Research ArticleGlioprotective Effects of Ashwagandha Leaf Extract against LeadInduced Toxicity

Praveen Kumar Raghavendra Singh Arshed Nazmi Dinesh LakhanpalHardeep Kataria and Gurcharan Kaur

Department of Biotechnology Guru Nanak Dev University Amritsar Punjab 143005 India

Correspondence should be addressed to Gurcharan Kaur kgurcharanneuroyahoocom

Received 13 February 2014 Revised 24 April 2014 Accepted 24 April 2014 Published 28 May 2014

Academic Editor Jose Carlos Tavares Carvalho

Copyright copy 2014 Praveen Kumar et alThis is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Withania somnifera (Ashwagandha) also known as IndianGinseng is a well-known Indianmedicinal plant due to its antioxidativeantistress antigenotoxic and immunomodulatory properties The present study was designed to assess and establish thecytoprotective potential of Ashwagandha leaf aqueous extract against lead induced toxicity Pretreatment of C6 cells with 01Ashwagandha extract showed cytoprotection against 25120583M to 400 120583M concentration of lead nitrate Further pretreatment withAshwagandha extract to lead nitrate exposed cells (200120583M) resulted in normalization of glial fibrillary acidic protein (GFAP)expression as well as heat shock protein (HSP70) mortalin and neural cell adhesion molecule (NCAM) expression Further thecytoprotective efficacy of Ashwagandha extract was studied in vivo Administration of Ashwagandha extract provided significantprotection to lead induced altered antioxidant defense that may significantly compromise normal cellular function Ashwagandhaalso provided a significant protection to lipid peroxidation (LPx) levels catalase and superoxide dismutase (SOD) but not reducedglutathione (GSH) contents in brain tissue as well as peripheral organs liver and kidney suggesting its ability to act as a free radicalscavenger protecting cells against toxic insult These results thus suggest that Ashwagandha water extract may have the potentialtherapeutic implication against lead poisoning

1 Introduction

There is a growing interest in the use of herbal plants for theirdifferentmedicinal properties due to their natural origin costeffectiveness and negligible side effects [1] Withania som-nifera (Ashwagandha) is very popular in traditional Indianmedicine system Ayurveda It is considered to be IndianGinseng due to its rejuvenating effects on the body such asantioxidative antistress antigenotoxic and immunomodula-tory properties [2 3] Among the herbs classified as brain ton-ics or rejuvenators in the traditional Indian medicine systemAshwagandha is the most important plant whose extractsmake a significant component to the daily supplements forbody and brain health Although a variety of Ashwagandhaextracts have displayed neuroprotective neuroregenerativeand anticancer potentials in recent in vitro studies [4ndash7] usingbrain-derived cells potentials of water extract of leaves ofAshwagandha (ASH-WEX) remain largely unexplored

Lead although one of the most useful metals is alsoone of the most toxic environmental pollutant which isdetected in almost all phases of biological systemsThemech-anisms of lead induced neurotoxicity are complex Oxidativestress membrane biophysics alterations deregulation of cellsignalling and the impairment of neurotransmission areconsidered as key aspects involved in lead neurotoxicity Themechanism involves toxicity by oxidative stress [8] and freeradical damage via two separate albeit related pathways (a)the generation of reactive oxygen species (ROS) includinghydroperoxides singlet oxygen and hydrogen peroxide and(b) the direct depletion of antioxidant reserves [9]

Astroglial cells are the most abundant cells in the CNSand are believed to play a key role in the brain and spinalcord pathologies Furthermore it is established that glial cellsand their resident protein GFAP integrate neuronal signalsand modulate synaptic activity by formation of cytoskeletalfilaments [10] GFAP is the cytoskeletal protein of astrocytes

Hindawi Publishing CorporationBioMed Research InternationalVolume 2014 Article ID 182029 15 pageshttpdxdoiorg1011552014182029

2 BioMed Research International

which is involved in controlling movement and shape ofastrocytes differentiation marker of glial cellsand increasedGFAP expression which has been associated with aging [1112] Astrocytes are important target of lead toxicity and takeup lead to store it intracellularly and by sequestering leadastrocytes may protect more sensitive neurons [13] It iswell established on getting exposed to stress the glial cellsreact by upregulating GFAP expression known as reactivegliosis [14 15] It is necessary for CNS morphogenesis as itprovides structural support to neurons [16] and hence it isconsidered as amarker of glial plasticity which controls struc-ture proliferation and adhesion of astrocytes neuron gliainteractions and CNS mechanisms Therefore glial cell lossmay contribute to the impairment of learning and memoryTherapeutic approaches to combat humanneurodegenerativediseases thus need to restore the function of both neurons andglial cells [10]

Various cellular proteins are altered upon challenge oflead induced oxidative stress andmany undesired side effectsof lead induced toxicity are known which include neuro-logical [16] behavioural [17] immunological [18] renal [19]and hepatic [20] dysfunctions We examined the expres-sion of several proteins including HSP70 mortalin proteinimmunoglobulin superfamily protein NCAM and an inter-mediate filament proteinGFAP to assess Ashwagandhamedi-ated rejuvenating effects on characteristics like proliferationadhesion and differentiation Lead toxicity is well knownfor causing oxidative stress in brain cells which can lead todamage and eventual cell death HSP70 acts as molecularchaperon and assists in the correct folding of the target pro-teins and it is induced under various environmental stresses[21] To further study the protective effect of Ashwagandha intissues other than the brain HSP70 expression was also stud-ied in the peripheral organs liver kidney and heartMortalinhas been shown to regulate the homeostasis of Ca++ in themitochondria that are very important for neuron functioning[22]NCAMregulates cell adhesion andneurite outgrowth bymeans of homophilic binding and subsequent activation andintracellular signalling through mitogen activated proteinkinase (MAPK) pathway [23] NCAM is neuronal plasticitymarker involved in cell adhesion migration and neuriteextension [24] The low-level lead exposure has been shownto attenuate the expression of all threemajorNCAM isoformsand induced reductions in neuronal growth and survival [25]

Nervous tissues have high lipid contents thus possesshigh aerobic metabolic activity which makes it more sus-ceptible to oxidative damage [26] C6 glioma cell line iswell-established in vitro model system for toxicity studiesdue to its astroglial origin The present study was aimedat evaluating the cytoprotective potential of Ashwagandhaleaf water extract against lead induced toxicity using both invitro and in vivo model systems To achieve these objectivesprotein and mRNA expression of markers of differentiationsuch as GFAP and NCAM as well as cytoprotection likeHSP70 and mortalin were studied Further protective effectsof Ashwagandha leaf extract were evaluated in the brain andperipheral organs in lead intoxicated animal model system

2 Material and Methods

21 Preparation of Water Extract of Ashwagandha Leaves(ASH-WEX) The Ashwagandha leaf extract was preparedby suspending 10 g of dry leaf powder in 100mL of doubledistilled water The suspension was stirred at 45 plusmn 5∘Covernight and filtered The filtrate so obtained was treated as100 water extract

22 C6 Glioma Cell Culture and Its Treatment C6 gliomacell line was obtained from National Centre for Cell Sci-ence (NCCS) Pune India The cell line was maintainedon DMEM supplemented with streptomycin (100UmL)penicillin (100UmL) gentamycin (100 120583gmL) and 10(FBS) at 37∘C and 5 CO

2 For 2-(35 dimethylthiazol-

2 yl)-4 5 dimethyltetrazolium bromide (MTT) assay C6cells were seeded in 96-well plate and were given 24 hourspretreatment of 01 ASH-WEX followed by treatment withdifferent concentrations (25 120583Mndash400 120583M) of lead nitrate for72 hrs 2 hr prior to the completion of the experiment MTT(05mgmL) was added and incubated at 37∘C for 2 hr Themedium was discarded and 100 120583L dimethylsulfoxide wasadded per well to dissolve the formazons The absorbancewas recorded at 550 nm To further evaluate the effect of leadand Ashwagandha on C6 cells the cultures were divided intofour groups control groupwithout any treatment (C) controlgroup with (01) ASH-WEX treatment (CA) lead nitratetreatment group (LN) and combined lead nitrate and ASH-WEX treatment (LN + AS) group 10mM lead nitrate filtersterilized stock solution was prepared The cells were seededalong with 01ASH-WEX Cells were allowed to grow for 24hours followed by lead nitrate (200120583M) treatment for 72 hrs

23 Experimental Animals The Wistar strain young malealbino rats in age group 2-3 months weighing 100ndash150mgwere taken All procedures for animals care were carriedout strictly in accordance with the guidelines of InstitutionalAnimal Ethical Committee The animals were divided intothree groups namely group C LN and LN+AS each having4-5 rats and were kept in single cage and provided water andfood ad libitum Animals of group C were kept as control(fed equal volume of vehicle) group LN was treated withlead nitrate (40mgkg body weight) intraperitoneally andgroup LN + AS was fed orally ASH-WEX (1 gmkg bodyweight) and injected lead nitrate (40mgkg body weight)intraperitoneally for 15 days simultaneously

24 Immunostaining The C6 cells were seeded in multiwellplates on polylysine coated cover slips After the completionof treatment the cells were washed with ice cold PBS threetimes for 5 minutes Cells were fixed with chilled 4 PFAfor 15 minutes After washing with PBS for 3x5 minutes cellswere permeabilized with 03 PBST for 15 minutes Blockingwas carried out with 5 NGS and 1 BSA in 01 PBST for 2hours at room temperature Cells were incubated in primaryantibody (prepared in blocking solution) GFAP (1 500Sigma) HSP70 (1 1000 Sigma clone BRM-22) mortalin(1 500 gift sample from Dr Renu Wadhwa) and NCAM(1 500 Abcys) for 48 hours at 4∘C After washings with

BioMed Research International 3

PBST (01) cellswere incubated in FITCTRITCconjugatedsecondary antibody (1 200) for 2 hours at room temperatureCover slips were mounted with antifading mediumThe cellswere observed under fluorescent microscope (Nikon E600)and images were captured and analyzed using Image-Pro Plussoftware version 451

25 Immunohistochemistry Brains from animals of all threegroups control lead nitrate and lead nitrate with Ashwa-gandha treated rats (119873 = 4-5 for each groups) were perfusedtranscardially with 4paraformaldehyde in phosphate buffersaline (PBS) (01M) and then cryopreserved in 20 and30 sucrose in phosphate buffer saline each for 24 hrs at4∘C 30 120583m coronal sections of brain were cut using cryostatmicrotome set at minus20∘C and sections were washed in 1X PBS(3X for 15min) Sections were then permeabilized in 03PBS-Triton X-100 (pH 74 01M) for 30min Then sectionswere washed with 01 PBST for 15min After washingsections were preincubated for 1 hr at room temperaturein blocking solution 5 NGS in PBS with 032 TritonX-100 for blocking nonspecific binding sites The sectionswere then incubated in the primary antibody anti-IgG forGFAP with appropriate dilution (1 500) in 032 PBST for48 hrs at 4∘C Sections were then washed in 01 PBST andincubated with fluorescent conjugated secondary antibody(anti-mouse IgG FITC diluted 1 200 for GFAP) in 03PBST for 2 hrs Sections were then mounted on the glassslide and covered with antifading mounting fluoromountmedium for capturing fluorescent images using Nikon E600fluorescent microscope and CoolSnap CCD camera GFAPimmunostaining was observed in hippocampus hypothala-mus and cortex regions of brain Quantitative image anal-ysis for immunostaining intensity measurement was doneusing Image-ProPlus version 451 (MediaCybernetics USA)Intensity of immunoreactivity and the number of GFAPpositive cells were quantified in random selected fields in eachsection using the countsize command of Image-Pro Plussoftware

26 Western Blotting

261 Sample Preparation After 72 hr of treatment the cellswere washed with PBS and were harvested with PBS-EDTA(1mM) The pellets were homogenized for 2 minutes and thehomogenate so produced was centrifuged at 10000 rpm for15 minutes at 4∘C Supernatant was collected and the proteinwas estimated using Bradfordrsquos method

For in vivo studies animals from all three groups (119899 =3 for each group) control lead nitrate and lead nitratewith Ashwagandha were sacrificed by cervical dislocationand decapitated Brain was dissected and brain regionshippocampus (HC) hypothalamus (HT) and cortex wereseparated Different brain regions and peripheral organs suchas liver kidney and heart were homogenized in 5 vol ofchilled homogenizing buffer containing 20mMTris 150mMNaCl 10mM NaF 1mM NaVO

4 001mM PMSF DTT and

1 tritonX-100 and centrifuged for 10min at 10000 rpmProtein content in supernatant was determined by theBradford method Each homogenate was then diluted in

homogenization buffer so as to equilibrate the protein contentin all the samples

262 SDS-PAGE and Chemiluminescence Detection TheSDS-PAGE electrophoresis was carried out under standarddenaturing conditions at 15mA After electrophoresis theresolved proteins were transferred (semidry transfer) to blotPVDFmembrane Immobilon P (Millipore)The transfer wascarried out at 25V for 2 hr After transfer the membrane wasput in nonfat protein (5 skimmed milk in 01 TBST) for2 hr at room temperatureThemembrane was incubated withmonoclonal antibody for GFAP (1 2500) HSP70 (1 5000)and mortalin (1 1000) in blocking solution overnight at4∘C Membrane was subjected to three washings with 01TBST each for 5min followed by incubation with 1 7000dilutedHRP conjugated goat anti-mouse IgG for 2 hr at roomtemperature Enhanced chemiluminescence (ECL) was usedfor the detection of protein bands of interest The developedblots were subjected to analysis by intensity measurementusing Alpha Imager Software

27 qRT-PCR Total RNA was extracted from cells by theTRI reagent (Sigma) according to themanufacturerrsquos instruc-tion The integrity of the isolated RNA was checked bynondenaturing agarose gel electrophoresis Equal amountsof RNA were used for cDNA synthesis cDNAs were syn-thesized in 20120583L reactions containing 200 units M-MLVreverse transcriptase 4120583L 5X first strand buffer 2 120583L DTT(01M) (Invitrogen) 5 120583g of total RNA 1mM each of dNTPs(Amersham) 20 units of ribonuclease inhibitor (Sigma) and250 ng pd(N)6 random hexamers (MBI Fermentas)

