TABLE OF CONTENTTABLE OF CONTENT........................................................................................................1

SUMMARY............................................................................................................................2

1.0 INTRODUCTION AND LITERATURE REVIEW....................................................3

1.1 Recommendations for malaria control in pregnancy.......................................4

1.2 Integrated Approaches........................................................................................4

1.3 Alternative Anti-malarias for IPTp...................................................................5

1.4 Drug resistance.....................................................................................................6

2.0 RESEARCH PROBLEM................................................................................................8

3.0 OBJECTIVES..................................................................................................................8

4.0 HYPOTHESIS..................................................................................................................9

5.0 JUSTIFICATION............................................................................................................9

6.0 MATERIALS AND METHODS....................................................................................9

6.1 Study Area............................................................................................................9

6.2 Study Design.......................................................................................................10

6.3 Ethical Consideration.........................................................................................11

6.4 Sample collection and screening........................................................................11

6.5 Molecular Analysis..............................................................................................12

6.6 Analysis of results................................................................................................12

6.7 Work plan.............................................................................................................13

7.0 BUDJECT.........................................................................................................................14

REFERENCES.......................................................................................................................15

CONSENT FORM I...............................................................................................................18

CONSENT FORM II.............................................................................................................20

CONSENT FORM III............................................................................................................21

QUESTIONNAIRE................................................................................................................22

Page | 1

SUMMARY

The burden of malaria in pregnancy cannot be over emphasised as has been established by

authors all over the world. The bulk of the damage has been recorded here in Africa. To this

effect, the WHO recommends a three pronged approach to curb this menace; effective case

management, intermittent preventive treatment and insecticide treated bed nets. Sulphadoxine

– pyrimethamine was recommended as the drug of choice for IPT, however resistant parasites

have been isolated in some countries. This research seeks to determine the prevalence of the

molecular markers of parasite resistances to sulphadoxine – pyrimethamine in the Central

Region, Ghana. After informed consent has been sought, venous blood samples would be

collected from pregnant women that attend selected antenatal clinics in the region. Thin and

thick blood films would be prepared to estimate the parasite density, DNA would be

extracted from dried spots using the Tris – EDTA method of extraction and amplified by

Polymerase Chain Reaction (PCR) using appropriate primers. The product would also be

subjected to enzyme digestion and gel electrophoresis to determine the point mutations on the

pfdhfr and pfdhps genes which have been stated as the molecular markers of SP resistance.

Associations between the different mutations would be tested using Fisher’s Exact Test.

Guided questionnaires would be administered to determine how socio-demographic factors

relates to malaria in pregnancy and also rule out confounders. The results of this research

would go a long way to inform policy makers on the progress of SP as IPT and also its

effectiveness in clearing parasites from the bodies of pregnant women.

Page | 2

1.0 INTRODUCTION AND LITERATURE REVIEW

Malaria is a parasitic disease transmitted by female mosquitoes of the genus Anopheles.

Anopheles gambiae and A. funestus are the main vectors of the disease in Africa (Steketee,

2001). It is widespread in tropical and sub-tropical regions, including parts of the Americas,

Asia and Africa (Snow et al., 2005). Malaria epidemics kill more than 2,000,000 people of all

ages every year (TASRBM, 2000). People at greatest risk are those who have been exposed

to malaria only infrequently and have developed little or no protective immunity, pregnant

women and children (Brabin, 1991). It is estimated that up to 124 million people in Africa

live in areas at risk of seasonal epidemic malaria, and many more in areas outside Africa

where transmission is less intense (Brabin, 1985). Of the four parasitic protozoa causing

malaria, Plasmodium falciparum is the most common and the most dangerous, causing

between 700,000 and 2.7 million deaths annually, most of which are in children and pregnant

women (Steketee, 2001).

Every year, approximately 50 million women living in malaria endemic areas become

pregnant; half of them in sub-Saharan Africa, many in areas of intense Plasmodium

falciparum transmission (WHO. AFR/MAL: 2004). In these regions, malaria in pregnancy is

predominantly asymptomatic and yet is a major cause of severe maternal anaemia and low

birth weight babies. There is a strong association between low birth weight and child

survival, successful control of malaria in pregnancy might prevent 75 000–200 000 infant

deaths every year (Steketee et al., 2001).

