Research ArticleThe Possible Roles of Biological Bone Constructed withPeripheral Blood Derived EPCs and BMSCs in Osteogenesisand Angiogenesis

Li Wu1 Xian Zhao2 Bo He1 Jie Jiang1 Xiao-Jie Xie1 and Liu Liu2

1Medical Imaging Department The First Affiliated Hospital Kunming Medical University Kunming 650032 China2Plastic Surgery Department The First Affiliated Hospital Kunming Medical University Kunming 650032 China

Correspondence should be addressed to Liu Liu liuliu3939126com

Received 14 December 2015 Revised 7 March 2016 Accepted 21 March 2016

Academic Editor Martin Bornhaeuser

Copyright copy 2016 Li Wu et al This is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

This study aimed to determine the possible potential of partially deproteinized biologic bone (PDPBB) seeded with bone marrowstromal cells (BMSCs) and endothelial progenitor cells (EPCs) in osteogenesis and angiogenesis BMSCs and EPCs were isolatedidentified and cocultured in vitro followed by seeding on the PDPBB Expression of osteogenesis and vascularization markerswas quantified by immunofluorescence (IF) staining immunohistochemistry (IHC) and quantitive real-time polymerase chainreaction (qRT-PCR) Scanning electron microscope (SEM) was also employed to further evaluate the morphologic alterationsof cocultured cells in the biologic bone Results demonstrated that the coculture system combined with BMSCs and EPCs hadsignificant advantages of (i) upregulating the mRNA expression of VEGF Osteonectin Osteopontin and Collagen Type I and(ii) increasing ALP and OC staining compared to the BMSCs or EPCs only group Moreover IHC staining for CD105 CD34and ZO-1 increased significantly in the implanted PDPBB seeded with coculture system compared to that of BMSCs or EPCsonly respectively Summarily the present data provided evidence that PDPBB seeded with cocultured system possessed favorablecytocompatibility provided suitable circumstances for different cell growth and had the potential to provide reconstruction forcases with bone defection by promoting osteogenesis and angiogenesis

1 Introduction

In china there are over three million patients with the bonedefects of cranium mandibula and limbs This number isincreasing 10 each year with population aging Takingadvantage of modern biological materials current graftingtreatments are extensively applied to clinic cases Howeverthe specific shortcomings and limitations of those graftingmaterials hold back the clinic research and application ofengineering bone [1 2]

Reports reveal that crucial steps contributing to engineer-ing bone development or restructure include the appropriatecomposite biomaterials for bone regeneration [3 4] as well asprepared reparative cells [5 6] By far multiple studies haveconfirmed the great potential of bone marrow stromal cells(BMSCs) in promoting regeneration of bone defects both inanimal models and in humans [7 8] Additionally evidences

support that endothelial progenitor cells (EPCs) contributeto revascularization in vitro and in vivo and enhance boneformation to bridge bone defects for bone repair [9 10] Bio-material scaffold which is necessary for reparative cells hasthe ability to influence cell adhesion and biological behavior(morphology proliferation and differentiation of neighbour-ing cells) [11]

One of the most important criteria for an ideal bonetissue engineering scaffold is that the scaffold consists of ahighly interconnected porous network with pore sizes largeenough for cell migration fluid exchange and eventuallytissue ingrowth and vascularization [12] Although syntheticcalcium phosphate ceramics with their excellent biocom-patibility are designed to mimic the native extracellularmatrix as closely as possible [13] the porous network of theartificial bone scaffold still cannot compare to natural bonein terms of structure and function There is a growing need

Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 8168943 11 pageshttpdxdoiorg10115520168168943

2 BioMed Research International

to provide alternatives to traditional bone grafting Depro-teinized bovine bone produced from natural materialsknown as inorganic porous bone has gained wide acceptancefor various medical applications for autologous bone grafts[14] Even so deproteinized bovine bone has no capability ofenhancing bone regeneration because it is not osteoinductiveComposite biomaterial combined with both of the reparativecells and the biological bone is a promising strategy forbone regeneration However little is known about the effectand influence of composite materials containing a partiallydeproteinized biologic bone (PDPBB) fraction on cells withosteogenesis capabilities

In the present study we prepared biological engineeringbone PDPBB seeded with cocultured BMSCs and EPCs andthen determined its potential for osteogenesis and angiogene-sis Peripheral blood derived EPCs and BMSCs were isolatedidentified and seeded onto the PDPBB The efficiency ofBMSCs EPCs alone and the coculture system on the osteo-genesis and angiogenesis was dynamically monitored both invitro and in vivo following transplantation Briefly the third-generation EPCs and BMSCs were cocultured and preparedfor alkaline phosphatase (ALP) and osteocalcin (OC) quanti-tive detection by IHC after 3 7 and 14 days of culture ThemRNA levels of Osteonectin Osteopontin vascular endo-thelial cell growth factor (VEGF) and Collagen Type I werealso evaluated by using qRT-PCR PDPBB was preparedfrom fresh porcine spine bone modified with fibronectinand then seeded with EPCs BMSCs alone and coculturesystem respectively The different engineering bones werethen implanted into the muscle of rabbits The osteogenesisand angiogenesis were evaluated by IHC staining with CD34CD105 and ZO-1 after 14 28 and 60 days of implantationSEM was also employed for morphological detection ofPDPBB seeded with different cells

2 Materials and Methods

21 Animal and Ethics Statement Twelve New Zealand malerabbits with 25 kgmean weight were employed in the presentresearch Animal use and care were in accordance with theanimal care guidelines which conformed to the Guide forthe Care and Use of Laboratory Animals published by the USNational Institutes of Health (NIH publication number 85-23 revised 1996) and the Care and Use Guidelines of Exper-imental Animals established by the Ministry of Medicine ofYunnan China The ethics committee of Kunming MedicalUniversity specifically approved this study (permit numberkm-edw-2014708) All surgical procedures were performedunder chloral hydrate anesthetised and all efforts were madeto minimize suffering

22 Cell Isolate and Characterization Adult New Zealandrabbits were anesthetised by intraperitoneal injection withchloral hydrate (2mLkg) EPCs were isolated from rabbitperipheral blood and cultured in endothelial cell medium(ECM) [15] After six daysrsquo culture EPCs were identified byimmunofluorescence staining for CD34 (hematopoietic pro-genitor antigen) (1 1000 Abcam CA UK) CD133 (PROM1)

(1 500 Santa Cruz USA) and vWF (von Willebrand Fac-tor) (1 800 Santa Cruz USA) Bone marrow stromal cells(BMSCs) were isolated from the same rabbit bone marrowblood and cultured in DMEM containing 15 fetal bovineserum [16] Cells of the third passage were harvested forfurther use

The immunofluorescence staining for CD34 (1 500)CD29 (integrin beta-1) (1 400 Santa Cruz USA) and CD90(Thy-1) (1 200 Vector USA) was also used for EPCs identi-fication

The coculture system was reconstructed as described asfollows EPCs and BMSCs were cocultured with the ratio 1 2in diet culturemedium including 10FBS by gently pipettingup and down and seeded on six-well plate at a density of 2 times105 cellsmL The medium was replaced once per three daysThe pure EPCs or BMSCs culture served as control

23 Immunofluorescence (IF) Staining The IF staining wasperformed as described before [17] Anti-rabbit CD34(1 500) CD133 (1 500) vWF (1 200) CD29 (1 800) andCD90 (1 200) were used Cells were then stained with asecondary antibody for 2 h Goat anti-rabbit IgG and AlexaFluorreg 488 Donkey Anti-Rabbit IgG (Life Technologies) wereused for second antibody staining and then counterstainedwith the nuclear dye 410158406-diamidino-2-phenylindole (DAPI)(Biotium Hayward CA USA) All images were taken with aLeica fluorescence microscope

24 Coculture System of BMSCs and EPCs In Vitro The coc-ulture system combined with EPCs and BMSCs referred toothers described before [18] Briefly to determine the optimalratio of EPCs and BMSCs for cocultured system sevengroups were designed including BMSCs alone EPCs aloneand EPCs BMSCs at ratios of 2 1 (6 times 104 3 times 104 cells)1 2 (3 times 104 6 times 104 cells) and 1 1 (5 times 104 5 times 104 cells)EGM (EGM-2 medium supplemented with growth factorbullet kit (Lonza Cologne Germany))complete medium(CM) which is DMEM (Gibco) supplemented with 10fetal bovine serum (FBS Gibco) L-glutamine (2mmolL)and penicillin (100UmL) and EGMosteogenic (OS) mediawere employed Cells were plated at 1 times 105 cells per wellin 12-well plates and induced with EGMcomplete mediaCocultured group combined with EPCs BMSCs at ratios of1 2 achieved the most excellent proliferation activity amongthe groups and was significantly different compared to others(see Figure S1 at Supplementary Material available online athttpdxdoiorg10115520168168943)

25 qRT-PCR On days 3 7 and 14 of culture a total of 1 times106 cells from pure EPCs BMSCs and coculture system wereobtained (119899 = 7) The mRNA expressions of multiple genesin cultured cells including VEGF Osteopontin Osteonectinand Collagen Type I were detected by qRT-PCR All experi-ments were performed in triplicateThe protocol was accord-ing to XiYang et al [19] Briefly Trizol reagent (InvitrogenUSA) was used to isolate total RNA of sample cDNA was

BioMed Research International 3

Table 1 Primer and PCR conditions used for qRT-PCR

Genes Primer sequence Lengths of products

VEGF Forward 51015840 GAAGAAGGAGACAATAAACCC 31015840Reversal 51015840 ACCAGAGGCACGCAGGAA 31015840 152 bp

