine-Dalgarno region.

An understanding of the factors which control the initiation of translation is desirable in any endeavour to achieve high level gene expression in Escherichia coli. This includes a detailed knowledge of the features which characterize efficient E. coli ribosome-binding sites (RBSs).’ Both primary se-

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed: Gesellschaft fiir Biotechnologische Forschung, Genetik, Mascheroder Weg 1, 3300 Braunschweig, Federal Republic of Germany.

’ The abbreviations used are: RBS, ribosome-binding site(s); a- loop, anticodon-loop of tRNAmM”; atpE, gene encoding the c-subunit of atp-synthase in E. coli; bla, gene encoding the /3-lactamase; IFN, interferon; IFN, gene encoding interferon; nt, nucleotide(s); lacy, gene encoding P-galactoside-permease; lucZ, gene encoding fl-galac- tosidase; ompA, gene encoding the outer membrane protein of E. coli; PAGE, polyacrylamide gel electrophoresis; pnp, gene encoding the polynucleotide-phosphorylase; SD, Shine-Dalgarno; SDS, sodium do- decyl sulfate; trpE, gene encoding the anthranilate synthetase; MLV, Moloney murine leukemia virus.

quence information and secondary-structure information con- tribute to the efficiency of RBSs. Thus, it has been found in statistical investigations of >lOO RBSs that nine nucleotides (nt) between Shine-Dalgarno (SD) region and the initiation codon and a certain non-random nt composition of this region are favored. However, there is no perfect correlation between primary sequence information and the level of protein syn- thesized (Scherer et al., 1980; Storm0 et al., 1982; Stormo, 1986; Gold, 1988). Strong evidence has also been presented for the involvement of mRNA secondary-structures as an- other major determinant of the translational initiation fre- quency in E. coli (Hall et al., 1982, Tessier et al., 1984; Buell et al., 1985; Schmidt et al., 1987; Spanjaard et al., 1989). In addition, the number and order of steps leading to initiation are still a matter of discussion. Gualerzi et al. (1988) postulate the formation of an obligatory 30 S ternary complex inter- mediate: the initiator tRNA”” binds to the ribosomes in the presence of translational initiation factors and mRNA. It was concluded that a relatively slow rate-limiting first-order re- arrangement into an active initiation complex follows. It has been suggested that sequence information located 3’-down- stream of the AUG-codon in mRNA should facilitate the positioning of the anticodon-loop (a-loop) of tRNAm” and mRNA thereby supporting the formation of the “active” 30 S complex (Gold, 1988).

The experimental approach described here involves two gene constructions where the RBS from the E. coli atpE gene is fused to either the human IFN-P gene or to a synthetic variant adapted to the so-called optimal E. coli codon usage. The study of site-specific mutations confirms the influence of sequences immediately 5’ to the initiator-codon as well as secondary structure-dependent effects 3’-downstream of the AUG codon within the region confined to the initial contact of the 30 S ribosomal subunit. The presence or absence of specific endonucleolytic cleavages 5’ of the RBS during mRNA as in the model for RNA degradation proposed by Cannistraro et al. (1986) were examined.

EXPERIMENTAL PROCEDURES

Vector Constructions-The expression vector used in this study is pILA-502 which belongs to the family of pILA-vectors (Schauder et al., 1987) where bacteriophage X promoters pR and pi are regulated by the temperature-sensitive cIts857-coded repressor. Transcription is terminated by a transcriptional terminator from phage fd. Induc- tion takes place by a temperature shift from 30 to 42 “C. E. coli cells harboring these ekpression vectors are induced at OD5sn = 0.5. The IFN-B structural gene is fused to the RBS from the &DE gene (McCarthy et al., 1385) with the sequence surrounding the initiation codon

-2 -1 +1 atpIFN, 5’ . . GU U AUGAGC...

17627

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17628 RNA Primary Sequence Construction and properties of this construct atplFN1 in various expression vectors has been described (McCarthy et al., 1986; Gross and Hollatz, 1988). The derivatives are described under “site-directed mutagenesis.” Construction of atpIFl\r,[X3], a polycistronic variant containing three utpIFIVl units in the same orientation, was produced by concatenation of the monomeric atp-IFN1 units involving a BarnHI-site at the 5’ and a BglII-site at the 3’-end. BamHI/BumHI and BglII/RglII ligation products were redigested with restric- tion enzymes BglII and BumHI. Restriction enzyme-resistant multi- mers represented BglII/BumHI fusion products having the correct orientation. These were isolated by gel electrophoresis. The corre- sponding trimer was ligated into the expression vector pILA-502. Constructs were characterized by restriction enzyme mapping and partial sequencing.

Construction of the Synthetic IFN-/3 Gene Variant-A DNA se- quence double strand coding for the IFN-0 amino acid sequence and containing only those codons frequently found in highly expressed E. coli proteins (Gouy et al., 1982) was constructed by enzymatic ligation of a set of 68 overlapping nucleotides as described by Frank et al. (1987). The sequence has been verified completely by sequencing. The primary sequence identity between the natural and the synthetic gene is 76% (Table I). Expression of this gene utp-synIFN1 was in pILA-502 under the control of the RBS of the E. coli utpE gene as described for the natural IFN-0 gene under “Experimental Proce- dures” (Vector Constructions).

utp-synIFN/IFNlso is a chimeric gene which contains the first 139 nt from the natural human IFN-p gene and the remaining 367 nt from the synthetic variant. It was constructed by recombination of the two parent genes via a common PstI site at the iunction +139 (Table 1,. -

Site-directed Mutagenesis-The “gapped-duplex” DNA approach as described by Kramer et al., 1984 was used to introduce site-directed mutations into the IFN genes cloned in M13mp9 (Table II). To obtain utp-IFN2 a 24-mer was synthesized chemically

+1 atp-IFN,: 5’ . . . CTGGAGACTGTTATGAGCTACAAC . . .

00 24-mer: GACCTCTGACGGTACTCGATGTTG

For the construction of utp-IFN3 the 24.mer: 5’ GTTGTAGCTCA- TAGCAGTCTCCAG and for utp-IFN, the 24-mer: 5’ GTTGTAGCTCATGACAGTCTCCAG was used. After certification of the mutations by sequencing, the various utp-IFN constructs were inserted in pILA-502 and subjected to expression studies.

