European Review for Medical and Pharmacological Sciences

950

Abstract. – OBJECTIVE: Traditional Mongo-lian Medicine (TMM) exhibits useful biologicalactivities including antifungal, antibacterial, andanti-inflammatory actions. The mechanisms ofTMM in anti-inflammation were still unclear. Theaim of this study was to investigate the effectsof the three main monomers (geniposide, gal-late, berberine hydrochloride and a mixture ofthem) of a traditional Mongolian medicine oncell survival and the proinflammatory cytokinessignaling pathways which are activated by bac-terial lipopolysaccharides (LPS).

MATERIALS AND METHODS: Mousemacrophage-like cell line RAW264.7 was usedas a model of inflammation to investigate the an-ti-inflammatory effects of three TMM momomersand their combination. RT-PCR and Western blotwas used to quantify the change of mRNA andprotein levels of cytokines, Toll-like receptor-4(TLR4) and Nuclear Factor-κκB (NF-κκB) and its in-hibitor IκκB. The non-radioactive electrophoresismobility shift assay (EMSA) was used to evalu-ate the binding activity of NF-κκB.

RESULTS: The monomers and their combina-tion exhibited a potent anti-inflammatory effectfor suppressing the LPS-evoked secretion ofproinflammatory cytokines IL-1ββ, IL-6 and TNFαα.Furthermore, the monomers and their combina-tion attenuated activation of NF-κκB and expres-sion of TLR4 at both mRNA and protein levels,the upstream player of the LPS-TLR4-cytokines/NF-κκB signaling pathway.

CONCLUSIONS: The Mongolia herbal com-pound exerts a potent anti-inflammatory effectand could potentially be developed as a usefulagent for the chemo-prevention of inflammatorydiseases.

Key Words:Anti-inflammation, Traditional Mongolian medicine,

Cytokines, NF-κB, TLR 4, LPS.

Anti-inflammatory effects of three kinds oftraditional Mongolian medicine monomer andits combination on LPS-stimulated RAW264.7macrophages

L.-H. HUANG1, X.-P. PAN1,2, K.-R. GONG1,3, G. SHAO1

1BaoTou Medical College, Inner Mongolia, P.R. China2The People’s Hospital of WuHai, Inner Mongolia, P.R. China3Department of Anatomy, University of California, San Francisco, CA, USA

Corresponding Author: Xiao-Ping Pan, MD; and Guo Shao, MD; e-mail: huanglihua858@163.com

Introduction

Inflammation is a protective physiological re-sponse of the body to activate the immune sys-tem in response to a variety of stimuli, includinginfections and tissue injury1,2. Inflammatory dis-eases are related to the over-production of pro-inflammatory cytokines such as interleukin (IL)-6 and IL-1β. Nitric oxide (NO) is also generatedby inducible nitric oxide synthase (iNOS)3-5.Therefore, it is believed that the suppression ofthese inflammatory mediators is an important tar-get for treating chronic inflammatory diseases.Inflammation is also a complex process mediatedby the action of various immune cells, includingnatural-killer cells, neutrophiles andmacrophages. Macrophages play a central role inthe inflammation process by mediating many dif-ferent immunopathological phenomena, such asthe over-expression of pro-inflammatory cy-tokines and inflammatory mediators. Hence, themacrophage cell line provides an excellent modelfor drug screening and evaluation of potential in-hibitors of the inflammatory response. Nonsteroidal anti-inflammatory monomers

(NSAIDs) are the most broadly used medicinesfor treating inflammation-related diseases.However, the long-term administration of po-tent NSAIDs can result in various and severeadverse effects. During the past few years, therehas been a resurgence of interest in isolatingand developing naturally occurring monomersfrom medicinal plants6. Although traditionalChinese herbs have been used for centuries asremedies in China, their clinical uses are limitedbecause we have not isolated and clinically test-ed all of the complex substances that make-up