Osteopontin Forward 51015840 GCTCAGCACCTGAATGTACC 31015840Reversal 51015840 CTTCGGCTCGATGGCTAGC 31015840 247 bp

Osteonectin Forward 51015840 CTCCAGCTGGACTACATCG 31015840Reversal 51015840 CTCCATGGGGATGAGTGGT 31015840 369 bp

Collagen Type I Forward 51015840 TCAACGGTGCTCCTGGTGAAG 31015840Reversal 51015840 GGACCTTGGCTACCCTGAGAA 31015840 514 bp

120573-actin Forward 51015840 GCTCGTCGTCGACAACGGCTC 31015840Reversal 51015840 CAAACATGATCTGGGTCATCTTCTC 31015840 353 bp

synthesized by using Oligo(dT)18 and MMLV reverse tran-scriptase (Promega Madison WI) Gene primers were syn-thesized by Shengon Ltd Company (Shanghai China) Theprimers were recorded in Table 1 qRT-PCR protocol wasapplied using ABI 5700 instrument (Bio-Rad LaboratoriesShanghai China) The melting curve analysis was performedto confirm the specificity of the amplification products PCRwas performed by the denaturation step at 95∘C for 3minutesfollowed by 35 cycles of 95∘C for 15 seconds annealing for15 seconds and 72∘C for 30 seconds Fluorescent signalsobtained from PCR products were recorded at 855∘C for5 seconds Relative CT method was employed to comparedifference between samples The fold decreaseincrease wasdetermined relative to a blank control after normalizing to ahousekeeping gene using 2minusΔΔCT [20]

26 Osteoblast Identification by ALP Staining and OC AssayOsteoblasts were identified by using an ALP (Jackson USA)or OC (Jackson USA) staining kit according to the manufac-turerrsquos instructions and osteogenic differentiation of EPCsBMSCs and coculture system was confirmed The stainedcells were then photographed with a camera [21]

The levels of ALP and OC were determined accordingto the manufacturerrsquos instructions (Jackson USA) In orderto normalize these markers expressions for quantificationmedium supernatant from each subgroup was collected toevaluate the ALP and OC levels at the same density of 1times 107 cells per well After 3 7 or 14 days of culture themedium supernatant from each groupwas collected and usedto evaluate the ALP and OC level [21] The OD was read at450 nmusing ELISA plate reader (Bio-Rad) All samples wereassayed in duplicate

27 Reconstruction of Biologic Bone Seeded with Cells ThePDPBB treated with fibronectin [22 23] was preparedfrom fresh porcine spine bone modified with fibronectin asdescribed in Table 2 A total of 168 pieces of PDPBB withsize of 05 times 05 times 01 cm each were prewetted with mediumsolutions for 30min

Rabbit pure EPCs (05times 106mL 30 120583L EPCs) BMSCs (05times 106mL 30 120583LBMSCs) and coculture system (20120583LBMSCs+ 10 120583L EPCs) were seeded into PDPBB to reconstruct tissue-engineered bone in vitro respectively [20 24] The optimal

Table 2 Preparation of partially deproteinized bone

Reagenttreatment Processing time Temperature30 H

2O2

72 hlowast RTDistilled water 30min RTEthanol 24 h RTDistilled water 30min RTAcetone 24 h RTDistilled water 30min RTDying oven 8 h RTlowast30H2O2 is changed every 24 h during 72 hRT room temperature

cells seeding density described above achieved an excellentadhesion and proliferation activity on PDPBB [24]

The proliferation of EPCs BMSCs or cocultured systemseeded on PDPBB was also determined by Wst-1 assay Coc-ulture seeded group achieved the most excellent proliferationactivity among the groups and was significantly differentcompared to others (Supplemental Data Figure S2)

28 PDPBB Transplantation The twelve rabbits above fromwhich we extracted peripheral blood and bone marrow forcell culture underwent the surgery of PDPBB transplantedback into their bodyThe engineering bone groups includingPDPBB + EPCs PDPBB + BMSCs and PDPBB + coculturesystem were respectively transplanted into the muscle ofthe upper limbs of animal Briefly the rabbits were anaes-thetizedwith intraperitoneal injection of 36 chloral hydrate(2mLkg) The skin and subcutaneous tissue of both upperlimbs were incised and then the sarcolemma and musclewere bluntly dissected by Wallerian clamp Muscle bag with1 times 1 times 1 cm volume was enlarged by forceps for engineeredbone transplantation After operation the rabbits receiveddaily injections of amoxicillin (dosage at 20mg) for 3 days

29 Immunohistochemistry (IHC) At 14 28 and 60 days aftertransplantation the rabbits in engineering bone groups wereunder anesthesia and the engineering bones were isolatedfor IHC analysis After anesthesia with 36 chloral hydratetransplanted engineering bones were carefully isolated andfixed in 4 paraformaldehyde solution They were then

4 BioMed Research International

CD34

CD133

vWF

(a)

CD29

CD90

CD34

(b)

Figure 1 Characterization of EPCs and BMSCs by immunofluorescence staining (a) IF analysis for EPCs cell surfacemarkers CD34 CD133and vWF (red) nucleuses were stained byDAPI (blue)Magnifications 100x scale bar 100 120583m (b) IF analysis for BMSCs cell surfacemarkersCD29 CD90 (red Magnifications 100x and scale bar 100 120583m) and CD34 (green) nucleuses were stained by DAPI (blue) (Magnifications400x scale bar 25 120583m)

embedded with resin Sections of 4 120583m thickness were cutin a hard tissue microtome collected and flatted in waterbath at 60∘C dredged on slide and baked in oven at50∘C The following protocol was described as others [25]After immersing in 001M PBS (containing 5 goat serumand 03 TritonX-100 solution) at 37∘C for 30min theywere subsequently incubated at 4∘C overnight with 2 goatserum containing goat polyclonal antibodies CD34 (1 800)CD105 (endoglin) (1 1000 Santa Cruz) or ZO-1 (Zonulaoccludens-1) (1 500 Santa Cruz) respectively Immunoreac-tive products were observed and photographed with a lightmicroscope coupled with a computer assisted video camera(Leica DMIRB Germany)

210 Scanning Electron Microscope (SEM) Field EmissionSEM S-4800 (Hitachi Japan) was employed to characterizethe PDPBB as well as the morphology and behavior of thecells grown in the PDPBB Prior to imaging the cells werefixed with 25 glutaraldehyde and samples were dehydratedin a graded ethanol series and sputter-coated with gold for15ndash20 s All samples were analyzed at 15 kV [26]

211 Statistical Analysis SPSS v145 (SPSS Inc Chicago IL)was used for statistical analysis Data are presented as meansplusmn standard deviation (SD) Two-way ANOVA were used todetermine statistically significant differences between groupsfollowed by Bonferroni posttests A 119875 value of less than 005was considered statistically significant (119875 lt 005)

3 Result

31 Isolation and Characterization of MSCs and EPCs Thecells were analyzed and identified by IF staining for EPCs

and BMSCs cell surface markers at passage 3 For EPCs weanalyzed the early hematopoietic progenitor cell marker byIF Results showed that EPCs expressed a cell surface proteinprofile positive for CD34 CD133 and vWF (Figure 1(a) andSupplemental Data Figure S3) As shown in Figure 1(b)BMSCs expressed a cell surface protein profile positive forCD29 and CD90 and negative for CD34 IF staining showedthat EPCs were CD34+CD133+vWF+ while BMSCs wereCD29+CD90+CD34minus

32 Effect of Cocultured System on ALP Activity At 3 daysALP stain was present negative either in EPCs group or inBMSCs group while it showed partially positive staining incocultured group At 7 days ALP stain of the EPCs groupstill appeared negative However positive cells were presentin either BMSCs or coculture group Moreover there weremore positive cells observed in the coculture group comparedto that of BMSCs group (Figure 2(a) and Supplemental DataFigure S4) At 14 days deep ALP stain was observed inconfluent cells in coculture group while light stained cellsof ALP were scattered in BMSCs only group Till 14 daysthere were noALP positive cells observed in EPCs only group(Figure 2(a))

Quantitive analysis in ALP content by CurveExpert 14softwarewas performedThe results showed that ALP contentof BMSCs and coculture group increased gradually from 3to 14 days after culture and the level peaked in coculturegroup at 14 days when compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 2(b)) In EPCs groupthe ALP level revealed no significant difference between eachtime point (119875 gt 005) Through the whole experimentalperiod content of ALP detected in coculture group was morecompared to BMSCs only group (119875 lt 005 Figure 2(b))

BioMed Research International 5

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowast lowastlowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

05

1

15

2

25

3

ALP

conc

entr

atio

n (U

L)

EPCs

(d)

BMSCsCoculture system

3 7 14

(b)

Figure 2 ALP analysis in three groups after 3 7 and 14 days of cell culture (a) ALP staining in EPCs BMSCs and cocultured groupsMagnifications 400x scale bar 25 120583m (b) ALP content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowastlowast lowast

amp

ampamp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

25

30

35

OC

conc

entr

atio

n (U

L)

3 7 14

EPCs

(d)

BMSCsCoculture system

(b)

Figure 3 OC analysis in three groups after 3 7 and 14 days of cell culture (a) OC staining in EPCs BMSCs and cocultured groupsMagnifications 200x scale bar 50 120583m (b) OC content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

