Research in the Shadow of DNA Patents

Andrew Chin

Microarray Workshop

April 5, 2002

Grant Opportunity

North Carolina Biotechnology Center Multidisciplinary Research Grants

$250,000 per project 3 different academic disciplines must be

represented Deadline: August 1, 2002

35 U.S.C. § 154

A patent confers “the right to exclude others from making, using, offering for sale, or selling the invention throughout the United States or importing the invention into the United States …”

Exclusionary vs. Exclusive Rights The right to exclude others from practicing

the claimed invention

• Does not give the right to practice the patented invention if covered by third party patent(s)

• Independent development is never a defense (as it is with copyright and trade secret protection)

Theories of Patents

Incentive to invent Incentive to disclose Incentive to innovate (Schumpeter, Kitch) Rent dissipation theory (Grady/Alexander) Race to invent theory (Merges/Nelson) Philosophical theories of property (Locke,

Hegel)

Eligibility Requirements

Subject Matter - § 101/100(b) Innovation - §§ 102/103 Disclosure & Claims - § 112 Utility - § 101

Patentable Subject Matter35 U.S.C. § 101 Whoever invents or discovers any new

and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.

New Uses35 U.S.C. § 100(b)The term “process” means process,

art or method, and includes a new use of a known process, machine, manufacture, composition of matter, or material.

§ 101: Statutory Subject Matter Statutory Subject Matter

– Process (“Method”)• Including new uses

– Machine (“Apparatus,” “Device,” or “System”)

– Article of manufacture;– Composition of matter; or – Improvement on any of above.

§ 101: Non-Statutory Categories Laws of nature (E = mc2; F = ma)

Natural phenomena (gravity, lightning) Scientific principles (Archimedes Principle,

Pythagorean Theorem) Abstract (unapplied) ideas (binary to BCD

conversion) Methods of doing business (investment

partnerships)

§ 102: Novelty Must be the first inventor

– First to invent (U.S.)

– First to file (Rest of World) Invention = Conception + Reduction to

Practice

§§ 102/103: Prior Art

Prior to applicant's invention date:– Printed publications - anywhere - §102(a)– Public knowledge or use in U.S. - §102(a)– Prior (non-public) inventions that are:

– Not suppressed, abandoned or concealed &• Diligently reduced to practice - §102(g)• Made in the U.S.A. (or NAFTA) §§ 104, 119

Printed Publications

Books, periodicals, newspapers of general circulationTrade catalogs, conference papersTest: Could anyone sufficiently interested in the

subject matter of the document obtain it?Not:

Classified government documentsConfidential corporate documentsDocuments not intended for distribution and not distributed

in fact

In re Hall

Is a doctoral thesis a printed publication under 102(b)?

Yes, if it is publicly accessible.General library practice may be relied upon to

establish an approximate time for thesis accessibility.

Library director’s affidavit: “The dissertation ‘most probably was available for general use toward the beginning of the month of December, 1977.”

In re Hall

Proponent of publication bar must show that: prior to the critical date the reference was

sufficiently accessible, at least to the public interested in the art,

so that such a one by examining the reference could make the claimed invention without further research or experimentation.

In re Hall

An applicant has constructive knowledge of all properly indexed, cataloged and shelved library materials worldwide.

“Described in a Printed Publication” To anticipate a claim to one or more chemical

compounds, a single printed publication must: specifically describe a compound within the

scope of the claim disclose a method of making the compound that

enables one of ordinary skill in the art to do so recite at least one significant useful property

(§ 101 utility requirement need not be met) It is not necessary that the disclosed

compound actually have been made

§ 103: Nonobviousness

The invention as a whole

• would not have been obvious

• to a person of ordinary skill in the relevant art

• at the time the invention was made.

§112: Disclosure & Claiming

Sufficiency of disclosure

• Written description

• Enablement

• Best mode Form of claims

Significance of Claim Scope

A claim that reads on prior art is unpatentable. – 35 U.S.C. § 102 (anticipation)

A claim that reads on an accused device or process is literally infringed.

A claim must read on the specification.– 35 U.S.C. § 112, ¶ 1 (written description)

§ 101: Utility Requirement

Usually only an issue for biotech inventions (and perpetual motion)

Related to requirement of “practical technological application" for software and business methods

Research Tools Utility for further research is not sufficient

– Research tools (e.g. microscopes): useful– Objects of research: not useful

• E.g.: a new class of chemicals under study as possible cancer cures

• “A patent is not a hunting license.” Brenner v. Manson, 383 U.S. at 536

But lower courts have found utility based on:– Effects in laboratory animals (In re Brana)– Chemical intermediaries in the production of directly

useful compounds

U.S. Patent No. 6,074,816

12. The purified preparation of claim 1 wherein the oligonucleotide comprises a contiguous sequence of at least 8 nucleotides complementary to either strand of the nucleotide residue sequence depicted in FIG. 62.”).