2120583L of cDNA was amplified in a 50120583L PCR reactionmixture containing two units Taq polymerase 5120583L 10X PCRbuffer 15 120583L of 50mM MgCl

2(Invitrogen) 1 120583L of 10mM

dNTP mix (Amersham) and 20pM respective primers aslisted in Table 1 Cycling conditions comprised an initialdenaturation of 3min at 94∘C followed by 35 cycles ofamplification (at 94∘C for 40 sec 55∘C for 45 sec and 72∘C for1min) and final elongation step at 72∘C for 10min To controlthe PCR reaction components and the integrity of the RNA2 120583L of each cDNA sample was amplified separately for 120573-actin specific primer

28 Estimation of Activities of Antioxidative Enzyme andLevels of Antioxidants

281 Preparation of Sample Animals from all three groups(119899 = 5 for each group) control lead nitrate and leadnitrate along with Ashwagandha were sacrificed by cervicaldislocation and decapitated Brain was dissected and brainregions hippocampus (HC) hypothalamus (HT) and cortexwere separated Different brain regions and peripheral organssuch as liver and kidney were homogenized in 10 volumeof child homogenizing buffer containing 250mM sucrose12mM Tris-HCl and 01mM DDT at pH 74 Homogenateswere centrifuged at 10000 rpm and used for further estima-tion of antioxidative enzymes

4 BioMed Research International

Table 1 Primer sequences used for semiquantitative RT-PCR

Number mRNA Primer sequence Expected product size

1 GFAP F 51015840GGC GCT CAA TGC TGG CTT CA31015840 326 bpR 51015840TCT GCC TCC AGC CTC AGG TT31015840

2 HSP70 F 51015840GAG TTC AAG CGC AAA CAC AA31015840 428 bpR 51015840CTC AGA CTT GTC GCC AAT GA31015840

3 NCAM F 51015840GCC AAG GAG AAA TCA GCG TTG GAG AGT C31015840 651 bpR 51015840ATG CTC TTC AGG GTC AAG GAG GAC ACA C31015840

4 Mortalin F 51015840CAG TCT TCT GGT GGA TTA AG31015840 420 bpR 51015840ATT AGC ACC GTC ACG TAA CAC CTC31015840

5 120573-Actin F 51015840TCACCCACACTGTGCCCATCTACGA31015840 285 bpR 51015840CAGCGGAACCGCTCATTGCCAATGG31015840

282 Estimation of Catalase Catalase activity was measuredaccording to the method of Aebi [27] The reaction mixture(1mL) contained 08mL phosphate buffer (02M pH 70)having 12mM H

2O2vol substrate 100 120583L enzyme sample to

make up the volume The change in absorbanceminute wastaken at 240 nm against H

2O2-phosphate buffer as blank

Enzyme activity was determined as one unit of catalase equalto decomposition of 1 120583m of H

2O2per min at pH 70 at 25∘C

283 Estimation of Cu-Zn SOD Activity of superoxidedismutase (SOD) was estimated according to the methodof Kono [28] The principle involved the inhibitory effectsof SOD on the reduction of nitro blue tetrazolium (NBT)dye by superoxide radicals which are generated by theautoxidation of hydroxylamine hydrochloride Briefly thereaction mixture contained 13mL sodium carbonate buffer(50mM) pH 100 500 120583L NBT (96 120583M) and 100 120583L TritonX-100 (06)The reactionwas initiated by addition of 100 120583Lof hydroxylamine hydrochloride (20mM) pH 60 After2min 50120583L enzyme sample was added and the percentageof inhibition in the rate of NBT reduction was recordedOne unit of enzyme activity was expressed as inverse of theamount of mg protein required to inhibit the reduction ofNBT by 50 The reduction of NBT was followed by anabsorbance increase at 540 nm

284 Assay of Glutathione Peroxides (GSH) Content TheGSH content in the samples was determined as describedby Sedlak and Lindsay [29] 100 120583L of enzyme sample of allthe groups (distilled water in the case of blank) was mixedwith 44mL of (001M) EDTA and 500120583L of trichloroaceticacid (50wv)The contents were centrifuged at 3000 g for 15minutes The supernatant so obtained was mixed with 50 120583Lof 5-51015840-dithiobis (2-nitrobenzoic acid) (001M) The yellowcolor formed was read at 412 nm

285 Estimation of Lipid Peroxidation (LPx) Method ofBuege and Aust [30] was followed to measure the lipidperoxidation level 100 120583L sample was incubated with 100 120583Leach of FeSO

4(1mM) ascorbic acid (15mM) and Tris-HCl

buffer (150mM pH 71) in a final volume made to 1mLmade up by DDW for 15 minutes at 37∘C The reaction was

stopped by adding 1mL of trichloroacetic acid (10wv)This was followed by addition of 2mL thiobarbituric acid(0375wv) After being kept in boiling water bath for15min contents were cooled off and then centrifuged Theabsorbance of supernatant so obtained was measured at532 nm The extent of lipid peroxidation was expressed asnanomoles of malondialdehyde consumed per minute at25∘C

29 Statistical Analysis Data of MTT immunostainingintensity Western blotting and RT-PCR was analyzed sta-tistically using Sigma Stat for Windows (version 35) Theresults were analyzed using one way ANOVA to determinethe significance of the mean between the groups followed bypost hoc comparison using Bonferroni test Values of 119875 le005 were considered significant The means of the data arepresented together with the standard error mean (SEM)

3 Results

31 ASH-WEX Modulates Lead Induced MorphologicalChanges as well as Viability in C6 Glioma Cells Therewas significant decrease in cell viability as compared tocontrol with an increase in lead nitrate concentrations(50 120583M onwards) The IC50 value was found to be around200120583M lead nitrate concentration which was used forfurther experiments The ASH-WEX pretreated group (LN+ AS) showed significantly higher survival rate as comparedto LN group (119875 lt 0001) at 50 100 and 200120583M leadconcentrations Results are presented in Figure 1(a) No suchprotective effect was observed at 400 120583M lead concentrationsin the presence of ASH-WEX

The control and 01 Ashwagandha pretreated cultureswere found to be confluent with typical morphology of C6cells Most of the cells in LN group showed rounding upand altered morphology as compared to control cells Cellsgrown with 01 Ashwagandha and treated with 200120583Mconcentrations of lead nitrate (LN + AS) showed differenti-ated morphology (Figure 1(b)) No significant difference wasobserved in the viability of the cells in the control and CAgroup whereas with increase in concentration of lead nitratethe number of cells decreased The Hoechst 33258 stainingfurther supported the cell viability assay results as there were

BioMed Research International 5

Lead nitrate

Cel

l via

bilit

y (

)

Lead nitrate concentration (120583M)

Lead nitrate + ASH-WEX

120

100

80

60

40

20

0

lowast

lowast

lowast

lowast

0 25 50 100 200 400

(a)

(b)

(c)

C CA LN LN + AS

C CA LN LN + AS

Figure 1 ASH-WEX protects against lead induced toxicity (a) Relative cell viability of C6 glioma cells after lead induced toxicity as assessedby MTT assay C6 cells were grown and pretreated with ASH-WEX (01) 24 hours before exposure to lead nitrate (25ndash400120583M) and grownfor 48ndash72 h Lead nitrate significantly reduced the viable cells at 50120583M and higher concentrations ASH-WEX treated cells were significantlyhigher in viability as compared to respective lead nitrate treated groups (in 50 100 and 200120583M) Data are representative of four differentexperiments and are expressed as mean plusmn SEM (b) Representative phase contrast pictures of control (C) control with ASH-WEX (01)pretreatment (CA) lead nitrate 200 120583M(LN) and lead nitrate after pretreatment with ASH-WEX (LN +AS) treatment Images were capturedusing Nikon TE-2000 microscope There was a significant difference in the cell number and morphology in lead nitrate treated cells ascompared to control cells which appeared to be noramlized by ASH-WEX pretreatment in LN +AS group (c) Cell death observed byHoechst33258 staining After the cells were treated with lead nitrate and ASH-WEX Hoechst 33258 staining was used to observe the morphologicalchanges of cell nucleus such as condensation of chromatin and nuclear fragmentations and higher intensity of stain were found clearly in leadnitrate treated group as compared to control and LN + AS group

most of the cell nuclei in LN group appeared to be withhigher intensity of stain due to chromatin condensation andnuclear fragmentation as compared to control cell nuclei Nosuch difference was observed in the LN + AS group nuclei(Figure 1(c))

32 ASH-WEX Normalizes GFAP Expression Stress ResponseProteins and NCAM In Vitro after Acute Lead ExposureGFAP HSP70 and mortalin protein expression was anal-ysed using immunostaining and Western blotting GFAPexpression was lower in the control group as compared toCA group Upon lead treatment the expression increasedsignificantly (Figures 2(a) and 2(b)) and was normalisedupon Ashwagandha treatment in LN + AS group (119875 lt005) The immunostaining results were further supportedby Western blotting analysis for GFAP (Figure 2(c)) RT-PCR results for GFAP mRNA also showed similar resultswith maximum expression in LN group and normaliza-tion upon Ashwagandha treatment (Figure 2(d)) SimilarlyHSP70 protein expression was enhanced in LN group uponlead treatment which was significantly reduced (119875 lt 005)in LN + AS group as compared to LN group (Figures3(a) and 3(b)) Western blotting and RT-PCR results forHSP70 protein further revealed similar trend as shown inFigures 3(c) and 3(d) The mitochondrial Mortalin (themitochondrial HSP70) was perinuclear in control cells whichis a characteristic pattern of transformed cells Upon 01Ashwagandha treatment the localization of mortalin seemed

to be redistributed in the cytoplasm The mortalin proteinexpression was significantly increased in the LN group andwas normalized in the LN + AS group The results are shownin Figures 4(a) and 4(b) The protein expression as analysedby Western blotting further revealed significant increase inmortalin expression upon lead exposure (Figure 4(c)) whichwas normalized in the presence of ASH-WEX (LN + ASgroup) Similarly there was increase in mortalin mRNAexpression upon lead treatment in LN group Ashwagandhatreatment leads to decline in the mortalin mRNA expressionin the LN+AS group as compared to LN group (Figure 4(d))Lead nitrate treatment apparently reducedNCAMexpressionin the LN group as compared to control and CA groupsAshwagandha treatment of lead exposed C6 cells showedenhanced NCAM expression in the LN + AS group as shownby immunostaining in Figure 5(a)These results were furthersupported by semiquantitative RT-PCR data (Figure 5(b))The rescue of C6 cells by ASH-WEX is also apparent fromthe morphology of cells in LN + AS group as the cells showedlong processes with distinct NCAM cell surface on both thecell bodies and processes

33 ASH-WEX Modulates GFAP Expression in Brain Regionsafter Lead Exposure GFAP is excellent marker of astrocytesactivation which responds toCNS damagewith reactive glio-sis induced bymany neurotoxic agents Immunohistochemi-cal staining was done to localize the GFAP protein expression

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

2 BioMed Research International

which is involved in controlling movement and shape ofastrocytes differentiation marker of glial cellsand increasedGFAP expression which has been associated with aging [1112] Astrocytes are important target of lead toxicity and takeup lead to store it intracellularly and by sequestering leadastrocytes may protect more sensitive neurons [13] It iswell established on getting exposed to stress the glial cellsreact by upregulating GFAP expression known as reactivegliosis [14 15] It is necessary for CNS morphogenesis as itprovides structural support to neurons [16] and hence it isconsidered as amarker of glial plasticity which controls struc-ture proliferation and adhesion of astrocytes neuron gliainteractions and CNS mechanisms Therefore glial cell lossmay contribute to the impairment of learning and memoryTherapeutic approaches to combat humanneurodegenerativediseases thus need to restore the function of both neurons andglial cells [10]

Various cellular proteins are altered upon challenge oflead induced oxidative stress andmany undesired side effectsof lead induced toxicity are known which include neuro-logical [16] behavioural [17] immunological [18] renal [19]and hepatic [20] dysfunctions We examined the expres-sion of several proteins including HSP70 mortalin proteinimmunoglobulin superfamily protein NCAM and an inter-mediate filament proteinGFAP to assess Ashwagandhamedi-ated rejuvenating effects on characteristics like proliferationadhesion and differentiation Lead toxicity is well knownfor causing oxidative stress in brain cells which can lead todamage and eventual cell death HSP70 acts as molecularchaperon and assists in the correct folding of the target pro-teins and it is induced under various environmental stresses[21] To further study the protective effect of Ashwagandha intissues other than the brain HSP70 expression was also stud-ied in the peripheral organs liver kidney and heartMortalinhas been shown to regulate the homeostasis of Ca++ in themitochondria that are very important for neuron functioning[22]NCAMregulates cell adhesion andneurite outgrowth bymeans of homophilic binding and subsequent activation andintracellular signalling through mitogen activated proteinkinase (MAPK) pathway [23] NCAM is neuronal plasticitymarker involved in cell adhesion migration and neuriteextension [24] The low-level lead exposure has been shownto attenuate the expression of all threemajorNCAM isoformsand induced reductions in neuronal growth and survival [25]

Nervous tissues have high lipid contents thus possesshigh aerobic metabolic activity which makes it more sus-ceptible to oxidative damage [26] C6 glioma cell line iswell-established in vitro model system for toxicity studiesdue to its astroglial origin The present study was aimedat evaluating the cytoprotective potential of Ashwagandhaleaf water extract against lead induced toxicity using both invitro and in vivo model systems To achieve these objectivesprotein and mRNA expression of markers of differentiationsuch as GFAP and NCAM as well as cytoprotection likeHSP70 and mortalin were studied Further protective effectsof Ashwagandha leaf extract were evaluated in the brain andperipheral organs in lead intoxicated animal model system