Successful control of malaria in pregnancy thus might save lives of mothers and babies, and

is a high public health priority in all endemic countries, although the optimum methods for

achieving this may vary according to local conditions. Malaria endemicity, its effect on the

Page | 3

pregnant women and the unborn baby as well as the high mortality among children under the

age of five, necessitated the WHO to come out with guidelines and recommendations for

malaria control in pregnancy.

1.1 Recommendations for malaria control in Pregnancy

For sub-Saharan Africa, the WHO has developed guidelines for the control of malaria during

pregnancy. These consist of prompt and effective case management of malaria illness

combined with prevention of infection and/or disease by insecticide-treated nets and

intermittent preventive treatment in pregnancy (IPTp) (WHO. AFR/MAL: 2004).

Intermittent Preventive Treatment in Pregnancy (IPTp) was explored and developed to avoid

the limitations of daily or weekly chemoprophylaxis (Schultz et al., 1994, Praise et al., 1998)

, Ver Hoeff et al., 1998, Shulman et al., 1999). It consists of an anti-malarial treatment given

at regular intervals during pregnancy, regardless of malaria infection or disease.

Sulphadoxine-Pyrimethamine is cheap, safe in the second and third trimester, and can be

given as a single dose. In areas with stable P falciparum malaria transmission, WHO

recommends that at least two doses are given from the second trimester onwards at least 1

month apart (WHO. AFR/MAL: 2004).

1.2 Integrated Approaches

Most studies of IPTp were done before the introduction of insecticide-treated nets to

prevention policy in pregnancy. The absence of apparent risks associated with insecticide-

treated net use and the additional benefits provided to the mothers and their infants dictate

that future IPTp trials should be conducted in the context of insecticide-treated nets in Africa.

However, the limited information does not suggest a synergistic or even additive effect

between the combined effects of IPTp and insecticide-treated nets. One randomised

Page | 4

controlled trial in Kenyan primigravidae and secundigravidae showed that the combination of

insecticide-treated nets and (two dose) IPTp with Sulphadoxine-Pyrimethamine was

associated with only a slightly greater reduction of anaemia than either intervention alone,

and only in primigravidae (Njagi et al., 2003). Concomitant insecticide-treated net use might

reduce the need or frequency of IPTp dosing, which may be an important advantage with new

anti-malarial combinations that are less well tolerated, involve more complex dosing

regimens, and are more expensive than Sulphadoxine-Pyrimethamine. Although this may be

attractive, insecticide-treated nets provide only partial protection against malaria, and the

operational effectiveness might be compromised by incorrect or irregular use of nets and

failure to re-impregnate the net. It was initially thought that a drug regimen based on a few

supervised doses would overcome the compliance limitations of chemoprophylaxis.

However, studies in countries where IPTp has been implemented for several years show that

the uptake of a second dose is surprisingly poor (Rogerson et al., 2000). More operational

research is needed to develop strategies to improve the uptake and effectiveness of this

promising strategy (Crawley et al., 2007).

1.3 Alternative Anti-malarials for IPTp

Defining the ideal properties for a drug to be used for IPTp will help the choice of

alternatives to Sulphadoxine-Pyrimethamine. Understanding the mechanism of action of IPTp

is a crucial first step that establishes what pharmacokinetic or Pharmacodynamic properties

are required of alternatives to Sulphadoxine-Pyrimethamine (White et al., 2005). IPTp might

provide intermittent clearance of existing asymptomatic placental infections (treatment

effect) and, with a slowly eliminated drug, might also prevent new infections by maintaining

suppressive drug levels for several weeks after each treatment (post-treatment prophylactic

effect). Although the precise mechanism of how falciparum malaria produces intrauterine

Page | 5

growth retardation (IUGR) is not yet defined, IUGR tends to be greater with high placental

parasite burden and high accumulation of Monocytes and Macrophages (Menendez et al.,

2000). Thus, IPTp might also act by the suppression of parasitaemia to levels too low to

cause clinical malaria. If the duration of post-treatment prophylaxis is an important

determinant of IPTp efficacy, drugs with long-half lives are likely to be more effective

(White et al., 2005). This should be verified by comparing drugs with different

pharmacokinetic profiles. An important epidemiological feature of malaria in pregnancy is

that the adverse effects tend to decrease with increasing parity, particularly where malaria

transmission is high. In the early trials among semi-immune women, the substantial impact of

malaria chemoprophylaxis was limited to primigravidae. It was then suggested that malaria

control should target primigravidae and multigravidae (Garner et al., 2000).