33 Effect of Cocultured System on OC Expression At 3 daysno OC stain was detected in three groups At 7 days therewere partially positive staining in cocultured group and lightpink in BMSCs group OC stain of the EPCs group stillappeared negative At 14 days confluent OC positive cellswere observed in coculture group while light stained cellsof OC were scattered in BMSCs only group Moreover fewcalcium nodes were also observed in the coculture group butnot in BMSCs alone one There were no positive OC stainingcells observed in EPCs only group until 14 days (Figure 3(a))

The OC content of each group increased gradually from7 to 14 days and the level of OC was the highest in coculturegroup on each time point compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 3(b)) There are sta-tistically significant differences between each group

34 Alteration in mRNA Expression of Osteoblast and Angio-genesis Genes ThemRNA levels of VEGFOsteonectin Oste-opontin and Collagen Type I detected by qRT-PCR weregradually increased from 3 to 7 to 14 days Compared to

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

2 BioMed Research International

to provide alternatives to traditional bone grafting Depro-teinized bovine bone produced from natural materialsknown as inorganic porous bone has gained wide acceptancefor various medical applications for autologous bone grafts[14] Even so deproteinized bovine bone has no capability ofenhancing bone regeneration because it is not osteoinductiveComposite biomaterial combined with both of the reparativecells and the biological bone is a promising strategy forbone regeneration However little is known about the effectand influence of composite materials containing a partiallydeproteinized biologic bone (PDPBB) fraction on cells withosteogenesis capabilities

In the present study we prepared biological engineeringbone PDPBB seeded with cocultured BMSCs and EPCs andthen determined its potential for osteogenesis and angiogene-sis Peripheral blood derived EPCs and BMSCs were isolatedidentified and seeded onto the PDPBB The efficiency ofBMSCs EPCs alone and the coculture system on the osteo-genesis and angiogenesis was dynamically monitored both invitro and in vivo following transplantation Briefly the third-generation EPCs and BMSCs were cocultured and preparedfor alkaline phosphatase (ALP) and osteocalcin (OC) quanti-tive detection by IHC after 3 7 and 14 days of culture ThemRNA levels of Osteonectin Osteopontin vascular endo-thelial cell growth factor (VEGF) and Collagen Type I werealso evaluated by using qRT-PCR PDPBB was preparedfrom fresh porcine spine bone modified with fibronectinand then seeded with EPCs BMSCs alone and coculturesystem respectively The different engineering bones werethen implanted into the muscle of rabbits The osteogenesisand angiogenesis were evaluated by IHC staining with CD34CD105 and ZO-1 after 14 28 and 60 days of implantationSEM was also employed for morphological detection ofPDPBB seeded with different cells

2 Materials and Methods

21 Animal and Ethics Statement Twelve New Zealand malerabbits with 25 kgmean weight were employed in the presentresearch Animal use and care were in accordance with theanimal care guidelines which conformed to the Guide forthe Care and Use of Laboratory Animals published by the USNational Institutes of Health (NIH publication number 85-23 revised 1996) and the Care and Use Guidelines of Exper-imental Animals established by the Ministry of Medicine ofYunnan China The ethics committee of Kunming MedicalUniversity specifically approved this study (permit numberkm-edw-2014708) All surgical procedures were performedunder chloral hydrate anesthetised and all efforts were madeto minimize suffering

22 Cell Isolate and Characterization Adult New Zealandrabbits were anesthetised by intraperitoneal injection withchloral hydrate (2mLkg) EPCs were isolated from rabbitperipheral blood and cultured in endothelial cell medium(ECM) [15] After six daysrsquo culture EPCs were identified byimmunofluorescence staining for CD34 (hematopoietic pro-genitor antigen) (1 1000 Abcam CA UK) CD133 (PROM1)

(1 500 Santa Cruz USA) and vWF (von Willebrand Fac-tor) (1 800 Santa Cruz USA) Bone marrow stromal cells(BMSCs) were isolated from the same rabbit bone marrowblood and cultured in DMEM containing 15 fetal bovineserum [16] Cells of the third passage were harvested forfurther use

The immunofluorescence staining for CD34 (1 500)CD29 (integrin beta-1) (1 400 Santa Cruz USA) and CD90(Thy-1) (1 200 Vector USA) was also used for EPCs identi-fication

The coculture system was reconstructed as described asfollows EPCs and BMSCs were cocultured with the ratio 1 2in diet culturemedium including 10FBS by gently pipettingup and down and seeded on six-well plate at a density of 2 times105 cellsmL The medium was replaced once per three daysThe pure EPCs or BMSCs culture served as control

23 Immunofluorescence (IF) Staining The IF staining wasperformed as described before [17] Anti-rabbit CD34(1 500) CD133 (1 500) vWF (1 200) CD29 (1 800) andCD90 (1 200) were used Cells were then stained with asecondary antibody for 2 h Goat anti-rabbit IgG and AlexaFluorreg 488 Donkey Anti-Rabbit IgG (Life Technologies) wereused for second antibody staining and then counterstainedwith the nuclear dye 410158406-diamidino-2-phenylindole (DAPI)(Biotium Hayward CA USA) All images were taken with aLeica fluorescence microscope

24 Coculture System of BMSCs and EPCs In Vitro The coc-ulture system combined with EPCs and BMSCs referred toothers described before [18] Briefly to determine the optimalratio of EPCs and BMSCs for cocultured system sevengroups were designed including BMSCs alone EPCs aloneand EPCs BMSCs at ratios of 2 1 (6 times 104 3 times 104 cells)1 2 (3 times 104 6 times 104 cells) and 1 1 (5 times 104 5 times 104 cells)EGM (EGM-2 medium supplemented with growth factorbullet kit (Lonza Cologne Germany))complete medium(CM) which is DMEM (Gibco) supplemented with 10fetal bovine serum (FBS Gibco) L-glutamine (2mmolL)and penicillin (100UmL) and EGMosteogenic (OS) mediawere employed Cells were plated at 1 times 105 cells per wellin 12-well plates and induced with EGMcomplete mediaCocultured group combined with EPCs BMSCs at ratios of1 2 achieved the most excellent proliferation activity amongthe groups and was significantly different compared to others(see Figure S1 at Supplementary Material available online athttpdxdoiorg10115520168168943)

25 qRT-PCR On days 3 7 and 14 of culture a total of 1 times106 cells from pure EPCs BMSCs and coculture system wereobtained (119899 = 7) The mRNA expressions of multiple genesin cultured cells including VEGF Osteopontin Osteonectinand Collagen Type I were detected by qRT-PCR All experi-ments were performed in triplicateThe protocol was accord-ing to XiYang et al [19] Briefly Trizol reagent (InvitrogenUSA) was used to isolate total RNA of sample cDNA was

BioMed Research International 3

Table 1 Primer and PCR conditions used for qRT-PCR

Genes Primer sequence Lengths of products

VEGF Forward 51015840 GAAGAAGGAGACAATAAACCC 31015840Reversal 51015840 ACCAGAGGCACGCAGGAA 31015840 152 bp

Osteopontin Forward 51015840 GCTCAGCACCTGAATGTACC 31015840Reversal 51015840 CTTCGGCTCGATGGCTAGC 31015840 247 bp

Osteonectin Forward 51015840 CTCCAGCTGGACTACATCG 31015840Reversal 51015840 CTCCATGGGGATGAGTGGT 31015840 369 bp

Collagen Type I Forward 51015840 TCAACGGTGCTCCTGGTGAAG 31015840Reversal 51015840 GGACCTTGGCTACCCTGAGAA 31015840 514 bp

120573-actin Forward 51015840 GCTCGTCGTCGACAACGGCTC 31015840Reversal 51015840 CAAACATGATCTGGGTCATCTTCTC 31015840 353 bp

synthesized by using Oligo(dT)18 and MMLV reverse tran-scriptase (Promega Madison WI) Gene primers were syn-thesized by Shengon Ltd Company (Shanghai China) Theprimers were recorded in Table 1 qRT-PCR protocol wasapplied using ABI 5700 instrument (Bio-Rad LaboratoriesShanghai China) The melting curve analysis was performedto confirm the specificity of the amplification products PCRwas performed by the denaturation step at 95∘C for 3minutesfollowed by 35 cycles of 95∘C for 15 seconds annealing for15 seconds and 72∘C for 30 seconds Fluorescent signalsobtained from PCR products were recorded at 855∘C for5 seconds Relative CT method was employed to comparedifference between samples The fold decreaseincrease wasdetermined relative to a blank control after normalizing to ahousekeeping gene using 2minusΔΔCT [20]

26 Osteoblast Identification by ALP Staining and OC AssayOsteoblasts were identified by using an ALP (Jackson USA)or OC (Jackson USA) staining kit according to the manufac-turerrsquos instructions and osteogenic differentiation of EPCsBMSCs and coculture system was confirmed The stainedcells were then photographed with a camera [21]

The levels of ALP and OC were determined accordingto the manufacturerrsquos instructions (Jackson USA) In orderto normalize these markers expressions for quantificationmedium supernatant from each subgroup was collected toevaluate the ALP and OC levels at the same density of 1times 107 cells per well After 3 7 or 14 days of culture themedium supernatant from each groupwas collected and usedto evaluate the ALP and OC level [21] The OD was read at450 nmusing ELISA plate reader (Bio-Rad) All samples wereassayed in duplicate

27 Reconstruction of Biologic Bone Seeded with Cells ThePDPBB treated with fibronectin [22 23] was preparedfrom fresh porcine spine bone modified with fibronectin asdescribed in Table 2 A total of 168 pieces of PDPBB withsize of 05 times 05 times 01 cm each were prewetted with mediumsolutions for 30min