For the construction of derivatives of the synthetic IFN-/3 gene utp-synIFN, in M13mp9, the following oligonucleotides were used:

5'GGTTGTAAGACATAGCAGTCTCCAGTTTG 3' atp-synIFNz

5'GGTTGTAAGACATGACAGTCTCCAGTTTG3' atp-synIFN,

TABLE I Comparison of the human and synthetic IFN-0 gene variants

The human or the synthetic human IFN-0 structural gene are fused to the ribosome-binding site of the E. coli utpE gene (a@IFN1/ utp-synIFN1). Bold letters indicate the Shine-Dalgarno region, the initiation, and stop codon. Also indicated is the start of the IFN-P gene reading frame (+l). The synthetic variant was synthesized chemically from position +l to +506 (“Experimental Procedures”) using the preferential E. coli codon usage of E. coli genes (Gouy et al., 1982). The overall identity between the two variants reconstitutes 76% and is indicated (*).

5'GGTTGTAAGACATAACAGTCTCCAGTTTG 3' atp-synIFN,

5'CCCAGCAGGTTGTAGCTCATGGCAGTCTCCAGTTTG3' atp-synIFN,

5'CCCAGCAGGTTGTAGCTCATAGCAGTCTCCAGTTTG3' atp-synIFN,

5'CCCAGCAGGTTGTAGCTCATGACAGTCTCCAGTTTG3' atp-synIFN7

5'CCCAGCAGGTTGTAGCTCATAACAGTCTCCAGTTTG 3' atp-synIFN,

~'GAACGGTGCAGGAATCCAAGCAAGTTGTAGCTCATFLKAG~' atp-synIFN,

5'GGAAGTTAGAAGAGCGTTGCAGGAAACC3' atp-synIFN,,

5'GGAAGTTAGAACAACGCTGCAGG 3' atp-synIFN,,

atp-synIFN$ and utp-synIFNlu were derived by site-directed mutagen- esis from utp-synIFN,; atp-synIFN,, from utp-synIFN+

RNA Kinetics-E. coli cells harboring the expression vectors were grown up to OD,,50 = 0.5 and induced at 42 “C for 30 min. Rifampicin (150 fig/ml) was added in the presence or absence of kasugamycin (inhibitor of translational initiation, 100 @g/ml). Cells were taken at the indicated time intervals, quickly pelleted, and frozen at -80 “C in a dry ice bath. RNA was isolated by the guanidinium-hot-phenol method as described by Maniatis et al. (1982). Total E. coli RNA (5 rg) was separated electrophoretically in a 2.2 M formaldehyde, 1.5% agarose gel and transferred to nitrocellulose. Hybridization was car- ried out with a nick-translated “*P-labeled IFN-P gene-specific DNA probe. The half-life of mRNA decay was calculated on the basis of the “P-label present in the intact mRNA band cut from the northern blot and determined in a scintillation counter. The level of steady- state IFN-fl mRNA was determined in the same way by the radioac- tivity present in the intact IFN-fi mRNA band 30 min after induction of transcription.

Protein Fractionation by SDS-PAGE-E. coli cells harboring expression vectors were grown to OD,,, = 0.5 and were then induced at 42 “C. At the indicated time intervals samples were taken and lysed in a SDS-lysis buffer containing 7 M urea for 5 min at 60 “C. Separation was by 0.1% SDS, lo-20% gradient PAGE.

E. coli strains-E. coli DHl (Hanahan, 1983) was used as host, if not stated otherwise.

In Vitro Formation of the Initiation Complex of Trunslution: Toe- printing-The rate of ribosome binding in the initiation region of protein synthesis was determined by the primer-extension inhibition analysis as described by Hartz et al. (1989). Low salt-washed 30 S ribosomal subunits (with translational initiation factors) were iso- lated by sedimentation through a sucrose gradient (lo-30%). The purity of fractions for 30 S ribosomal subunits was checked by gel electrophoresis (2.5% acrylamide, 1% agarose-mixed gel). Active frac- tions in mRNA binding determined by the toeprinting technology were used for further studies. Total cellular E. coli RNA (10 pg) or in uitro synthesized RNA (2 pg, synthesized as described by Stiiber et al., 1984) was incubated 10 min at 37 “C in the presence of 20 pmol of 30 S ribosomal subunits and 100 pmol of uncharged tRNAW” in 20 ~1 of volumina. Primer-mediated reverse transcription of the human IFN-P mRNA was initiated at position +91 downstream of the AUG initiation codon with the “‘P-labeled oligonucleotide 5’ TCATCCTGTCCTTGAGGC. Reverse transcription with mRNAs of the synthetic IFN-0 gene variant and its derivatives was initiated at position +67 with the oligonucleotide 5’ GACGACCGTTCAGCT. Elongation products were separated on a 6% acrylamide-urea gel.

RESULTS

Expression of the Human ZFN-(3 Gene-The fusion of the human IFN-P gene to the E. coli atpE ribosome-binding site resulted in the expression of 15-20% of total cellular protein (McCarthy et al., 1986; Gross and Hollatz, 1988; Table IV, Fig. 2). To further delineate the parameters which govern efficient protein synthesis we analyzed the influence of pri- mary sequence information between the SDS region and the canonical AUG initiation codon in this system. Since analysis of sequence/function relationships is always hampered by the fact that any point mutation is also capable of changing the secondary-structure we used a modified version of the “Zuker- program” (Zuker et al., 1981) to predict the secondary-struc- ture within the 90 nt surrounding the initiation codon AUG. Two relatively weak loop-structures for the atp-ZFN1 mRNA

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RNA Primary Sequence

FIG. 1. Proposed mRNA secondary structure of IFN-8 gene variants in the initiation region of protein synthesis. The mRNA secondary structure was calculated by a modified version described by Zuker et al. (1981). A, human IFN-@ gene variants fused to the RBS of the E. coli atpE gene. The U -+ C substitutions either at the -1, -2, or at both positions in atp-ZFN, lead(s) to the predicted structure shown for atp-ZFN2. B, synthetic human IFN-P gene variants fused to the RBS of the E. cob atpE gene. The synthetic IFN-P gene variant utp-ZFN8 is modified at positions 13, 18, and 21 as indicated to give the utp-synZFN9 variant with reduced stability. Other substitutions in utp-synZFN8 leading to reduced stability are at positions 30 and 33 resulting in the utp- synZFN,,, variant. The C + G replacement at position 35 of atp-synZFN9 was introduced to refold a similar structure like in utp-synZFNs resulting in variant atp-synZFNll. This latter exchange leads to a conservative Ser + Cys exchange in the reading frame. The start codon AUG (+l) and the toeprint of the 30 S ribosomal subunit at position +16 is indicated in all cases.