1.4 Drug Resistance

The alarming increase of Sulphadoxine-Pyrimethamine resistance in Africa has raised

concerns about its use as IPTp. Pharmacokinetic modelling suggests that the suppressive

prophylactic effect of Sulphadoxine-Pyrimethamine, assuming similar pharmacokinetic

profiles as in non-pregnant adults, may last approximately 2–3 months in areas with sensitive

parasites (White et al., 2005). The period of effective post-treatment prophylaxis then

progressively shortens with increasing drug resistance, compromising the efficacy of the two-

dose regimen given at 3-month intervals (White et al., 2005). Sulphadoxine-Pyrimethamine

resistance is linked to mutations in the dihydrofolate reductase (dhfr) and dihydropteroate

synthetase (dhps) genes. Parasites with quadruple mutations in the dhfr gene, including the

164L mutation (highly prevalent in Thailand), 51I, 59R, 108N and double mutations in the

(dhps) genes at 540E and 437G are fully resistant. These point mutations have been identified

to be the molecular markers of (SP) resistance. Such parasites have already been observed in

Page | 6

Malawi, Uganda, and western Kenya (McCollum et al., 2006, Hastings et al., 2002, Alker et

al., 2005, Farnet et al., 2002, Staedke et al., 2004) though their rate of spread cannot be

predicted. It might be slowed if Sulphadoxine-Pyrimethamine use in the general population is

not widespread and is limited to intermittent preventive treatment regimen (kalanda et al.,

2006, Tagbor et al., 2006).

Sulphadoxine-Pyrimethamine (S/P) act as a synergistic inhibitor of folate biosynthesis which,

in malaria parasites, is an obligatory requirement for the production of nucleotides and hence

DNA synthesis. Both compounds act synergistically, hence any loss of efficiency in either

component results in the reduction of the effectiveness of the combination as whole. The

occurrence of certain molecular polymorphisms in the dihydrofolate reductase (pfdhfr) and

dihydropteroate synthase (pfdhps) genes has been associated to in vivo S/P treatment outcome

[Wongsrichanalai et al., 2002]. Particularly in East Africa, the occurrence of pfdhfr quadruple

mutations (dhfr 51I/59R/108N/164L) have been associated with pyrimethamine resistance

and pfdhps double mutations (dhps 437G/540E) have been associated with sulphadoxine

resistance[Le Bras et al., 2003].

This research would investigate the prevalence of mutations in the pfdhfr and pfdhps gene

from samples collected from pregnant women at selected antenatal clinics in central region,

Ghana.

Page | 7

2.0 RESEARCH PROBLEM

For over 5 years, Sulphadoxine-Pyrimethamine (SP) has been prescribed for pregnant women

at antenatal clinics in Ghana. This is to fulfil the requirements of the WHO for Intermittent

Preventive Treatment (IPT) of malaria in endemic areas. However, there is knowledge of

parasite mutations conferring resistances to the parasites. These mutations have been

identified on the dihydrofolate reductase (dhfr) and the dihydropteroate synthase (dhps) genes

and associated to SP resistance. These mutations have been recorded in parasite isolates from

Eastern and Southern Africa, Asia and some Western Africa countries especially Ghana,

before the introduction of IPT. If these mutant species have become prevalent among

pregnant women in Ghana, the efficacy of (SP) as prophylaxis for pregnant women will be

highly questionable.

3.0 OBJECTIVES

The main objective of this study is to determine the point mutations on pfdhfr and pfdhps

genes associated with (SP) resistance in Ghana.

Specific Objectives

To determine the predominant pfdhfr and pfdhps mutants present in pregnant women

in Central Region, Ghana.

To determine the seasonality of the prevalence of the mutants.

To identify the various mutations associated with dihydrofolate reductase gene of P.

falciparum pyrimethamine resistance.

To identify the various mutations associated with dihydropteroate synthase gene of P.

falciparum sulphadoxine resistance.

To determine the relationship between socio-demographic factors and the prevalence

of the mutants.