2 Material and Methods

21 Preparation of Water Extract of Ashwagandha Leaves(ASH-WEX) The Ashwagandha leaf extract was preparedby suspending 10 g of dry leaf powder in 100mL of doubledistilled water The suspension was stirred at 45 plusmn 5∘Covernight and filtered The filtrate so obtained was treated as100 water extract

22 C6 Glioma Cell Culture and Its Treatment C6 gliomacell line was obtained from National Centre for Cell Sci-ence (NCCS) Pune India The cell line was maintainedon DMEM supplemented with streptomycin (100UmL)penicillin (100UmL) gentamycin (100 120583gmL) and 10(FBS) at 37∘C and 5 CO

2 For 2-(35 dimethylthiazol-

2 yl)-4 5 dimethyltetrazolium bromide (MTT) assay C6cells were seeded in 96-well plate and were given 24 hourspretreatment of 01 ASH-WEX followed by treatment withdifferent concentrations (25 120583Mndash400 120583M) of lead nitrate for72 hrs 2 hr prior to the completion of the experiment MTT(05mgmL) was added and incubated at 37∘C for 2 hr Themedium was discarded and 100 120583L dimethylsulfoxide wasadded per well to dissolve the formazons The absorbancewas recorded at 550 nm To further evaluate the effect of leadand Ashwagandha on C6 cells the cultures were divided intofour groups control groupwithout any treatment (C) controlgroup with (01) ASH-WEX treatment (CA) lead nitratetreatment group (LN) and combined lead nitrate and ASH-WEX treatment (LN + AS) group 10mM lead nitrate filtersterilized stock solution was prepared The cells were seededalong with 01ASH-WEX Cells were allowed to grow for 24hours followed by lead nitrate (200120583M) treatment for 72 hrs

23 Experimental Animals The Wistar strain young malealbino rats in age group 2-3 months weighing 100ndash150mgwere taken All procedures for animals care were carriedout strictly in accordance with the guidelines of InstitutionalAnimal Ethical Committee The animals were divided intothree groups namely group C LN and LN+AS each having4-5 rats and were kept in single cage and provided water andfood ad libitum Animals of group C were kept as control(fed equal volume of vehicle) group LN was treated withlead nitrate (40mgkg body weight) intraperitoneally andgroup LN + AS was fed orally ASH-WEX (1 gmkg bodyweight) and injected lead nitrate (40mgkg body weight)intraperitoneally for 15 days simultaneously

24 Immunostaining The C6 cells were seeded in multiwellplates on polylysine coated cover slips After the completionof treatment the cells were washed with ice cold PBS threetimes for 5 minutes Cells were fixed with chilled 4 PFAfor 15 minutes After washing with PBS for 3x5 minutes cellswere permeabilized with 03 PBST for 15 minutes Blockingwas carried out with 5 NGS and 1 BSA in 01 PBST for 2hours at room temperature Cells were incubated in primaryantibody (prepared in blocking solution) GFAP (1 500Sigma) HSP70 (1 1000 Sigma clone BRM-22) mortalin(1 500 gift sample from Dr Renu Wadhwa) and NCAM(1 500 Abcys) for 48 hours at 4∘C After washings with

BioMed Research International 3

PBST (01) cellswere incubated in FITCTRITCconjugatedsecondary antibody (1 200) for 2 hours at room temperatureCover slips were mounted with antifading mediumThe cellswere observed under fluorescent microscope (Nikon E600)and images were captured and analyzed using Image-Pro Plussoftware version 451

25 Immunohistochemistry Brains from animals of all threegroups control lead nitrate and lead nitrate with Ashwa-gandha treated rats (119873 = 4-5 for each groups) were perfusedtranscardially with 4paraformaldehyde in phosphate buffersaline (PBS) (01M) and then cryopreserved in 20 and30 sucrose in phosphate buffer saline each for 24 hrs at4∘C 30 120583m coronal sections of brain were cut using cryostatmicrotome set at minus20∘C and sections were washed in 1X PBS(3X for 15min) Sections were then permeabilized in 03PBS-Triton X-100 (pH 74 01M) for 30min Then sectionswere washed with 01 PBST for 15min After washingsections were preincubated for 1 hr at room temperaturein blocking solution 5 NGS in PBS with 032 TritonX-100 for blocking nonspecific binding sites The sectionswere then incubated in the primary antibody anti-IgG forGFAP with appropriate dilution (1 500) in 032 PBST for48 hrs at 4∘C Sections were then washed in 01 PBST andincubated with fluorescent conjugated secondary antibody(anti-mouse IgG FITC diluted 1 200 for GFAP) in 03PBST for 2 hrs Sections were then mounted on the glassslide and covered with antifading mounting fluoromountmedium for capturing fluorescent images using Nikon E600fluorescent microscope and CoolSnap CCD camera GFAPimmunostaining was observed in hippocampus hypothala-mus and cortex regions of brain Quantitative image anal-ysis for immunostaining intensity measurement was doneusing Image-ProPlus version 451 (MediaCybernetics USA)Intensity of immunoreactivity and the number of GFAPpositive cells were quantified in random selected fields in eachsection using the countsize command of Image-Pro Plussoftware

26 Western Blotting

261 Sample Preparation After 72 hr of treatment the cellswere washed with PBS and were harvested with PBS-EDTA(1mM) The pellets were homogenized for 2 minutes and thehomogenate so produced was centrifuged at 10000 rpm for15 minutes at 4∘C Supernatant was collected and the proteinwas estimated using Bradfordrsquos method

For in vivo studies animals from all three groups (119899 =3 for each group) control lead nitrate and lead nitratewith Ashwagandha were sacrificed by cervical dislocationand decapitated Brain was dissected and brain regionshippocampus (HC) hypothalamus (HT) and cortex wereseparated Different brain regions and peripheral organs suchas liver kidney and heart were homogenized in 5 vol ofchilled homogenizing buffer containing 20mMTris 150mMNaCl 10mM NaF 1mM NaVO

4 001mM PMSF DTT and

1 tritonX-100 and centrifuged for 10min at 10000 rpmProtein content in supernatant was determined by theBradford method Each homogenate was then diluted in

homogenization buffer so as to equilibrate the protein contentin all the samples

262 SDS-PAGE and Chemiluminescence Detection TheSDS-PAGE electrophoresis was carried out under standarddenaturing conditions at 15mA After electrophoresis theresolved proteins were transferred (semidry transfer) to blotPVDFmembrane Immobilon P (Millipore)The transfer wascarried out at 25V for 2 hr After transfer the membrane wasput in nonfat protein (5 skimmed milk in 01 TBST) for2 hr at room temperatureThemembrane was incubated withmonoclonal antibody for GFAP (1 2500) HSP70 (1 5000)and mortalin (1 1000) in blocking solution overnight at4∘C Membrane was subjected to three washings with 01TBST each for 5min followed by incubation with 1 7000dilutedHRP conjugated goat anti-mouse IgG for 2 hr at roomtemperature Enhanced chemiluminescence (ECL) was usedfor the detection of protein bands of interest The developedblots were subjected to analysis by intensity measurementusing Alpha Imager Software

27 qRT-PCR Total RNA was extracted from cells by theTRI reagent (Sigma) according to themanufacturerrsquos instruc-tion The integrity of the isolated RNA was checked bynondenaturing agarose gel electrophoresis Equal amountsof RNA were used for cDNA synthesis cDNAs were syn-thesized in 20120583L reactions containing 200 units M-MLVreverse transcriptase 4120583L 5X first strand buffer 2 120583L DTT(01M) (Invitrogen) 5 120583g of total RNA 1mM each of dNTPs(Amersham) 20 units of ribonuclease inhibitor (Sigma) and250 ng pd(N)6 random hexamers (MBI Fermentas)

2120583L of cDNA was amplified in a 50120583L PCR reactionmixture containing two units Taq polymerase 5120583L 10X PCRbuffer 15 120583L of 50mM MgCl

2(Invitrogen) 1 120583L of 10mM

dNTP mix (Amersham) and 20pM respective primers aslisted in Table 1 Cycling conditions comprised an initialdenaturation of 3min at 94∘C followed by 35 cycles ofamplification (at 94∘C for 40 sec 55∘C for 45 sec and 72∘C for1min) and final elongation step at 72∘C for 10min To controlthe PCR reaction components and the integrity of the RNA2 120583L of each cDNA sample was amplified separately for 120573-actin specific primer

28 Estimation of Activities of Antioxidative Enzyme andLevels of Antioxidants

281 Preparation of Sample Animals from all three groups(119899 = 5 for each group) control lead nitrate and leadnitrate along with Ashwagandha were sacrificed by cervicaldislocation and decapitated Brain was dissected and brainregions hippocampus (HC) hypothalamus (HT) and cortexwere separated Different brain regions and peripheral organssuch as liver and kidney were homogenized in 10 volumeof child homogenizing buffer containing 250mM sucrose12mM Tris-HCl and 01mM DDT at pH 74 Homogenateswere centrifuged at 10000 rpm and used for further estima-tion of antioxidative enzymes

4 BioMed Research International

Table 1 Primer sequences used for semiquantitative RT-PCR

Number mRNA Primer sequence Expected product size

1 GFAP F 51015840GGC GCT CAA TGC TGG CTT CA31015840 326 bpR 51015840TCT GCC TCC AGC CTC AGG TT31015840

2 HSP70 F 51015840GAG TTC AAG CGC AAA CAC AA31015840 428 bpR 51015840CTC AGA CTT GTC GCC AAT GA31015840

3 NCAM F 51015840GCC AAG GAG AAA TCA GCG TTG GAG AGT C31015840 651 bpR 51015840ATG CTC TTC AGG GTC AAG GAG GAC ACA C31015840

4 Mortalin F 51015840CAG TCT TCT GGT GGA TTA AG31015840 420 bpR 51015840ATT AGC ACC GTC ACG TAA CAC CTC31015840

5 120573-Actin F 51015840TCACCCACACTGTGCCCATCTACGA31015840 285 bpR 51015840CAGCGGAACCGCTCATTGCCAATGG31015840

282 Estimation of Catalase Catalase activity was measuredaccording to the method of Aebi [27] The reaction mixture(1mL) contained 08mL phosphate buffer (02M pH 70)having 12mM H

2O2vol substrate 100 120583L enzyme sample to

make up the volume The change in absorbanceminute wastaken at 240 nm against H

2O2-phosphate buffer as blank

Enzyme activity was determined as one unit of catalase equalto decomposition of 1 120583m of H

2O2per min at pH 70 at 25∘C

283 Estimation of Cu-Zn SOD Activity of superoxidedismutase (SOD) was estimated according to the methodof Kono [28] The principle involved the inhibitory effectsof SOD on the reduction of nitro blue tetrazolium (NBT)dye by superoxide radicals which are generated by theautoxidation of hydroxylamine hydrochloride Briefly thereaction mixture contained 13mL sodium carbonate buffer(50mM) pH 100 500 120583L NBT (96 120583M) and 100 120583L TritonX-100 (06)The reactionwas initiated by addition of 100 120583Lof hydroxylamine hydrochloride (20mM) pH 60 After2min 50120583L enzyme sample was added and the percentageof inhibition in the rate of NBT reduction was recordedOne unit of enzyme activity was expressed as inverse of theamount of mg protein required to inhibit the reduction ofNBT by 50 The reduction of NBT was followed by anabsorbance increase at 540 nm

284 Assay of Glutathione Peroxides (GSH) Content TheGSH content in the samples was determined as describedby Sedlak and Lindsay [29] 100 120583L of enzyme sample of allthe groups (distilled water in the case of blank) was mixedwith 44mL of (001M) EDTA and 500120583L of trichloroaceticacid (50wv)The contents were centrifuged at 3000 g for 15minutes The supernatant so obtained was mixed with 50 120583Lof 5-51015840-dithiobis (2-nitrobenzoic acid) (001M) The yellowcolor formed was read at 412 nm

285 Estimation of Lipid Peroxidation (LPx) Method ofBuege and Aust [30] was followed to measure the lipidperoxidation level 100 120583L sample was incubated with 100 120583Leach of FeSO

4(1mM) ascorbic acid (15mM) and Tris-HCl

buffer (150mM pH 71) in a final volume made to 1mLmade up by DDW for 15 minutes at 37∘C The reaction was

stopped by adding 1mL of trichloroacetic acid (10wv)This was followed by addition of 2mL thiobarbituric acid(0375wv) After being kept in boiling water bath for15min contents were cooled off and then centrifuged Theabsorbance of supernatant so obtained was measured at532 nm The extent of lipid peroxidation was expressed asnanomoles of malondialdehyde consumed per minute at25∘C

29 Statistical Analysis Data of MTT immunostainingintensity Western blotting and RT-PCR was analyzed sta-tistically using Sigma Stat for Windows (version 35) Theresults were analyzed using one way ANOVA to determinethe significance of the mean between the groups followed bypost hoc comparison using Bonferroni test Values of 119875 le005 were considered significant The means of the data arepresented together with the standard error mean (SEM)

3 Results

31 ASH-WEX Modulates Lead Induced MorphologicalChanges as well as Viability in C6 Glioma Cells Therewas significant decrease in cell viability as compared tocontrol with an increase in lead nitrate concentrations(50 120583M onwards) The IC50 value was found to be around200120583M lead nitrate concentration which was used forfurther experiments The ASH-WEX pretreated group (LN+ AS) showed significantly higher survival rate as comparedto LN group (119875 lt 0001) at 50 100 and 200120583M leadconcentrations Results are presented in Figure 1(a) No suchprotective effect was observed at 400 120583M lead concentrationsin the presence of ASH-WEX

The control and 01 Ashwagandha pretreated cultureswere found to be confluent with typical morphology of C6cells Most of the cells in LN group showed rounding upand altered morphology as compared to control cells Cellsgrown with 01 Ashwagandha and treated with 200120583Mconcentrations of lead nitrate (LN + AS) showed differenti-ated morphology (Figure 1(b)) No significant difference wasobserved in the viability of the cells in the control and CAgroup whereas with increase in concentration of lead nitratethe number of cells decreased The Hoechst 33258 stainingfurther supported the cell viability assay results as there were

BioMed Research International 5

Lead nitrate

Cel

l via

bilit

y (

)