17629

TABLE II

Sequence of ZFN-0 mRNA-variants, their predicted stability of RNA structure in the trunslutionul initiation region and their expression rate in E. coli

Silent mutations were introduced by site-directed mutagenesis (“Experimental Procedures”). In the atp-synZFNll variant the C - G substitution results in a Ser + Cys exchange. The free energy AG (kcal/mol) of mRNA structure has been predicted for 37 and 42 “C by the method devised by Zuker et al., 1981.

IFN+ gono variants:

5:.. UU %G AGC UAC AAC UUG CUU GGA . . . . . . CC AUG AGC UAC AAC UUG CUU GGA . . . . . . CU AUG AGC UAC MC UUG CUU GGA . . . . . . UC AU0 AGC UAC AAC UUG CUU GGA . . .

!&nthotio UN-@ gana vorfant8:

5:.. CC i&G UCU UAC AAC CUG CUG GGU UUC CUG CAG CGU UCU UCU AAC . . . . . . ‘Xl AUG UCU UAC AAC CUG CUG GGU UUC CUG ‘ZAG CGU UCU UCU AAC . . . . . . UC AUG UCU UAC AAC CUG CUG GGU UUC CUG CAG CGU UCU UCU AAC . . . . . . UU AUG UCU UAC AAC CUG CUG GGU UUC CUG CAG CGU UCU UCU MC . . . . . . CC AU0 A#: UAC AAC CUG CUG GGU UUC CUG CAG CGU UCU UCU AAC 1.. . . . CU AUG MC UAC MC CUG CUG GGU UUC CUD CAG CGU UCU UCU AAC . . . . . . W AUG A#: UAC AM CUG CUG GGU UUC CUG CAG CGU UCU UCU AAC . . . . . . W AUG A#: UAC MC CUG CUG GGU UUC CUG CAG CGU UCU UCU AAC . . . . . . W AUG MC UAC AAC UUG CUU GtX UUC CUG CAG CGU UCU UCU AAC . . . . . . W A!JG k#: UAC AAC CUG CUG GGU UUC CUG CAA CGA UCU UCU MC . . . . . . W AUG A#: UAC MC UUG CUU GGA UUC CUG CAG CGU UGU UCU AAC . . .

Otp-Iml atp-II32 atp-IFNJ atp-IFNq

Free energy AG of mRNA structure in the

Exp;ss:&; in

initiation region of [X of total protein synthesis

[kcal/mol] csllular protein]

3fc 42’ C -1 .Q -0.7 18 -1.2 -0.7 <l

-1.2 -0.7 -1.2 -0.7 t

a tp-synIF?i 1 -4.7 atp-eynIFN2 -4.7 atp-synIFN3 -4.7 a tp-syn IiW4 -4.7 atp-synIF?Jg -4.7 atp-synIF?Q -4.7 a tp-ayn IFN7 -4.7 atp-synIF?Q -4.7 atp-synIFNg -1.8 atp-synlfllrlo -2.6 atp-.synIFNf 1 -4.6

-3.1 -3.1 -3.1 -3.1 -3.1 -3.1 -3.1 -3.1 -0.3

2.9

(1 <l <l <l <l <l <l

:A 3

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17630 RNA Primary Sequence

A otp-IFNf otp-IF?f4 otp-IFN2

r

-- -- +t-- %YU SlFf

ZJ --- --s SZr - -~ _. _-

-- FIG. 2. Rate of expression of IFN-

fi gene variants in E. coli. A, level of IFN-P synthesis directed from human IFN-/3 gene variants modified in the im- mediate vicinity of the initiation codon AUG. The U + C exchanges exert a more negative influence in the -1 than in the -2 position before the initiation

ti L-3 m- - 2 4

codon. B, level of IFN-P synthesis di- B rected from synthetic human IFN-fl gene derivatives. Construction and propelties are as detailed under “Experimental Pro- cedures.”

Otp-S,dFNg atp-synlrng utp-synIfN1fJ otp-synIF?41 , otp-synIFN/IfNf50

1 - ‘2 ‘4 [hours] -12’4

of translation than in the -2 position (atp-ZFN4, 18% + 4%; atp-ZFN3, 18 + 8%) while the coupled substitution at both positions (atp-ZFN,) reduces the translational efficiency from 18 to less than 1% of total cellular protein. This effect may reflect reduced 30 S subunit affinity toward IFN-/3 mRNA or could possibly suggest a major role of the extended a-loop of tRNAMe’ upon the formation of the translational initiation complex by the interaction with nucleotides flanking the initiation codon AUG in the mRNA molecule (Table III, for an evaluation see “Discussion”) which should explain that a mismatch at the position -1 exerts a stronger negative effect upon the formation of the translational initiation complex and the rate of expression than the position -2 (Figs. 2 and 3). A double-mismatch in these positions should give an enhanced effect in this respect which seems in agreement with our data (Figs. 2 and 3, Table III).

Formation of the Translational Initiation Complex-A direct proof that the nt exchanges described above interfere with the formation of a translational initiation complex is the toeprinting of the initiating 30 S ribosomal subunit. This complex presumably covers in mRNA nt -20 to +14 at the initial binding site (if the A of the initiation codon AUG is considered as position +l) and which corresponds to position +16 in toeprints due to steric effects of the experimental system (for an evaluation, see Gold, 1988). Toeprinting reveals the 3’ boundary of the initiation 30 S ribosomal subunit by the extension inhibition of primer-initiated DNA synthesis by reverse transcriptase. The intensity of the toeprint corre- sponds to the efficiency of translational initiation at this particular location (Hartz et al., 1987; Gold, 1988). Here, comparative toeprinting with RNA isolated from E. coli hosts was impossible for both the natural and synthetic IFN-/3 gene derivatives since the mRNA content in total cellular RNA is strikingly different due to differential half-lives (Fig. 4, see also RNA stability). Hence, RNA was synthesized in uitro

TABLE III Potential interaction of atp-IFN,., mRNAs with the extended anticodon loop of tRNAfM” in the initiation region of protein

synthesis The potential interaction of atp-ZFN1.4 mRNA with a g-base region

surrounding the anticodon loop (a-loop) is demonstrated. Comple- mentarity is indicated by points.