Page | 8

4.0 HYPOTHESIS

Mutations in the dhfr and dhps genes associated with Plasmodium falciparum resistance to

(SP) are increasing in Ghana.

5.0 JUSTIFICATION

Malaria infection during pregnancy has a very important adverse effect on both the mother

and the foetus and accounts for a large number of deaths and labour complications around the

world, most especially in malaria endemic areas. To this end, integrated approach with

insecticide treated nets and intermittent preventive treatment with Sulphadoxine-

Pyrimethamine is practised in most West African countries including Ghana. However there

is knowledge of Plasmodium falciparum dihydrofolate reductase and Plasmodium falciparum

dihydropteroate synthase mutations in East and Central Africa conferring resistance to the

parasite. If these mutants become more prevalent in Ghana, especially among pregnant

women, the efficacy of (SP) as (IPT) would be jeopardised, requiring a new drug policy.

Therefore monitoring the prevalence of the molecular markers of (SP) resistance would give

a good basis for the evaluation of the effectiveness of (SP) as (IPT) in Ghana.

6.0 MATERIALS AND METHODS

6.1 STUDY AREA

Central Region (5° 30′ 0″ N, 1° 0′ 0″ W) occupies an area of 9,826 square kilometers, which

is about 6.6% of the land area of Ghana. It has an estimated population of 1,805,488 and an

annual population growth rate of 2.1% with 17 administrative districts. The region is the

second most densely populated region in the country with a population density of about 176

persons per-square kilometers; 63% of the region is rural. Generally, there are two rainy

Page | 9

seasons in the region. The peak of the major season is in June. The vegetation is divided into

dry Coastal Savannah stretching about 15 km inland, and a Tropical Rain Forest with various

reserve areas. The Region is endowed with rich cultural practices like annual festivals such as

Aboakyer, Fetu Afahye, and Bakatue, among others. An international festival, Pan African

Historical Theatre Festival is also hosted by the region. The region is also endowed with

historic monuments like castles and forts. These attract lots of tourist to the region. The

people are mostly Fantis, with, Akans and Guans, but the towns have significant presence of

different tribes form other parts of the country. The major economic activities are agriculture

and fishing. Small-scale manufacturing also takes place in food-processing, ceramic wares, as

well as salt and soap industries. The region is classified among the four poorest in the

country.

6.2 STUDY DESIGN

This research would be a cross-sectional study and the cluster sampling method would be

applied. The central region has seventeen (17) administrative districts. Each district would

represent a cluster. One or two (based on population) health facilities would be selected

randomly from each district. Each selected health facility would be visited twice (rainy and

dry seasons). A guided questionnaire would be administered before venous blood is collected.

All pregnant women would be eligible to participate whether or not (SP) dose has been taken.

6.3 SAMPLE SIZE DETERMINATION

Projected number of pregnant women in Central region = 85, 347 (GHS, Central Regional

Health Directorate).

Number of Health facilities with antenatal clinic in Central Region = 225

Page | 10

Number of Districts in Central Region = 17

Number of pregnant women per district = 85,347 / 17 = 5020

Number of Health Facilities Per district = 225 / 17 = 13

Number of pregnant women per Health Facility = 5020 / 13 = 386

Sample = 33% of the Population

From above, 33% of the estimated number of pregnant women would be sampled.

Thus number participants per health facility = 33% of 386 = 127

Since only one health facility would be visited per district, then

Sample size = 127 * 17(districts) = 2165

SAMPLE SIZE = 2165

6.3 ETHICAL CONSIDERATIONS

Ethical approval would be sought from the Ghana Health Service Ethical Review Committee.

All hospital and clinic heads would be briefed on the research procedures and its benefit to

the population. Informed consent would be obtained from the pregnant women that attend the

hospitals before they are included.

6.4 SAMPLE COLLECTION AND SCREENING

Page | 11

Four millilitres of Peripheral blood samples would be collected into a heparinised tube by

trained and licensed laboratory technicians; 50ul of blood would be dotted on a 3 MM

Whatman filter paper and air-dried at room temperature. Thick and thin blood films would

also be prepared. Full Blood Count (FBC) would be determined using ‘Cell Dyn 1800’.

Sickling status, blood group and G6PD would also be determined. The thin film would be

fixed with Methanol and both thin and thick films would be stained with 10% Giemsa

solution. Parasite density would be estimated. The spotted filter papers and plasma would be

stored at -20 until usage.