Rabbit pure EPCs (05times 106mL 30 120583L EPCs) BMSCs (05times 106mL 30 120583LBMSCs) and coculture system (20120583LBMSCs+ 10 120583L EPCs) were seeded into PDPBB to reconstruct tissue-engineered bone in vitro respectively [20 24] The optimal

Table 2 Preparation of partially deproteinized bone

Reagenttreatment Processing time Temperature30 H

2O2

72 hlowast RTDistilled water 30min RTEthanol 24 h RTDistilled water 30min RTAcetone 24 h RTDistilled water 30min RTDying oven 8 h RTlowast30H2O2 is changed every 24 h during 72 hRT room temperature

cells seeding density described above achieved an excellentadhesion and proliferation activity on PDPBB [24]

The proliferation of EPCs BMSCs or cocultured systemseeded on PDPBB was also determined by Wst-1 assay Coc-ulture seeded group achieved the most excellent proliferationactivity among the groups and was significantly differentcompared to others (Supplemental Data Figure S2)

28 PDPBB Transplantation The twelve rabbits above fromwhich we extracted peripheral blood and bone marrow forcell culture underwent the surgery of PDPBB transplantedback into their bodyThe engineering bone groups includingPDPBB + EPCs PDPBB + BMSCs and PDPBB + coculturesystem were respectively transplanted into the muscle ofthe upper limbs of animal Briefly the rabbits were anaes-thetizedwith intraperitoneal injection of 36 chloral hydrate(2mLkg) The skin and subcutaneous tissue of both upperlimbs were incised and then the sarcolemma and musclewere bluntly dissected by Wallerian clamp Muscle bag with1 times 1 times 1 cm volume was enlarged by forceps for engineeredbone transplantation After operation the rabbits receiveddaily injections of amoxicillin (dosage at 20mg) for 3 days

29 Immunohistochemistry (IHC) At 14 28 and 60 days aftertransplantation the rabbits in engineering bone groups wereunder anesthesia and the engineering bones were isolatedfor IHC analysis After anesthesia with 36 chloral hydratetransplanted engineering bones were carefully isolated andfixed in 4 paraformaldehyde solution They were then

4 BioMed Research International

CD34

CD133

vWF

(a)

CD29

CD90

CD34

(b)

Figure 1 Characterization of EPCs and BMSCs by immunofluorescence staining (a) IF analysis for EPCs cell surfacemarkers CD34 CD133and vWF (red) nucleuses were stained byDAPI (blue)Magnifications 100x scale bar 100 120583m (b) IF analysis for BMSCs cell surfacemarkersCD29 CD90 (red Magnifications 100x and scale bar 100 120583m) and CD34 (green) nucleuses were stained by DAPI (blue) (Magnifications400x scale bar 25 120583m)

embedded with resin Sections of 4 120583m thickness were cutin a hard tissue microtome collected and flatted in waterbath at 60∘C dredged on slide and baked in oven at50∘C The following protocol was described as others [25]After immersing in 001M PBS (containing 5 goat serumand 03 TritonX-100 solution) at 37∘C for 30min theywere subsequently incubated at 4∘C overnight with 2 goatserum containing goat polyclonal antibodies CD34 (1 800)CD105 (endoglin) (1 1000 Santa Cruz) or ZO-1 (Zonulaoccludens-1) (1 500 Santa Cruz) respectively Immunoreac-tive products were observed and photographed with a lightmicroscope coupled with a computer assisted video camera(Leica DMIRB Germany)

210 Scanning Electron Microscope (SEM) Field EmissionSEM S-4800 (Hitachi Japan) was employed to characterizethe PDPBB as well as the morphology and behavior of thecells grown in the PDPBB Prior to imaging the cells werefixed with 25 glutaraldehyde and samples were dehydratedin a graded ethanol series and sputter-coated with gold for15ndash20 s All samples were analyzed at 15 kV [26]

211 Statistical Analysis SPSS v145 (SPSS Inc Chicago IL)was used for statistical analysis Data are presented as meansplusmn standard deviation (SD) Two-way ANOVA were used todetermine statistically significant differences between groupsfollowed by Bonferroni posttests A 119875 value of less than 005was considered statistically significant (119875 lt 005)

3 Result

31 Isolation and Characterization of MSCs and EPCs Thecells were analyzed and identified by IF staining for EPCs

and BMSCs cell surface markers at passage 3 For EPCs weanalyzed the early hematopoietic progenitor cell marker byIF Results showed that EPCs expressed a cell surface proteinprofile positive for CD34 CD133 and vWF (Figure 1(a) andSupplemental Data Figure S3) As shown in Figure 1(b)BMSCs expressed a cell surface protein profile positive forCD29 and CD90 and negative for CD34 IF staining showedthat EPCs were CD34+CD133+vWF+ while BMSCs wereCD29+CD90+CD34minus

32 Effect of Cocultured System on ALP Activity At 3 daysALP stain was present negative either in EPCs group or inBMSCs group while it showed partially positive staining incocultured group At 7 days ALP stain of the EPCs groupstill appeared negative However positive cells were presentin either BMSCs or coculture group Moreover there weremore positive cells observed in the coculture group comparedto that of BMSCs group (Figure 2(a) and Supplemental DataFigure S4) At 14 days deep ALP stain was observed inconfluent cells in coculture group while light stained cellsof ALP were scattered in BMSCs only group Till 14 daysthere were noALP positive cells observed in EPCs only group(Figure 2(a))

Quantitive analysis in ALP content by CurveExpert 14softwarewas performedThe results showed that ALP contentof BMSCs and coculture group increased gradually from 3to 14 days after culture and the level peaked in coculturegroup at 14 days when compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 2(b)) In EPCs groupthe ALP level revealed no significant difference between eachtime point (119875 gt 005) Through the whole experimentalperiod content of ALP detected in coculture group was morecompared to BMSCs only group (119875 lt 005 Figure 2(b))

BioMed Research International 5

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowast lowastlowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

05

1

15

2

25

3

ALP

conc

entr

atio

n (U

L)

EPCs

(d)

BMSCsCoculture system

3 7 14

(b)

Figure 2 ALP analysis in three groups after 3 7 and 14 days of cell culture (a) ALP staining in EPCs BMSCs and cocultured groupsMagnifications 400x scale bar 25 120583m (b) ALP content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowastlowast lowast

amp

ampamp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

25

30

35

OC

conc

entr

atio

n (U

L)

3 7 14

EPCs

(d)

BMSCsCoculture system

(b)

Figure 3 OC analysis in three groups after 3 7 and 14 days of cell culture (a) OC staining in EPCs BMSCs and cocultured groupsMagnifications 200x scale bar 50 120583m (b) OC content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

33 Effect of Cocultured System on OC Expression At 3 daysno OC stain was detected in three groups At 7 days therewere partially positive staining in cocultured group and lightpink in BMSCs group OC stain of the EPCs group stillappeared negative At 14 days confluent OC positive cellswere observed in coculture group while light stained cellsof OC were scattered in BMSCs only group Moreover fewcalcium nodes were also observed in the coculture group butnot in BMSCs alone one There were no positive OC stainingcells observed in EPCs only group until 14 days (Figure 3(a))

The OC content of each group increased gradually from7 to 14 days and the level of OC was the highest in coculturegroup on each time point compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 3(b)) There are sta-tistically significant differences between each group

34 Alteration in mRNA Expression of Osteoblast and Angio-genesis Genes ThemRNA levels of VEGFOsteonectin Oste-opontin and Collagen Type I detected by qRT-PCR weregradually increased from 3 to 7 to 14 days Compared to

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 3

Table 1 Primer and PCR conditions used for qRT-PCR

Genes Primer sequence Lengths of products

VEGF Forward 51015840 GAAGAAGGAGACAATAAACCC 31015840Reversal 51015840 ACCAGAGGCACGCAGGAA 31015840 152 bp

Osteopontin Forward 51015840 GCTCAGCACCTGAATGTACC 31015840Reversal 51015840 CTTCGGCTCGATGGCTAGC 31015840 247 bp

Osteonectin Forward 51015840 CTCCAGCTGGACTACATCG 31015840Reversal 51015840 CTCCATGGGGATGAGTGGT 31015840 369 bp

Collagen Type I Forward 51015840 TCAACGGTGCTCCTGGTGAAG 31015840Reversal 51015840 GGACCTTGGCTACCCTGAGAA 31015840 514 bp

120573-actin Forward 51015840 GCTCGTCGTCGACAACGGCTC 31015840Reversal 51015840 CAAACATGATCTGGGTCATCTTCTC 31015840 353 bp

synthesized by using Oligo(dT)18 and MMLV reverse tran-scriptase (Promega Madison WI) Gene primers were syn-thesized by Shengon Ltd Company (Shanghai China) Theprimers were recorded in Table 1 qRT-PCR protocol wasapplied using ABI 5700 instrument (Bio-Rad LaboratoriesShanghai China) The melting curve analysis was performedto confirm the specificity of the amplification products PCRwas performed by the denaturation step at 95∘C for 3minutesfollowed by 35 cycles of 95∘C for 15 seconds annealing for15 seconds and 72∘C for 30 seconds Fluorescent signalsobtained from PCR products were recorded at 855∘C for5 seconds Relative CT method was employed to comparedifference between samples The fold decreaseincrease wasdetermined relative to a blank control after normalizing to ahousekeeping gene using 2minusΔΔCT [20]