Figure 62

Strand A has 9,185 bases, beginning with:

5’-CACTCCACCATGAATCACTCCCCTGTG AGGAACTACTGTCTTCACGCAGAAAGCGTCTAG….

Strand B is Strand A’s reverse complement.

Claim covers 18,356 oligonucleotides (minus duplicates)

But there are only 48 = 65,536 possible oligonucleotides with 8 bases!

What is Patented?

An isolated and purified DNA molecule.

Why is it Patentable?

Statutory law Case law Patent Office Guidelines

35 U.S.C. § 101 (1952)

Whoever invents or discovers any new and useful process, machine, manufacture, or combination of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.

35 U.S.C. § 103 (1952)

(a) A patent may not be obtained … if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art …

(c) Patentability shall not be negatived by the manner in which the invention was made.

Diamond v. Chakrabarty

Claim 7:

– A bacterium from the genus Pseudomonas containing therein at least two stable energy-generating plasmids, each of said plasmids providing a separate hydrocarbon degradative pathway.

In re Bergy Claim 5:

– A biologically pure culture of the microorganism Streptomyces vellosus, having the identifying characteristics of NRRL 8037, said culture being capable of producing the antibiotic lincomycin in a recoverable quantity upon fermentation in an aqueous nutrient medium containing assimilable sources of carbon, nitrogen and inorganic substances.

Diamond v. Chakrabarty (S. Ct. 1980) § 101 subject matter includes any

“nonnaturally occurring manufacture or composition of matter [that is] a product of human ingenuity.”

In re Bergstrom(C.C.P.A. 1970) Isolated and purified compounds are

not “naturally occurring” if they “do not exist in nature in pure form.”

In re Deuel (Fed Cir. 1995)

“[T]he existence of a general method of isolating cDNA or DNA molecules is essentially irrelevant to the question whether the specific molecules themselves would have been obvious.”

Patent Office Utility Guidelines

12/99: PTO publishes interim guidelines, seeks public comments

1/01: PTO responds to public comments, publishes final guidelines

Controlling Law(Comments 6, 12, 16, 17) “The USPTO must administer the laws as

Congress has enacted them and as the Federal courts have interpreted them.”

Subject Matter and Utility(Comments 1-4, 6, 8, 14, 23) An isolated and purified nucleic acid molecule is a

non-naturally occurring composition of matter, and satisfies the §101 subject matter requirement

Disclosure of a specific, substantial and credible utility satisfies the §101 utility requirement– Examples: having a role in the synthesis of a

“useful protein”; expressing the presence of a disease

Uses of DNA Molecules(Comment 5, 7, 9-11, 20)

First disclosed use will support a claim to DNA molecule as composition of matter– Right to exclude all subsequent uses

Subsequent nonobvious uses may support “new use” process claims under § 100(b)– Outcome: Blocking patents– “When genes are treated the same as for other

chemicals, progress is promoted … because a new chemical is made available for future research.”

Enablement(Comment 15) It is not necessary to disclose how

or why the molecule works.– Newman v. Quigg, 877 F.2d 1575,

1581 (Fed. Cir. 1989)

Obviousness(Comment 13) Obviousness does not depend on the amount of

work required to characterize the DNA molecule.– See 35 U.S.C. § 103(a) (patentability shall not

be negatived by the manner in which the invention was made).

Correct inquiry: Would the claimed DNA molecule have been obvious to one of ordinary skill in the art at the time the invention was made?

Homology-Based Utility(Comments 18, 19) Homology: common ancestry DNA sequence similarity may be

evidence of homology Homology may be evidence of

common utility PTO will judge homology-based

assertions of utility on their own merits

Well-Established Utilities(Comments 21, 22) Unless a well-established utility is readily

apparent, burden is on applicant to show a specific, substantial and credible utility.

This showing can be made after the filing date (e.g., by submitting prior art references), but the original specification must enable the utility shown.

Derwent GENESEQ Database

Collection of patented DNA sequences– 10 or more base pairs

Coverage from 1981 Feb. 2001: 1,000,000 sequences Feb. 2002: 2,000,000 sequences One patent covers 382,000 sequences

How to Stop (Some) DNA Patents

Patents are not allowed to claim subject matter that has been previously described in a printed publication. 35 U.S.C. § 102(a)

General methods of making and using oligonucleotides of arbitrary sequence are well known and described in the literature.