6.5 MOLECULAR ANALYSIS

Parasite DNA would be extracted from dried spots on the filter paper using the Tris – EDTA

method (as described in MR4, 2008) and the purified DNA amplified by Polymerase Chain

Reaction (PCR) using the following primers;

Name Locus / fragment Sequence

Primary PCR amplification 5’ 3’

P5-for Dhfr TTTATGATGGAACAAGTCTGC

P5-1 rev Dhfr ATTCATATGTACTATTTATTCTAGT

P8-1 for Dhps ATTTTTGTTGAACCTAAACGTGCTGTTCA

Page | 12

P8-1 rev Dhps CTTGTCTTTCCTCATGTAATTCATCT

Curled from Methods in Malaria Research. 2008

Nested PCR amplification

P5 for dhfr ACAAGTCTGCGACGTTTTCGATATTTATG

P5 rev Dhfr AGTATATACATCGCTAACAGA

P8 for Dhps TTGAAATGATAAATGAAGGTGCTAGT

P8 rev Dhps CCAATTGTGTGATTTGTCCA

. Curled from Methods in Malaria Research. 2008

After amplification, enzyme digestion and gel electrophoresis would be carried out and

visualised under U. V. To determine the mutants.

6.5 ANALYSIS OF RESULTS

The questionnaires would be analyzed using Statistical Package for Social Scientists.

Associations between the different mutations would be tested using Fisher’s Exact Test.

6.6 WORK PLAN

AUG – DEC 2009 JAN – AUG 2010

ACTIVITY A S O N D J F M A M J J A

Ethical Clearance and visits to clinics

Sample collection and screening

DNA Extraction

PCR Assay

Electrophoresis and Digestion

Page | 13

Report Writing

Seminars and conferences

Submission of thesis

7.0 BUDGET

MATERIALS AND REAGENTS QTY UNIT PRICE

(GH¢)

TOTAL

PRICE (GH¢)

SAMPLE COLLECTION AND SCREENING

1. Transportation 500

2. Chromatography filter paper 20 pkgs 7.89 157.8

3. Heparinised capillary tubes 2000 pcs 0.2 400

4. Microscope slides 20 pkgs 5.0 100

5. Giemsa stain 1L 50 50

DNA EXTRACTION

1. Ethanol 1L 72.27 72.27

2. Tris-HCl (pH 9.0) 1L 48.86 48

3. EDTA 1kg 58.98 58.98

Page | 14

PCR AMPLIFICATION

1. 96 well plates 10 pkgs 12.4 124

2. 10 x PCR Buffer 5 vials 27.05 135.25

3. EDTA 1kg 92.37 92.37

4. Readymix Taq PCR reaction mix 1000 units 0.605 605

5. PCR tubes 2 pkgs 45.51 91.02

6. primers 5 vials 7.0 35.00

ENZYME DIGESTION AND ELECTROPHORESIS

7. Ethidium bromide 1 vial 85 850

8. Agarose gel 5kg 12.0 60.00

TOTAL 3379.83

REFERENCES

1. WHO. A strategic framework for malaria prevention and control during pregnancy in

the African region. Geneva: World Health Organization, 2004: AFR/MAL.

2. Brabin, B. J. (1985). Epidemiology of infection in pregnancy. Review of infectious

Diseases, 7, 579-603.

3. The African summit on Roll Back Malaria, (TASRBM) Abuja, Nigeria, 25 April

2000. Geneva, World Health Organization, 2000 (document

WHO/CDS/RBM/2000.17

Page | 15

4. Brabin, B. J. (1991). The Risk and Severity of Malaria in Pregnant Women. Applied

Field Research in Malaria Reports No. 1. Geneva: World Health Organization.

5. Steketee R. W., Nahlen B. L., Parise M. E., Menendez C. The burden of malaria in

pregnancy in malaria-endemic areas. Am J Trop Med Hyg 2001; 64 (suppl 1–2): 28–

35.

6. Schultz L. J., Steketee R. W., Macheso A., Kazembe P., Chitsulo L., Wirima J. J. The

efficacy of anti-malarial regimens containing Sulphadoxine-Pyrimethamine and/or

Chloroquine in preventing peripheral and placental Plasmodium falciparum infection

among pregnant women in Malawi. Am J Trop Med Hyg 1994; 51: 515–22.