26 Osteoblast Identification by ALP Staining and OC AssayOsteoblasts were identified by using an ALP (Jackson USA)or OC (Jackson USA) staining kit according to the manufac-turerrsquos instructions and osteogenic differentiation of EPCsBMSCs and coculture system was confirmed The stainedcells were then photographed with a camera [21]

The levels of ALP and OC were determined accordingto the manufacturerrsquos instructions (Jackson USA) In orderto normalize these markers expressions for quantificationmedium supernatant from each subgroup was collected toevaluate the ALP and OC levels at the same density of 1times 107 cells per well After 3 7 or 14 days of culture themedium supernatant from each groupwas collected and usedto evaluate the ALP and OC level [21] The OD was read at450 nmusing ELISA plate reader (Bio-Rad) All samples wereassayed in duplicate

27 Reconstruction of Biologic Bone Seeded with Cells ThePDPBB treated with fibronectin [22 23] was preparedfrom fresh porcine spine bone modified with fibronectin asdescribed in Table 2 A total of 168 pieces of PDPBB withsize of 05 times 05 times 01 cm each were prewetted with mediumsolutions for 30min

Rabbit pure EPCs (05times 106mL 30 120583L EPCs) BMSCs (05times 106mL 30 120583LBMSCs) and coculture system (20120583LBMSCs+ 10 120583L EPCs) were seeded into PDPBB to reconstruct tissue-engineered bone in vitro respectively [20 24] The optimal

Table 2 Preparation of partially deproteinized bone

Reagenttreatment Processing time Temperature30 H

2O2

72 hlowast RTDistilled water 30min RTEthanol 24 h RTDistilled water 30min RTAcetone 24 h RTDistilled water 30min RTDying oven 8 h RTlowast30H2O2 is changed every 24 h during 72 hRT room temperature

cells seeding density described above achieved an excellentadhesion and proliferation activity on PDPBB [24]

The proliferation of EPCs BMSCs or cocultured systemseeded on PDPBB was also determined by Wst-1 assay Coc-ulture seeded group achieved the most excellent proliferationactivity among the groups and was significantly differentcompared to others (Supplemental Data Figure S2)

28 PDPBB Transplantation The twelve rabbits above fromwhich we extracted peripheral blood and bone marrow forcell culture underwent the surgery of PDPBB transplantedback into their bodyThe engineering bone groups includingPDPBB + EPCs PDPBB + BMSCs and PDPBB + coculturesystem were respectively transplanted into the muscle ofthe upper limbs of animal Briefly the rabbits were anaes-thetizedwith intraperitoneal injection of 36 chloral hydrate(2mLkg) The skin and subcutaneous tissue of both upperlimbs were incised and then the sarcolemma and musclewere bluntly dissected by Wallerian clamp Muscle bag with1 times 1 times 1 cm volume was enlarged by forceps for engineeredbone transplantation After operation the rabbits receiveddaily injections of amoxicillin (dosage at 20mg) for 3 days

29 Immunohistochemistry (IHC) At 14 28 and 60 days aftertransplantation the rabbits in engineering bone groups wereunder anesthesia and the engineering bones were isolatedfor IHC analysis After anesthesia with 36 chloral hydratetransplanted engineering bones were carefully isolated andfixed in 4 paraformaldehyde solution They were then

4 BioMed Research International

CD34

CD133

vWF

(a)

CD29

CD90

CD34

(b)

Figure 1 Characterization of EPCs and BMSCs by immunofluorescence staining (a) IF analysis for EPCs cell surfacemarkers CD34 CD133and vWF (red) nucleuses were stained byDAPI (blue)Magnifications 100x scale bar 100 120583m (b) IF analysis for BMSCs cell surfacemarkersCD29 CD90 (red Magnifications 100x and scale bar 100 120583m) and CD34 (green) nucleuses were stained by DAPI (blue) (Magnifications400x scale bar 25 120583m)

embedded with resin Sections of 4 120583m thickness were cutin a hard tissue microtome collected and flatted in waterbath at 60∘C dredged on slide and baked in oven at50∘C The following protocol was described as others [25]After immersing in 001M PBS (containing 5 goat serumand 03 TritonX-100 solution) at 37∘C for 30min theywere subsequently incubated at 4∘C overnight with 2 goatserum containing goat polyclonal antibodies CD34 (1 800)CD105 (endoglin) (1 1000 Santa Cruz) or ZO-1 (Zonulaoccludens-1) (1 500 Santa Cruz) respectively Immunoreac-tive products were observed and photographed with a lightmicroscope coupled with a computer assisted video camera(Leica DMIRB Germany)

210 Scanning Electron Microscope (SEM) Field EmissionSEM S-4800 (Hitachi Japan) was employed to characterizethe PDPBB as well as the morphology and behavior of thecells grown in the PDPBB Prior to imaging the cells werefixed with 25 glutaraldehyde and samples were dehydratedin a graded ethanol series and sputter-coated with gold for15ndash20 s All samples were analyzed at 15 kV [26]

211 Statistical Analysis SPSS v145 (SPSS Inc Chicago IL)was used for statistical analysis Data are presented as meansplusmn standard deviation (SD) Two-way ANOVA were used todetermine statistically significant differences between groupsfollowed by Bonferroni posttests A 119875 value of less than 005was considered statistically significant (119875 lt 005)

3 Result

31 Isolation and Characterization of MSCs and EPCs Thecells were analyzed and identified by IF staining for EPCs

and BMSCs cell surface markers at passage 3 For EPCs weanalyzed the early hematopoietic progenitor cell marker byIF Results showed that EPCs expressed a cell surface proteinprofile positive for CD34 CD133 and vWF (Figure 1(a) andSupplemental Data Figure S3) As shown in Figure 1(b)BMSCs expressed a cell surface protein profile positive forCD29 and CD90 and negative for CD34 IF staining showedthat EPCs were CD34+CD133+vWF+ while BMSCs wereCD29+CD90+CD34minus

32 Effect of Cocultured System on ALP Activity At 3 daysALP stain was present negative either in EPCs group or inBMSCs group while it showed partially positive staining incocultured group At 7 days ALP stain of the EPCs groupstill appeared negative However positive cells were presentin either BMSCs or coculture group Moreover there weremore positive cells observed in the coculture group comparedto that of BMSCs group (Figure 2(a) and Supplemental DataFigure S4) At 14 days deep ALP stain was observed inconfluent cells in coculture group while light stained cellsof ALP were scattered in BMSCs only group Till 14 daysthere were noALP positive cells observed in EPCs only group(Figure 2(a))

Quantitive analysis in ALP content by CurveExpert 14softwarewas performedThe results showed that ALP contentof BMSCs and coculture group increased gradually from 3to 14 days after culture and the level peaked in coculturegroup at 14 days when compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 2(b)) In EPCs groupthe ALP level revealed no significant difference between eachtime point (119875 gt 005) Through the whole experimentalperiod content of ALP detected in coculture group was morecompared to BMSCs only group (119875 lt 005 Figure 2(b))

BioMed Research International 5

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowast lowastlowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

05

1

15

2

25

3

ALP

conc

entr

atio

n (U

L)

EPCs

(d)

BMSCsCoculture system

3 7 14

(b)

Figure 2 ALP analysis in three groups after 3 7 and 14 days of cell culture (a) ALP staining in EPCs BMSCs and cocultured groupsMagnifications 400x scale bar 25 120583m (b) ALP content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowastlowast lowast

amp

ampamp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

25

30

35

OC

conc

entr

atio

n (U

L)

3 7 14

EPCs

(d)

BMSCsCoculture system

(b)

Figure 3 OC analysis in three groups after 3 7 and 14 days of cell culture (a) OC staining in EPCs BMSCs and cocultured groupsMagnifications 200x scale bar 50 120583m (b) OC content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

33 Effect of Cocultured System on OC Expression At 3 daysno OC stain was detected in three groups At 7 days therewere partially positive staining in cocultured group and lightpink in BMSCs group OC stain of the EPCs group stillappeared negative At 14 days confluent OC positive cellswere observed in coculture group while light stained cellsof OC were scattered in BMSCs only group Moreover fewcalcium nodes were also observed in the coculture group butnot in BMSCs alone one There were no positive OC stainingcells observed in EPCs only group until 14 days (Figure 3(a))

The OC content of each group increased gradually from7 to 14 days and the level of OC was the highest in coculturegroup on each time point compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 3(b)) There are sta-tistically significant differences between each group

34 Alteration in mRNA Expression of Osteoblast and Angio-genesis Genes ThemRNA levels of VEGFOsteonectin Oste-opontin and Collagen Type I detected by qRT-PCR weregradually increased from 3 to 7 to 14 days Compared to

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 BioMed Research International

CD34

CD133

vWF

(a)

CD29

CD90

CD34

(b)

Figure 1 Characterization of EPCs and BMSCs by immunofluorescence staining (a) IF analysis for EPCs cell surfacemarkers CD34 CD133and vWF (red) nucleuses were stained byDAPI (blue)Magnifications 100x scale bar 100 120583m (b) IF analysis for BMSCs cell surfacemarkersCD29 CD90 (red Magnifications 100x and scale bar 100 120583m) and CD34 (green) nucleuses were stained by DAPI (blue) (Magnifications400x scale bar 25 120583m)

embedded with resin Sections of 4 120583m thickness were cutin a hard tissue microtome collected and flatted in waterbath at 60∘C dredged on slide and baked in oven at50∘C The following protocol was described as others [25]After immersing in 001M PBS (containing 5 goat serumand 03 TritonX-100 solution) at 37∘C for 30min theywere subsequently incubated at 4∘C overnight with 2 goatserum containing goat polyclonal antibodies CD34 (1 800)CD105 (endoglin) (1 1000 Santa Cruz) or ZO-1 (Zonulaoccludens-1) (1 500 Santa Cruz) respectively Immunoreac-tive products were observed and photographed with a lightmicroscope coupled with a computer assisted video camera(Leica DMIRB Germany)