2016; 20: 950-958

these medicines. It is well known that many tra-ditional Chinese herbs possess anti-sepsis func-tion7,8 and traditional Chinese herbs have beenoften used for the treatment of various inflam-matory diseases due to high effectiveness andminimal side effects. There is a Mongolia herbmedicinal formula (MHMF) named “Te-Run-Su-Du-Le” which is used as an anti-inflamma-tory in Inner Mongolia. This Mongolian herbformula, with a history of over 2000 years, issimilar to traditional Chinese herbs and can beused as a natural anti-inflammatory. There are 7kinds of Mongolia herbs, including Gardeniajasminoides, Rheum officinale and Coptis chi-nensis, in this formula. It has been reported thatGeniposide (isolated from Gardenia jasmi-noides), Epigallocatechin gallate (isolated fromRheum officinale) and Berberine (isolated fromCoptis chinensis) play roles in inflammatory re-actions9-11. We propose that these three Mongo-lia medicine monomers or their combinationmay play major roles in anti-inflammatory ef-fects in this MHMF. In this study, we investigated the anti-inflam-

matory effects of these monomers (geniposide,gallate, berberine hydrochloride and their combi-nation) on pro-inflammatory responses and thecytokine signaling pathways which are activatedby bacterial lipopolysaccharide (LPS) challengein the mouse macrophage-like cell lineRAW264.7. It is well studied cell line for investi-gation of the inflammatory model. The levels ofTNFα, IL-6, 1L-β and TLR4, and the NF-κB de-pendent transcriptional activation induced byLPS were determined. TMM monomers and theircombination repressed LPS-induced expressionof these genes compared with pyrrolidine dithio-carbamate (PDTC) and dexamethasone (DEX),which are well-known as a NF-κB p65 inhibitorand an anti-inflammatory reagent, respectively.These monomers and their combination showedpotent inhibitory activities on the production ofthese inflammatory factors.

Materials and Methods

Cell Culture and ReagentsRAW 264.7 cell line was obtained from China

Center for Type Culture Collection. The cellswere cultured in Dulbecco Modified Eagle’sMedium (DMEM) (Gibco BRL Life Technolo-gies, Grand Island, NY, USA) supplementedwith 10% heat-inactivated fetal bovine serum

(Gibco BRL Life Technologies Inc.) and main-tained at 37°C in a humidified incubator contain-ing 5% CO2. The effects of the principal monomers on the

viability of RAW264.7 cells were examined.Cells were incubated in the compound Mongo-lian medicine and in each of these monomersseparately, or in combination, at different con-centrations for varying periods of time. Threedifferent concentrations (designated low, medi-um, and high) of these monomers were deter-mined. The concentrations of geniposide were 5,10 and 15 mM, gallate 8, 16, and 32 µg/L andberberine hydrochloride 10, 20, and 40 µM.Drug incubation time ranged from 0-48 h.

Cell Viability AssayCell Counting Kit-8 (CCK-8; Shanghai Bey-

otime Inc, Shanghai, China) was used to quantifyviable cells. RAW264.7 cells (5×103 cells/well)were seeded in 96-well plates and were incubat-ed in a humidified incubator at 37°C with 5%CO2 for 24 hours before experimental interven-tions. Upon completion of the 24-hour incuba-tion the CCK-8 assay was performed accordingto the manufacturer’s instructions. 10 µl of CCK-8 solution was added to each well and plate wasincubated at 37°C for 1 h. After shaking for 1min, the absorbance was measured at 450 nm us-ing a microplate reader. Each test condition wasperformed and measured in triplicate includingcontrol wells which contained cells in the ab-sence of monomers. Additionally, a cell-free,drug-free well was measured for adjusting back-ground noise.

Real Time PCRTotal cellular RNA was prepared from 106

cells using the RNeasy mini kit (Qiagen Valen-cia, CA, USA). The cDNA was synthesized us-ing Invitrogen Superscript III (Invitrogen, Carls-bad, CA, USA). PCR reactions were carried outon the ABI-7900 RT-PCR with initial denatura-tion at 950C for 10 min, 40 cycles of 950C for 30s, 600C for 60 s and a final extension for 2 min at600C in a 50 µl reaction mixture containing 2 µleach cDNA, 0.2 µM each primer, and 25 µl 2Xreal-time master mix.The threshold cycle number (CT) value for

target genes were normalized against β-actinreference genes and calculated as ∆CT =CTtarget-CTβ-actin. Relative target gene mRNA con-centrations were expressed as multiples of it ver-sus reference: F = 2∆CT.