Expression in E. coli

rx of total

a-loop +a * u n +1 -4 -1 ceilular protein]

3’...C A A IJ AC U C G...5’ . . . . . . .

-2 -7 +t n u * ts

otp-IFNl 5’...G U U AU G A G C...3’ 18 . - _ . . .

otp-IFN3 . ..G C U AU GA G C... 8 _ . . . . .

otp-IFNq . ..G U CA U GA G C... 4 . . . . .

atp-IFNZ . ..G C CA U GA G C... <l

were suggested in this particular region (AG = -1.9 kcal/mol, 37 “C) one with the AG = -0.7 and the other one with AG = -1.2 kcal/mol (Fig. 1A). At 42 “C (the temperature of tran- scription and translation) the existence of the weaker struc- ture enclosing the SD region is predicted to cease while the stability of the remaining between position +14 and +37 is reduced to AC = -0.7 kcal/mol (Fig. IA, Table II). Similarly, at 37 “C, the substitution of one or two U + C in the -1 and -2 position in front of the initiator codon AUG are predicted to destroy the weaker hairpin (atp-ZFN2,3,4, Fig. IA) leading to a further overall destabilization of secondary-structure in this region. Any translational effect observed at 42 “C should therefore be mainly sequence-specific. Contrary to the fact that in numerous cases a reduced secondary-structure leads to enhanced translational efficiency (see Introduction) in our case here the level of expression shows a dramatic decrease (Fig. 2, Table II). It is also obvious that the U + C exchange at the -1 position exerts a more critical effect upon the level

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RNA Primary Sequence 17631

.

[I

.-

e. !

. * c . m- .

A. +4 k-*

Jam?

- - c- .

-- - . 5 - - . -- . -- . - .

m

:; _ 4 .-

;. .

4cIcl cl 4 c21( c+e.e..rT PPPP ;;;; zzdz

FIG. 3. Toeprint analysis of IFN-B mRNA. Toeprinting analysis was as described under “Experimental Procedures.” 30 S ribosomsal subunits were bound in vitro to mRNA, and the binding complex was revealed by extension inhibition analysis with MLV-reverse transcriptase started from a “P-labeled internal primer. Synthesis products were separated on 6% urea-PAGE. I, toeprinting analysis with total E. coli mRNA (10 /*g) harboring the atp-IFN, containing expression vector, isolated 30 min after induction; a, toeprint with 20 pmol of 30 S ribosomal subunits; b, toeprint with 2 pmol of 30 S subunits; c, control: DNA synthesis with MLV-reverse transcriptase in the absence of 30 S subunits. A, C, G, Z’, specific sequencing reactions with atp-IFN, mRNA and MLV-reverse transcriptase mediated from the same internal primer. II, toeprinting analysis with mRNA synthesized in vitro with E. coli RNA polymerase. 2 pg RNA derived from each natural IFN-P gene construct ~~,PIFN~.~ in expression vector pILA-502 was toeprinted with 30 S ribosomal subunits. c, control of DNA synthesis by reverse transcriptase in the absence of 30 S ribosomal subunits. A, C, specific sequencing reactions as described above. The toeprints of the IFN-P derivatives are enlarged in an extra panel. III, toeprints with 2 fig of RNA synthesized in uitro from synthetic human IFN-P derivatives. Experimental details and legend is as described above. In all cases the start of protein synthesis and the position of the toeprints are indicated.

with E. coli RNA polymerase and identical amounts of RNA (2 pg) were subjected to toeprint analysis (Fig. 3). The toeprint of the initiating 30 S ribosomal subunit gives the identical toeprint in vitro as in uiuo with atp-IFN, mRNA and covers the mRNA up to position +16 (Fig. 3, I and Zr). Toeprinting with in uitro synthesized RNA from the derivatives atp- IFN1-4 correlates with the translational data in Figs. 1 and 2 namely that a U + C exchange at position -1 has a more negative impact on 30s subunit binding than an exchange at position -2. The double exchange at positions -1 and -2 exhibits only a weak toeprint shifted by two nt (Fig. 3, II). Also a high background of “false” toeprints is detected in mRNAs from lower expressing constructs atp-IFNpe4 which do not bind the 30 S subunits at the (optimal) rate observed for the atp-ZFN, mRNA and may therefore represent binding sites for 30 S subunits which do not mediate efficient initia- tion of translation.

The Case of the Synthetic IFN-/3 Gene-The synthetic IFN- fi gene was assembled chemically on the basis of the optimal E. coli codon usage and shows a 76% primary sequence iden-

tity to the natural human IFN-P gene (Table I). Like the natural human IFN-/? gene, it was fused to the RBS of the E. coli atpE gene, but contrary to the latter it does not show significant rates of translation in E. coli (Table II, atp-syn- IFNJ. Attempts to enhance interaction with the extended a- loop of tRNAe”‘” as described above for the natural human IFN-@ gene had no significant effect upon the level of trans- lation (atp-synZFNl-e, Table II, Fig. 2). Instead, the block of translation could be localized in a moderately stable second- ary-structure (AG = -4 kcal/mol, 37 “C) located 3’-down- stream of the initiation codon AUG between position +lO and +34 (Fig. lB, atp-synZFN& which is within the limits of the initial binding site of the 30 S ribosomal subunit. By site- directed mutagenesis this predicted hairpin was destabilized by three substitutions (C + U, G + U, and U ---f A at positions +13, +18, and +21, respectively; Fig. 1B). At these positions, the sequence was adjusted to the natural human IFN-P gene resulting in construct atp-synIFNg and thereby retaining the original amino acid sequence (Fig. lB, atp-synIFNd. The reduced stability predicted for the prevailing hairpin is -1.1