210 Scanning Electron Microscope (SEM) Field EmissionSEM S-4800 (Hitachi Japan) was employed to characterizethe PDPBB as well as the morphology and behavior of thecells grown in the PDPBB Prior to imaging the cells werefixed with 25 glutaraldehyde and samples were dehydratedin a graded ethanol series and sputter-coated with gold for15ndash20 s All samples were analyzed at 15 kV [26]

211 Statistical Analysis SPSS v145 (SPSS Inc Chicago IL)was used for statistical analysis Data are presented as meansplusmn standard deviation (SD) Two-way ANOVA were used todetermine statistically significant differences between groupsfollowed by Bonferroni posttests A 119875 value of less than 005was considered statistically significant (119875 lt 005)

3 Result

31 Isolation and Characterization of MSCs and EPCs Thecells were analyzed and identified by IF staining for EPCs

and BMSCs cell surface markers at passage 3 For EPCs weanalyzed the early hematopoietic progenitor cell marker byIF Results showed that EPCs expressed a cell surface proteinprofile positive for CD34 CD133 and vWF (Figure 1(a) andSupplemental Data Figure S3) As shown in Figure 1(b)BMSCs expressed a cell surface protein profile positive forCD29 and CD90 and negative for CD34 IF staining showedthat EPCs were CD34+CD133+vWF+ while BMSCs wereCD29+CD90+CD34minus

32 Effect of Cocultured System on ALP Activity At 3 daysALP stain was present negative either in EPCs group or inBMSCs group while it showed partially positive staining incocultured group At 7 days ALP stain of the EPCs groupstill appeared negative However positive cells were presentin either BMSCs or coculture group Moreover there weremore positive cells observed in the coculture group comparedto that of BMSCs group (Figure 2(a) and Supplemental DataFigure S4) At 14 days deep ALP stain was observed inconfluent cells in coculture group while light stained cellsof ALP were scattered in BMSCs only group Till 14 daysthere were noALP positive cells observed in EPCs only group(Figure 2(a))

Quantitive analysis in ALP content by CurveExpert 14softwarewas performedThe results showed that ALP contentof BMSCs and coculture group increased gradually from 3to 14 days after culture and the level peaked in coculturegroup at 14 days when compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 2(b)) In EPCs groupthe ALP level revealed no significant difference between eachtime point (119875 gt 005) Through the whole experimentalperiod content of ALP detected in coculture group was morecompared to BMSCs only group (119875 lt 005 Figure 2(b))

BioMed Research International 5

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowast lowastlowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

05

1

15

2

25

3

ALP

conc

entr

atio

n (U

L)

EPCs

(d)

BMSCsCoculture system

3 7 14

(b)

Figure 2 ALP analysis in three groups after 3 7 and 14 days of cell culture (a) ALP staining in EPCs BMSCs and cocultured groupsMagnifications 400x scale bar 25 120583m (b) ALP content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowastlowast lowast

amp

ampamp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

25

30

35

OC

conc

entr

atio

n (U

L)

3 7 14

EPCs

(d)

BMSCsCoculture system

(b)

Figure 3 OC analysis in three groups after 3 7 and 14 days of cell culture (a) OC staining in EPCs BMSCs and cocultured groupsMagnifications 200x scale bar 50 120583m (b) OC content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

33 Effect of Cocultured System on OC Expression At 3 daysno OC stain was detected in three groups At 7 days therewere partially positive staining in cocultured group and lightpink in BMSCs group OC stain of the EPCs group stillappeared negative At 14 days confluent OC positive cellswere observed in coculture group while light stained cellsof OC were scattered in BMSCs only group Moreover fewcalcium nodes were also observed in the coculture group butnot in BMSCs alone one There were no positive OC stainingcells observed in EPCs only group until 14 days (Figure 3(a))

The OC content of each group increased gradually from7 to 14 days and the level of OC was the highest in coculturegroup on each time point compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 3(b)) There are sta-tistically significant differences between each group

34 Alteration in mRNA Expression of Osteoblast and Angio-genesis Genes ThemRNA levels of VEGFOsteonectin Oste-opontin and Collagen Type I detected by qRT-PCR weregradually increased from 3 to 7 to 14 days Compared to

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 5

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowast lowastlowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

05

1

15

2

25

3

ALP

conc

entr

atio

n (U

L)

EPCs

(d)

BMSCsCoculture system

3 7 14

(b)

Figure 2 ALP analysis in three groups after 3 7 and 14 days of cell culture (a) ALP staining in EPCs BMSCs and cocultured groupsMagnifications 400x scale bar 25 120583m (b) ALP content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

EPCs BMSCs Coculture

3d

7d

14d

(a)

lowastlowast lowast

amp

ampamp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

25

30

35

OC

conc

entr

atio

n (U

L)

3 7 14

EPCs

(d)

BMSCsCoculture system

(b)

Figure 3 OC analysis in three groups after 3 7 and 14 days of cell culture (a) OC staining in EPCs BMSCs and cocultured groupsMagnifications 200x scale bar 50 120583m (b) OC content evaluated by quantitive analysis Values plotted are means plusmn SD (119899 = 6) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

33 Effect of Cocultured System on OC Expression At 3 daysno OC stain was detected in three groups At 7 days therewere partially positive staining in cocultured group and lightpink in BMSCs group OC stain of the EPCs group stillappeared negative At 14 days confluent OC positive cellswere observed in coculture group while light stained cellsof OC were scattered in BMSCs only group Moreover fewcalcium nodes were also observed in the coculture group butnot in BMSCs alone one There were no positive OC stainingcells observed in EPCs only group until 14 days (Figure 3(a))

The OC content of each group increased gradually from7 to 14 days and the level of OC was the highest in coculturegroup on each time point compared to EPCs or BMSCs onlygroup respectively (119875 lt 005 Figure 3(b)) There are sta-tistically significant differences between each group

34 Alteration in mRNA Expression of Osteoblast and Angio-genesis Genes ThemRNA levels of VEGFOsteonectin Oste-opontin and Collagen Type I detected by qRT-PCR weregradually increased from 3 to 7 to 14 days Compared to

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 BioMed Research International

0

5

10

15

20

3 7 14(d)

EPCsBMSCsCoculture system

mRN

A le

vels

of V

EGF

eval

uate

d by

2minusΔΔ

CT

lowast amp

lowast amp

lowastamp

lowastamp

lowastamp

lowastamp

(a)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steon

ectin

eval

uate

dby

2minusΔΔ

CT

(b)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of O

steop

ontin

eval

uate

dby

2minusΔΔ

CT

(c)

lowast

lowast

lowast

amp

amp

amp

lowastamp

lowastamp

lowastamp

0

5

10

15

20

EPCsBMSCsCoculture system

3 7 14(d)

mRN

A le

vels

of C

olla

gen

Type

I ev

alua

ted

by2minusΔΔ

CT

(d)

Figure 4 mRNA expression of genes associated with osteoblast and angiogenesis Relative mRNA levels of VEGF (a) Osteonectin (b)Osteopontin (c) and Collagen Type I (d) evaluated by qRT-PCR in three different groups Values plotted are means plusmn SD (119899 = 7) lowast119875 lt 005versus BMSCs group amp119875 lt 005 versus EPCs group 119875 lt 005 versus coculture group

BMSCs or EPCs alone group there were increased VEGFOsteonectin Osteopontin and Collagen Type I mRNA levelsdetected in cocultured group (119875 lt 005 Figure 4)

As shown in Figure 4 compared to BMSCs group thelevel of VEGF gene was upregulated significantly in cocul-tured or EPCs group (119875 lt 005) However there was no sig-nificant difference between cocultured and EPCs group at 3days (119875 gt 005) From 7 to 14 days the cocultured system hadsignificant advantages of upregulating the mRNA expressionof VEGF compared to the EPCs alone group (119875 lt 005Figure 4(a))

At 3 days the mRNA expression of Collagen Type I wasupregulated significantly in cocultured or BMSCs group (119875 lt005) From 7 to 14 days the cocultured system had signif-icant advantages of upregulating the mRNA expression ofCollagenType I compared to the BMSCs or EPCs alone group

(119875 lt 005) There was no significant difference betweenBMSCs and EPCs group (119875 gt 005 Figure 4(d)) A similartendency was observed in the expression of Osteopontin andOsteonectin genes in three groups (Figures 4(b) and 4(c))

35 The Morphology of Cells on Heterotopia Bone GraftingIn PDPBB seeded with EPCs few polygonal endotheliocytesattached to the surface of PDPBB under SEM It could beobserved that flat cells with irregular shape attached to thesurface of PDPBB + BMSCs by pseudopodia The BMSCswere scattered and spread on the PDPBB surface Of notecompared to other PDPBB + EPCs or PDPBB + BMSCs onlya large number of cocultured cells appeared better adheredand significantly grown in number to link as flakiness on thesurface of the PDPBB + cocultured system (Figure 5)

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 7

(a) (b)

(c) (d)

(e) (f)