951

TMM and LPS-stimulated RAW264.7 macrophages

Western Blot AnalysisTotal protein samples from cultured

RAW264.7 cells were extracted using the TotalProtein Extraction Kit (ProMab, Richmond, CA,USA). Protein extracts were prepared in lysisbuffer (50 mM Tris, pH 7.4, 1% NP-40, 150 mMNaCl, 1mM EDTA, 1 mM PMSF, 1 µg/mL eachof aprotinin, leupeptin, and pepstatin). Mem-brane protein samples from cell preparationswere isolated using the ProteoExtract® NativeMembrane Protein Extraction Kit (M-PEK;MERCK KGaA, Darmstadt, Germany). Nuclearand cytosolic protein samples were extractedfrom RAW264.7 cells using NucBuster TM Pro-tein Exaction Kit (MERCK KGaA).The intensity of bands in the Western blot and

EMSA were obtained by the Gel-Doc system andanalyzed with SigmaGel software (Jandel Scien-tific, San Rafael, CA, USA). The data of theWestern blot were normalized to β-actin and pre-sented as relative abundance.

Non-Radioactive Electrophoresis MobilityShift Assay (Non-Rad EMSA)Nuclear protein was extracted from the cell

and analyzed for the presence of NF-κB using anon-radioactive NF-κB electrophoresis mobilityshift assay (EMSA) kit (Viagene Biotech Inc,Tampa, FL, USA). Equal amounts of nuclearprotein (5 µg) from each sample were analyzedby EMSA following the manufacturer’s instruc-tions, as previously described12.The intensity of bands in EMSA was obtained

by the Gel-Doc system and analyzed with Sig-maGel software (Jandel Scientific, San Rafael,CA, USA).

Enzyme-Linked ImmunosorbentAssay (ELISA)Levels of IL-1β, IL-6, and TNF-α in cell

lysates were measured according to the manufac-turer’s instructions using the Mouse IL-1βELISA Kit, Mouse IL-6 ELISA Kit, and MouseTNF-α ELISA Kit (Beyotime Inc, Shanghai,China), respectively.

Statistical AnalysisAll of the data was expressed as mean ±SD

(standard deviation). Statistical analysis was per-formed with an analysis of variance (ANOVA)model for among group factor comparisons, andthe Tukey HSD test was used for comparisonsbetween the groups. All analysis was undertaken

952

L.-H. Huang, X.-P. Pan, K.-R. Gong, G. Shao

Figure 1. Effects of monomers and their combination onthe cell viability in a cellular inflammation model inducedby lipopolysaccharide (LPS) of the RAW264.7 cells. *p <0.05 compared to CTL group, **p < 0.05 compared to LPSgroup.

using SPSS Version 10.0® software (SPSS Inc.,Chicago, IL, USA) and p < 0.05 was consideredto be statistically significant.

Results

Effects of the Monomers and theMonomers Combination on Viability ofRAW264.7 CellsWe performed preliminary experiments to de-

termine the optimal concentrations and length oftime for each treatment. The concentrations ofthe monomers chosen were geniposide 15mmol/L, gallate 32 µg/L, berberine hydrochlo-ride 40 µmol/L and the monomer combinationconcentration grade consisted of a mixture of 1/3of each monomer. The cells were incubated for24 hours in our experiments. After the cells hadbeen treated with monomers and their combina-tion for 24 hours, they were then incubated withLPS (100 ng /ml)9 for 4 hours to induce pro-in-flammatory responses.The effects of the monomers and their combi-

nation on the cell viability are shown in Figure 1.Exposure of RAW264.7 cells to LPS leads toenormous cell death with the resulting cell via-bility of 63.6% ± 1.67% The three kinds ofmonomers and their complex were all able tomitigate the decreases of cell survival induced byLPS challenge. The cell viability of the genipo-side (GEN), gallate (GAL), berberine hydrochlo-ride (BER), the complex of the monomers

953

TMM and LPS-stimulated RAW264.7 macrophages

(COMP), pyrrolidine dithiocarbamate (PDTC)and dexamethasone (DEX) increased to 68.2% ±2.33%, 70.00% ± 3.03%, 66.90% ± 2.32%,74.10% ± 0.90%, 77.70% ± 2.81%, 82.60% ±2.31%, 85.7% ± 0.57% respectively. Comparedto the three individual monomers the monomercomplex has higher a cell survival rate. As ex-pected, both the potent NF-κB inhibitor PDTC(20 µmol/L) and the anti-inflammatory and im-munosuppressant dexamethasone (Dex, 10µg/ml) exhibited cytoprotection against LPS in-duced cell death similar to the test monomers andthe strength of their action was in the same rangeas that of the monomers. Moreover, the cell via-bility of the co-application of PDTC and themonomer complex group is higher than that ofthe single PDTC group or the monomer complexgroup.