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17632 RNA Primary Sequence

FIG. 4. RNA stability of IFN-fi gene variants. Z, mRNA stability of the natural human IFN-P gene constructs atp-IFN,+ Rifampicin was added to the E. coli cells 30 min after induction to block further transcription. Total RNA was isolated and 10 UP were subiected to Northern blotting. IFN-B-snecific mRNA is revealed bv hybridization with a nick-translated IFN-@ gene-specific probe. II, mRNA of IFN-igene variants in endonucleo- lytically attacked. atp-IFN, mRNA isolated as described above was annealed with an internal primer followed by elongation with MLV-reverse transcriptase. Elongation products were separated in a 6% urea-PAGE. c, control elongation of 2 pg atp-lFN1 RNA synthesized in uitro as described in Fig. 3. 0, 3, 8, 15 exhibit elongation products with atp-IFN, RNA (10 pg) isolated after rifampicin treatment in minutes. Major RNA cleavage sites in the 5’- end of mRNA resulting from endonucleolytical cleavage are indicated. A, C, specific sequencing relations started from the same internal primer with MLV-reverse transcriptase. IZI, mRNA decay of the polycistronic atp-ZFN,[x3] mRNA containing three atp-IFN1 gene units in the expression vector pILA-502. A, addition of rifampicin was 30 min after induction of the cells. B, kasugamycin (translational inhibitor) was added simultaneously with the addition of rifampicin. C, cells were preincubated with kasugamycin for 30 min before the addition of rifampicin.

kcal/mol, 37 “C. The so modified synthetic IFN-/3 gene variant (atp-synlFNg) construct produces 28% of IFN-/3 in E. cob hosts which is roughly 10% more than the atp-IFN, construct (Tables II and IV, Fig. 2). Toeprint analysis revealed that the base substitutions which reduce the stability of the secondary structure (atp-synlFNg) exhibits two strong toeprints at po- sition +16 and +17 which in comparison to the inactive derivatives atp-synZFN,+,s (Fig. 3,110 demonstrates that the high rate of translation probably resides in an efficient initi- ation of translation (Fig. 3, ZZO. These toeprints had to be performed also with in vitro synthesized RNA since transla- tionally inactive derivatives of the synthetic IFN-0 gene dis- play an equally short half-life as described already for the natural IFN-/l gene (data not shown). In an additional inves- tigation, we modified the secondary structure of the atp- synIFNs construct by base substitutions outside of the se- quence which is covered by the initiation 30 S subunit and which should also effect the predicted secondary structure. At positions +30 and +33, G + A and U + C were introduced (atp-synZFNIO) so that it is destabilized considerably (AG = -4 kcal/mol + AG = -1.9 kcal/mol; 37 “C) by conserving the original amino acid sequence. This leads to an improvement

of IFN-@ synthesis from Cl% (atp-synIFNs) + -3% total cellular protein. This correlates roughly with the remaining free energy of the atp-synZFNIO mRNA in this region. In addition we tried to show that the predicted structure has a negative impact upon translational initiation by introducing a C + G exchange at position +35 of the destabilized variant atp-synIFNg (Fig. lB, atp-synIFN1,). This single base ex- change in atp-synIFNll refolds a nearly original hairpin be- tween positions +8 and +36 with an almost identical free energy AG = -3.9 kcal/mol; 37 “C. This latter C + G exchange results in a conservative Ser + Cys substitution in the amino acid primary sequence which should not significantly change the overall physiology of this protein in the E. coli host. As anticipated, this single C + G exchange causes a drastic drop in the level of IFN-/3 synthesized (30%, atp-synIFNg + -l%, atp-synZFN,,; Fig. 2). This should ascertain that the predicted moderately stable hairpin in the region 3’-downstream of the AUG codon in the translational initiation region interferes with 30 S subunit binding and efficient initiation of transla- tion.

RNA Stability-The stability of the mRNAs synthesized from the IFN-/3 gene variants in expression vector pILA-502

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RNA Primary Sequence

TABLE IV

IFN-fl protein and mRNA level, mRNA half-hues of constructs with mutations

IFN-0 expression of the various constructs in E. coli has been determined as described under “Experimental Procedures” represent- ing mean values + the standard deviation of five independent exper- iments. The mRNA half-life -t the standard deviation has been determined as described under “Experimental Procedures” with at least three independent experiments. The steady-state level of IFN- fl mRNA in E. coli was determined as described under “Experimental Procedures.” Values are the mean k standard deviation of duplicates from the same sample. Similar relationships have been obtained in other experiments. These values have been correlated to the data of the original IFN-/3 gene via hybridization standards specific for the synthetic and the original IFN-P gene (*). Value in parentheses is % relative to atp-synZFNg exhibiting the highest steady-state mRNA level in E. coli (100).

IFN- expresslo” Hdf-Iif* Of reIo*,ve mm-p MN4 I! x Of total

‘y%?y Ievd In E. co,*

E. COII pdain] [ counts per min ]

otp-IFN, ,a* 2.5 2:: 23

.?,,m * I IW Otp-IFN~ <I lloot .?oo ‘Sj Otp-IFNJ at 1.6 2.3* 0.3 rtmwt am atp-Im4 I* I 1.4scJ.2

atp-spIm’ : I 0.5 IO.2

olw: E (;g*

atp-SynIrn4 “.d. n.d. a tp-aynxFN8 < 1 n.d. otp-aynrm&3 .?a* 2s 4.5* 0.3 5&~;3200 (loo)* atp-oynrm~o J* 0.5 f.lt0.2 OtPaynxFNI 1 f t 0.5 0.5t 0.2 7%: E (‘yj:

is positively correlated with the rate of translation (Fig. 5, a and 6) and exhibits half-lives ranging from 3.1 min for the atp-IFN,, 2.3 min for atp-IFNs, 1.4 min for atp-ZFN,, and 0.5 min for the atp-IFNs mRNA (Fig. 4, I; Table IV). An identical situation exists for mRNA synthesized from the synthetic IFN-/3 gene variant: nonproducing derivatives exhibit a mRNA half-life of only about 0.5 min (Table IV). In contrast, the atp-synIFNg derivative which directs the highest level of IFN-@ synthesis of all constructs described here (28% of total cellular E. coli protein) also displays the longest mRNA half- life: 4.5 min at 42 “C (Table IV). Steady-state IFN-/3 mRNA levels are correlated to the amount of IFN-P synthesized (Fig. 5b) and the differential amounts of the steady-state IFN-fi mRNA level may be explained by the mRNA half-lives (Fig. 5c, Table IV).