Lead nitrate concentration (120583M)

Lead nitrate + ASH-WEX

120

100

80

60

40

20

0

lowast

lowast

lowast

lowast

0 25 50 100 200 400

(a)

(b)

(c)

C CA LN LN + AS

C CA LN LN + AS

Figure 1 ASH-WEX protects against lead induced toxicity (a) Relative cell viability of C6 glioma cells after lead induced toxicity as assessedby MTT assay C6 cells were grown and pretreated with ASH-WEX (01) 24 hours before exposure to lead nitrate (25ndash400120583M) and grownfor 48ndash72 h Lead nitrate significantly reduced the viable cells at 50120583M and higher concentrations ASH-WEX treated cells were significantlyhigher in viability as compared to respective lead nitrate treated groups (in 50 100 and 200120583M) Data are representative of four differentexperiments and are expressed as mean plusmn SEM (b) Representative phase contrast pictures of control (C) control with ASH-WEX (01)pretreatment (CA) lead nitrate 200 120583M(LN) and lead nitrate after pretreatment with ASH-WEX (LN +AS) treatment Images were capturedusing Nikon TE-2000 microscope There was a significant difference in the cell number and morphology in lead nitrate treated cells ascompared to control cells which appeared to be noramlized by ASH-WEX pretreatment in LN +AS group (c) Cell death observed byHoechst33258 staining After the cells were treated with lead nitrate and ASH-WEX Hoechst 33258 staining was used to observe the morphologicalchanges of cell nucleus such as condensation of chromatin and nuclear fragmentations and higher intensity of stain were found clearly in leadnitrate treated group as compared to control and LN + AS group

most of the cell nuclei in LN group appeared to be withhigher intensity of stain due to chromatin condensation andnuclear fragmentation as compared to control cell nuclei Nosuch difference was observed in the LN + AS group nuclei(Figure 1(c))

32 ASH-WEX Normalizes GFAP Expression Stress ResponseProteins and NCAM In Vitro after Acute Lead ExposureGFAP HSP70 and mortalin protein expression was anal-ysed using immunostaining and Western blotting GFAPexpression was lower in the control group as compared toCA group Upon lead treatment the expression increasedsignificantly (Figures 2(a) and 2(b)) and was normalisedupon Ashwagandha treatment in LN + AS group (119875 lt005) The immunostaining results were further supportedby Western blotting analysis for GFAP (Figure 2(c)) RT-PCR results for GFAP mRNA also showed similar resultswith maximum expression in LN group and normaliza-tion upon Ashwagandha treatment (Figure 2(d)) SimilarlyHSP70 protein expression was enhanced in LN group uponlead treatment which was significantly reduced (119875 lt 005)in LN + AS group as compared to LN group (Figures3(a) and 3(b)) Western blotting and RT-PCR results forHSP70 protein further revealed similar trend as shown inFigures 3(c) and 3(d) The mitochondrial Mortalin (themitochondrial HSP70) was perinuclear in control cells whichis a characteristic pattern of transformed cells Upon 01Ashwagandha treatment the localization of mortalin seemed

to be redistributed in the cytoplasm The mortalin proteinexpression was significantly increased in the LN group andwas normalized in the LN + AS group The results are shownin Figures 4(a) and 4(b) The protein expression as analysedby Western blotting further revealed significant increase inmortalin expression upon lead exposure (Figure 4(c)) whichwas normalized in the presence of ASH-WEX (LN + ASgroup) Similarly there was increase in mortalin mRNAexpression upon lead treatment in LN group Ashwagandhatreatment leads to decline in the mortalin mRNA expressionin the LN+AS group as compared to LN group (Figure 4(d))Lead nitrate treatment apparently reducedNCAMexpressionin the LN group as compared to control and CA groupsAshwagandha treatment of lead exposed C6 cells showedenhanced NCAM expression in the LN + AS group as shownby immunostaining in Figure 5(a)These results were furthersupported by semiquantitative RT-PCR data (Figure 5(b))The rescue of C6 cells by ASH-WEX is also apparent fromthe morphology of cells in LN + AS group as the cells showedlong processes with distinct NCAM cell surface on both thecell bodies and processes

33 ASH-WEX Modulates GFAP Expression in Brain Regionsafter Lead Exposure GFAP is excellent marker of astrocytesactivation which responds toCNS damagewith reactive glio-sis induced bymany neurotoxic agents Immunohistochemi-cal staining was done to localize the GFAP protein expression

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 3

PBST (01) cellswere incubated in FITCTRITCconjugatedsecondary antibody (1 200) for 2 hours at room temperatureCover slips were mounted with antifading mediumThe cellswere observed under fluorescent microscope (Nikon E600)and images were captured and analyzed using Image-Pro Plussoftware version 451

25 Immunohistochemistry Brains from animals of all threegroups control lead nitrate and lead nitrate with Ashwa-gandha treated rats (119873 = 4-5 for each groups) were perfusedtranscardially with 4paraformaldehyde in phosphate buffersaline (PBS) (01M) and then cryopreserved in 20 and30 sucrose in phosphate buffer saline each for 24 hrs at4∘C 30 120583m coronal sections of brain were cut using cryostatmicrotome set at minus20∘C and sections were washed in 1X PBS(3X for 15min) Sections were then permeabilized in 03PBS-Triton X-100 (pH 74 01M) for 30min Then sectionswere washed with 01 PBST for 15min After washingsections were preincubated for 1 hr at room temperaturein blocking solution 5 NGS in PBS with 032 TritonX-100 for blocking nonspecific binding sites The sectionswere then incubated in the primary antibody anti-IgG forGFAP with appropriate dilution (1 500) in 032 PBST for48 hrs at 4∘C Sections were then washed in 01 PBST andincubated with fluorescent conjugated secondary antibody(anti-mouse IgG FITC diluted 1 200 for GFAP) in 03PBST for 2 hrs Sections were then mounted on the glassslide and covered with antifading mounting fluoromountmedium for capturing fluorescent images using Nikon E600fluorescent microscope and CoolSnap CCD camera GFAPimmunostaining was observed in hippocampus hypothala-mus and cortex regions of brain Quantitative image anal-ysis for immunostaining intensity measurement was doneusing Image-ProPlus version 451 (MediaCybernetics USA)Intensity of immunoreactivity and the number of GFAPpositive cells were quantified in random selected fields in eachsection using the countsize command of Image-Pro Plussoftware

26 Western Blotting

261 Sample Preparation After 72 hr of treatment the cellswere washed with PBS and were harvested with PBS-EDTA(1mM) The pellets were homogenized for 2 minutes and thehomogenate so produced was centrifuged at 10000 rpm for15 minutes at 4∘C Supernatant was collected and the proteinwas estimated using Bradfordrsquos method

For in vivo studies animals from all three groups (119899 =3 for each group) control lead nitrate and lead nitratewith Ashwagandha were sacrificed by cervical dislocationand decapitated Brain was dissected and brain regionshippocampus (HC) hypothalamus (HT) and cortex wereseparated Different brain regions and peripheral organs suchas liver kidney and heart were homogenized in 5 vol ofchilled homogenizing buffer containing 20mMTris 150mMNaCl 10mM NaF 1mM NaVO

4 001mM PMSF DTT and

1 tritonX-100 and centrifuged for 10min at 10000 rpmProtein content in supernatant was determined by theBradford method Each homogenate was then diluted in

homogenization buffer so as to equilibrate the protein contentin all the samples

262 SDS-PAGE and Chemiluminescence Detection TheSDS-PAGE electrophoresis was carried out under standarddenaturing conditions at 15mA After electrophoresis theresolved proteins were transferred (semidry transfer) to blotPVDFmembrane Immobilon P (Millipore)The transfer wascarried out at 25V for 2 hr After transfer the membrane wasput in nonfat protein (5 skimmed milk in 01 TBST) for2 hr at room temperatureThemembrane was incubated withmonoclonal antibody for GFAP (1 2500) HSP70 (1 5000)and mortalin (1 1000) in blocking solution overnight at4∘C Membrane was subjected to three washings with 01TBST each for 5min followed by incubation with 1 7000dilutedHRP conjugated goat anti-mouse IgG for 2 hr at roomtemperature Enhanced chemiluminescence (ECL) was usedfor the detection of protein bands of interest The developedblots were subjected to analysis by intensity measurementusing Alpha Imager Software

27 qRT-PCR Total RNA was extracted from cells by theTRI reagent (Sigma) according to themanufacturerrsquos instruc-tion The integrity of the isolated RNA was checked bynondenaturing agarose gel electrophoresis Equal amountsof RNA were used for cDNA synthesis cDNAs were syn-thesized in 20120583L reactions containing 200 units M-MLVreverse transcriptase 4120583L 5X first strand buffer 2 120583L DTT(01M) (Invitrogen) 5 120583g of total RNA 1mM each of dNTPs(Amersham) 20 units of ribonuclease inhibitor (Sigma) and250 ng pd(N)6 random hexamers (MBI Fermentas)

2120583L of cDNA was amplified in a 50120583L PCR reactionmixture containing two units Taq polymerase 5120583L 10X PCRbuffer 15 120583L of 50mM MgCl

2(Invitrogen) 1 120583L of 10mM

dNTP mix (Amersham) and 20pM respective primers aslisted in Table 1 Cycling conditions comprised an initialdenaturation of 3min at 94∘C followed by 35 cycles ofamplification (at 94∘C for 40 sec 55∘C for 45 sec and 72∘C for1min) and final elongation step at 72∘C for 10min To controlthe PCR reaction components and the integrity of the RNA2 120583L of each cDNA sample was amplified separately for 120573-actin specific primer

28 Estimation of Activities of Antioxidative Enzyme andLevels of Antioxidants

281 Preparation of Sample Animals from all three groups(119899 = 5 for each group) control lead nitrate and leadnitrate along with Ashwagandha were sacrificed by cervicaldislocation and decapitated Brain was dissected and brainregions hippocampus (HC) hypothalamus (HT) and cortexwere separated Different brain regions and peripheral organssuch as liver and kidney were homogenized in 10 volumeof child homogenizing buffer containing 250mM sucrose12mM Tris-HCl and 01mM DDT at pH 74 Homogenateswere centrifuged at 10000 rpm and used for further estima-tion of antioxidative enzymes

4 BioMed Research International

Table 1 Primer sequences used for semiquantitative RT-PCR

Number mRNA Primer sequence Expected product size

1 GFAP F 51015840GGC GCT CAA TGC TGG CTT CA31015840 326 bpR 51015840TCT GCC TCC AGC CTC AGG TT31015840

2 HSP70 F 51015840GAG TTC AAG CGC AAA CAC AA31015840 428 bpR 51015840CTC AGA CTT GTC GCC AAT GA31015840

3 NCAM F 51015840GCC AAG GAG AAA TCA GCG TTG GAG AGT C31015840 651 bpR 51015840ATG CTC TTC AGG GTC AAG GAG GAC ACA C31015840

4 Mortalin F 51015840CAG TCT TCT GGT GGA TTA AG31015840 420 bpR 51015840ATT AGC ACC GTC ACG TAA CAC CTC31015840

5 120573-Actin F 51015840TCACCCACACTGTGCCCATCTACGA31015840 285 bpR 51015840CAGCGGAACCGCTCATTGCCAATGG31015840

282 Estimation of Catalase Catalase activity was measuredaccording to the method of Aebi [27] The reaction mixture(1mL) contained 08mL phosphate buffer (02M pH 70)having 12mM H

2O2vol substrate 100 120583L enzyme sample to

make up the volume The change in absorbanceminute wastaken at 240 nm against H

2O2-phosphate buffer as blank

Enzyme activity was determined as one unit of catalase equalto decomposition of 1 120583m of H

2O2per min at pH 70 at 25∘C

283 Estimation of Cu-Zn SOD Activity of superoxidedismutase (SOD) was estimated according to the methodof Kono [28] The principle involved the inhibitory effectsof SOD on the reduction of nitro blue tetrazolium (NBT)dye by superoxide radicals which are generated by theautoxidation of hydroxylamine hydrochloride Briefly thereaction mixture contained 13mL sodium carbonate buffer(50mM) pH 100 500 120583L NBT (96 120583M) and 100 120583L TritonX-100 (06)The reactionwas initiated by addition of 100 120583Lof hydroxylamine hydrochloride (20mM) pH 60 After2min 50120583L enzyme sample was added and the percentageof inhibition in the rate of NBT reduction was recordedOne unit of enzyme activity was expressed as inverse of theamount of mg protein required to inhibit the reduction ofNBT by 50 The reduction of NBT was followed by anabsorbance increase at 540 nm

284 Assay of Glutathione Peroxides (GSH) Content TheGSH content in the samples was determined as describedby Sedlak and Lindsay [29] 100 120583L of enzyme sample of allthe groups (distilled water in the case of blank) was mixedwith 44mL of (001M) EDTA and 500120583L of trichloroaceticacid (50wv)The contents were centrifuged at 3000 g for 15minutes The supernatant so obtained was mixed with 50 120583Lof 5-51015840-dithiobis (2-nitrobenzoic acid) (001M) The yellowcolor formed was read at 412 nm

285 Estimation of Lipid Peroxidation (LPx) Method ofBuege and Aust [30] was followed to measure the lipidperoxidation level 100 120583L sample was incubated with 100 120583Leach of FeSO

4(1mM) ascorbic acid (15mM) and Tris-HCl

buffer (150mM pH 71) in a final volume made to 1mLmade up by DDW for 15 minutes at 37∘C The reaction was

stopped by adding 1mL of trichloroacetic acid (10wv)This was followed by addition of 2mL thiobarbituric acid(0375wv) After being kept in boiling water bath for15min contents were cooled off and then centrifuged Theabsorbance of supernatant so obtained was measured at532 nm The extent of lipid peroxidation was expressed asnanomoles of malondialdehyde consumed per minute at25∘C

29 Statistical Analysis Data of MTT immunostainingintensity Western blotting and RT-PCR was analyzed sta-tistically using Sigma Stat for Windows (version 35) Theresults were analyzed using one way ANOVA to determinethe significance of the mean between the groups followed bypost hoc comparison using Bonferroni test Values of 119875 le005 were considered significant The means of the data arepresented together with the standard error mean (SEM)

3 Results

31 ASH-WEX Modulates Lead Induced MorphologicalChanges as well as Viability in C6 Glioma Cells Therewas significant decrease in cell viability as compared tocontrol with an increase in lead nitrate concentrations(50 120583M onwards) The IC50 value was found to be around200120583M lead nitrate concentration which was used forfurther experiments The ASH-WEX pretreated group (LN+ AS) showed significantly higher survival rate as comparedto LN group (119875 lt 0001) at 50 100 and 200120583M leadconcentrations Results are presented in Figure 1(a) No suchprotective effect was observed at 400 120583M lead concentrationsin the presence of ASH-WEX

The control and 01 Ashwagandha pretreated cultureswere found to be confluent with typical morphology of C6cells Most of the cells in LN group showed rounding upand altered morphology as compared to control cells Cellsgrown with 01 Ashwagandha and treated with 200120583Mconcentrations of lead nitrate (LN + AS) showed differenti-ated morphology (Figure 1(b)) No significant difference wasobserved in the viability of the cells in the control and CAgroup whereas with increase in concentration of lead nitratethe number of cells decreased The Hoechst 33258 stainingfurther supported the cell viability assay results as there were

BioMed Research International 5

Lead nitrate

Cel

l via

bilit

y (

)

Lead nitrate concentration (120583M)

Lead nitrate + ASH-WEX

120

100

80

60

40

20

0

lowast

lowast

lowast

lowast

0 25 50 100 200 400

(a)

(b)

(c)

C CA LN LN + AS

C CA LN LN + AS

Figure 1 ASH-WEX protects against lead induced toxicity (a) Relative cell viability of C6 glioma cells after lead induced toxicity as assessedby MTT assay C6 cells were grown and pretreated with ASH-WEX (01) 24 hours before exposure to lead nitrate (25ndash400120583M) and grownfor 48ndash72 h Lead nitrate significantly reduced the viable cells at 50120583M and higher concentrations ASH-WEX treated cells were significantlyhigher in viability as compared to respective lead nitrate treated groups (in 50 100 and 200120583M) Data are representative of four differentexperiments and are expressed as mean plusmn SEM (b) Representative phase contrast pictures of control (C) control with ASH-WEX (01)pretreatment (CA) lead nitrate 200 120583M(LN) and lead nitrate after pretreatment with ASH-WEX (LN +AS) treatment Images were capturedusing Nikon TE-2000 microscope There was a significant difference in the cell number and morphology in lead nitrate treated cells ascompared to control cells which appeared to be noramlized by ASH-WEX pretreatment in LN +AS group (c) Cell death observed byHoechst33258 staining After the cells were treated with lead nitrate and ASH-WEX Hoechst 33258 staining was used to observe the morphologicalchanges of cell nucleus such as condensation of chromatin and nuclear fragmentations and higher intensity of stain were found clearly in leadnitrate treated group as compared to control and LN + AS group

most of the cell nuclei in LN group appeared to be withhigher intensity of stain due to chromatin condensation andnuclear fragmentation as compared to control cell nuclei Nosuch difference was observed in the LN + AS group nuclei(Figure 1(c))

32 ASH-WEX Normalizes GFAP Expression Stress ResponseProteins and NCAM In Vitro after Acute Lead ExposureGFAP HSP70 and mortalin protein expression was anal-ysed using immunostaining and Western blotting GFAPexpression was lower in the control group as compared toCA group Upon lead treatment the expression increasedsignificantly (Figures 2(a) and 2(b)) and was normalisedupon Ashwagandha treatment in LN + AS group (119875 lt005) The immunostaining results were further supportedby Western blotting analysis for GFAP (Figure 2(c)) RT-PCR results for GFAP mRNA also showed similar resultswith maximum expression in LN group and normaliza-tion upon Ashwagandha treatment (Figure 2(d)) SimilarlyHSP70 protein expression was enhanced in LN group uponlead treatment which was significantly reduced (119875 lt 005)in LN + AS group as compared to LN group (Figures3(a) and 3(b)) Western blotting and RT-PCR results forHSP70 protein further revealed similar trend as shown inFigures 3(c) and 3(d) The mitochondrial Mortalin (themitochondrial HSP70) was perinuclear in control cells whichis a characteristic pattern of transformed cells Upon 01Ashwagandha treatment the localization of mortalin seemed

to be redistributed in the cytoplasm The mortalin proteinexpression was significantly increased in the LN group andwas normalized in the LN + AS group The results are shownin Figures 4(a) and 4(b) The protein expression as analysedby Western blotting further revealed significant increase inmortalin expression upon lead exposure (Figure 4(c)) whichwas normalized in the presence of ASH-WEX (LN + ASgroup) Similarly there was increase in mortalin mRNAexpression upon lead treatment in LN group Ashwagandhatreatment leads to decline in the mortalin mRNA expressionin the LN+AS group as compared to LN group (Figure 4(d))Lead nitrate treatment apparently reducedNCAMexpressionin the LN group as compared to control and CA groupsAshwagandha treatment of lead exposed C6 cells showedenhanced NCAM expression in the LN + AS group as shownby immunostaining in Figure 5(a)These results were furthersupported by semiquantitative RT-PCR data (Figure 5(b))The rescue of C6 cells by ASH-WEX is also apparent fromthe morphology of cells in LN + AS group as the cells showedlong processes with distinct NCAM cell surface on both thecell bodies and processes

33 ASH-WEX Modulates GFAP Expression in Brain Regionsafter Lead Exposure GFAP is excellent marker of astrocytesactivation which responds toCNS damagewith reactive glio-sis induced bymany neurotoxic agents Immunohistochemi-cal staining was done to localize the GFAP protein expression

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 BioMed Research International

Table 1 Primer sequences used for semiquantitative RT-PCR

Number mRNA Primer sequence Expected product size

1 GFAP F 51015840GGC GCT CAA TGC TGG CTT CA31015840 326 bpR 51015840TCT GCC TCC AGC CTC AGG TT31015840

2 HSP70 F 51015840GAG TTC AAG CGC AAA CAC AA31015840 428 bpR 51015840CTC AGA CTT GTC GCC AAT GA31015840

3 NCAM F 51015840GCC AAG GAG AAA TCA GCG TTG GAG AGT C31015840 651 bpR 51015840ATG CTC TTC AGG GTC AAG GAG GAC ACA C31015840

4 Mortalin F 51015840CAG TCT TCT GGT GGA TTA AG31015840 420 bpR 51015840ATT AGC ACC GTC ACG TAA CAC CTC31015840

5 120573-Actin F 51015840TCACCCACACTGTGCCCATCTACGA31015840 285 bpR 51015840CAGCGGAACCGCTCATTGCCAATGG31015840

282 Estimation of Catalase Catalase activity was measuredaccording to the method of Aebi [27] The reaction mixture(1mL) contained 08mL phosphate buffer (02M pH 70)having 12mM H

2O2vol substrate 100 120583L enzyme sample to

make up the volume The change in absorbanceminute wastaken at 240 nm against H

2O2-phosphate buffer as blank

Enzyme activity was determined as one unit of catalase equalto decomposition of 1 120583m of H

2O2per min at pH 70 at 25∘C

283 Estimation of Cu-Zn SOD Activity of superoxidedismutase (SOD) was estimated according to the methodof Kono [28] The principle involved the inhibitory effectsof SOD on the reduction of nitro blue tetrazolium (NBT)dye by superoxide radicals which are generated by theautoxidation of hydroxylamine hydrochloride Briefly thereaction mixture contained 13mL sodium carbonate buffer(50mM) pH 100 500 120583L NBT (96 120583M) and 100 120583L TritonX-100 (06)The reactionwas initiated by addition of 100 120583Lof hydroxylamine hydrochloride (20mM) pH 60 After2min 50120583L enzyme sample was added and the percentageof inhibition in the rate of NBT reduction was recordedOne unit of enzyme activity was expressed as inverse of theamount of mg protein required to inhibit the reduction ofNBT by 50 The reduction of NBT was followed by anabsorbance increase at 540 nm

284 Assay of Glutathione Peroxides (GSH) Content TheGSH content in the samples was determined as describedby Sedlak and Lindsay [29] 100 120583L of enzyme sample of allthe groups (distilled water in the case of blank) was mixedwith 44mL of (001M) EDTA and 500120583L of trichloroaceticacid (50wv)The contents were centrifuged at 3000 g for 15minutes The supernatant so obtained was mixed with 50 120583Lof 5-51015840-dithiobis (2-nitrobenzoic acid) (001M) The yellowcolor formed was read at 412 nm

285 Estimation of Lipid Peroxidation (LPx) Method ofBuege and Aust [30] was followed to measure the lipidperoxidation level 100 120583L sample was incubated with 100 120583Leach of FeSO

4(1mM) ascorbic acid (15mM) and Tris-HCl

buffer (150mM pH 71) in a final volume made to 1mLmade up by DDW for 15 minutes at 37∘C The reaction was

stopped by adding 1mL of trichloroacetic acid (10wv)This was followed by addition of 2mL thiobarbituric acid(0375wv) After being kept in boiling water bath for15min contents were cooled off and then centrifuged Theabsorbance of supernatant so obtained was measured at532 nm The extent of lipid peroxidation was expressed asnanomoles of malondialdehyde consumed per minute at25∘C

29 Statistical Analysis Data of MTT immunostainingintensity Western blotting and RT-PCR was analyzed sta-tistically using Sigma Stat for Windows (version 35) Theresults were analyzed using one way ANOVA to determinethe significance of the mean between the groups followed bypost hoc comparison using Bonferroni test Values of 119875 le005 were considered significant The means of the data arepresented together with the standard error mean (SEM)

3 Results

31 ASH-WEX Modulates Lead Induced MorphologicalChanges as well as Viability in C6 Glioma Cells Therewas significant decrease in cell viability as compared tocontrol with an increase in lead nitrate concentrations(50 120583M onwards) The IC50 value was found to be around200120583M lead nitrate concentration which was used forfurther experiments The ASH-WEX pretreated group (LN+ AS) showed significantly higher survival rate as comparedto LN group (119875 lt 0001) at 50 100 and 200120583M leadconcentrations Results are presented in Figure 1(a) No suchprotective effect was observed at 400 120583M lead concentrationsin the presence of ASH-WEX

The control and 01 Ashwagandha pretreated cultureswere found to be confluent with typical morphology of C6cells Most of the cells in LN group showed rounding upand altered morphology as compared to control cells Cellsgrown with 01 Ashwagandha and treated with 200120583Mconcentrations of lead nitrate (LN + AS) showed differenti-ated morphology (Figure 1(b)) No significant difference wasobserved in the viability of the cells in the control and CAgroup whereas with increase in concentration of lead nitratethe number of cells decreased The Hoechst 33258 stainingfurther supported the cell viability assay results as there were

BioMed Research International 5

Lead nitrate

Cel

l via

bilit

y (

)

Lead nitrate concentration (120583M)

Lead nitrate + ASH-WEX

120

100

80

60

40

20

0

lowast

lowast

lowast

lowast

0 25 50 100 200 400

(a)

(b)

(c)

C CA LN LN + AS

C CA LN LN + AS

Figure 1 ASH-WEX protects against lead induced toxicity (a) Relative cell viability of C6 glioma cells after lead induced toxicity as assessedby MTT assay C6 cells were grown and pretreated with ASH-WEX (01) 24 hours before exposure to lead nitrate (25ndash400120583M) and grownfor 48ndash72 h Lead nitrate significantly reduced the viable cells at 50120583M and higher concentrations ASH-WEX treated cells were significantlyhigher in viability as compared to respective lead nitrate treated groups (in 50 100 and 200120583M) Data are representative of four differentexperiments and are expressed as mean plusmn SEM (b) Representative phase contrast pictures of control (C) control with ASH-WEX (01)pretreatment (CA) lead nitrate 200 120583M(LN) and lead nitrate after pretreatment with ASH-WEX (LN +AS) treatment Images were capturedusing Nikon TE-2000 microscope There was a significant difference in the cell number and morphology in lead nitrate treated cells ascompared to control cells which appeared to be noramlized by ASH-WEX pretreatment in LN +AS group (c) Cell death observed byHoechst33258 staining After the cells were treated with lead nitrate and ASH-WEX Hoechst 33258 staining was used to observe the morphologicalchanges of cell nucleus such as condensation of chromatin and nuclear fragmentations and higher intensity of stain were found clearly in leadnitrate treated group as compared to control and LN + AS group

most of the cell nuclei in LN group appeared to be withhigher intensity of stain due to chromatin condensation andnuclear fragmentation as compared to control cell nuclei Nosuch difference was observed in the LN + AS group nuclei(Figure 1(c))

32 ASH-WEX Normalizes GFAP Expression Stress ResponseProteins and NCAM In Vitro after Acute Lead ExposureGFAP HSP70 and mortalin protein expression was anal-ysed using immunostaining and Western blotting GFAPexpression was lower in the control group as compared toCA group Upon lead treatment the expression increasedsignificantly (Figures 2(a) and 2(b)) and was normalisedupon Ashwagandha treatment in LN + AS group (119875 lt005) The immunostaining results were further supportedby Western blotting analysis for GFAP (Figure 2(c)) RT-PCR results for GFAP mRNA also showed similar resultswith maximum expression in LN group and normaliza-tion upon Ashwagandha treatment (Figure 2(d)) SimilarlyHSP70 protein expression was enhanced in LN group uponlead treatment which was significantly reduced (119875 lt 005)in LN + AS group as compared to LN group (Figures3(a) and 3(b)) Western blotting and RT-PCR results forHSP70 protein further revealed similar trend as shown inFigures 3(c) and 3(d) The mitochondrial Mortalin (themitochondrial HSP70) was perinuclear in control cells whichis a characteristic pattern of transformed cells Upon 01Ashwagandha treatment the localization of mortalin seemed

to be redistributed in the cytoplasm The mortalin proteinexpression was significantly increased in the LN group andwas normalized in the LN + AS group The results are shownin Figures 4(a) and 4(b) The protein expression as analysedby Western blotting further revealed significant increase inmortalin expression upon lead exposure (Figure 4(c)) whichwas normalized in the presence of ASH-WEX (LN + ASgroup) Similarly there was increase in mortalin mRNAexpression upon lead treatment in LN group Ashwagandhatreatment leads to decline in the mortalin mRNA expressionin the LN+AS group as compared to LN group (Figure 4(d))Lead nitrate treatment apparently reducedNCAMexpressionin the LN group as compared to control and CA groupsAshwagandha treatment of lead exposed C6 cells showedenhanced NCAM expression in the LN + AS group as shownby immunostaining in Figure 5(a)These results were furthersupported by semiquantitative RT-PCR data (Figure 5(b))The rescue of C6 cells by ASH-WEX is also apparent fromthe morphology of cells in LN + AS group as the cells showedlong processes with distinct NCAM cell surface on both thecell bodies and processes

33 ASH-WEX Modulates GFAP Expression in Brain Regionsafter Lead Exposure GFAP is excellent marker of astrocytesactivation which responds toCNS damagewith reactive glio-sis induced bymany neurotoxic agents Immunohistochemi-cal staining was done to localize the GFAP protein expression

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 5

Lead nitrate

Cel

l via

bilit

y (

)

Lead nitrate concentration (120583M)

Lead nitrate + ASH-WEX

120

100

80

60

40

20

0

lowast

lowast

lowast

lowast

0 25 50 100 200 400

(a)

(b)

(c)

C CA LN LN + AS

C CA LN LN + AS

Figure 1 ASH-WEX protects against lead induced toxicity (a) Relative cell viability of C6 glioma cells after lead induced toxicity as assessedby MTT assay C6 cells were grown and pretreated with ASH-WEX (01) 24 hours before exposure to lead nitrate (25ndash400120583M) and grownfor 48ndash72 h Lead nitrate significantly reduced the viable cells at 50120583M and higher concentrations ASH-WEX treated cells were significantlyhigher in viability as compared to respective lead nitrate treated groups (in 50 100 and 200120583M) Data are representative of four differentexperiments and are expressed as mean plusmn SEM (b) Representative phase contrast pictures of control (C) control with ASH-WEX (01)pretreatment (CA) lead nitrate 200 120583M(LN) and lead nitrate after pretreatment with ASH-WEX (LN +AS) treatment Images were capturedusing Nikon TE-2000 microscope There was a significant difference in the cell number and morphology in lead nitrate treated cells ascompared to control cells which appeared to be noramlized by ASH-WEX pretreatment in LN +AS group (c) Cell death observed byHoechst33258 staining After the cells were treated with lead nitrate and ASH-WEX Hoechst 33258 staining was used to observe the morphologicalchanges of cell nucleus such as condensation of chromatin and nuclear fragmentations and higher intensity of stain were found clearly in leadnitrate treated group as compared to control and LN + AS group

most of the cell nuclei in LN group appeared to be withhigher intensity of stain due to chromatin condensation andnuclear fragmentation as compared to control cell nuclei Nosuch difference was observed in the LN + AS group nuclei(Figure 1(c))

32 ASH-WEX Normalizes GFAP Expression Stress ResponseProteins and NCAM In Vitro after Acute Lead ExposureGFAP HSP70 and mortalin protein expression was anal-ysed using immunostaining and Western blotting GFAPexpression was lower in the control group as compared toCA group Upon lead treatment the expression increasedsignificantly (Figures 2(a) and 2(b)) and was normalisedupon Ashwagandha treatment in LN + AS group (119875 lt005) The immunostaining results were further supportedby Western blotting analysis for GFAP (Figure 2(c)) RT-PCR results for GFAP mRNA also showed similar resultswith maximum expression in LN group and normaliza-tion upon Ashwagandha treatment (Figure 2(d)) SimilarlyHSP70 protein expression was enhanced in LN group uponlead treatment which was significantly reduced (119875 lt 005)in LN + AS group as compared to LN group (Figures3(a) and 3(b)) Western blotting and RT-PCR results forHSP70 protein further revealed similar trend as shown inFigures 3(c) and 3(d) The mitochondrial Mortalin (themitochondrial HSP70) was perinuclear in control cells whichis a characteristic pattern of transformed cells Upon 01Ashwagandha treatment the localization of mortalin seemed

to be redistributed in the cytoplasm The mortalin proteinexpression was significantly increased in the LN group andwas normalized in the LN + AS group The results are shownin Figures 4(a) and 4(b) The protein expression as analysedby Western blotting further revealed significant increase inmortalin expression upon lead exposure (Figure 4(c)) whichwas normalized in the presence of ASH-WEX (LN + ASgroup) Similarly there was increase in mortalin mRNAexpression upon lead treatment in LN group Ashwagandhatreatment leads to decline in the mortalin mRNA expressionin the LN+AS group as compared to LN group (Figure 4(d))Lead nitrate treatment apparently reducedNCAMexpressionin the LN group as compared to control and CA groupsAshwagandha treatment of lead exposed C6 cells showedenhanced NCAM expression in the LN + AS group as shownby immunostaining in Figure 5(a)These results were furthersupported by semiquantitative RT-PCR data (Figure 5(b))The rescue of C6 cells by ASH-WEX is also apparent fromthe morphology of cells in LN + AS group as the cells showedlong processes with distinct NCAM cell surface on both thecell bodies and processes

33 ASH-WEX Modulates GFAP Expression in Brain Regionsafter Lead Exposure GFAP is excellent marker of astrocytesactivation which responds toCNS damagewith reactive glio-sis induced bymany neurotoxic agents Immunohistochemi-cal staining was done to localize the GFAP protein expression

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 BioMed Research International

C CA

LN LN + AS

Negative

(a)

Relat

ive e

xpre

ssio

n le

vel

0

200

400

600

800

1000

1200

C CA LN LN + AS

lowast

lowast

(b)

52kDa

52kDa120572-Tubulin

C CA LN LN + AS

GFAP

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

160

140

120

100

80

60

40

20

0

(c)

C CA LN LN + AS

GFAP

120573-Actin

(d)

Figure 2 Expression of GFAP after treatment with ASH-WEX and lead nitrate Control (C) control with ASH-WEX (01) pretreatment(CA) lead nitrate 200120583M (LN) and lead nitrate after pretreatment with ASH-WEX (LN + AS) cells were used for GFAP immunostaining(a) protein expression by Western blotting (c) and mRNA expression by RT-PCR (d) (b) depicts GFAP expression levels as analysed byimmunostaining using intensity measurement command of Image-Pro Plus software GFAP protein expression levels in control cells weretaken as 100 to plot the histogramwith relative level of expression of GFAP inC CA LN and LN+AS groups Data are calculated from threeindependent experiments and represented as the mean plusmn SEM Value of 119875 le 005 was considered to be significant lowastSignificant differenceas compared to control significant difference between LN and LN + AS groups lowastSignificant difference between C and other groups andsignificant difference between LN and LN + AS groups

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 7

C CA

LN LN + AS

Negative

(a)

0

100

200

300

400

500

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

HSP70

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast150

100

50

0

(c)

C CA LN LN + AS

HSP70

120573-Actin

(d)

Figure 3 (a) Immunostaining of HSP70 in control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200120583M (LN) and leadnitrate after pretreatment with ASH-WEX (LN + AS) treated C6 cells (b) Histogram depicts staining intensity measurement of HSP70immunofluorescence indicating HSP70 expression levels in the cells from different treatment groups (c) Representative Western blots andrelative expression levels as analysed by densitometry and normalized against 120572-tubulin expression levels The data represents mean plusmn SEMfrom three independent experiments (d) Representative RT-PCR products of HSP70 and 120573-actin (internal control) mRNA in differenttreatment groups Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant difference in comparison to control ldquordquorepresents significant difference between LN and LN + AS groups

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

8 BioMed Research International

C CA

LN LN + AS

Negative

(a)

0

100

200

300

Relat

ive e

xpre

ssio

n le

vel

C CA LN LN + AS

lowast

lowast

(b)

52kDa

76kDa

120572-Tubulin

C CA LN LN + AS

Mortalin

Relat

ive e

xpre

ssio

n

C CA LN LN + AS

lowast

200

150

100

50

0

(c)

C CA LN LN + AS

Mortalin

120573-Actin

(d)

Figure 4 ASH-WEX pretreatment normalizes lead induced changes in mortalin expression levels (a) Immunostaining of mortalin in C6cells from control (C) ASH-WEX (01) pretreatment (CA) lead nitrate 200 120583M (LN) and lead nitrate after pretreatment with ASH-WEX(LN + AS) treated groups (b) Histogram shows expression levels of mortalin as analysed by intensity measurement using Image-Pro Plussoftware (c) Representative Western blot of mortalin expression and histogram depicts relative expression levels of mortalin normalizedagainst 120572-tubulin in C CA LN and LN + AS groups as analysed by densitometry Data are calculated from three independent experimentsand represented as the mean plusmn SEM (d) Representative RT-PCR products of mortalin and 120573-actin mRNA in all the groups under studyMortalin expression levels were significantly lowered down by ASH-WEX pretreatment in LN +AS group as compared to LN group as shownby immunostaining Western blotting and RT-PCR Value of 119875 le 005 was considered to be significant ldquolowastrdquo represents significant differencein comparison to control ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 9

C CA

LN LN + AS

Negative

(a)

C CA LN LN + AS

NCAM

120573-Actin

(b)

Figure 5 (a) NCAM protein expression levels were determined by immunostaining in control (C) ASH-WEX (01) pretreatment (CA)lead nitrate (200 120583M LN) and lead nitrate after pretreatment with ASH-WEX (LN+AS) treated groups Lead treatment resulted in decreasedexpression of NCAM in LN group which was normalized by ASH-WEX pretreatment as shown in LN + AS group cells These changes werealso evident at transcription levels (b) depicts representative RT-PCR products for the mRNA expression levels of NCAM and 120573-actin

in brain regions Lead nitrate treated group showed a consid-erable increase in expression ofGFAP in the brain regions likehippocampus (119875 lt 0001) hypothalamus (119875 lt 0001) andpiriform cortex (119875 lt 005) (Figure 6(a)) Simultaneous leadnitrate and Ashwagandha treatment showed considerabledecrease of GFAP expression in hypothalamus (119875 lt 0001Figure 6(c)) and piriform cortex (119875 lt 005 Figure 6(d)) butthere was no statistical significant difference in hippocampus(Figure 5(b)) No specific signal was observed in the negativecontrol immunostaining (Figure 6(f))

GFAP expression was further confirmed by West-ern blotting Lead nitrate treatment showed a significantincrease in GFAP expression from different regions of brain-hippocampus (119875 lt 001) hypothalamus (119875 lt 001) andcortex (119875 lt 005) Simultaneous lead nitrate and Ashwa-gandha treatment resulted in decrease of GFAP expression inhypothalamus (119875 lt 0001) and cortex (119875 lt 005) regionsonly Hippocampus region showed no significant decrease inGFAP level upon ASH-WEX treatment Results are shown inFigure 6(e)

34 ASH-WEX Was Able to Normalize HSP70 Levels inBrain Regions and Peripheral Organs HSP70 expression wasanalyzed in brain regions such as hippocampus hypothala-mus and cortex Hippocampus hypothalamus and cortexregions showed significant increase in HSP70 level when

treated with lead nitrate alone Treatment of ASH-WEXwith lead nitrate led to a significant decrease in HSP70levels both in hypothalamus (119875 lt 005) and cortex (119875 lt0001) as compared to lead nitrate treatment group TheHSP70 expression remained significantly higher in LN + ASgroup as compared to control and no significant change inHSP70 levels was observed as compared to LN group Inorder to account for potential variation and sample loadingexpression of each sample was compared to that of 120572-tubulinResults are shown in Figure 7(a)

The HSP70 levels were also examined in peripheralorgans heart kidney and liver Heart (119875 lt 0001) andkidney (119875 lt 005) showed a marked increase in HSP70 levelupon lead nitrate treatment alone Simultaneous ASH-WEXand lead nitrate treatment showed considerable reduction inHSP70 level of heart (119875 lt 005) and kidney (119875 lt 001)as compared to lead nitrate treatment thereby indicatingthat ASH-WEX treatment counteracts lead induced stressAdministration of lead nitrate and Ashwagandha in LN + ASgroup showed significantly decreased HSP70 in liver (119875 lt002) as compared to lead nitrate treatment Of note HSP70protein bands for both constitutive and induced form canbe observed in the blots In order to account for potentialvariation and sample loading expression of each samplewas normalized to that of 120572-tubulin Results are shown inFigure 7(b)

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

10 BioMed Research International

Control

Den

tate

gyr

usM

edia

n em

inen

cePi

rifor

m co

rtex

LN LN + AS

(a)

Relat

ive e

xpre

ssio

n

lowast150

100

50

0C LN LN + AS

(b)

Relat

ive e

xpre

ssio

n

lowast

150

100

50

0C LN

LN + AS

(c)

Relat

ive e

xpre

ssio

n lowast

150

100

50

0C LN

LN + AS

(d)

Hippocampus Hypothalamus CortexC LN

52kDa

76kDa

120572-Tubulin

GFAP

0

50

100

150

Relat

ive e

xpre

ssio

n lowast lowast

lowast

C LNC LNC LN LN + AS LN + AS LN + AS

LN + AS C LN LN + AS C LN LN + AS

(e)

Negative

(f)

Figure 6 (a) Representative immunofluorescent images of 30 120583m thick coronal sections showing GFAP expression in dentate gyrus regionof hippocampus median eminence region of hypothalamus and piriform cortex in vehicle control (C) lead nitrate (LN) and simultaneouslead nitrate and ASH-WEX (LN +AS) treated animal brains (119873 = 4-5) Amarked increase in expression of GFAPwas observed in the animalstreated with lead nitrate as compared to control The lead nitrate and ASH-WEX treated group showed normalization in expression of GFAPlevels Relative expression levels of GFAP were analysed using intensity measurement command of Image-Pro Plus software in hippocampus(b) hypothalamus (c) and cortex (d) shown as histograms (e) Representative Western blot for GFAP and 120572-tubulin expression levels fordifferent brain regionsmdashhippocampus hypothalamus and cortex from C LN and LN + AS treated animals GFAP protein expression levelswere normalized against 120572-tubulin and data was plotted as histograms Bar shows themeanplusmn SEMvalues (f) depicts specific immunostainingfor GFAP shown above as no specific signal was visible in the secondary antibody control group 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 11

Hippocampus Hypothalamus CortexC LN C LN C LN

52kDa

76kDa

120572-Tubulin

HSP70

C LNC LNC LN

lowast lowastlowast

lowast

Relat

ive e

xpre

ssio

n

200

150

100

50

0LN + AS

LN + ASLN + ASLN + AS

LN + ASLN + AS

(a)

52kDa

76kDa

120572-Tubulin

HSP70

Heart Kidney Liver

Relat

ive e

xpre

ssio

n

lowast

lowast

lowast

150

100

50

0C LNC LNC LN LN + ASLN + ASLN + AS

C LN C LN C LN LN + ASLN + ASLN + AS

(b)

Figure 7 (a) Representative Western blots for HSP-70 expression and 120572-tubulin for different brain regions hippocampus hypothalamusand cortex from control (C) lead nitrate (LN) and lead nitrate and Ashwagandha (LN + AS) treated rats Relative expression levels of HSP-70 normalized against 120572-tubulin were plotted as histograms (b) Representative Western blots for HSP-70 expression and 120572-tubulin fromdifferent peripheral organs heart kidney and liver from control and treatment groups Histograms represent expression levels of HSP-70normalized against 120572-tubulin Data are calculated and represented as the mean plusmn SEM (119873 = 4-5) 119875 lt 005 was considered significant ldquolowastrdquorepresents significant difference between C and other groups and ldquordquo represents significant difference between LN and LN + AS groups

35 ASH-WEX Interferes with Antioxidant Defence Status inAcute Lead Toxicity

351 Catalase Activity A statistical significant decrease (119875 lt0002) in the CAT activity was seen after lead nitrate treat-ment from all the brain regions studied Similarly a signif-icant decrease was observed in CAT activity in peripheralorgans kidney (119875 lt 005) aswell as increase in liver (119875 lt 002)upon lead nitrate treatment as compared to control groupCatalase activity upon feeding of ASH-WEXwith lead nitratetreatment showed significant increase (119875 lt 005) in enzymeactivity in kidney liver cortex and hypothalamus regions ofbrain with no significant changes in hippocampus region ofbrain as compared to LN group (Table 2)

352 Superoxide Dismutase (SOD) Lead nitrate treatmentalone showed significant decrease (119875 lt 0001) in SODactivity in all regions of brain as well as in kidney and liver(119875 lt 002) as compared to control group Treatment ofASH-WEXwith lead nitrate showed no significant change onSOD in liver and hippocampus and cortex regions of brainwhile hypothalamus and kidney showed significant increasein SOD activity as compared to LN group (Table 2)

353 Lipid Peroxidation (LPx) The lead nitrate exposed ratsexhibited a significant increase in LPx in hippocampus (119875 lt005) hypothalamus (119875 lt 002) and cortex regions ofbrain as well as kidney but liver tissue showed nonsignificantincrease as compared to control Simultaneous lead nitrateand Ash-WEX treatment (LN + AS group) showed statisticalsignificant decrease in LPx in hippocampus and hypothala-mus respectively and also in peripheral organs as comparedto LN group (Table 2)

354 Glutathione Content Lead nitrate treatment showedslight decrease inGSH content in hippocampus and hypotha-lamus regions of brain aswell as liverTherewas no significantchange in kidney glutathione content Ashwagandha treatedrats showed increase in level of GSH in all the tissuesunder study but the changes were not statistically significant(Table 2)

4 Discussion

CNS is the principal target of the neurotoxic effects oflead however there are no effective treatments or interven-tions available to counteract it Ashwagandha is a popularAyurvedic plant with a variety of medicinal properties andis also widely used as a nerve tonic [3] Ashwagandha leafextract is a potential agent in treating oxidative damageand physiological abnormalities seen in mouse model ofParkinsonrsquos disease [31] In the light of aforementioned CNSrelated beneficial properties of Ashwagandha the presentstudy was designed to evaluate the beneficial effects of itsaqueous leaf extract against lead nitrate neurotoxicity usingin vitro (C6 glioma cells) and further analysing it in vivo ratmodel system 01 ASH-WEX was able to prevent the toxiceffects of lead treatment in LN + AS group as evident bynormal cell morphology and viability providing evidence forcytoprotective role of this important Indian herb

In the present study the upregulation of GFAP expressionwas observed upon lead treatment both in vitro and invivo systems Lead alone induced reactive gliosis which isapparent from the significantly higher expression of GFAPin all brain regions under study Morphological changes inastrocytes coupled with immunostaining for GFAP expres-sion showed a marked increase in its level after lead nitratetreatment Simultaneous Ashwagandha treatment of lead

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

12 BioMed Research International

Table 2 Effects of Ashwagandha water extract on lead induced oxidative damage to CAT SOD GSH and LPx in rat brain regions liver andkidney

Groups Kidney Liver Hippocampus Hypothalamus CortexCatalase (CAT)mdashunitsminuteg

C 1005 plusmn 137 372 plusmn 120 1880 plusmn 195 1147 plusmn 047 1024 plusmn 152LN 380 plusmn 168lowast 495 plusmn 168lowast 1057 plusmn 183lowast 458 plusmn 084lowast 535 plusmn 120lowast

LN + AS 1237 plusmn 426 700 plusmn 171lowast 956 plusmn 107lowast 931 plusmn 117 1137 plusmn 195

CundashZn (SOD)mdashunitsmgC 1344 plusmn 283 1089 plusmn 264 2125 plusmn 455 1988 plusmn 358 1360 plusmn 461LN 921 plusmn 159 674 plusmn 131lowast 1237 plusmn 188lowast 1152 plusmn 103lowast 866 plusmn 209lowast

LN + AS 1303 plusmn 009 726 plusmn 143 1207 plusmn 251lowast 2213 plusmn 303 986 plusmn 254lowast

Glutathione (GSH)mdashunitsminutegC 334 plusmn 009 411 plusmn 013 348 plusmn 009 371 plusmn 011 322 plusmn 039LN 328 plusmn 007 369 plusmn 016 329 plusmn 005 316 plusmn 012 345 plusmn 021LN + AS 356 plusmn 009 392 plusmn 013 359 plusmn 005 354 plusmn 011 389 plusmn 031

Lipid peroxidation (LPx)mdashnmoles MDAmLC 1043 plusmn 231 2007 plusmn 187 478 plusmn 023 529 plusmn 022 1076 plusmn 053LN 2366 plusmn 175lowast 2230 plusmn 053lowast 1375 plusmn 171lowast 1205 plusmn 103lowast 1897 plusmn 165lowast

LN + AS 1142 plusmn 083 1461 plusmn 067 0982 plusmn 104lowast 0639 plusmn 067 1461 plusmn 082lowast

Data are expressed as mean plusmn SEM 119875 lt 005 was considered significant lowastrepresents significant difference compared to control group represents significantdifference compared to lead treated animals (LN group)

exposed cultures showed significant abatement in GFAPexpression and also normalizing the morphology of astro-cytes Previous studies have reported association of increasedGFAP levels and hypertrophic changes with susceptibilityto toxic insult in C6 rat glioma cells [32] The acute leadexposure is accompanied by astrocyte activation associatedwith the enhanced expression of GFAP as an indicator of leadinduced neuronal injury [15] Ashwagandha has been shownto antagonize the DNA damage and oxidative stress inducedby lead [21] Recently it has been shown that Ashwagandhaextract and its bioactive component Withanone was able torevert scopolamine induced changes in GFAP expression inthe neuronal cells aswell as animalmodel [33]Normalizationof GFAP expression by Ashwagandha extract in glutamateinduced neurodegeneration in RA differentiated cultures hasbeen shown in a recent study from our lab [34] Thusdownregulation of GFAP expression by ASH-WEX treatmentunder both in vitro as well as in vivo conditions could beattributed to protective properties of Ashwagandha

We further evaluated the levels of HSP70 expression afterlead and Ashwagandha treatment Our results have shownan increase in HSP70 expression in the LN treated cellsin response to lead induced stress whereas its expressionlevel was significantly reduced in the ASH-WEX pretreatedgroup in C6 cells Further in vivo studies suggested thatAshwagandha leaf extract treatment decapitated the expres-sion of HSP70 significantly as compared to LN treatmentgroup in hypothalamus and cortex regions of brain thusdebilitating the cytotoxic effects of lead nitrate in vivo Thesepalliative results suggested that Ashwagandha leaf extract hasa potential cytoprotective effect on different brain regions andcan curtail cytotoxicity caused due to exposure of lead Leadexposure has been implicated in induction of prenatal andpostnatal induction ofHSP70 in astrocytes [35]The antibody

used in present study for HSP70 (clone BRM-22) recognisesboth HSP70 and HSC70 Although HSP70 is known to becytoplasmic in control cells it is well documented thatHSP70is present in the nucleus predominantly during S-phase and atlow levels during remaining cell cycle [36]Moreover nucleartranslocation of stress protein Hsc70 during S phase in rat C6glioma cells has also been reported [37] So nuclear staining ofHSP70 could be attributed to its cell cycle regulatory or otherroles

Furthermore expression of mitochondrial HSP70 mor-talin was perinuclear in the control group which shifted topancytoplasmic in case of LN group and in LN + AS groupMortalin is nonheat inducible molecular chaperon which isinduced by different environmental stresses [38] Mortalinhas been implicated in Alzheimerrsquos (AD) and Parkinsonrsquos(PD) diseases with proteomic studies consistently identifyingoxidatively damaged mortalin as potential biomarker [29]Significantly higher expression of mortalin as an adaptiveresponse has been reported as a result of Ashwagandhatreatment [39] Thus current results showing increase inmortalin in Ashwagandha treated group indicate role of mor-talin in cytoprotective mechanism induced in glial cells andelucidation of molecular mechanism(s) of these functionsrequires further studies

Lead nitrate treatment caused significant increase inHSP70 expression in all these organs as shown by Westernblotting which was significantly reduced after oral feeding ofthe animals with Ashwagandha extract Increased expressionofHSPs in liver at both transcriptional and translational levelshas been associated with the early phase of liver regeneration[40] Previously HSP72 (inducible form of HSP70) has beenshown to be upregulated during kidney injury in rats whichpartially protected human kidney proximal tubule cell linesHK-2 and HKC from triptolide-induced injury [41] Thus

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 13

normalization of HSP 70 levels in the present study afterAshwagandha treatment in vitro as well as in vivo furtherconfirms the protective effects of Ashwagandha against leadinduced toxicity

Another important neuronal marker NCAM was foundto be downregulated in C6 glioma cells after lead exposureThe low level maternal lead exposure has been shown todecrease the expression of NCAM and its glycosylated formin hippocampus of rat pups [42 43] Consistent with thesereports expression of NCAM was found to decrease in leadnitrate exposed C6 cells whereas Ashwagandha treatmentwas observed to augment the lead mediated downregulationof NCAM partially as shown by immunostaining and RT-PCRA recent study onAshwagandha treatment inC6 gliomacells has shown significant increase in expression of NCAM[39] and also increase in NCAM expression after Ashwa-gandha treatment has been associatedwith protection againstglutamate induced damage in RA differentiated neuronalcultures [34]

As recent studies point to the fact that at least some ofthe effects may occur as a consequence of lead propensityfor disrupting the delicate prooxidantantioxidant balancethat exists within mammalian cells [44] we further inves-tigated the possible mechanism of Ashwagandha inducedneuroprotection against lead toxicity by analysing the cellularantioxidant defense system Lead exposure leads to induc-tion of ROS production oxidative stress and expression ofproapoptotic genes and cell death [45] The present resultshave shown that Ashwagandha extract does have antioxidantproperties as it resulted in a decrease of lead induced risein lipid peroxidation in all the brain regions under studyas well as peripheral organs kidney and liver In relationto the levels of SOD here too mostly beneficial effectswere seen in the brain regions There was a nonsignificantincrease in the level of SOD in the liver and cortex whilethe kidney and hypothalamus SOD levels were normalizedThese results are consistentwith the data reported by differentstudies with root extracts of Ashwagandha [2 46] wherean overall increase in the level of SOD and decrease inthe lipid peroxidation was observed after administration ofAshwagandha extracts Chaudhary et al [47] has reportedAshwagandha root extract enhancing the antiperoxidation ofhepatic tissue

In contrast to the above results there was a consistentdecrease in the levels of catalase in all the regions of thebrain and peripheral organs after lead treatment which wasnormalized by Ashwagandha extract treatmentThis is in linewith the effect of the root powder and extracts which havebeen shown to induce an increase in the catalase activityin previous studies Bhattacharya et al [2] have shown anincrease in catalase activity in rat brain frontal cortex andstriatum after treatment with roots of Ashwagandha Pandaand Kar [46] also have reported an increase in the level ofcatalase after treatmentwith roots ofAshwagandha SimilarlyJain et al [48] have shown that Withania somnifera reversesthe chronic footshock induced changes which include anincrease in SOD and lipid peroxidation and decrease incatalase activity in the rat frontal brain cortex and striatum

Administration of Ashwagandha did not show significantchange in GSH in all regions understudied and is supportedby the study of Bhattacharya et al [2] in which theadministration of Ashwagandha inhibits lipid peroxidationwhich follows a different mechanism without modifying theglutathione system which is a main antioxidant systemGSH selenium containing tetrameric enzyme is the primarylow molecular-weight thiol in the cytoplasm and is a majorreserve for cysteine SOD converts O

2

minus into H2O2and GSH

in conjunction with the reductant NADPH that can reducelipid peroxides free radicals and H