Effects of Mongolian MedicineMonomers on TLR4-NF-κκB InflammatoryResponses Signaling Pathway The mRNA expressions of TLR4 and NF-κB

p65 were monitored to detect the involvement oftranscriptional events during their biosynthesis.Changes in mRNA levels for TLR4 and NF-κB

p65 were assessed by RT-PCR using β-actin asthe control gene. As show in Figure 2, LPS pro-moted the transcription of both TLR4 and NF-κBp65 sub-unit, as indicated by the elevation of themRNA levels of TLR4 and NF-κB p65. Theseup-regulations were moved towards the normalvalue under control conditions by all testmonomers and positive control agents. Thegreatest magnitude of action was found to beelicited by the monomer complex, relative to themonomers. Again the complex and PDTC incombination demonstrated synergistic effects,particularly in the case of TLR4. Transcript lev-els of NF-κB p65 and TLR4 were determined byreal-time RT-PCR. Note that LPS induced sub-stantial up-regulation of NF-κB p65 and TLR4,and test monomers and positive control agentsalleviated the up-regulation.We performed Western blot analysis utilizing

specific primary antibodies to detect the effectsof the individual three monomers on protein lev-els of phosphorylated nuclear factor of lightpolypeptide gene enhancer in B-cells inhibitor(p-IκB), NF-κB p65, phospho-p65 (p-p65) andTLR4 in LPS-stimulated RAW 264.7. β-actinwas used as loading control (Figure 3). p-IκB-p-

Figure 2. Repressive effects of Mongolian Medicine monomers on expression of NF-κB p65 subunit (p65) and Toll-like re-ceptor 4 (TLR4) in LPS-stimulated RAW 264.7. P65 (A), TLR4 (B). *p < 0.05 compared to CTL group, **p < 0.05 comparedto LPS group (n=3.)

Gene Forward primer Reverse primer

P65 GCAGAAAGAAGACATTGAGG TCATCTGTGTCTGGCAAGTATLR4 ACCTCTGCCTTCACTACAGA AGGGACTTCTCAACCTTCTCβ-actin GGACCTGACAGACTACCTCA GTTGCCAATAGTGATGACCT

Table I. The following primer pairs use for real time PCR.

954

L.-H. Huang, X.-P. Pan, K.-R. Gong, G. Shao

Figure 3. A, Effect of three kinds of Mongolian Medicine monomers on expression of p-IκB, p65, p-p65 and TLR4 proteinsin LPS-stimulated RAW 264.7. Typical result of Western blot showed p-IκB, p65, p-p65 and TLR4 in LPS-stimulated RAW264.7 (A), semi-quantitative analysis indicated the changes in levels of p-IκB� (B), p65 (C), p-p65 (D) and TLR4 (E) (β-actin was used as control) respectively (p < 0.05, compared to CTL group, **p < 0.05, compared to LPS group).

955

TMM and LPS-stimulated RAW264.7 macrophages

p65 and TLR4 were increased by LPS and wereslightly attenuated by the individual threemonomers and were significantly attenuated bythe MMM mixture and positive control agents.Interesting, the p65 protein level was not affectedby LPS or the other treatments. Non-radioactive electrophoresis mobility shift

assay (EMSA) was conducted using the fragmentencompassing the putative p65 cis-acting ele-ment to bind NF-κB p65 protein in the nuclearextract from RAW264.7 cells (Figure 4). EMSAanalysis demonstrated that three kinds of MMMslightly diminished and their mixture markedlydiminished the enhancement of the binding be-tween NF-κB p65 and the putative p65 cis-actingelement which was induced by LPS. The NF-κBp65 DNA binding activity was parallel to NF-κBp65 protein level.

Inhibitory Effects of Monomers and theMonomers Complex on LPS-Induced Secretion of Proinflammatory CytokinesLPS significantly (p < 0.001) increase the

amounts of IL-1β, IL-6 and TNF-α inRAW264.7 cells (Figure 5). The monomers aswell as the positive control agents (PDTC andDex) all significantly mitigated the LPS-inducedsecretion of the pro-inflammatory cytokines. No-tably, the monomer complex elicited the greatesteffect among the test monomers and co-applica-tion of the monomer complex and PDTC elicitedsynergistic effects: the magnitude of reductionwith the combination of 3 monomers was greaterthan that with each of them alone. For example,

the TNF-α content of the single monomer com-plex and PDTC was 405.33 and 390.12 pg/mLrespectively. While the TNF-α content of com-bined application of monomer complex andPDTC decreased to 253.68 pg/mL. The observedanti-inflammatory efficacy was in good agree-ment with the cytoprotective actions of the testmonomers.