In general, RNA degradation in E. coli seems either in 3’ + 5’ or in 5’ + 3’ direction (for a review see e.g. Brawerman, 1987, 1989). However, the criteria which determine the sta- bility of mRNA have up to now not been understood in detail. So, extended RNA secondary structures may stabilize mRNA sequences located upstream probably against the degradation by 3’ --, 5’ exonucleases (Schmeissner et al., 1984; Mott et al., 1985; Belasco et al., 1985; Newbury et al., 1987; Gross et al., 1988). However, the presence of certain sequences at the 5’- end of mRNA (Gorski et al., 1985; Belasco et al., 1986) may also influence RNA stability. Furthermore, in a number of genes endonucleolytic cleavages were found near to or in front of the SD region (e.g. between lacZ and lacy mRNA, Cannis- traro et al., 1986; in ompA and bla mRNA, Nilsson et al., 1988; pnp mRNA, Portier et al., 1987) probably connected to RNA degradation.

With our gene constructs two endonucleolytic cleavage sites were monitored upstream of the SD region (Fig. 4, II). The cleavage sites could be localized in short oligo U stretches in front of the SD region (Fig. 6) and may substantiate the model of RNA decay put forward by Cannistraro et al. (1986). This model states that endonucleolytic cleavages in the 5’-end of mRNA interfere with the formation of a translational initia- tion complex thus leading to ribosomal depletion of the RNA which is now susceptible for further endonucleolytic cleavages and then is degraded exonucleolytically. Here, the truncated mRNAs at the two cleavage sites observed in the atpE RBS

could interfere with the efficient reinitiation of translation indeed, as demonstrated in another investigation by deletion mapping of this particular region in the E. coli atpE RBS (McCarthy et al., 1985). The E. coli endonuclease possibly responsible for these cleavages may be the recently described RNase M which prefers for pyrimidine-adenosine linkages (Cannistraro et al., 1989) albeit in this case the cleavage sites rather seem within the oligo U stretches than in the U/A boundary (Fig. 6). These two endonucleolytic cleavage sites have also been localized in the atpE RBS in front of the synthetic IFN-@ gene variant and their derivatives (data not shown).

In a previous investigation, we documented the great influ- ence of regions in the 3’-end of IFN-@ mRNA enclosing terminators of transcription from bacteriophage fd and X origin upon RNA stability and the level of protein synthesized (Gross and Hollatz, 1988). Here we add the observation that endonucleolytical cleavages at the 5’-end of mRNAs seem also connected to mRNA stability. A proof whether these cleavage sites are the dominating entry sites for endonucleo- lytical attack would be a clearly visible cleavage pattern during mRNA decay in an artificial polycistronic atp-IFNi[x3] mRNA molecule containing three IFN-@ structural gene units each under the control of the same RBS from the E. coli atpE gene (Fig. 6). The cleavage pattern should display cleavage products of the monomer and of the partially cleaved dimer size class and depend upon the presence of actively translating ribosomes protecting the mRNA against the action of the endonuclease(s). Indeed, mRNA decay studies of this polycis- tronic mRNA exhibit such a cleavage pattern which is ob- served in the absence of kasugamycin (inhibitor of the initi- ation of translation; Fig. 4, 110. The simultaneous addition of rifampicin and kasugamycin reduces the cleavage pattern which completely disappears if kasugamycin has been prein- cubated 30 min before the addition of rifampicin. However, in contrast to the expectation mRNA half-life of IFN-/? mRNA substantially increases in the presence of kasugamy- tin. An explanation for this would be that in viuo in the E. coli cell kasugamycin may cause effects not uncommon to animal cells where the absence of ongoing translation blocks the de nouo synthesis of unstable (protein) factor(s) involved in the regulation of RNA degradation resulting in a stabili- zation of some mRNA classes. So, the latter experiment has to be studied in detail with the introduction of stop codons in this polycistronic IFN-P mRNA atp-ZFNl[x3] to assure that translationally inactive RNA exhibits as a high turnover rate in this experimental system as observed with low producing constructs atp-IFN,-, and atp-synIFN1-s,,l. Yet, the experi- ment in the presence of kasugamycin indicates that the cleav- age pattern observed in viuo in E. coli in the absence of kasugamycin is probably not caused by premature transcrip- tional termination which is also not observed by in vitro transcription of this or other constructs (not shown).

DISCUSSION

The two human artificial E. coli atpE/human IFN-p gene fusions investigated allowed us to differentiate between pri- mary-sequence and structural information in the translational initiation region upon the level of protein synthesized. In a presumably unfolded RNA structure within this region of the atp-ZFN1 construct nucleotide conversions U + C at positions -1 and -2 exert a strong negative influence upon the level of protein synthesized. What is the nature of this effect? Two alternatives seem possible: either these nucleotide substitu- tions reflect reduced 30 S/mRNA interactions as has been suggested by Hui et al. (1984) where a similar observation has

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17634 n

RNA Primary Sequence

I I

I- - 0.97s

FIG. 5. Correlation between IFN-/3 expression, mRNA level, and mRNA half-life in E. coli. Correlation between IFN-0 expression and IFN-fl mRNA half-life (a) (determined as described under “Experimental Proce- dures”). The values used were from Table IV. The line drawn was obtained using least-square linear regression (correlation coefficient r = 0.982); b, between the IFN-0 expression and the steady-state IFN-@ mRNA level (determined as described under “Experimental Procedures”). The values are from Table IV. The correlation coefficient is r = 0.986; c, between IFN-P mRNA half-life and level (steady-state mRNA) in E. coli. The values are from Table IV and the correlation coefficient is r = 0.978.

endonuclsolytio cleavage sites

30S-subunit

FIG. 6. Major endonucleolytic cleavage sites in the upstream region of IFN-&atpE mRNA. Endonu- cleolytic cleavage sites in polycistronic a@-ZZW,[x3] mRNA are indicated. The corresponding region of cleavage sites in one cistron is localized within the U-rich region upstream the SD region of the E. coli atpE RBS. The position of the initiating 30 S ribosomal subunit is indicated. Endonucleolytical cleavages interfere with efficient initiation of translation since the region upstream the SD sequence is indispensable for optimal rates of translation as established by deletion mapping in the E. coli atpE gene (McCarthy et aZ., 1985).