Figure 5 Representative SEM micrographs of PDPBB seeded with different cells The micrographs show the proliferation and spreading ofcocultured EPCs and BMSCs ((e) and (f)) after seeding in PDPBB scaffolds ((a) and (b)) PDPBB with EPCs alone ((c) and (d)) PDPBB withBMSCs alone ((e) and (f)) PDPBB with cocultured EPCs and BMSCs Scale bar (a) (b) (e) and (f) 15 120583m and (c) and (d) 5 120583m

36 Effect of Cocultured EPCs and BMSCs on MicrovascularAngiogenesis The microvascular vascularization after bio-logical bone transplantation in vivo was observed by IHCstaining of CD34 CD105 and ZO-1 respectively At 14 daysafter transplantation granulation tissues grew into the cavityof engineering bone grafting There were some positive cellsand microvascular structures observed in group EPCs andfewer positive cells were observed in BMSCs group andmicrovascular structures were observed in this group Theexpressions of CD34 CD105 and ZO-1 kept the highestin cocultured group which showed significant differencecompared with the control groups (119875 lt 005 Figure 6)

At 14 dpo IHC positive OD for CD34 in three groups wasgradually increasing from 14 to 28 to 60 dpo Compared toBMSCs or EPCs group theOD level of CD34was upregulatedsignificantly in cocultured group at 14 28 and 60 dporespectively (119875 lt 005) There was higher OD of CD34 inEPCs group than BMSCs group from 14 to 60 dpo (119875 lt 005Figure 6) A similar tendency was observed in detection ofOD level for CD105 and ZO-1 IHC (Figures 7 and 8 resp)

4 Discussion

The present data demonstrated that coculture system com-bined with BMSCs and EPCs had significant advantages of(i) upregulating themRNA expression of VEGF OsteonectinOsteopontin andCollagenType I and (ii) increasingALP and

OC amount compared to either of the BMSCs or EPCs onlygroup in vitro Moreover IHC staining for CD105 CD34 andZO-1 increased significantly in the implanted PDPBB seededwith coculture system BMSCs and EPCs compared to thatseeded with BMSCs or EPCs only following transplantationThe above results revealed that combination of PDPBB withBMSCs and EPCs promoted osteoblast and angiogenesis invitro and in vivo

Evidences reveal that VEGF as a key angiogenic andparacrine angiogenic factor has the ability to (i) simultane-ously promote osteogenesis and angiogenesis [27 28] (ii)specifically target vascular endothelial cells and subsequentlyinduced endothelial angiogenesis [29 30] (iii) increase thepermeability of small veins and venules [31] It is wellknown that ALP Collagen Type I and Osteonectin are themajor biological markers in osteoblasts differentiation Ourstudy showed that ALP activity increased significantly bythe coculture of BMSCs and EPCs compared to BMSCs orEPCs alone Moreover the staining of Collagen Type I andOsteonectin was remarkably upregulated by the combinationof BMSCs and EPCs compared to that of BMSCs or EPCsalone Given those the present results showed that therewas apositive effect of cocultured systemon themRNAand proteinexpression of ALP OC VEGF Collagen Type I Osteopon-tin and Osteonectin which suggested that combination ofBMSCs and EPCs would induce osteoblast proliferationenhancing angiogenic factor expression better compared to

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

8 BioMed Research International

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amp

lowastamp

lowastamplowastamp

0

01

02

03

IHC

for C

D34

(d)

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

14 28 60

(b)

Figure 6 IHCdetection and quantitive analysis of CD34 in PDPBB groups after implantation (a) CD34 staining in PDPBB seededwith EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of CD34 staining in three groups after implantation Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versusPDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB + coculture group

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

amp amp

amplowastamp

lowastamplowastamp

0

01

02

03

14 28 60

IHC

for C

D10

5

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 7 IHC detection and quantitive analysis of CD105 in PDPBB groups after implantation (a) CD105 staining in PDPBB seeded withEPCs BMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB +cocultured system (b)Quantitive analysis of CD105 staining in three groups after implantation Arrow showed the representative IHC stainingof CD105 Values plotted are means plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group119875 lt 005 versus PDPBB + coculture group

BMSCs or EPCs alone In cocultured system EPCs enhancedthe osteogenesis ability of BMSCs significantly

The present data also demonstrated that IHC positivestaining for CD105 CD34 and ZO-1 significantly increasedin the implanted PDPBB seeded with coculture BMSCs andEPCs compared to that with BMSCs or EPCs only group

respectively FurthermoreODvalues of the selected endothe-lial cell (EC) and angiogenesis markers CD105 CD34 andZO-1 increased from 14 to 28 to 60 dpo in coculture systemPrevious study showed that in normal human tissues CD34was EC marker in various vascular beds [32] while ZO-1modulated cellular migration and angiogenesis via paracrine

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 9

B + EPCs B + BMSCs B + coculture

14d

28d

60d50120583m

(a)

lowast

lowast

lowast

ampamp

amp

lowastamp

lowastamp

lowastamp

0

01

02

03

14 28 60

IHC

for Z

O-1

PDPBB + EPCsPDPBB + BMSCsPDPBB + coculture system

(d)

(b)

Figure 8 IHC detection and quantitive analysis of ZO-1 in PDPBB groups after implantation (a) ZO-1 staining in PDPBB seeded with EPCsBMSCs and cocultured groups respectively B + EPCs PDPBB + EPCs B + BMSCs PDPBB + BMSCs B + coculture PDPBB + coculturedsystem (b) Quantitive analysis of ZO-1 staining in three groups after implantation Arrow showed the representative IHC files of ZO-1 Valuesplotted aremeans plusmn SD (119899 = 3) lowast119875 lt 005 versus PDPBB + BMSCs group amp119875 lt 005 versus PDPBB + EPCs group 119875 lt 005 versus PDPBB+ coculture group

regulation by miR-191 [33] Reports revealed that CD105a hypoxia-inducible protein associated with proliferationabundantly located in angiogenic endothelial cells was apromising vascular target used for angiogenic diseases [34]

Abundant studies have demonstrated that EPCs whichcan differentiate into endothelial cells play an indispensablerole in neovascularization and vascular maintenance andrepair Factors generated by endothelial cells are also con-sidered crucial for the process of osteogenesis [35] Previousdata also demonstrated that coimplanted EPCs with MSCsincreased neovascularization and the capillary score as com-pared to the MSC only group which enhanced regenerationof tissue-engineered bone [35] Reasonably the present datademonstrated EPCs and BMSCs mutually promoted abilityin neovascularization in the cocultured system and endowedPDPBBwith the angiogenesis ability by releasing chemotacticfactors [36]

It is demonstrated that combination of three key regener-ative factors including a scaffold reparative cells and growthfactors is crucial for efficient restoring of bone defectsNowadays a number of biomaterials have been innovatedimproved and applied clinically as promising scaffolds forengineering bone [37 38] As typical reparative cells EPCsand BMSCs have been recently determined as potentialelements applied to regeneration and repair of tissue afterdefection [37] Promising advanced scaffold systems utilisedin engineering bone should enable bone defect repairing withfewer scars decreasedmorbidity and reject rate and less painand less disruption of the soft tissue envelope For this reasonthe engineering scaffolds should be developed to bemoldablebiodegradable and injectable [37] PDPBB designed in thisresearch and seeded with BMSCs and EPCs appeared more

biodegradable moldable and injectable than with BMSCsorand EPCs alone Further SEM micrograph demonstratedthat in contrast to EPCs or BMSCs alone seeded in PDPBBcocultured cells in PDPBB were well attached and spreadthroughout the scaffold These results indicated that thePDPBBwith cocultured systempossessed favorable cytocom-patibility and provided suitable circumstances for cell growth

5 Conclusions

In conclusion the present study provided evidence that thecombination of PDPBB with BMSCs and EPCs promotedosteoblast and angiogenesis The implanted PDPBB seededwith BMSCs and EPCs might accelerate bone healing by pro-moting vascularized biological bone regeneration Accordingto the presented data we propose that this scaffold system hasthe potential to provide reconstruction for patients sufferingfrom bone defection Our findings showed that coculturingBMSCs and peripheral blood derived EPCs may prove usefulfor generating osteogenic and vascularized bone tissue forclinical use

Abbreviations

BMSCs Bone marrow stromal cellsEPCs Endothelial progenitor cells

PDPBB Partially deproteinized biologicbone

IHC ImmunohistochemistryIF Immunofluorescence

qRT-PCR Quantitive real-time polymerasechain reaction

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

10 BioMed Research International

ALP Alkaline phosphataseOC Osteocalcin

VEGF Vascular endothelial cell growthfactor

CD34 Hematopoietic progenitor antigenCD133 PROM1vWF von Willebrand FactorCD29 Integrin beta-1CD90 Thy-1OD Optical densitySEM Scanning electron microscope

Competing Interests

There are no competing interests

Authorsrsquo Contributions

Li Wu and Xian Zhao contributed equally to this paper

Acknowledgments

The authors thank the Labreal Bioscience and TechnologyLtd Company Kunming China for valuable contribution toparts of the experimental design

References

[1] B Samstein and J L Platt ldquoPhysiologic and immunologichurdles to xenotransplantationrdquo Journal of the American Societyof Nephrology vol 12 no 1 pp 182ndash193 2001

[2] G FMuschler YMatsukura H Nitto et al ldquoSelective retentionof bonemarrow-derived cells to enhance spinal fusionrdquoClinicalOrthopaedics and Related Research no 432 pp 242ndash251 2005

[3] Z Hong R L Reis and J F Mano ldquoPreparation and in vitrocharacterization of scaffolds of poly(l-lactic acid) containingbioactive glass ceramic nanoparticlesrdquo Acta Biomaterialia vol4 no 5 pp 1297ndash1306 2008