But specific oligonucleotides are not described in this literature, so there is no § 102(a) bar

How to Stop (Some) DNA Patents

A § 102(a) reference must include:– A specific description of the subject matter and– Instructions that will enable an ordinary

practitioner to make and use the subject matter Not necessary to have actually made or used the

subject matter A single copy in a public library counts as

“publication” Solution: Describe 11 million DNA sequences,

and general methods of making and using them, on a single CD-ROM

The CD-ROM On the Preparation and Utilization of Isolated and Purified Oligonucleotides 

As described in U.S. Patent No. 5,808,022 (issued Sept. 15, 1998) (William D. Huse), oligonucleotide synthesis proceeds via linear coupling of individual monomers in a stepwise reaction. The reactions are generally performed on a solid phase support . . .

The CD-ROM

Based on the the disclosures herein and the knowledge of a person of ordinary skill in the art, it will be apparent to such a person how to make and use an isolated and/or purified oligonucleotide characterized by any of the following nucleotide sequences:

The CD-ROM

5'-AAACACCC-3'5'-AAACACCG-3'5'-AAACACGC-3'5'-AAACACGG-3'5'-AAACAGCC-3'5'-AAACAGCG-3'5'-AAACAGGC-3'5'-AAACAGGG-3'5'-AAACCACC-3'. . .

Anticipation of Oligonucleotide Patents

# of 8-to-12 base oligonucleotides claimed

% of possible claims anticipated

1 49.6%

2 74.6%

3 87.2%

10 99.9%

25 99.99999+%

Objections to DNA Patents Claimed DNA inventions are discoveries of

naturally-occurring phenomena Sequencing DNA is not inventive Gene patents block:

– Development of useful downstream products• Clinical tests for presence of patented

sequences– Alternative uses of DNA molecules– Free flow of DNA sequence information

Gene patents result in marketing of human tissues

Problem

Discussion of these objections is now closed– 1952 Patent Act– Supreme Court and Federal Circuit caselaw– USPTO Guidelines

USPTO Utility Guidelines (2001)

There is no legal basis for treating DNA molecules differently from other chemical compounds as “compositions of matter”

One who is first to identify and promptly disclose a specific, substantial, and credible utility for an isolated and purified DNA molecule is entitled to exclude others from any method of making or using that molecule during the patent term.– Quid pro quo: § 112 disclosure

Disclosure Requirements35 U.S.C. § 112 Written description

– Usually: Nucleotide sequence information

How to make– Usually: Nucleotide sequence information

How to use– “Specific, substantial, and credible” utility– Example: Microarray probe for measuring

clinically salient gene expression

The Internal Logic of DNA Patents The public gets a § 112 disclosure

– Learns how to make and use a new and nonobvious composition of matter

The inventor gets a patent– Exclusive rights to make and use

the composition of matter for 20 years from filing of application

Fairness of the exchange is not to be examined

How to Reopen the Discussion

Grant the patent system’s premises– DNA patents create incentives for § 112

disclosures of DNA molecules– The public benefits because more § 112

disclosures of DNA molecules are made Demonstrate that the project fails on its own

terms– A few patented DNA molecules are

sufficient to impair § 112 disclosures of most other DNA molecules

DNA Chips

Size: One square inch Capacity: 100,000-1,000,000 DNA

sequences (probes) “If each spot on the array involves a gene

that’s patented, you have to get licenses for each spot.”– Jeffrey Trent

National Human Genome Research Institute

Case Study 1:Sequencing By Hybridization Use a chip containing all 4k sequences of k

nucleotides (probes) Hybridization reaction will identify all

subsequences of k contiguous nucleotides in the sample

TCACAGG: { TCA, CAC, CAG, ACA, AGG}

Lysov et al.

Pevzner

TCA

CAC ACA

AGGCAGHamiltonian path

Eulerian path

TC CA AC

AG GG

TCA CAC

ACA

CAG

AGG

Sequencing by Hybridization

Sequencing by Hybridization

A sample sequence of length o(2k) can be reconstructed using the Pevzner algorithm from the set of subsequences with probability 1-o(1) (Dyer et al.)

If (2k) of the 4k possible probes are unavailable, this is no longer true

Aim to show: A few probe patents will impede sequencing of many DNA molecules

Case Study 2:Cluster Analysis of Gene Expression Data

Use a chip containing probes that hybridize uniquely to known genes

Hybridization reaction will measure expression of these genes in the sample(s)

Cluster analysis can generate clinically salient classifications

Case Study 2:Cluster Analysis of Gene Expression Data If probes for highly distinguishing sets of genes

(Perou) are unavailable, diagnostics will be degraded If a few probes are unavailable, spurious clusters are

likely

– Missing value estimation methods (Troyanskaya) cannot help

Aim to show: A few probe patents will impede the identification of probes with high distinguishing power (a specific, substantial and credible utility)