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

RNA Primary Sequence

been made with 1ucZ mRNA. They may alternatively reflect an extended interaction of the a-loop of tRNAm” with mRNA influencing the rate of translational initiation. Indeed, other experimental data have shown, e.g. that nucleotide conversion leading to a potential enhanced tRNAmet/mRNA interaction at the first position after the initiation codon AUG (corre- sponding to mRNA position +4, Table III) exerts also a positive influence upon translational efficiency (Taniguchi et al., 1978). In addition, the substantial influence of (almost any) tRNA anticodon region upon the positioning of the initiating 30 S subunit has been demonstrated in a study of Hartz et al. (1989) while initiation factors IF2 and IF3 exert a positive selection for the initiator tRNAfMet. An extended interaction of the a-loop of tRNAfM”” with mRNA leading to enhanced protein synthesis has also been suggested (on a statistical basis) by Ganoza et al. (1985). In this respect one has to consider structural implications of the a-loop and stem of tRNAmet . Seong and RajBhandary (1987) have shown that the unaltered anticodon stem is essential for the conformation of the a-loop. Therefore, if at all, only a potential extended two-base interaction flanking the anticodon CAU is conceiv- able to lead to enhanced rates of translational initiation and expression. Due to a certain rigidity of the a-loop (Wakao et al., 1989), one would expect that sequence alterations in the immediate vicinity of the initiator-codon like the position -1 exert a stronger effect upon the formation of the translational initiation complex and the initiation frequency than sequence alterations at position -2. A double mismatch at these posi- tions should exhibit an augmented effect which indeed is in agreement with our data (Figs. 2 and 3, Table III). A possible explanation for the positive effect upon translational effi- ciency by enhanced interaction between tRNAmet, mRNA and the 30 S ribosomal subunit would be a more rapid con- version of the ternary pre- to the initiation complex capable of initiating translation as described by Gualerzi et ul. (1988). The observed consequences of nucleotide changes in the vi- cinity of the initiator codon should be dependent on a rela- tively unfolded translational initiation region in mRNA. Ex- perimental systems with this particular feature have to be evaluated to substantiate above considerations.

Furthermore, a stem-loop structure in the region of the initial binding site of the 30 S subunit which does not involve the SD region and/or AUG codon infers with efficient trans- lational rates. Interestingly, the relaxed form of this stem- loop structure in the synthetic human IFN-p gene variant (utp-syn1FNg) gives rise to a 10% higher IFN-P synthesis than a comparable region of the natural IFN-/? gene (Fig. 1, A and B). In our view, this is probably not due to the codon usage optimized for the E. coli environment. Rather this enhanced rate of translation seems to be caused by a reduced free energy by 0.4 kcal/mol, 42 “C between utp-IFN, and atp-synZFN9 mRNA (Table II and Fig. 1, A and B) even though conclusions based on the distinction between AG- measurements of such closely similar RNA secondary-structures seem problematic due to the inherent inaccuracy. However, small changes in the free energy may exert a great influence upon RNA/ ribosome interaction, as discussed by Storm0 (1986) and Gold (1988). Moreover, a hybrid construct consisting of about one- third of the natural human IFN-/3 gene at the 5’-end and of about two-thirds of the synthetic variant with E. coli codon usage at the 3’-end (atp-synZFN/IFNls,,, “Experimental Pro- cedures”) shows the expression rate of the natural human IFN-p gene (Fig. 2). This is not too surprising since the use of rare codons in E. coli exerts only in special situations an effect upon translational efficiency (e.g. AGG-Codons at high translational rates; Robinson et al., 1984) albeit rare codons

prolong the time needed for the completion of translation (Sbrensen et al., 1989).

The low level of IFN-P expression of some derivatives could be explained also by a reduced mRNA stability per se as an inherent feature of the changed nucleic acid primary sequence specially since one would expect that the line of Fig. 56 (steady-state IFN-P mRNA level/IFN-P expression) rather would curve downward instead of exhibiting a linear relation- ship. Even if one cannot exclude this argument with absolute certainty, it seems unlikely since in vitro synthesized RNA shows clearly differential 30 S ribosomal subunit-binding efficiencies (toeprinting) giving a clear indication of the prior- ity. Our results seem consistent with the interpretation that primary sequence and/or structural changes influence the translational initiation frequency (Fig. 3). If this conclusion is correct then it should also account for the additional effect: the correlation between mRNA stability and the level of protein synthesized since a relatively constant IFN-P mRNA/ IFN-P protein relationship is observed (Table IV, Fig. 5). The RNA lability phenomenon in all cases tested seems ultimately to be linked to the major endonucleolytic cleavage sites in the untranslated upstream region of the utpE RBS. These are not involved in nucleotide exchanges investigated here and at least for the synthetic IFN-fi mRNA we can with a high probability exclude that structural rearrangements take place near the major endonucleolytical cleavage sites. Our findings are in agreement with other investigations where the sequence upstream the SD region has been observed to influence mRNA stability like in lucZ, ompA, trpE mRNA (Cannistraro et al. 1979; Green et al., 1984; Stanssens et al., 1986; Cho et al., 1988). Thus, it seems conceivable that initiating ribosomes protect IFN-/3 mRNA against endonucleolytic attack. IFN-@ mRNA decay seems to depend on the mRNA susceptibility to endonucleolytic attack in the atpE translational initiation region which is modulated by the efficiency of ribosome binding as suggested in Fig. 6.

Although the mRNAs examined here represent unnatural gene fusion between an E. coli RBS and two human IFN-@ gene variants, our findings document primary sequence and structural influences upon the translational initiation fre- quency in this prokaryotic host. Here, mRNA stability ap- pears to be controlled by ribosomes modulating nuclease susceptibility in the 5’-end of mRNA. Yet, more analyses are needed for a deeper understanding of the rules and regulation of mRNA metabolism in E. coli.

Acknowledgements-We thank Prof. J. Collins and Dr. E. Wingen- der for stimulating discussions, and we are indebted to Dr. J. Mc- Carthy for the donation of expression vectors.

REFERENCES

Belasco, J. G., Beatty, J. T., Adams, C. W., von Gabain, A., and Cohen, S. N. (1985) Cell 40, 171-181

Belasco, J., Nilsson, G., von Gabain, A., and Cohen, S. (1986) Cell 46,245-251

Brawerman, G. (1987) Cell 48, 5-6 Brawerman, G. (1989) Cell 57,9-10 Buell, G., Schulz, M-F., Selzer, G., Chollet, A., Rao Mowa, N., Semon,

D., Escanez, S., and Kavashima, E. (1985) Nucleic Acids Res. 13, 1923-1938

Cannistraro, V. J., and Kennell, D. (1979) Nature 277,407-409 Cannistraro, V. J., and Kennell, D. (1989) Eur. J. Biochem. 181,

363-370 Cannistraro, V. J., Subbarraro, M. N., and Kennell, D. (1986) J. Mol.

Biol. 192,257-274 Cho, K-O., and Yanofsky, C. (1988) J. Mol. Biol. 204,51-60 Frank, R., Meyerhans, A., Schwellnus, K., and Blocker, H. (1987)

Methods Enzymol. 154,221-249 Ganoza, M. C., Marliere, P., Kofoid, E. C., and Louis, B. G. (1985)

Proc. Natl. Acad. Sci. U. S. A. 82, 4587-4591

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

17636 RNA Primary Sequence

Gold, L. (1988) Annu. Rev. Biochem. 57, 199-233 Stephens, P., Millican, A., Eaton, M., and Humphreys, G. (1984) Gorski, K., Roth, J.-M., Prentki, P., and Krisch, H. M. (1985) Cell Nucleic Acids Res. 12, 6663-6671

43,461-469 Schauder, B., Blocker, H., Frank, R., and McCarthy, J. E.-G. (1987) Gouy, M., and Gautier, C. (1982) Nucleic Acids Res. 10, 7055-7074 Gene (Am&.) 52, 279-283 Green, P. J., and Inouye, M. (1984) J. Mol. Biol. 176, 431-442 Scherer, G. F. E., Walkinshaw, M. D., Arnott, S., and Morri, D. J. Gross, G., and Hollatz, I. (1988) Gene (Amst.) 72, 119-128 (1980) Nucleic Acids Res. 8, 3895-3907 Gualerzi, C. O., Calgero, R. A., Canonaco, M. A., Brombach, M., and Schmeissner, U., McKenney, K., Rosenberg, M., and Court, D. (1984)

Pon, C. L. (1988) in Genetics of Translation (Tuite, M. F., and J. Mol. Biol. 176, 39-53 Bolotin-Fukuhara, M., eds) pp. 317-330, Springer-Verlag, Heidel- Schmidt, B. F., Berkhout, B., Overbeek, G. P., van Strien, A., and berg van Duin, J. (1987) J. Mol. Biol. 195, 505-516

Hall, M. N., Gabay, J., Debarbouille, M., and Schwartz, M. (1982) Schneider, T. D., Stormo, G. D., Gold, L., and Ehrenfeucht, A. (1986) Nature 295,616-618 J. Mol. Biol. 188, 415-431

Hartz, D., McPheeters, D. S., Traut, R., and Gold, L. (1988) Methods Seong, B. L., and RajBhandary, U. L. (1987) Proc. Natl. Acad. Sci. Enzymol. 164,419-425 U. S. A. 84,334-338

Hartz, D., McPheeters, D. S., and Gold, L. (1989) Genes Deu. 3, Sorensen, M. A., Kurland, C. G., and Pedersen, S. (1989) J. Mol. Biol. 1899-1912 207,365-377

Hui, A., Hayflick, J., Dinkelspiel, K., and de Boer, H. A. (1984) Spanjaard, R. A., van Dijk, M. C. M., Turion, A. J., and van Duin, J.

EMBO J. 3,623-629 (1989) Gene (Amst.) 80, 345-351

Kramer, W., Drutsa, V., Jansen, H-W., Kramer, B., Pflugfelder, M., Stanssens, P., Remaut, E., and Fiers, W. (1986) Cell 44, 711-718

and Fritz, H-J. (1984) Nucleic Acids Res. 12, 9441-9456 Stormo, G. D. (1986) in Maximizing Gene Expression (Reznikoff, W.,

McCarthy, J. E. G., Schairer, H., and Sebald, W. (1985) EMBO J. 4, and Gold, L. M., eds), pp. 195-224, Butterworth, Stoneham, MA

519-526 Stormo, G. D., Schneider, T. D., and Gold, L. M. (1982) Nucleic Acids

McCarthy, J. E. G., Sebald, W., Gross, G., and Lammers, R. (1986) Res. 10.2971-2996 Gene(Amst.) 41,201-206 Stiiher, D., Ibrahim, I., Cutler, D., Dobberstein, B., and Bujard, H.

Mott, J., Galloway, J., and Platt, T. (1985) EMBO J. 4, 1887-1891 (1984) EMBO J. 3, 3143-3148

Newbury, S., Smith, N., Robinson, E., Hiles, I., and Higgins, C. (1987) T Taniguchi, T., and Weissmann, C. (1978) J. Mol. Biol. 118, 533-565

Cell 48,297-310 essier, L. H., Sondermeyer, P., Faure, T., Dreyer, D., Benavente,

Nilsson, G., Lundberg, U., and von Gabain, A. (1988) EMBO J. 7, A., Villeval, D., Courtney, M., and Lecocq, J-P. (1984) Nucleic AcidsRes. 12,7663-7675

2269-2275 Wakao, H., Romby, P., Westhof, E., Laalami, S., Grunberg-Manago, Portier, C., Dondon, L., Grunberg-Manago, M., and Regnier, P. (1987) M., Ebel, J.-P., Ehresmann, C., and Ehresmann, B. (1989) J. Biol.

EMBO J. 6, 2165-2170 Chem. 264,20363-20371 Robinson, M., Lilley, R., Little, S., Emtage, J. S., Yarronton, G., Zuker, M., and Stiegler, P. (1981) Nucleic Acids Res. 9, 133-148

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from

G Gross, C Mielke, I Hollatz, H Blöcker and R Frankregion controls expression of two variant interferon-beta genes in Escherichia coli.

RNA primary sequence or secondary structure in the translational initiation

1990, 265:17627-17636.J. Biol. Chem. 

  http://www.jbc.org/content/265/29/17627Access the most updated version of this article at

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/265/29/17627.full.html#ref-list-1

This article cites 0 references, 0 of which can be accessed free at

by guest on April 10, 2018

http://ww

w.jbc.org/

Dow

nloaded from