7. Parise M. E., Ayisi J. G., Nahlen B. L., et al. Efficacy of Sulphadoxine-

Pyrimethamine for prevention of placental malaria in an area of Kenya with a high

prevalence of malaria and human immunodeficiency virus infection. Am J Trop Med

Hyg 1998; 59: 813–22.

8. Verhoeff F. H., Brabin B. J., Chimsuku L., Kazembe P., Russell W. B., Broadhead R.

L. An evaluation of the effects of intermittent Sulphadoxine-Pyrimethamine treatment

in pregnancy on parasite clearance and risk of low birth weight in rural Malawi. Ann

Trop Med Parasitol 1998; 92: 141–50.

9. Shulman C. E., Dorman E. K., Cutts F., et al. Intermittent sulphadoxine-

pyrimethamine to prevent severe anaemia secondary to malaria in pregnancy: a

randomised placebo-controlled trial. Lancet 1999; 353: 632–36.

10. White N. J. Intermittent presumptive treatment for malaria. PLoS Med 2005; 2: e3.

11. McCollum A. M., Poe A. C., Hamel M., et al. Antifolate resistance in Plasmodium

falciparum: multiple origins and identification of novel dhfr alleles. J Infect Dis 2006;

194: 189–97.

12. Hastings M. D., Bates S. J., Blackstone E. A., Monks S. M., Mutabingwa T. K.,

Sibley C. H. Highly pyrimethamine-resistant alleles of dihydrofolate reductase in

Page | 16

isolates of Plasmodium falciparum from Tanzania. Trans R Soc Trop Med Hyg 2002;

96: 674–76.

13. Alker A. P., Mwapasa V., Purfield A., et al. Mutations associated with Sulphadoxine-

Pyrimethamine and chlorproguanil resistance in Plasmodium falciparum isolates from

Blantyre, Malawi. Antimicrob Agents Chemother 2005; 49: 3919–21.

14. Farnert A., Tengstam K., Palme I. B., et al. Polyclonal Plasmodium falciparum

malaria in travellers and selection of antifolate mutations after proguanil prophylaxis.

Am J Trop Med Hyg 2002; 66: 487–91.

15. Staedke S. G., Sendagire H., Lamola S., Kamya M. R., Dorsey G., Rosenthal P. J.

Relationship between age, molecular markers, and response to sulphadoxine-

pyrimethamine treatment in Kampala, Uganda. Trop Med Int Health 2004; 9: 624–29.

16. Kalanda G. C., Hill J., Verhoeff F. H., Brabin B. J. Comparative efficacy of

Chloroquine and Sulphadoxine-Pyrimethamine in pregnant women and children: a

meta-analysis. Trop Med Int Health 2006; 11: 569–77.

17. Tagbor H., Bruce J., Browne E., Randal A., Greenwood B., Chandramohan D.

Efficacy, safety, and tolerability of Amodiaquine and Sulphadoxine-Pyrimethamine

used alone or in combination for malaria treatment in pregnancy: a randomised trial.

Lancet 2006; 368: 1349–56.

18. Menendez C., Ordi J., Ismail M. R., et al. The impact of placental malaria on

gestational age and birth weight. J Infect Dis 2000; 181: 1740–45.

19. Garner P., Gulmezoglu A. M. Prevention versus treatment for malaria in pregnant

women. Cochrane Database Syst Rev 2000; 2: CD000169.

Page | 17

20. Rogerson S. J., van den Broek N. R., Chaluluka E., Qongwane C., Mhango C. G.,

Molyneux M. E. Malaria and anaemia in antenatal women in Blantyre, Malawi: a

twelve-month survey. Am J Trop Med Hyg 2000; 62: 335–40.

21. Njagi J. K., Magnussen P., Estambale B., Ouma J., Mugo B. Prevention of anaemia in

pregnancy using insecticide-treated bed nets and Sulphadoxine-Pyrimethamine in a

highly malarious area of Kenya: a randomized controlled trial. Trans R Soc Trop Med

Hyg 2003; 97: 277–82.

22. Crawley J., Hill J., Yartey J., et al. From evidence to action? Challenges to policy

change and programme delivery for malaria in pregnancy. Lancet Infect Dis 2007; 7:

145–55.