[4] X Li J Shi X Dong L Zhang and H Zeng ldquoA mesoporousbioactive glasspolycaprolactone composite scaffold and its bio-activity behaviorrdquo Journal of Biomedical Materials Research Avol 84 no 1 pp 84ndash91 2008

[5] Z He and L Xiong ldquoAssessment of cytocompatibility of bulkmodified poly-L-lactic acid biomaterialsrdquo PolymermdashPlasticsTechnology and Engineering vol 48 no 10 pp 1020ndash1024 2009

[6] F Xin C Jian R Jianming Z Zhongcheng and Z JianpengldquoPreparation and properties of poly(lactide-co-glycolide)bonemeals composite materialsrdquo PolymermdashPlastics Technology andEngineering vol 49 no 3 pp 309ndash315 2010

[7] E Jones and X Yang ldquoMesenchymal stem cells and bone regen-eration current statusrdquo Injury vol 42 no 6 pp 562ndash568 2011

[8] E Zomorodian and M Baghaban Eslaminejad ldquoMesenchymalstem cells as a potent cell source for bone regenerationrdquo StemCells International vol 2012 Article ID 980353 9 pages 2012

[9] N Rozen T Bick A Bajayo et al ldquoTransplanted blood-derivedendothelial progenitor cells (EPC) enhance bridging of sheeptibia critical size defectsrdquo Bone vol 45 no 5 pp 918ndash924 2009

[10] K Atesok R Li D J Stewart and E H Schemitsch ldquoEndothe-lial progenitor cells promote fracture healing in a segmental

bone defect modelrdquo Journal of Orthopaedic Research vol 28 no8 pp 1007ndash1014 2010

[11] K Eldesoqi C Seebach C N Ngoc et al ldquoHigh calcium bio-glass enhances differentiation and survival of endothelial pro-genitor cells inducing early vascularization in critical size bonedefectsrdquo PLoS ONE vol 8 no 11 Article ID e79058 2013

[12] C Mangano B Sinjari J A Shibli et al ldquoA Human clinicalhistological histomorphometrical and radiographical study onbiphasic ha-beta-tcp 3070 in maxillary sinus augmentationrdquoClinical Implant Dentistry and Related Research vol 17 no 3pp 610ndash618 2015

[13] E H C van Manen W Zhang X F Walboomers et al ldquoTheinfluence of electrospun fibre scaffold orientation and nano-hydroxyapatite content on the development of tooth bud stemcells in vitrordquo Odontology vol 102 no 1 pp 14ndash21 2014

[14] J Wiltfang N Jatschmann J Hedderich F W Neukam K ASchlegel and M Gierloff ldquoEffect of deproteinized bovine bonematrix coverage on the resorption of iliac cortico-spongeousbone graftsmdasha prospective study of two cohortsrdquo Clinical OralImplants Research vol 25 no 2 pp e127ndashe132 2014

[15] C Niehage C Steenblock T Pursche M Bornhauser DCorbeil and B Hoflack ldquoThe cell surface proteome of humanmesenchymal stromal cellsrdquo PLoS ONE vol 6 no 5 Article IDe20399 pp 1546ndash1651 2011

[16] X Ma Y Sun X Cheng et al ldquoRepair of osteochondral defectsby mosaicplasty and allogeneic BMSCs transplantationrdquo Inter-national Journal of Clinical and Experimental Medicine vol 8no 4 pp 6053ndash6059 2015

[17] R Kang Y Zhou S Tan et al ldquoMesenchymal stem cells derivedfrom human induced pluripotent stem cells retain adequateosteogenicity and chondrogenicity but less adipogenicityrdquo StemCell Research andTherapy vol 6 no 1 article 144 2015

[18] A K Gosain L Song P Yu et al ldquoOsteogenesis in cranialdefects reassessment of the concept of critical size and theexpression of TGF-120573 isoformsrdquo Plastic and Reconstructive Sur-gery vol 106 no 2 pp 360ndash371 2000

[19] Y-B XiYang B-T Lu Ya-Zhao et al ldquoExpressional differencedistributions of TGF-1205731 in TGF-1205731 knock down transgenicmouse and its possible roles in injured spinal cordrdquo Experimen-tal Biology and Medicine vol 239 no 3 pp 320ndash329 2014

[20] Q-S Wang Y Xiang Y-L Cui K-M Lin and X-F ZhangldquoDietary blue pigments derived from genipin attenuate inflam-mation by inhibiting LPS-induced iNOS andCOX-2 expressionvia the NF-120581B inactivationrdquo PLoS ONE vol 7 no 3 Article IDe34122 2012

[21] S Zong G Zeng B Zou et al ldquoEffects of Polygonatum sib-iricum polysaccharide on the osteogenic differentiation of bonemesenchymal stem cells in micerdquo International Journal ofClinical and Experimental Pathology vol 8 no 6 pp 6169ndash61802015

[22] Y L Li Z M Yang H Q Xie Y W Qin and F G Huang ldquoThepreparation and physicochemical property of the biologicalderivative tissue-engineered bonerdquo The Journal of BiomedicalEngineering vol 19 no 1 pp 10ndash12 2002

[23] G Cho Y Wu and J L Ackerman ldquoDetection of hydroxyl ionsin bone mineral by solid-state NMR spectroscopyrdquo Science vol300 no 5622 pp 1123ndash1127 2003

[24] X Han L Liu F Wang et al ldquoReconstruction of tissue-engi-neered bone with bone marrow mesenchymal stem cells andpartially deproteinized bone in vitrordquoCell Biology Internationalvol 36 no 11 pp 1049ndash1053 2012

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 11

[25] Y-B Xiyang S Liu J Liu et al ldquoRoles of platelet-derivedgrowth factor-B expression in the ventral horn and motorcortex in the spinal cord-hemisected rhesus monkeyrdquo Journalof Neurotrauma vol 26 no 2 pp 275ndash287 2009

[26] TWang X Yang X Qi and C Jiang ldquoOsteoinduction and pro-liferation of bone-marrow stromal cells in three-dimensionalpoly (120576-caprolactone)hydroxyapatitecollagen scaffoldsrdquo Jour-nal of Translational Medicine vol 13 article152 2015

[27] D Clark X Wang S Chang A Czajka-Jakubowska B HClarkson and J Liu ldquoVEGF promotes osteogenic differentia-tion of ASCs on ordered fluorapatite surfacesrdquo Journal of Bio-medical Materials Research Part A vol 103 no 2 pp 639ndash6452015

[28] Z Lin J-S Wang L Lin et al ldquoEffects of BMP2 and VEGF165on the osteogenic differentiation of rat bone marrow-derivedmesenchymal stem cellsrdquo Experimental and Therapeutic Medi-cine vol 7 no 3 pp 625ndash629 2014

[29] A Bikfalvi C Sauzeau H Moukadiri et al ldquoInteraction of vas-culotropinvascular endothelial cell growth factor with humanumbilical vein endothelial cells binding internalization degra-dation and biological effectsrdquo Journal of Cellular Physiology vol149 no 1 pp 50ndash59 1991

[30] N Ferrara and S Bunting ldquoVascular endothelial growth factora specific regulator of angiogenesisrdquo Current Opinion in Neph-rology and Hypertension vol 5 no 1 pp 35ndash44 1996

[31] H F Dvorak T M Sioussat L F Brown et al ldquoDistribution ofvascular permeability factor (vascular endothelial growth fac-tor) in tumors concentration in tumor blood vesselsrdquo Journalof Experimental Medicine vol 174 no 5 pp 1275ndash1278 1991

[32] M P PusztaszeriW Seelentag and F T Bosman ldquoImmunohis-tochemical expression of endothelial markers CD31 CD34 vonWillebrand factor and Fli-1 in normal human tissuesrdquo Journalof Histochemistry and Cytochemistry vol 54 no 4 pp 385ndash3952006

[33] S Dangwal B Stratmann C Bang et al ldquoImpairment of woundhealing in patients with type 2 diabetes mellitus influencescirculating microRNA patterns via inflammatory cytokinesrdquoArteriosclerosis Thrombosis and Vascular Biology vol 35 no6 pp 1480ndash1488 2015

[34] S E Duff C Li J M Garland and S Kumar ldquoCD105 is impor-tant for angiogenesis evidence and potential applicationsrdquoTheFASEB Journal vol 17 no 9 pp 984ndash992 2003

[35] K Usami H Mizuno K Okada et al ldquoComposite implan-tation of mesenchymal stem cells with endothelial progenitorcells enhances tissue-engineered bone formationrdquo Journal ofBiomedical Materials Research Part A vol 90 no 3 pp 730ndash741 2009

[36] C Seebach D Henrich K Wilhelm J H Barker and I MarzildquoEndothelial progenitor cells improve directly and indirectlyearly vascularization of mesenchymal stem cell-driven boneregeneration in a critical bone defect in ratsrdquo Cell Transplan-tation vol 21 no 8 pp 1667ndash1677 2012

[37] F Granero-Molto J A Weis L Longobardi and A SpagnolildquoRole of mesenchymal stem cells in regenerative medicineapplication to bone and cartilage repairrdquo Expert Opinion onBiological Therapy vol 8 no 3 pp 255ndash268 2008

[38] P C Bessa M Casal and R L Reis ldquoBone morphogenetic pro-teins in tissue engineering the road from laboratory to clinicpart II (BMPdelivery)rdquo Journal of Tissue Engineering andRegen-erative Medicine vol 2 no 2-3 pp 81ndash96 2008

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology