Research Article

The Jasmonate-responsive transcription factor CbWRKY24 regulates terpenoid biosynthetic genes to

promote saponin biosynthesis in Conyza blinii H.Lév.

Wen-Jun Sun1 • Jun-Yi Zhan1 • Tian-Run Zheng1 • Rong Sun1 • Tao-Wang1 • Zi-Zhong Tang1 •

Tong-Liang Bu1 • Cheng-Lei Li1 • Qi Wu1 • Hui Chen1*

1 College of life Science, Sichuan Agricultural University, No. 46, XinKang Road, 625014 Ya’ an,

Sichuan, China

*For correspondence. E-mail: chen62hui@163.com

Abstract

Conyza blinii H.Lév., whose the most effective component is saponin, is a biennial medicinal material

that needs to be overwintered. WRKY transcription factors family is a large protein superfamily that

plays a predominant role in plant secondary metabolism, but their characteristics and functions have

not been identified in Conyza blinii H.Lév. The CbWRKY24 sequence was selected from the

transcriptome database of the Conyza blinii H.Lév leaves constructed in our laboratory. Phylogenetic

tree analysis revealed that it was associated with AaWRKY1 which can regulate artemisinin synthesis in

Artemisia annua. Expression analysis in Conyza blinii H.Lév revealed that CbWRKY24 was mainly

induced by Methyl jasmonate (MeJA) and cold treatments. Transcriptional activity assay showed that it

had an independent biological activity. Overexpression of CbWRKY24 in transient transformed Conyza

blinii H.Lév. resulted in improved total saponins content, which was attributed to up-regulate the

expression level of keys genes from MVA pathway in transient transformed plants compared to wild

type (WT) plants. Meanwhile, overexpression the CbWRKY24 in transient transformed tomato fruits

showed that the transcript level of related genes in lycopene pathway decreased significantly compared

to WT tomato fruits. Additionally, the MeJA-response-element was found in the promoter regions of

CbWRKY24 and the histochemical staining experiments showed that promoter had GUS activity in

transiently transformed tobacco leaves. In summary, our results indicated that we may have found a

transcription factor that can regulate the biosynthesis of terpenoids in Conyza blinii H.Lév.

Keywords: Conyza blinii H.Lév; CbWRKY24 ; saponin; Methyl jasmonate

Introduction

Conyza blinii H.Lév. is a biennial medicinal plant belonging to compositae, which is distributed in

southwest China. Its dried aerial part used to treat some inflammatory diseases such as gastroenteritis

and chronic bronchitis in folk (Su et al. 2000). It has been found that its effective components are

diterpenoids, triterpenoids, and flavonoids (Yanfang Su et al. 2003). Blinin is an important diterpenoid

compound, which is a characteristic compound of Conyza blinii H.Lév. (Yang et al. 1989). According

to previous studies, Conyza blinii saponin has a strong protective effect on ethanol induced acute

gastric ulcer (Ma and Liu 2014). Subsequently, the saponin fraction isolated from Conyza blinii H.Lév.

was found to have excellent antitumor activity by inhibiting NF-KB signaling pathway (Ma et al. 2016).

In addition, some studies showed that Conyza blinii saponin can play an anti-cancer role in vivo and in

vitro in many ways (Ma et al. 2017).

Conyza blinii H.Lév. is a unique Chinese herbal medicine with good medicinal and economic

value in southwest China. However, the low content of terpenes seriously hampers the clinical

application of Conyza blinii H.Lév. Many studies have been devoted to elucidating the terpenoid

synthesis pathways of Conyza blinii H.Lév., so as to improve terpenoid contents by playing the role of

key enzyme genes (Sun et al. 2017). The MVA pathway in Conyza blinii H.Lév. formed the triterpenoid

compounds represented by oleanane type of triterpenoid saponins, and the MEP pathway formed the

diterpenoid compounds represented by blinin (Sun et al. 2017; Sykora and Legut 2015). Studies have

shown that the content of secondary metabolites in plants can be improved by overexpressing the

terpene synthase gene (Bansal et al. 2018; Yin et al. 2017), but sometimes the regulation effect of a

single enzyme gene is minimal (Carleton et al. 2017). Transcriptional factors can regulate the whole

metabolic pathway, so in recent years, it has attracted wide attention in the regulation of the growth,

development and the synthesis of effective components in plants (Dai et al. 2009; Huang et al. 2016;

YingkeZhao and Liu 2017; Zhu et al. 2012).

At present, the transcription factors that regulate terpenoid pathways are mainly found in the

AP2-ERF family, the WRKY family, the bZIP family and the bHLH family. The WRKY protein can

not only participate in plant growth regulation, but also play a necessary role in regulate plant

metabolic pathways (Li et al. 2012; Tang et al. 2014). In recent years, many WRKY transcription

factors that regulate effective components of medicinal plants have been isolated and identified (Chen

et al. 2017; Ma et al. 2009).

However, there are few studies on WRKY transcription factors regulating terpenoid pathways in

Conyza blinii H.Lév. Therefore, it is very necessary to isolate and identify these transcription factors

from the Conyza blinii H.Lév. In this study, based on the transcriptome database of Conyza blinii

H.Lév, a novel WRKY transcription factor (designated as CbWRKY24) that responds to MeJA was

isolated and characterized. Our results indicated that CbWRKY24 may improved the content of total

saponins through upregulating the expression level of multiple MVA pathway genes.

Materials and methods

Plant materials and stress conditions

Conyza blinii H.Lév. called ‘jin long dan cao’, was grown in a greenhouse at 25℃. Tobacco and

tomatoes plants were also grown in 25℃ chamber with 16 h light/8 h dark. Seedlings of Conyza blinii

H.Lév. were treated with the following conditions: 100 μM methyl jasmonate (MeJA), 100 μM abscisic

acid (ABA), 100 μM gibberellin (GA), and 4℃ (Shen et al. 2016; Xiong et al. 2013). The control group

was not treated with these hormones. The samples were collected at 0 h, 1 h, 3 h, 6 h, 12 h, 24 h, 36 h,

and 48 h, and quickly frozen in liquid nitrogen and stored at -80℃ for further analysis.

Isolation and phylogenetic analysis of CbWRKY24

Extraction of total RNA with an RNAout kit and reversed into cDNA with PrimeScript TM RT reagent

Kit (Takara, China). A novel WRKY gene (designated as CbWRKY24) was isolated from Conyza blinii

H.Lév. The complete amino acid sequences of CbWRKY24 and 30 WRKY proteins from other plants

were aligned by Clustalx1.81 program and then a neighbor-joining phylogenetic tree was constructed

using MEGA 5 with 10000 bootstrap Replicates (Stracke et al. 2001). The gene sequence of

CbWRKY24 was analyzed via the NCBI database and the amino acid sequence alignments of

CbWRKY24 and AaWRKY1 were performed with DNAMAN.

Transcriptional assay

The coding region of CbWRKY24 was constructed on the pBridge vector by specific primers to form

the pBridge-CbWRKY24 constructs, and then transcriptional activity was analyzed. The empty vector,

the positive control pBridge-GmMYBJ6, and the pBridge-CbWRKY24 plasmids were transformed into

the yeast strain AH109 respectively. The transformed cells in SD/H-Trp medium were validated by

colony PCR. The galactosidase filter lift assay was performed to evaluate its transcriptional activation.

The primers are listed in supplementary Table S1.

Transient transformation of CbWRKY24 into Conyza blinii H.Lév and tomato fruits

The codon region of CbWRKY24 was PCR-amplified from Conyza blinii H.Lév. using the specific

primers in supplementary Table S1 and the fragment was cloned into the vector pCHF3-YFP. The

recombinant plasmid was transiently transformed into the leaves of Conyza blinii H.Lév. and tomato

fruits by agrobacterium tumefaciens mediated transformation. The PCR was performed to identify

whether the recombinant plasmid was transiently transformed into Conyza blinii H.Lév and tomato

fruits. The qRT-PCR was used to detect the expression of terpenoid related genes in transiently

transformed, empty transformed, and wild type Conyza blinii H.Lév. The expression level of key genes

from lycopene pathway in transient transformed tomato fruits were determined according to the same

method. The content of blinin and total saponins were also determined.

Cloing of the CbWRKY24 promoter and GUS histochemistry of transient transfection of tobacco.

The isolated of CbWRKY24 promoter from Conyza blinii H.Lév. genome was performed according to

Genome Walking (TaKaRa, Japan) with nested specific primers sp1, sp2, sp3 and AP primers provided

in the kit. The nested PCR product was cloned into the pMD19-T vector and sequenced. Analysis the

cloned promoter sequence of CbWRKY24 in the PlantCARE database.

The obtained promoter sequence was designated as CbWRKY24P and constructed on the plant

expression vector pBI101-GUS. The empty vector, the recombinant plasmid CbWRKY24P-GUS and

the positive cauliflower mosaic virus (CaMV) 35S-GUS were transiently transfected into tobacco

leaves using agrobacterium tumefaciens strain GV3101. Histochemical staining was performed in

transiently transformed tobacco leaves. The primers are listed in Supplementary Table S1.

Relative expression analysis by quantitative real-time PCR

The relative expression level of CbWRKY24 and terpenoid pathway related genes in Conyza blinii

H.Lév. were analyzed by qRT-PCR. The primers for qRT-PCR were designed with Primer Premier 5

software according to the CbWRKY24 cDNA sequences. The qRT-PCR was performed with a SYBR

Premix EX Taq Kit (TaKaRa, China). The housekeeping genes GAPDH (KF027475) in Conyza blinii

H.Lév and UBI3 (X58253.1) in Solanum lycopersicum were used as the internal standards (Mascia et

al. 2010; Sykora and Legut 2015). The experimental data was processed by 2-△△CT method and each

qRT-PCR experiment was performed with at least three biological replicates (Livak and Schmittgen

2012).

Statistical analysis

The experimental datas were analyzed by using the Student’s t test and it was considered to be

significant if P value < 0.05. The experimental data was plotted with Origin 8.0 software.

Results

Cloning and characterizations analysis of CbWRKY24

To identify putative WRKY genes that may be involved in the terpene synthesis, the WRKY gene

CbWRKY24 was screened from the Conyza blinii H.Lév. transcriptome database constructed by our

laboratory. The CbWRKY24 protein was clustered together with the transcription factors involved in

artemisinin biosynthesis in Artemisia annua (Zhang et al. 2009). The CbWRKY24 gene encodes a

protein of 342 amino acid residues with a predicted molecular mass of 38.44 kDa and a calculated pI of

5.51. The CbWRKY24 has an 1029 bp open reading frame (GenBank Accession No. MG148350).

WRKY transcription factors of different structures perform different functions. The multiple sequence

alignment result showed that CbWRKY24 has a single WRKYGQK domain and has a C2H2-type zinc

finger motif at the C-terminal, which belongs to group II (Fig. S2). The WRKY family belongs to

group II is not only involved in environmental stresses, but also involved in the development of

trichome and secondary metabolism of plants (Eulgem et al. 2000). Understanding the structure of

WRKY family transcription factors can lay a foundation for functional verification (Cao et al. 2018;

Dai et al. 2016; Schluttenhofer et al. 2014).

In order to further verify the characterization of CbWRKY24 as a transcription factor, the

transcriptional activity of CbWRKY24 were analyzed using a yeast assay system. Yeast cells containing

pBridge-GmMYBJ6 and pBridge-CbWRKY24 grew well in SD/-Trp/-His medium, whereas cells

containing empty vector did not grow (Fig. 1A). After treatment with X-gal, the pBridge-CbWRKY24

and the positive control showed a significant blue reaction, while the negative control was no color

change (Fig. 1B). These results indicate that CbWRKY24 has transcriptional activity.

Expression analysis of CbWRKY24 and key genes in terpenoid pathway under different

phytohormones and cold treatment conditions

The expression of tissue-specific genes are supposed to be closely related to some growth and

development functions. Previous experiments proved that blinin and saponin were mainly found in

Conyza blinii H.Lév. leaves (Fig. S3). The qRT-PCR experimental results indicated that CbWRKY24

had the highest expression level in leaves, which was similar to CbHMGR, CbβAS, CbSQE, CbSQS in

MVA pathway and CbDXR, CbGGPPS, CbMCS in MEP pathway (Fig. 2). From tissue specific

expression experiments, it is speculated that CbWRKY24 probably regulates the terpenoid synthesis in

Conyza blinii H.Lév.

The relative expression level of CbWRKY24 and terpenoid related genes were measured under

stress treatments. From the result, it showed that CbWRKY24 almost responded to every stress

treatment, but the transcript level changed most obviously under MeJA and cold treatments (Fig. 3).

The expression pattern of CbWRKY24 reached the maximum at 12 hours and was subsequently

declined under MeJA treatment, which was similar to CbFPPS, CbHMGR, CbΒAS in MVA pathway,

and CbDXS in the MEP pathways (Fig. 4). Under cold treatment, the expression profile of CbWRKY24

achieved the highest at 6 hours and was dropped, which was similar to CbSQE, CbΒAS in MVA

pathway, and CbDXR, CbDXS, and CbGGPPS in the MEP pathways (Fig. 5).

Determination of blinin and saponin under different phytohormones and cold treatments

The contents of blinin and total saponins in Conyza blinii H.Lév. were changed under hormone and

cold treatments (Fig. S4). It was suggested from picture S4 that in the first 24 hours the change of the

blinin content had the same trend under these three hormone treatments.

In brief, hormones and cold treatments have a great influence on the content of blinin and saponin

in Conyza blinii H.Lév. It can be speculated from the experimental results that CbWRKY24 may

regulate the expression of terpenoid genes and thus affect the changes of blinin and total saponin

content.

Transient transformation of Conyza blinii H.Lév. and tomato fruits.

To further verify the function of CbWRKY24, transient transfected Conyza blinii H.Lév. plants and

tomato fruits with CbWRKY24 were generated. The PCR verification results showed that CbWRKY24

was expressed in all of the transient transfected Conyza blinii H.Lév. plants and tomato fruits but not in

WT and empty vector transient transfected plants (Fig. S5). Transiently transformed plants were used

for the following experiments.

CbWRKY24 positively regulates the saponin pathway in Conyza blinii H.Lév. and negatively

regulates lycopene pathway in tomato.

To confirm whether CbWRKY24 was involved in biosynthesis of terpenoids, the expression patterns of

key genes from terpenoid pathways in transiently transformed plants with CbWRKY24, empty vctor

and WT plants were measured. From the results, we can see that the transcript level of CbβAS in

transiently transformed Conyza blinii H.Lév. with CbWRKY24 was approximately 4.6-fold compared to

that in WT plants, meanwhile the content of total saponins also increased (Fig. 6-7). However, the

expression level of CbDXS, CbDXR, CbGGPPS in MEP pathway decreased, as well as the content of

blinin. Conclusively, it showed that CbWRKY24 could increase the content of total saponins in Conyza

blinii H.Lév. in some degree.

In order to further verify the function of CbWRKY24, it was transiently transformed into tomato

fruits. It can be seen from the results that the expression level of related genes from lycopene pathway

in transient transformed tomato fruits with CbWRKY24 dropped rapidly compared to WT plants, and

CbWRKY24 may negatively regulated the expression of related genes in lycopene pathway (Fig.8).

Isolation and Sequence Analysis of the CbWRKY24P

A 2025 bp promoter fragments upstream of the start codon of CbWRKY24 was cloned. Analyzing its

sequence on plantCARE, it is found that CbWRKY24P contained multiple cis-acting elements

involved in abiotic and biotic stress responses. For example, there are heat shock response element

(HSE), elicitor response element (W box) and drought stress response element (MBS) in CbWRKY24P.

In addition, the cis-acting elements in CbWRKY24P also contains components which are involved in

regulating the abiotic stress genes, including methyl jasmonate response element (TGACG-motif),

abscisic acid response element (ABRE), gibberellin response element (GARE) and so on (Table S2).

The CbWRKY24P: GUS fusion constructs was transient transformed into tobacco leaves to detect

the activity. The CaMV 35S promoter transformed plants as positive controls and non-transformed

plants were used as negative controls. Experimental results show that the transiently converted tobacco

with CbWRKY24P and positive control stained different degrees of blue (Fig. 9).

Discussion

The WRKY transcription factors not only play an important role in plant biotic and abiotic stresses, but

also regulate the synthesis of secondary metabolites (Phukan et al. 2016). It owns a long domain with

the length of 60 amino acid, along with a highly conserved WRKYGQK structure at the N-terminus

and a zinc finger structure at the C-terminus. There are three groups of WRKY transcription factors

according to the amount of WRKY domains and the type of zinc finger structure (Eulgem et al. 2000).

Contrary to group I WRKY genes which own two WRKY domains, there is only one domain in group

II and III WRKY genes. It was found that there is a zinc finger motif with a C2H2-type structure

(C–X4–5–C–X22–23–H–X1–H) in group I and II at the C-terminal, while Group III have a C2HC zinc

finger motif C–X7–C–X23–H–X–C. Understanding the classification of WRKY family can lay a

foundation for the isolation and identification of transcription factors. Several plant WRKY factors that

have been functionally verified and identified are involved in biosynthesis of terpenoids, such as

AaWRKY1 (Chen et al. 2017; Ma et al. 2009), TcWRKY1 († et al. 2013), pqWRKY1 (Sun et al. 2013),

AtWRKY1 (Schluttenhofer et al. 2014) and GaWRKY1 (Xu et al. 2004). AaWRKY1, which is found in

Artemisia annua, can regulate the biosynthesis of artemisinin. The paclitaxel owns the excellent

antitumor activity of taxus chinensis. Now the related transcription factors on the synthesis of taxol

were also found in taxus chinensis such as TcWRKY1.

In this study, MeJA-inducible CbWRKY24 was identified from Conyza blinii H.Lév. It has a single

WRKYGQK domain and has a C2H2-type zinc finger motif at the C-terminal, which belongs to group

II (Fig. S2). Transcriptional activity assay shows that it is transcriptional activator (Fig. 1). The

phytohormones GA3, ABA and MeJA play an indispensable role in regulating plant development and

enhancing biosynthesis of secondary metabolites, including terpenoids (Mansouri and Asrar 2012; Wild

et al. 2012; Yu et al. 2012). However, low temperature is also the main environmental stress that

influences plant cell survival and physiological activities (Chinnusamy et al. 2007). In our experiments,

the CbWRKY24 has different response to each treatment, and the response are most intense under MeJA

and cold treatment (Fig. 3, Fig. 4). Transcription factors are usually induced rapidly under abiotic stress

in the early stage, reach the maximum induction level after a few hours, and then the expression level

decreased (Dai et al. 2007). For instance, the transcript level of AaMYC2 reached its peak at 6 h after

MeJA treatment in Artemisia annua (Shen et al. 2016). However, the expression level of OsEBP2

which comes from Rice accumulated quickly within 4 h after MeJA treatment and then begun to

downregulate compared with that in control (Lin et al. 2007). The transcript level of CbWRKY24 in our

experiment begun to accumulate after MeJA treatment for 6 h, and reached the maximum level at 12h,

then the transcript level begun to decrease gradually compared with that in control (Fig. 3). It is

necessary to experient a low temperature environment in the growth cycle of Conyza blinii H.Lév.

However, the expression of CbWRKY24 up-regulated to 11.96-fold after cold treatment for 6 h,

indicating that CbWRKY24 should response to the cold stress in Conyza blinii H.Lév (Fig. 4).

Meanwhile, the expression patterns of CbWRKY24 and key genes in terpenoid pathway of Conyza

blinii H.Lév. were similar under MeJA and cold treatments. It is possible to infer that CbWRKY24 may

play an important role in terpene biosynthesis. To test this hypothesis, we transiently transfected

CbWRKY24 to the leaves of Conyza blinii H.Lév and tomato fruits.

To verify the role of CbWRKY24 in terpenoid biosynthesis of Conyza blinii H.Lév, multiple

terpenoid pathway genes were analyzed by qRT-PCR in transiently transfected plants with CbWRKY24

and WT plants. The results indicated that several genes, including CbFPPS, CbSQE, CbHMGR, CbΒAS

and CbMCS were significantly up-regulated in transiently transfected Conyza blinii H.Lév with

CbWRKY24 compared to that in WT plants; while the expression level of CbGGPPS, CbDXS and

CbDXR were down-regulated (Fig. 6). These genes including CbΒAS, CbHMGR, CbSQE and CbFPPS

belong to MVA pathway, which can generate oleanane type of triterpenoid saponins from Conyza blinii

H.Lév. Thus, the higher expression of these genes may improve the the quality of Conyza blinii H.Lév.

Besides, the CbDXS, CbDXR, CbMCS and CbGGPPS belong to MEP pathway, which can generate

diterpenoid blinin from Conyza blinii H.Lév. In brief, the CbWRKY24 may regulate biosynthesis of

terpenoids from Conyza blinii H.Lév. In order to further verify the effect of CbWRKY24 on terpenoid

synthesis, it was transiently transformed into tomato fruits. Lycopene, a four terpenoid, is a natural fat

soluble carotenoid. The MVA pathway of synthetic lycopene is relatively clear. The transient

transformed tomato fruits with CbWRKY24 were found that the transcript level of SlPSY, SlPDS, SlZDS

in lycopene pathway decreased sharply compared to that in WT fruits (Fig. 8). It can be seen from the

above results that CbWRKY24 can regulate terpenoid biosynthesis, but the regulation effects of

different terpenoid pathways were quite different.

Studies have shown that MeJA can increase the expression of genes including ADS, CYP71AV1

and DBR2 in artemisinin biosynthesis, thereby increasing the density of glandular trichomes and

resulting in the accumulation of sesquiterpenes (Maes et al. 2011). In addition, the expression of

AaWRKY1 which is an Artemisia annua transcription factor that regulates artemisinin biosynthesis was

also strongly induced under MeJA treatment (Zhang et al. 2009). Similar to previous studies, the

CbWRKY24 in our experiment showed strong induction under MeJA treatment, meanwhile the

expression of upstream genes CbHMGR, CbFPPS, and downstream genes CbSQE, CbβAS in MVA

pathway and upstream gene CbDXS in MEP pathway also increased (Fig. 4). The expression of the

CbWRKY24 is rapidly induced by MeJA, which implies that CbWRKY24 either self-regulation its own

gene expression level or regulated by one or more upstream transcription factors. It has been reported

that the transcriptional cascade of different signaling pathways can regulate plant stress response

(Chinnusamy et al. 2003). Under the MeJA treatment, the accumulation time of key genes expression

were earlier than that of CbWRKY24, while CbWRKY24 response to cold stress was earlier than that of

key genes. Therefore, we are bold to speculate that CbWRKY24 is methyl jasmonate activated

transcription factor, and may also participate in jasmonic acid signal transduction pathway through

interaction with cold stress. In order to test this hypothesis, we cloned the upstream promoter region of

CbWRKY24, and analyzed the cis acting elements of the CbWRKY24P, we found many biotic and

abiotic stress responsive elements including methyl jasmonate response element (JRE), but no cold

responsive element was found. Many of the methyl jasmonate responsive elements have been identified

from different plant promoters (Brown et al. 2003; Xu and Timko 2004). Meanwhile, it was found that

GUS histochemistry test of transient transformed tobacco leaves with CbWRKY24P appeared blue (Fig.

9). Based on this study, the CbWRKY24 promoter can be transformed into Arabidopsis thaliana, and

GUS activity can be determined under MeJA and other stress treatments to further verify the function

of CbWRKY24.

In summary, a jasmonate-responsive gene, CbWRKY24, was isolated from Conyza blinii H.Lév.

and funtions as an important TF in changing terpenoid content. The overexpression of CbWRKY24

up-regulate the transcript level of terpenoid related genes in transient transformed Conyza blinii H.Lév

leaves; but down-regulated the expression of lycopene related genes in transiently transfected tomato

fruits. In conclusion, the experimental results can be used to lay the foundation for further study on

improving the quality of medicinal plants.

Acknowledgments

We thank all people who participated in this study for their support.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

REFERENCES

† SL, † PZ, Zhang M, † CF, Yu L (2013) Functional analysis of a WRKY transcription factor involved

in transcriptional activation of the DBAT gene in Taxus chinensis. Plant Biol 15, 19–26

Bansal S, Narnoliya LK, Mishra B, Chandra M, Yadav RK, Sangwan NS (2018) HMG-CoA reductase

from Camphor Tulsi (Ocimum kilimandscharicum) regulated MVA dependent biosynthesis of

diverse terpenoids in homologous and heterologous plant systems. Sci Rep 8, 3547-3562

Brown RL, Kazan K, Mcgrath KC, Maclean DJ, Manners JM (2003) A role for the GCC-Box in

Jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis1. Plant Physiol 132,

1020-1032

Cao W et al. (2018) Transcription Factor SmWRKY1 Positively Promotes the Biosynthesis of

Tanshinones in salvia miltiorrhiza. Front Plant Sci, 9, 554-564.

Carleton JB, Berrett KC, Gertz J (2017) Multiplex enhancer interference reveals collaborative control

of gene regulation by estrogen receptor α-Bound enhancers. Cell Syst 5, 333-344

Chen M et al. (2017) GLANDULAR TRICHOME‐ SPECIFIC WRKY 1 promotes artemisinin

biosynthesis in Artemisia annua. New Phytol 214, 304-316

Chinnusamy, Viswanathan, Zhu, Jianhua, Zhu, JianKang (2007) Cold stress regulation of gene

expression in plants. Trends Plant Sci 12, 444-451

Chinnusamy V, Ohta M, Kanrar S, Lee BH, Hong X, Agarwal M, Zhu JK (2003) ICE1: a regulator of

cold-induced transcriptome and freezing tolerance in Arabidopsis. Genes Dev 17, 1043-1054

Dai X, Wang Y, Zhang WH (2016) OsWRKY74, a WRKY transcription factor, modulates tolerance to

phosphate starvation in rice. J Exp Bot, 67(3), 947-960.

Dai X, Xu Y, Ma Q, Xu W, Wang T, Xue Y, Chong K (2007) Overexpression of an R1R2R3 MYB gene,

OsMYB3R-2, increases tolerance to freezing, drought, and salt stress in transgenic

Arabidopsis. Plant Physiol 143, 1739-1751

Dai Y et al. (2009) Isolation and characterization of a novel cDNA encoding methyl

jasmonate-responsive transcription factor TcAP2 from Taxus cuspidata. Biotechnol Lett 31,

1801-1809

Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription

factors. Trends Plant Sci 5, 199-206

Huang W, Khaldun ABM, Chen J, Zhang C, Lv H, Yuan L, Wang Y (2016) A R2R3-MYB transcription

factor regulates the flavonol biosynthetic pathway in a traditional chinese medicinal plant,

Epimedium sagittatum. Front Plant Sci 7, 1089-1101

Li HL, Zhang LB, Guo D, Li CZ, Peng SQ (2012) Identification and expression profiles of the WRKY

transcription factor family in Ricinus communis. Gene 503, 248-253

Lin R, Zhao W, Meng X, Peng YL (2007) Molecular cloning and characterization of a rice gene

encoding AP2/EREBP-type transcription factor and its expression in response to infection

with blast fungus and abiotic stresses. Physiol Mol Plant Pathol 70, 60-68

Livak KJ, Schmittgen TD (2012) Analysis of relative gene expression data using real-time quantitative

PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408

Ma D et al. (2009) Isolation and characterization of AaWRKY1, an Artemisia annua transcription

factor that regulates the amorpha-4,11-diene synthase gene, a key gene of artemisinin

biosynthesis. Plant Cell Physiol 50, 2146-2161

Ma L et al. (2017) Evaluation of the anti-cancer activity of the triterpenoidal saponin fraction isolated

from the traditional Chinese medicine Conyza blinii H. Lév. Rsc Adv 7, 3408-3412

Ma L et al. (2016) Saponin fraction isolated from Conyza blinii H.Lév. demonstrates strong anti-cancer

activity that is due to its NF-κB inhibition. Biochem Bioph Res Co 483, 779-785

Ma L, Liu J (2014) The protective activity of Conyza blinii saponin against acute gastric ulcer induced

by ethanol. J Ethnopharmacol 158, 358-363

Maes L et al. (2011) Dissection of the phytohormonal regulation of trichome formation and

biosynthesis of the antimalarial compound artemisinin in Artemisia annua plants. New Phytol

189, 176-189

Mansouri H, Asrar Z (2012) Effects of abscisic acid on content and biosynthesis of terpenoids in

Cannabis sativa at vegetative stage. Biol Plantarum 56, 153-156

Mascia T, Santovito E, Gallitelli D, Cillo F (2010) Evaluation of reference genes for quantitative

reverse-transcription polymerase chain reaction normalization in infected tomato plants. Mol

Plant Pathol 11, 805-816

Phukan UJ, Jeena GS, Shukla RK (2016) WRKY transcription factors: molecular regulation and stress

responses in Plants. Front Plant Sci 7, 760-774

Schluttenhofer C, Pattanaik S, Patra B, Yuan L (2014) Analyses of Catharanthus roseus and

Arabidopsis thaliana WRKY transcription factors reveal involvement in jasmonate signaling.

BMC Genomics 15, 502-522

Shen Q et al. (2016) The jasmonate-responsive AaMYC2 transcription factor positively regulates

artemisinin biosynthesis in Artemisia annua. New Phytol 210, 1269-1281

Stracke R, Werber M, Weisshaar B (2001) The R2R3-MYB gene family in Arabidopsis thaliana. Curr

Opin Plant Biol 4, 447-456

Su Y, Koike K, Guo D, Satou T, Liu J, Zheng J, Nikaido T (2000) New apiose-containing triterpenoid

saponins from Conyza blinii. Tetrahedron 57, 6721-6726

Sun R et al. (2017) β-Amyrin synthase from Conyza blinii expressed in Saccharomyces cerevisiae.

Febs Open Bio 7, 1575-1585

Sun Y et al. (2013) Discovery of WRKY transcription factors through transcriptome analysis and

characterization of a novel methyl jasmonate-inducible PqWRKY1 gene from Panax

quinquefolius. Plant Cell Tiss Organ 114, 269-277

Sykora R, Legut D (2015) Cloning and expression analysis of 1-deoxy-D-xylulose-5-phosphate

synthase gene from the medicinal plant Conyza blinii H.Lév. Turkish J Biol 38, 664-670

Tang L, Cai H, Zhai H, Luo X, Wang Z, Cui L, Bai X (2014) Overexpression of Glycine soja WRKY20

enhances both drought and salt tolerance in transgenic alfalfa (Medicago sativa L.). Plant Cell

Tiss Org 118, 77-86

Wild M et al. (2012) The Arabidopsis DELLA RGA-LIKE3 is a direct target of MYC2 and modulates

jasmonate signaling responses. Plant Cell 24, 3307-3319

Xiong AS et al. (2013) Expression and function of a modified AP2/ERF transcription factor from

brassica napus enhances cold tolerance in transgenic Arabidopsis. Mol Biotechnol 53, 198-206

Xu B, Timko M (2004) Methyl jasmonate induced expression of the tobacco putrescine N

-methyltransferase genes requires both G-box and GCC-motif elements. Plant Mol Biol 55,

743-761

Xu YH, Wang JW, Wang S, Wang JY, Chen XY (2004) Characterization of GaWRKY1, a cotton

transcription factor that regulates the sesquiterpene synthase gene (+)-delta-cadinene

synthase-A. Plant Physiol 135, 507-515

Yanfang Su, ‡, Kazuo Koike, Tamotsu Nikaido, †, Jiansheng Liu, Junhua Zheng A, Dean Guo (2003)

Conyzasaponins I−Q, Nine new triterpenoid saponins from Conyza blinii. J Nat Prod 66,

1593-1599

Yang CR, He ZT, Li XC, Zheng QT, He CH, Yang J, Morita T (1989) Blinin, a neoclerodane diterpene

from Conyza blinii. Phytochemistry 28, 3131-3134

Yin J, Zhang D, Zhuang J, Huang Y, Mu Y, Lv S (2017) Study on the correlation between gene

expression and enzyme activity of seven key enzymes and ginsenoside content in ginseng in

over time in Ji'an, China. Int J Mol Sci 18, 2682-2694

YingkeZhao, Liu Y (2017) A mechanistic overview of herbal medicine and botanical compounds to

target transcriptional factors in breast cancer. Pharmacol Res 130, 292-302

Yu ZX, Li JX, Yang CQ, Hu WL, Wang LJ, Chen XY (2012) The jasmonate-responsive AP2/ERF

transcription factors AaERF1 and AaERF2 positively regulate artemisinin biosynthesis in

Artemisia annua L. Mol plant 5, 353-365

Zhang G, Ming C, Li L, Xu Z, Chen X, Guo J, Ma Y (2009) Overexpression of the soybean GmERF3

gene, an AP2/ERF type transcription factor for increased tolerances to salt, drought, and

diseases in transgenic tobacco. J Exp Bot 60, 3781-3796

Zhu Z, Shi J, He M, Cao J, Wang Y (2012) Isolation and functional characterization of a transcription

factor VpNAC1 from Chinese wild Vitis pseudoreticulata. Biotechnol Lett 34, 1335-1342

Figure legends

Fig. 1 Transcriptional activation activity verification of CbWRKY24 in yeast.

(A) The transformed cells were screened on SD/-His-Trp medium. (B) After the galactosidase filter lift

assay. Negative Control 1 (NC1): empty pBridge plasmid; Negative Control 2 (NC2): AH109 cells;

C24: pBridge-WRKY24; Positive Control (PC): pBridge-GmMYBJ6. Fusion proteins of

pBridge-CbWRKY24, pBridge- GmMYBJ6 and pBridge were expressed in the yeast strain AH109.

Fig. 2 Tissue-specific genes expression of CbWRKY24 and key genes in terpenoid pathway

Figure a represents the expression level of CbWRKY24 and genes in MVA pathway in different tissues.

Figure b represents the expression level of CbWRKY24 and genes in MEP pathway in different tissues.

The mRNA expression patterns of genes in root, stem, leaf, and flower tissues were examined by qPCR

assay. The 2 -△△CT method was used to determine the relative expression, and the expression level of

genes in flower tissue were set to “1”. GAPDH was used as a housekeeping gene. All experiments were

performed using at least three biological replicates and error bars indicated standard deviations (±SD).

Statistical significance was determined by Student’s t-test (*, P<0.05; **, P<0.01). Different genes

were represented by different colors in columns, and the relative expression of the same gene in root,

stem and leave were significantly analyzed with which in flower.

Fig. 3 Expression patterns of CbWRKY24 and key genes in terpenoid pathway under stress treaments.

Expression patterns of CbWRKY24 and key genes in terpenoid pathway under methyl jasmonate (MeJA,

100 µM), gibberellin (GA, 100 μM), abscisic acid (ABA, 100 μM) and 4℃ treatments after 48h. The

mRNA expression patterns of CbWRKY24 and key genes in Conyza blinii H.Lév were examined by

qRT-PCR assay. The 2-△△CT method was used to determine the relative Expression. GAPDH was used

as a housekeeping gene. The diagram was obtained by the heat map making tool HemL.

Fig. 4 Expression analysis of CbWRKY24 and key genes in terpenoid pathway under methyl jasmonate

(MeJA, 100 µM) treatments after 48h.

Figure a represents the expression level of CbWRKY24 and genes in MVA pathway after MeJA

treatment. Figure b represents the expression level of CbWRKY24 and genes in MEP pathway after

MeJA treatment. The mRNA expression patterns of CbWRKY24 and key genes in Conyza blinii H.Lév

were examined by qRT-PCR assay. The 2-△△CT method was used to determine the relative Expression.

GAPDH was used as a housekeeping gene. All experiments were performed using at least three

biological replicates and error bars indicated standard deviations(±SD). Statistical significance was

determined by Student’s t-test (*, P<0.05; **, P<0.01). Different genes were represented by different

colors in columns, and the relative expression of the same gene was significantly analyzed with which

at 0 h.

Fig. 5 Expression analysis of CbWRKY24 and key genes in terpenoid pathway under cold stress

treatment after 48h.

Figure a represents the expression level of CbWRKY24 and genes in MVA pathway after cold treatment.

Figure b represents the expression level of CbWRKY24 and genes in MEP pathway after cold treatment.

The mRNA expression patterns of these genes in Conyza blinii H.Lév. were examined by qRT-PCR

assay. The 2-△△CT method was used to determine the relative Expression. GAPDH was used as a

housekeeping gene. All experiments were performed using at least three biological replicates and error

bars indicated standard deviations(±SD). Statistical significance was determined by Student’s t-test (*,

P<0.05; **, P<0.01). Different genes were represented by different colors in columns, and the relative

expression of the same gene was significantly analyzed with which at 0 h.

Fig. 6 The transcript expression of key enzymes genes from terpenoid biosynthesis pathway in of

Conyza blinii H.Lév lines transiently transfected with CbWRKY24.

Figure a represents the transcriptional level of genes from MVA pathway in transient transfected

Conyza blinii H.Lév with CbWRKY24. Figure b represents the transcriptional level of genes from MEP

pathway in transient transfected Conyza blinii H.Lév with CbWRKY24. The MVA pathway formed the

triterpenoid compounds represented by saponin and the MEP pathway formed the diterpenoid

compounds represented by blinin. All experiments were performed using at least three biological

replicates and error bars indicated standard deviations(±SD). Statistical significance was determined by

Student’s t-test (*, P<0.05; **, P<0.01). Different genes were represented by different colors in

columns, and the relative expression of the same gene was significantly analyzed with which in WT

plants.

Fig. 7 Percentage content of blinin and total saponins content analysis in of Conyza blinii H.Lév lines

transiently transfected with CbWRKY24.

Figure a respresents percentage of blinin in transient transfectd of Conyza blinii H.Lév with

CbWRKY24. Figure b respresents total saponins content in transient transfectd of Conyza blinii H.Lév

with CbWRKY24. The content of blinin was determined by high performance liquid chromatography,

and the content of total saponins was determined by spectrophotometry. All experiments were

performed using at least three biological replicates and error bars indicated standard deviations(±SD).

Statistical significance was determined by Student’s t-test (*, P<0.05; **, P<0.01).

Fig. 8 The transcript expression of key enzymes genes from lycopene biosynthesis pathway in of

tomato fruits transiently transfected with CbWRKY24.

The mRNA expression patterns of these genes in Solanum lycopersicum were examined by qRT-PCR

assay. The 2-△△CT method was used to determine the relative Expression. UBI3 was used as a

housekeeping gene. All experiments were performed using at least three biological replicates and error

bars indicated standard deviations(±SD). Statistical significance was determined by Student’s t-test (*,

P<0.05; **, P<0.01). Different genes were represented by different colors in columns, and the relative

expression of the same gene was significantly analyzed with which in WT plants.

Fig. 9 Histochemical analysis of GUS in transient transformed tobacco leaves with the CbWRKY24

promoter.

(A) Non-transformed plants as negative controls; (B) Transformed plants with the CaMV 35S

promoter as a positive control; (C-E) positive lines with CbWRKY24 promoter.

Received 4 May 2018; revised 27 June 2018; accepted 27 July 2018

Table S1 the primers used in the experiment

Name Primer (5’- 3’)

pBridge-CbWRKY24-F ttgactgtatcgccggaattcatggacactagtgcttgtatcatcaa

pBridge-CbWRKY24-R ttagcttggctgcaggtcgactcagaggaaataccccgagttg

pCHF3-CbWRKY24-F acgggggacgagctcggtaccatggacactagtgcttgtatcatcaa

pCHF3-CbWRKY24-R gcccttgctcaccatgtcgacgaggaaataccccgagttgct

CbWRKY24P-sp1-1 cgatagataccttttcttggatacgac

CbWRKY24P-sp2-1 gggctctcaccaatggaaacag

CbWRKY24P-sp3-1 tgaacccagttgaccagca

CbWRKY24P-sp1-2 tttatccattttggtaggaggaacgc

CbWRKY24P-sp2-2 gttacaaggtgcggctttctct

CbWRKY24P-sp3-2 cttccccagctcaatagat

Table S2 Sequence prediction of cis acting elements in promoter of CbWRKY24

cis-acting element sequence Position biological function

ABRE CACGTG -308(+)

Cis-acting element

involved in abscisic

acid responsiveness

ACE AAAACGTTTA -593(+)

Cis-acting element

involved in light

responsiveness

Box 4 ATTAAT

ATTAAT

-273(+)

-868(-)

Part of a conserved

DNA module involved

in light responsiveness

Box I

TTTCAAA

TTTCAAA

TTTCAAA

-328(-)

-1450(+)

-1292(-)

Light responsive

element

Box-W1 TTGACC

TTGACC

-71(-)

-712(-)

Fungal elictitor

responsive element

CAAT-box CAAAT

CAAT

-26(-)

-39(+)

Common cis-acting

element in promoter

and enhancer region

CCGTCC-box CCGTCC -1143(-)

Cis-acting regulator

element related to

meristem specific

activation

CGTCA-motif CGTCA -851(+) Cis-acting regulator

CGTCA -1120(+) element related to

meristem specific

activation

ERE ATTTCAAA -326(-) Ethylene-responsive

element

G-Box CACGTG -308(+)

Cis-acting element

involved in light

responsiveness

GA-motif ATAGATAA

ATAGATAA

-826(-)

-1046(-)

Part of light

responsive element

GARE-motif AAACAGA -208(+) Gibberellin responsive

element

GCN4- motif CAAGCCA -683(-)

Cis-acting regulator

element involved in

endosperm expression

GT1-motif GGTTAA -793(-) Light responsive

element

HSE

AAAAAATTTC

-1003(+)

Cis-acting element

involved in heat stress

responsiveness

MBS CGGTCA -711(+) MYB Binding site

O2-site GATGATGTGG -1399(-)

Cis-acting regulator

element involved in

maize metabolism

regulation

P-box CCTTTTG -1267(-) Gibberellin-responsive

element

Skn-1 motif GTCAT

GTCAT

-852(+)

-1149(+)

Cis-acting regulator

element required for

endosperm expression

Sp1 CC(G/A)CCC -928(+) Light responsive

element

TATA-box TTTAAAAA -51(-)

Core promoter element

around -30 of

transcription start

TCT-motif TCTTAC -445(+) Part of light

responsive element

TGACG-motif TGACG

TGACG

-851(-)

-1120(-)

Cis-acting regulator

element involved in

the MeJA-

responsiveness

W-box TTGACC

TTGACC

-71(-)

-712(-)

Binding element of

WRKY transcription

factors; elicitor

response element

Fig. S1 Phylogenetic relationship of CbWRKY24 from Conyza blinii H.Lév. and Other plants WRKY

proteins.

The complete amino acid sequences of CbWRKY24 and 30 WRKY proteins from other plants were

aligned by Clustalx1.81, and the neighbor-joining tree was constructed using MEGA 5.0 with 10000

bootstrap replicates. The black dot represents the target transcription factor in Conyza blinii H.Lév. and

the red dots represent the TFs associated with terpenoid biosynthesis in other plants.

Fig. S2 Sequence conservation analysis of CbWRKY24 in Conyza blinii H.Lév.

The amino acid sequences of CbWRKY24 and AaWRKY1 were compared in DNAMAN. The sequence

in red is the conserved domain structure of WRKY transcription factors.

Fig. S3 Distribution of blinin and total saponins in different tissues of Conyza blinii H.Lév.

The figure a is the percentage of blinin in different tissues, while figure b is the total saponins content

in different tissues. The content of blinin was determined by high performance liquid chromatography,

and the content of total saponins was determined by spectrophotometry.

Fig. S4 Percentage content of blinin and total saponins content analysis in Conyza blinii H.Lév under

stress treatments.

The contents of saponin and blinin were determined under methyl jasmonate (MeJA, 100 µM), abscisic

acid (ABA, 100 µM), gibberellic acid (GA3 , 100 µM) and cold treatments after 48h. The content of

blinin was determined by high performance liquid chromatography, and the content of total saponins

was determined by spectrophotometry.Statistical significance was determined by Student’s t-test (*,

P<0.05; **, P<0.01).

Fig. S5 Positive transient transfected Conyza blinii H.Lév leaves and tomato fruits with CbWRKY24

detected by PCR.

The figure a represents PCR verification of transient transfected Conyza blinii H.Lév leaves and figure

b represents PCR verification of transient transfected tomato fruits. M: D2000 0: negative control 1:

WT plants 2: pCHF3-YFP vector transient transfection lines 3: L1 4: L2 5: L3