23. Wongsrichanalai C., Pickard A. L., Wernsdorfer W. H., Meshnick S. R:

Epidemiology of drug resistant malaria. Lancet Infect Dis 2002, 2:209-218

24. Le Bras J., Durand R: The mechanisms of resistance to antimalarial drugs in

Plasmodium falciparum. Fundam Clin Pharmacol 2003, 17:147-53

Consent form (C1) for pregnancy associated malaria

Information: (To be read or translated to participants/volunteers in their own mother tongue)

Dear Sir/Madam,

We kindly ask your permission to participate in a study, which we will proceed to

describe.

We would like to stress the fact that this study is strictly voluntary. Should you decide not to

participate, it would have no consequences for you. Should you at any point during the study

Page | 18

decide that you do not wish to participate any further, you are free to terminate the

participation. Any such decision will be respected without any further discussion. All

information gathered would be strictly confidential. You can also decide not to answer any

question you don’t feel comfortable with.

Summary of the study

The risk of pregnancy-associated malaria is highest among women in their first pregnancy,

with lower incidence and severity in women who have given birth to many children. The

adverse consequences include low birth weight and premature births, as well as maternal and

infant anaemia. In order to prevent this the WHO recommends that pregnant women are

given SP as prophylaxis. This has since been implemented in Ghana. However studies from

other countries had indicated and increasing resistance of parasite to SP. It is thus important

to determine the status of these mutants here in Ghana.

We are in this community for the first time but in order to have a good data we require blood

samples from pregnant women living in this community. The blood samples would be used

to determine if the (SP) given to pregnant women is effective in preventing malaria during

pregnancy. We will do this by examining samples of blood.

The procedure and method of blood collection would be the normal routine protocol and not

experimental. About 4 millilitres of venous blood will be collected and about 50uL of blood

is blotted on a filter paper. You may feel a little pain as a result of the prick of the needle but

this is sure to end as soon as the blood is collected. The plasma will be used to measure

specific cells and immunoglobulin in your body that fight against malaria parasites while the

genetic material of the parasite will be extracted from the blood spotted filter paper. This

genetic material will be subjected to analysis so that we can understand the genomics of the

parasite. All samples would be properly stored and used periodically during the research

Page | 19

(August 2009 – August 2010), after which any remnants would be appropriately disposed off.

Sterile techniques and disposable (single use) materials will be used at all times. If you have

any questions please feel free to ask any member of the team.

Yours sincerely

DR. JOHNSON N. BOAMPONG ( U. C. C.)

DR. ALEXANDER EGYIR-YAWSON ( GAEC)

DR. MICHEAL OFORI (NMIMR)

MR. EKENE K. NWAEFUNA (UCC)

CONSENT FORM (II) (FOR PARTICIPANTS)

I ................................................................................................have read/have had the study explained to me in English/Twi/Fante and have been given the opportunity to discuss it and to ask questions, and any question I have asked has been answered to my satisfaction. I hereby consent voluntarily to take part in the study and I understand that I have the right to withdraw from the study anytime without affecting my further medical care.

.......................................................... ..................................

Signature/Thumbprint of volunteer Date

............................................................ .................................

Signature of Principal Investigator Date

Page | 20

For further information please contact any of the following people:

Dr. Johnson Boampong ( U. C. C.) Tel: 0208154078

Dr. Alexander Egyir-Yawson (GAEC) Tel: 0242966341

Mr. Ekene Nwaefuna (UCC) Tel: 0245698616

……………………………………………………………………………………………………………………………………………………………

CONSENT FORM (II) (FOR PARTICIPANTS)

I ................................................................................................have read/have had the study explained to me in English/Twi/Fante and have been given the opportunity to discuss it and to ask questions, and any question IS have asked has been answered to my satisfaction. I hereby consent voluntarily to take part in the study and I understand that I have the right to withdraw from the study anytime without affecting my further medical care.

.......................................................... ..................................

Signature/Thumbprint of volunteer Date

............................................................ .................................