Discussion

Inflammation is a complex process regulatedby a variety of immune cells and effector mole-cules. IL-6, IL-1β and other proinflammatory cy-tokines are important mediators of macrophage-mediated inflammation. The expressions of IL-6,IL-1β and other proinflammatory cytokines areregulated by NF-κB. It has been reported thatTLR4 and mitogen-activated protein kinases(MAPKs) can affect the activity of NF-κB13.Therefore, the inhibition of these mediators withpharmacological modulators may be an effectivetherapeutic strategy for preventing inflammatoryreactions and diseases. Macrophage activation is important in the pro-

gression of multiple diseases through the releaseof inflammatory mediators. LPS is known to actas the prototypical endotoxin because it binds theCD14/TLR4/MD2 receptor complex, which pro-motes the secretion of proinflammatory cytokinesin macrophages and B cells through transcriptionfactor NF-κB. NF-κB is located in the cytoplasmand binds with its inhibitory protein IκB in un-

Figure 4. Suppressive effects of Mongolian Medicine monomers on the transcriptional activities of NF-κB p65 subunit in the nu-clei of RAW264.7 cells. (A) A typical example of image showing the shifted band representing the DNA-p65 complex using non-radioactive electrophoresis mobility shift assay (EMSA). (B) Digital data of the bands shown in the (A) panel. (Lane 1: positivecontrol; Lane 2, 3:100-folds unlabed probe; Lane 5: LPS; Lane 6: Gen; Lane 7: Gal; Lane 8: Ber; Lane 9: Com; Lane 10: PDTC;Lane 11: PDTC+Comp; Lane 12: Dex.). *p < 0.05, compared to CTL group, **p < 0.05, compared to LPS group.

956

anti-inflammatory effects of some compounds inRAW264.7 macrophages12,18-28. In order to understand the anti-inflammatory

compounds from plants in Mongolia herb medici-nal formula “Te-Run-Su-Du-Le”, the effects ofthree kinds of MMM on TLR4/NF-κB inflamma-tory responses signaling pathway were exploredusing RAW264.7 macrophages treated with LPS.Zheng et al9 showed that geniposide can directlybind LPS and neutralize it in vitro. Geniposide ex-erted an anti-inflammatory effect by regulatingTLR4 expression, which affected the downstreamNF-κB and mitogen-activated protein kinase(MAPK) signaling pathways. The inhibitory effectof epigallocatechin-3-gallate is largely related tothe ability of the molecule to down-regulate theinflammatory mediators (iNOS and COX-2)biosynthesis at a transcriptional level29. Jeong etal30 showed that BER would down-regulate pro-inflammatory responses in macrophages viaAMPK stimulation. The inhibitory effects of BERon proinflammatory gene expression and signalingcascades were abrogated by inhibition of MAPKactivity. Berberine can act as a LPS antagonist andblock the LPS/TLR4 signaling from the source,resulting in the anti-bacterial action11. In thisstudy, the mixtures of three kinds of MMM down-regulated the expression of TLR4 at both tran-scriptional and post-transcriptional levels and re-duced the NF-κB binding activity that was in-duced by LPS. At the same time, the combinationof 3 monomers may be a more efficient anti-in-flammatory due to their different inhibition site inthe TLR4/NF-κB signaling pathway.It is clear that both TLR4 and MAPK are in-

volved in the expression of IL-1β, IL-6 andTNF-α which are regulated by NF-κB13. TLR4 isone of the well-characterized pathogen recogni-tion receptors (PRRs) that recognize LPS ofGram-negative bacteria31-33. TLR4 which plays acentral role in the regulation of the host immunesystem, was found to be down-regulated by thethree monomers and their combination in thisstudy. We did not detect any change in MAPKactivity. Our experiments provided several piecesof evidence in support of the notion that theMMM components are able to prevent activa-tion, but not expression, of NF-κB p65, as indi-cated by the reduced phosphorylated form of NF-κB-p65 and weakened NF-κB p65 DNA bindingcapacity. Due to the change of NF-κB p65 DNAbinding capacity, NF-κB target genes such as IL-1β, IL-6 and TNF-α, were reduced by MMMwhen induced by LPS.

L.-H. Huang, X.-P. Pan, K.-R. Gong, G. Shao

stimulated cells. When the cells are exposed to thestimulants such as LPS, IκB is phosphorylatedand liberates NF-κB, resulting in NF-κB translo-cation into the nucleus. Nuclear NF-κB, then,binds to the promoters of pro-inflammatory medi-ators, resulting in the induction of their gene ex-pression14-17. LPS is widely used to elucidate the

Figure 5 LPS-induced elevation of intracellular levels ofpotent proinflammatory cytokines interleukin IL-1β, iIL-6and TNF-α in RAW264.7 cells. (A) IL-1β (B) IL-6 (C)TNF-α. (*p < 0.05 compared to CTL group, **p < 0.05compared to LPS group).

Conclusions

The present study provides preliminary evi-dence that traditional Mongolian medicinemonomers and their compounds have anti-in-flammatory effects on LPS-stimulatedRAW264.7 macrophages. The Mongolia herbalcompound exerts a potent anti-inflammatory ef-fect and could potentially be developed as a use-ful agent for the chemoprevention of cancer orinflammatory diseases.

––––––––––––––––––––AcknowledgementsThis project was supported by the National Natural ScienceFoundation of China (Nos. 81060212, 81160244, 81360316,81460283), China Postdoctoral Science Foundation (No.20080430851), Scientific research foundation for returnedoverseas Chinese scholar (state education ministry), YoungTalents of Science and Technology in Universities of InnerMongolia Autonomous Region (NJYT-13-A10), Inner Mon-golia Science Foundation (Nos. 2010BS1104, 2010MS1127,2014MS0810), Inner Mongolia Health Foundation (No.201302101) and Inner Mongolia Educational Research Foun-dation (Nos. NJ06011, NJ10193, NJZY12221, NJZY12225,NJZY13243). The doctoral scientific research foundation ofBaotou medical college (BSJJ201621). We thank Mrs. JeanDanforth for her language-editing assistance.

–––––––––––––––––-––––Conflict of InterestThe Authors declare that there are no conflicts of interest.

References

1) ZHONG Y, CHIOU YS, PAN MH, SHAHIDI F. Anti-inflam-matory activity of lipophilic epigallocatechin gal-late (EGCG) derivatives in LPS-stimulated murinemacrophages. Food Chem 2012; 134: 742-748.

2) KWON OK, LEE MY, YUK JE, OH SR, CHIN YW, LEE HK,AHN KS. Anti-inflammatory effects of methanol ex-tracts of the root of Lilium lancifolium on LPS-stimulated Raw264.7 cells. J Ethnopharmacol2010; 130: 28-34.

3) LU J, WANG JS, KONG LY. Anti-inflammatory effectsof Huang-Lian-Jie-Du decoction, its two fractionsand four typical compounds. J Ethnopharmacol2011; 134: 911-918.

4) LIN QY, JIN LJ, CAO ZH, XU YP. Inhibition of in-ducible nitric oxide synthase by Acanthopanaxsenticosus extract in RAW264.7 macrophages. JEthnopharmacol 2008; 118: 231-236.

5) JEONG JB, SHIN YK, LEE SH. Anti-inflammatory activ-ity of patchouli alcohol in RAW264.7 and HT-29cells. Food Chem Toxicol 2013; 55: 229-233.

6) ZHENG X, YANG D, LIU X, WANG N, LI B, CAO H, LU Y,WEI G, ZHOU H, ZHENG H. Identification of a newanti-LPS agent, geniposide, from Gardenia jasmi-

957

TMM and LPS-stimulated RAW264.7 macrophages

noides Ellis, and its ability of direct binding andneutralization of lipopolysaccharide in vitro and invivo. Int Immunopharmacol 2010; 10: 1209-1219.

7) WANG Q, KUANG H, SU Y, SUN Y, FENG J, R GUO, KCHAN. Naturally derived anti-inflammatory com-pounds from Chinese medicinal plants. JEthnopharmacol 2012; 146: 9-39.

8) TEZUKA Y, IRIKAWA S, KANEKO T, BANSKOTA AH, NAGAO-KA T, XIONG Q, HASE K, KADOTA S. Screening of Chi-nese herbal drug extracts for inhibitory activity onnitric oxide production and identification of an ac-tive compound of Zanthoxylum bungeanum. JEthnopharmacol 2001; 77: 209-217.

9) ZHENG X, YANG D, LIU X, WANG N, LI B, CAO H, LU Y,WEI G, ZHOU H, ZHENG J. Identification of a newanti-LPS agent, geniposide, from Gardenia jasmi-noides Ellis, and its ability of direct binding andneutralization of lipopolysaccharide in vitro and invivo. Int Immunopharmacol 2010; 10: 1209-1219.

10) BAE HB, LI M, KIM JP, KIM SJ, JEONG CW, LEE HG, KIMWM, KIM HS, KWAK SH. The effect of epigallocate-chin gallate on lipopolysaccharide-induced acutelung injury in a murine model. Inflammation 2010;33: 82-91.

11) CHU M, DING R, CHU ZY, ZHANG MB, LIU XY, XIE SH,ZHAI YJ, WANG YD. Role of berberine in anti-bacte-rial as a high-affinity LPS antagonist binding toTLR4/MD-2 receptor. BMC Complement AlternMed 2014; 14: 14-89.

12) GAO Y, JIANG W, DONG C, LI C, FU X, MIN L, TIAN J,JIN H, SHEN J. Anti-inflammatory effects of sopho-carpine in LPS-induced RAW 264.7 cells via NF-κB and MAPKs signaling pathways. Toxicol InVitro 2012; 26: 1-6.

13) BOGNAR E, SARSZEGI Z, SZABO A, DEBRECENI B, KALMAN

N, TUCSEK Z, SUMEGI B, GALLYAS JR F. Antioxidantand anti-inflammatory effects in RAW264.7macrophages of malvidin, a major red winepolyphenol. PLoS One 2013; 8: e65355.

14) KANG SR, PARK KI, PARK HS, LEE DH, KIM JA, NAGAP-PAN A, KIM EH, LEE WS, SHIN SC, PARK MK, HAN DY,KIM GS. Anti-inflammatory effect of flavonoids iso-lated from Korea Citrus aurantium L. onlipopolysaccharide-induced mouse macrophageRAW264.7 cells by blocking of nuclear factor-kappa B (NF-κB) and mitogen-activated proteinkinase (MAPK) signalling pathways. Food Chem2011; 129: 1721-1728.

15) SCHWARTZ SA, HERNANDEZ A, MARK EVERS B. The roleof NF-kappaB/IkappaB proteins in cancer: impli-cations for novel treatment strategies. Surg Oncol1999; 8: 143-153.

16) GROSSMANN M, NAKAMURA Y, GRUMONT R, GERONDAKIS

S. New insights into the roles of ReL/NF-kappa Btranscription factors in immune function, hemo-poiesis and human disease. Int J Biochem CellBiol 1999; 31: 1209-1219.

17) OLIVERA A, MOORE TW, HU F, BROWN AP, SUN A, LIOT-TA DC, SNYDER JP, YOON Y, SHIM H, MARCUS AI, MILLER

AH, PACE TW. Inhibition of the NF-κB signalingpathway by the curcumin analog, 3,5-Bis(2-

958

L.-H. Huang, X.-P. Pan, K.-R. Gong, G. Shao

pyridinylmethylidene)-4-piperidone (EF31): anti-inflammatory and anti-cancer properties. Int Im-munopharmacol 2012; 12: 368-377.

18) ICHIYAMA H, ONODERA S, NISHIHIRA J, ISHIBASHI T,NAKAYAMA T, MINAMI A, YASUDA K, TOHYAMA H. Inhibi-tion of joint inflammation and destruction inducedby anti-type II collagen antibody/lipopolysaccha-ride (LPS)-induced arthritis in mice due to dele-tion of macrophage migration inhibitory factor(MIF). Cytokine 2004; 26: 187-194.

19) NIU X, XING W, LI W, FAN T, HU H, LI Y. Isofraxidin ex-hibited anti-inflammatory effects in vivo and inhibit-ed TNF-α production in LPS-induced mouse peri-toneal macrophages in vitro via the MAPK path-way. Int Immunopharmacol 2012; 14: 164-171.

20) PAN MH, YANG JR, TSAI ML, SANG S, HO CT. Anti-in-flammatory effect of momordica grosvenoriswingle extract through suppressed LPS-inducedupregulation of iNOS and COX-2 in murinemacrophages. J Funct Foods 2009; 1: 145-152.

21) SARKAR D, SAHA P, GAMRE S, BHATTACHARJEE S, HARIHA-RAN C, GANGULY S, SEN R, MANDAL G, CHATTOPADHYAYS, MAJUMDAR S, CHATTERJEE M. Anti-inflammatory ef-fect of al lylpyrocatechol in LPS-inducedmacrophages is mediated by suppression of iN-OS and COX-2 via the NF-kappaB pathway. IntImmunopharmacol 2008; 8: 1264-1271.

22) KUDO K, HAGIWARA S, HASEGAWA A, KUSAKA J, KOGAH, NOGUCHI T. Cepharanthine exerts anti-inflam-matory effects via NF-κB inhibition in a LPS-in-duced rat model of systemic inflammation. J SurgRes 2011; 171: 199-204.

23) CHOI RJ, SHIN EM, JUNG HA, CHOI JS, KIM YS. In-hibitory effects of kaurenoic acid from Aralia con-tinentalis on LPS-induced inflammatory responsein RAW264.7 macrophages. Phytomedicine2011; 18: 677-682.

24) HU XD, YANG Y, ZHONG XG, ZHANG XH, ZHANG YN,ZHENG ZP, ZHOU Y, TANG W, YANG YF, HU LH, ZUO JP.Anti-inflammatory effects of Z23 on LPS-inducedinflammatory responses in RAW264.7macrophages. J Ethnopharmacol 2008; 120: 447-451.

25) WANG Z, JIANG W, ZHANG Z, QIAN M, DU B. Nitidinechloride inhibits LPS-induced inflammatory cy-

tokines production via MAPK and NF-kappaBpathway in RAW 264.7 cells. J Ethnopharmacol2012; 144: 145-150.

26) CAO J, JIANG L, ZHANG X, YAO X, GENG C, XUE X,ZHONG L. Boric acid inhibits LPS-induced TNF-al-pha formation through a thiol-dependent mecha-nism in THP-1 cells. J Trace Elem Med Biol 2008;22: 189-195.

27) HEO SK, YUN HJ, NOH EJ, PARK WH, PARK SD. LPSinduces inflammatory responses in human aorticvascular smooth muscle cells via toll-like receptor4 expression and nitric oxide production. ImmunolLett 2008;120:57-64.

28) RHULE A, NAVARRO S, SMITH JR, SHEPHERD DM. Panaxnotoginseng attenuates LPS-induced pro-inflam-matory mediators in RAW264.7 cells. JEthnopharmacol 2006; 106: 121-128.

29) ZHONG Y, CHIOU YS, PAN MH, SHAHIDI F. Anti-inflam-matory activity of lipophilic epigallocatechin gal-late (EGCG) derivatives in LPS-stimulated murinemacrophages. Food Chem 2012; 134:742-748.

30) JEONG HW, HSU KC, LEE JW, HAM M, HUH JY, SHINHJ, KIM WS, KIM JB. Berberine suppresses proin-flammatory responses through AMPK activationin macrophages. Am J Physiol Endocrinol Metab2009; 296: E955-964.

31) BALISTRERI CR, CARUSO C, LISTI F, COLONNA-ROMANO G,LIO D, CANDORE G. LPS-mediated production ofpro/anti-inflammatory cytokines and eicosanoidsin whole blood samples: biological effects of+896A/G TLR4 polymorphism in a Sicilian popu-lation of healthy subjects. Mech Ageing Dev2011; 132: 86-92.

32) PARK SH, KYEONG MS, HWANG Y, RYU SY, HAN SB, KIMY. Inhibition of LPS binding to MD-2 co-receptorfor suppressing TLR4-mediated expression of in-flammatory cytokine by 1-dehydro-10-gingerdionefrom dietary ginger. Biochem Biophys Res Comm2012; 419:735-740.

33) FU Y, LIU B, ZHANG N, LIU Z, LIANG D, LI F, CAO Y,FENG X, ZHANG X, YANG Z. Magnolol inhibitslipopolysaccharide-induced inflammatory re-sponse by interfering with TLR4 mediated NF-κBand MAPKs signaling pathways. J Ethnopharma-col 2013; 145: 193-199.