Signature of Principal Investigator Date

For further information please contact any of the following people:

Dr. Johnson Boampong ( U. C. C.) Tel: 0208154078

Dr. Alexander Egyir-Yawson (GAEC) Tel: 0242966341

Mr. Ekene Nwaefuna (UCC) Tel: 0245698616

CONSENT FORM III(FOR PARTICIPANT’S PARENT/REPRESENTATIVE)

On behalf of .................................................., I.......................................................... have read or have had the study explained to me in my local language. I have also been given the opportunity to discuss it and to ask questions and all my questions have been answered satisfactorily. I hereby voluntarily give my consent for ...................................................... to take part in the study as a subject and I understand that I have the right to withdraw him/her from the study at any time without any consequences to me or him/her.

Relationship of representative to participant .............................................................................

.............................................................. ........................................Signature/Thumbprint of Participant’s representative Date

............................................................. ........................................Signature of Principal Investigator Date

Page | 21

For further information please contact anyone of the following peopleDr. Johnson Nyarko Boampong (UCC) 020 -8154078Dr. Alex Egyir Yawson (GAEC) 024 -2966341Mr. Ekene Nwaefuna (UCC) 024 -5698616

CONSENT FORM III(FOR PARTICIPANT’S PARENT/REPRESENTATIVE)

On behalf of .................................................., I.......................................................... have read or have had the study explained to me in my local language. I have also been given the opportunity to discuss it and to ask questions and all my questions have been answered satisfactorily. I hereby voluntarily give my consent for ...................................................... to take part in the study as a subject and I understand that I have the right to withdraw him/her from the study at any time without any consequences to me or him/her.

Relationship of representative to participant .............................................................................

.............................................................. ........................................Signature/Thumbprint of Participant’s representative Date

............................................................. ........................................Signature of Principal Investigator Date

For further information please contact anyone of the following peopleDr. Johnson Nyarko Boampong (UCC) 020 -8154078Dr. Alex Egyir Yawson (GAEC) 024 -2966341Mr. Ekene Nwaefuna (UCC) 024 -5698616

SP STUDY QUESTIONNAIRE

FACILITY……………………………………………………………………………….

CODE…..…..…………..SOCIO-DEMOGRAPHICS

1. Folder No.:…………………..

2. Age:………………………..

3. Occupation :

(Trader) (Farmer) (Para – profession) (White collar) Other, Specify………………

4. Level of Education:

(Basic) (JSS) (SSS) (Tertiary) Other, specify………………………………………

Page | 22

5. Area of Residence:……………………………………………………………………..

6. Ethnic Origin:…………………………………………………………………………...

7. Occupation of Husband:

(Trader) (Farmer) (Para – profession) (White collar) Other, specify…,,,,………….

GENERAL EXCLUSION CRITERIA

8. No. of visits to antenatal clinic {1} {2} {more}

9. Age of present pregnancy…………………………………………………………..…

10. No. of present pregnancy……………………………………………………...………

11. No. of Deliveries………………………………………………………………...……

12. No. of Children………………………………………………………………………..

13. No. of Abortions……………………………………………………………………...……….

14. History of Blood Transfusion…………………………………………………………..

15. Any recent severe bleeding………………………………………..……………………

16. Any hospital admission during pregnancy……………………………………………..

17. Any history of fever within 2 weeks…{yes} {no} Body temperature ………..

18. If yes, specify condition……………………………………………….………………

19. Use of mosquito net ……………………………………………………………………

20. Use of mosquito coils…………………………………………………………………

21. Use of repellants……………………………………………………………………….

22. Use of insecticides………….………………………………………………………….

NUTRITIONAL HISTORY

23. How many times do you eat in a day…………………………………………………

24. what kind of food…………………………………………………………..………….

25. Do you have any food type you forbid eating during pregnancy……….………………

26. Have you had any episode of vomiting in this pregnancy…………………………….

DRUG HISTORY

Page | 23

27. Have you taken SP……………………………………………………………………

28. How many times………………………………………………………...………………

29. History of dewormer taken……………………………………………………………

30. Do you take herbal mixtures……………………………………..……………………..

31. Are you on any drug? yes no

Specify……………………………………………………………………..…………….

LAB USE ONLY

MPs:…………………………………………………………………………………………

PARASITE DENSITY:……………………………PARASITEAMIA………………………

HB:…………………………………………………………………………………………….

G6PD:…………………………………………………………………………………………

SICKLING:…………………………… ELECTROPHORESIS:……………………………

BLOOD GROUP:…………………………………RH. FACTOR……………………………

Page | 24