2O2[49] So an increase

in SOD in our study would indirectly indicate lowering ofthe free radical levels and thus point towards the antioxidanteffect of the aqueous leaf extract of Ashwagandha

The current data of protection against lead inducedcytotoxicity is also consistentwith several previously reportedneuroprotective activities in both in vivo and in vitromodelsusing this important medicinal plant Recently we reportedthat water extract of Ashwagandha leaves confers protectionto neuronal cells against glutamate excitotoxicity [34] Pre-liminary data from our lab also showed that ASH-WEX hassix different water solublemolecules whichmay be associatedwith neuroprotective activity either alone or combined [39]The bioactive components sitoindosides VII-X and with-aferin A have been shown to have neuroprotective activityby binding with cholinergic receptors [48] Modulation ofrelease of three neurotransmitters that is acetylcholineglutamate and serotonin byAshwagandhahas beenproposedto contribute to inhibition of nNOS in extract treated stressedmice [5] Neuroregeneration of both axons and dendrites aswell as reconstruction of pre- and postsynapses in the neu-rons was induced by withanolide A from the Ashwagandhaextract which is considered to be an important candidate forthe treatment of neurodegenerative diseases [50] Based onthe present findings itmay be suggested thatASH-WEXplaysneuromodulatory role to rescue the glial cells against leadtoxicity by suppression of stress response and upregulationof plasticity marker proteins such as GFAP and NCAM

5 Conclusion

In view of our present results we hypothesize that watersoluble extract of Ashwagandha is able to partially reverse theeffect of lead induced toxicity as is shown in both in vitro andin vivo systems Detailed mechanistic studies are required tounderstand the mechanisms underlying the beneficial effectsof Ashwagandha and to explore the optimum dosage andduration of treatment to implement the same in clinicalperspectives

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Authorsrsquo Contribution

PraveenKumar andDinesh Lakhanpal performed cell culture(in vitro) experiments and Raghavendra Singh and Arshed

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

14 BioMed Research International

Nazmi performed in vivo experiments and analysed dataDinesh Lakhanpal Hardeep Kataria and Gurcharan Kaurcontributed to the paper preparation Gurcharan Kaur con-tributed to reagentsmaterialsanalysis tools Praveen Kumarand Raghavendra Singh contributed equally towards thispaper

Acknowledgment

Dinesh Lakhanpal and Hardeep Kataria are thankful to theCouncil of Scientific and Industrial Research India forproviding Junior and Senior Research Fellowship during thecourse of this study

References

[1] G H Naik K I Priyadarsini J G Satav et al ldquoComparativeantioxidant activity of individual herbal components used inayurvedic medicinerdquo Phytochemistry vol 63 no 1 pp 97ndash1042003

[2] S K Bhattacharya K S Satyan and S Ghosal ldquoAntioxidantactivity of glycowithanolides fromWithania somniferardquo IndianJournal of Experimental Biology vol 35 pp 236ndash239 1997

[3] S K Kulkarni and A Dhir ldquoWithania somnifera an Indianginsengrdquo Progress in Neuro-Psychopharmacology and BiologicalPsychiatry vol 32 no 5 pp 1093ndash1105 2008

[4] M Bhatnagar D Sharma and M Salvi ldquoNeuroprotectiveeffects of Withania somnifera dunal a possible mechanismrdquoNeurochemical Research vol 34 no 11 pp 1975ndash1983 2009

[5] S RajaSankar T Manivasagam V Sankar et al ldquoWithaniasomnifera root extract improves catecholamines and physiolog-ical abnormalities seen in a Parkinsonrsquos disease model mouserdquoJournal of Ethnopharmacology vol 125 no 3 pp 369ndash373 2009

[6] C Tohda and E Joyashiki ldquoSominone enhances neurite out-growth and spatial memory mediated by the neurotrophicfactor receptor RETrdquo British Journal of Pharmacology vol 157no 8 pp 1427ndash1440 2009

[7] N ShahH Kataria S C Kaul T Ishii G Kaur andRWadhwaldquoEffect of the alcoholic extract of Ashwagandha leaves andits components on proliferation migration and differentiationof glioblastoma cells combinational approach for enhanceddifferentiationrdquo Cancer Science vol 100 no 9 pp 1740ndash17472009

[8] I A Bergdahl and S Skerfving ldquoBiomonitoring of leadexposuremdashalternatives to bloodrdquo Journal of Toxicology andEnvironmental Health A Current Issues vol 71 no 18 pp 1235ndash1243 2008

[9] T Sanders Y Liu V Buchner and P B Tchounwou ldquoNeuro-toxic effects and biomarkers of lead exposure a reviewrdquoReviewson Environmental Health vol 24 no 1 pp 15ndash45 2009

[10] P Kurosinski and J Gotz ldquoGlial cells under physiologic andpathologic conditionsrdquoArchives of Neurology vol 59 no 10 pp1524ndash1528 2002

[11] E Galea P Dupouey and D L Feinstein ldquoGlial fibrillary acidicproteinmRNA isotypes expression in vitro and in vivordquo Journalof Neuroscience Research vol 41 no 4 pp 452ndash461 1995

[12] M Kaur S Sharma and G Kaur ldquoAge-related impairmentsin neuronal plasticity markers and astrocytic GFAP and theirreversal by late-onset short term dietary restrictionrdquo Biogeron-tology vol 9 no 6 pp 441ndash454 2008

[13] D Holtzman C DeVries and H Nguyen ldquoMaturation ofresistance to lead encephalopathy cellular and subcellularmechanismsrdquo NeuroToxicology vol 5 no 3 pp 97ndash124 1984

[14] J P OrsquoCallaghan K F Jensen and D B Miller ldquoQuantitativeaspects of drug and toxicant-induced astrogliosisrdquo Neurochem-istry International vol 26 no 2 pp 115ndash124 1995

[15] L Struyska I Bubko MWalski and U Rafalowska ldquoAstroglialreaction during the early phase of acute lead toxicity in the adultrat brainrdquo Toxicology vol 165 no 2-3 pp 121ndash131 2001

[16] D C Bellinger ldquoVery low lead exposures and childrenrsquos neu-rodevelopmentrdquoCurrent Opinion in Pediatrics vol 20 no 2 pp172ndash177 2008

[17] M deMarco R Halpern andHM T Barros ldquoEarly behavioraleffects of lead perinatal exposure in rat pupsrdquo Toxicology vol211 no 1-2 pp 49ndash58 2005

[18] N Ercal R Neal P Treeratphan et al ldquoA role for oxidative stressin suppressing serum immunoglobulin levels in lead-exposedfisher 344 ratsrdquo Archives of Environmental Contamination andToxicology vol 39 no 2 pp 251ndash256 2000

[19] S Rastogi ldquoRenal effects of environmental and occupationallead exposurerdquo Indian Journal of Occupational and Environmen-tal Medicine vol 12 no 3 pp 103ndash106 2008

[20] D Y Yu W F Li B Deng and X F Mao ldquoEffects of leadon hepatic antioxidant status and transcription of superoxidedismutase gene in pigsrdquo Biological Trace Element Research vol126 no 1ndash3 pp 121ndash128 2008

[21] S Khanam and K Devi ldquoEffect of Withania somnifera rootextract on lead-induced DNA damagerdquo International Journal ofFood Agriculture and Environment vol 3 pp 31ndash33 2005

[22] C C Deocaris S C Kaul and R Wadhwa ldquoFrom proliferativeto neurological role of an hsp70 stress chaperone mortalinrdquoBiogerontology vol 9 no 6 pp 391ndash403 2008

[23] D K Ditlevsen G K Povlsen V Berezin and E BockldquoNCAM-induced intracellular signaling revisitedrdquo Journal ofNeuroscience Research vol 86 no 4 pp 727ndash743 2008

[24] C-M Chuong and G M Edelman ldquoAlterations in neural celladhesion molecules during development of different regions ofthe nervous systemrdquo Journal of Neuroscience vol 4 no 9 pp2354ndash2368 1984

[25] Q HuH Fu H Song et al ldquoLow-level lead exposure attenuatesthe expression of three major isoforms of neural cell adhesionmoleculerdquo NeuroToxicology vol 32 no 2 pp 255ndash260 2011

[26] R P Singh S Sharad and S Kapur ldquoFree radicals and oxida-tive stress in neurodegenerative diseases relevance of dietaryantioxidantsrdquo Journal Indian Academy of Clinical Medicine vol5 no 3 pp 218ndash225 2004

[27] H Aebi Catalase in Vitro Methods in Enzymology vol 105Academic Press New York NY USA 1984

[28] Y Kono ldquoGeneration of superoxide radical during autoxidationof hydroxylamine and an assay for superoxide dismutaserdquoArchives of Biochemistry and Biophysics vol 186 no 1 pp 189ndash195 1978

[29] J Sedlak and R H Lindsay ldquoEstimation of total protein-bound andnonprotein sulfhydryl groups in tissuewith Ellmanrsquosreagentrdquo Analytical Biochemistry vol 25 pp 192ndash205 1968

[30] J A Buege and S D Aust ldquoMicrosomal lipid peroxidationrdquoMethods in Enzymology vol 52 pp 302ndash310 1978

[31] S RajaSankar T Manivasagam and S Surendran ldquoAshwa-gandha leaf extract a potential agent in treating oxidativedamage and physiological abnormalities seen in amousemodelof Parkinsonrsquos diseaserdquo Neuroscience Letters vol 454 no 1 pp11ndash15 2009

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

BioMed Research International 15

[32] C Mead and V W Pentreath ldquoHypertrophy and increasedglial fibrillary acidic protein are coupled to increased protectionagainst cytotoxicity in glioma cell linesrdquo Toxicology in Vitro vol12 no 2 pp 141ndash152 1998

[33] A Konar N Shah R Singh et al ldquoProtective role of Ash-wagandha leaf extract and its component withanone on scopo-lamine-induced changes in the brain and brain-derived cellsrdquoPLoS ONE vol 6 no 11 Article ID e27265 2011

[34] H Kataria R Wadhwa S C Kaul and G Kaur ldquoWater extractfrom the leaves of Withania somnifera protect ra differentiatedc6 and IMR-32 cells against glutamate-induced excitotoxicityrdquoPLoS ONE vol 7 no 5 Article ID e37080 2012

[35] A Selvin-Testa F Capani C F Loidl E M Lopez and J Pecci-Saavedra ldquoPrenatal and postnatal lead exposure induces 70kDa heat shock protein in young rat brain prior to changesin astrocyte cytoskeletonrdquo Neurotoxicology vol 18 pp 805ndash8171997

[36] K LMilarski andR IMorimoto ldquoExpression of humanHSP70during the synthetic phase of the cell cyclerdquo Proceedings of theNational Academy of Sciences of the United States of Americavol 83 no 24 pp 9517ndash9521 1986

[37] E Zeise N Kuhl J Kunz and L Rensing ldquoNuclear transloca-tion of stress protein Hsc70 during S phase in rat C6 gliomacellsrdquo Cell Stress Chaperones vol 3 no 2 pp 94ndash99 1998

[38] R Wadhwa K Taira and S C Kaul ldquoAn HSP70 familychaperone mortalinmthsp70PBP74Grp75 what when andwhererdquo Cell Stress Chaperones vol 7 pp 309ndash316 2002

[39] H Kataria N Shah S C Kaul R Wadhwa and G KaurldquoWater extract of Ashwagandha leaves limits proliferationand migration and induces differentiation in glioma cellsrdquoEvidence-Based Complementary and Alternative Medicine vol2011 Article ID 267614 12 pages 2011

[40] Q Shi Z Dong and H Wei ldquoThe involvement of heat shockproteins in murine liver regenerationrdquo Cellular amp MolecularImmunology vol 4 no 1 pp 53ndash57 2007

[41] Z Wang H Jin C Li Y Hou Q Mei and D Fan ldquoHeat shockprotein 72 protects kidney proximal tubule cells from injuryinduced by triptolide by means of activation of the MEKERKpathwayrdquo International Journal of Toxicology vol 28 no 3 pp177ndash189 2009

[42] P M Dey J Burger M Gochfeld and K R Reuhl ldquoDevelop-mental lead exposure disturbs expression of synaptic neural celladhesion molecules in herring gull brainsrdquo Toxicology vol 146no 2-3 pp 137ndash147 2000

[43] Q Hu H Fu T Ren et al ldquoMaternal low-level lead expo-sure reduces the expression of PSA-NCAM and the activityof sialyltransferase in the hippocampi of neonatal rat pupsrdquoNeuroToxicology vol 29 no 4 pp 675ndash681 2008

[44] W E Donaldson and S O Knowles ldquoIs lead toxicosis a ref-lection of altered fatty acid composition of membranesrdquoComparative Biochemistry and Physiology C PharmacologyToxicology and Endocrinology vol 104 no 3 pp 377ndash379 1993

[45] K M Savolainen J Loikkanen S Eerikainen and J NaaralaldquoGlutamate-stimulated ROS production in neuronal culturesinteractions with lead and the cholinergic systemrdquo NeuroTox-icology vol 19 no 4-5 pp 669ndash674 1998

[46] S Panda and A Kar ldquoEvidence for free radical scavengingactivity of Ashwagandha root powder inmicerdquo Indian Journal ofPhysiology and Pharmacology vol 41 no 4 pp 424ndash426 1997

[47] G Chaudhary U Sharma N R Jagannathan and Y K GuptaldquoEvaluation of Withania somnifera in a middle cerebral artery

occlusion model of stroke in ratsrdquo Clinical and ExperimentalPharmacology and Physiology vol 30 no 5-6 pp 399ndash4042003

[48] S Jain S D Shukla K Sharma and M Bhatnagar ldquoNeuropro-tective effects ofWithania somniferaDunn in hippocampal sub-regions of female albino ratrdquo Phytotherapy Research vol 15 no6 pp 544ndash548 2001

[49] N A Simonian and J T Coyle ldquoOxidative stress in neu-rodegenerative diseasesrdquo Annual Review of Pharmacology andToxicology vol 36 pp 83ndash106 1996

[50] T Kuboyama C Tohda and K Komatsu ldquoNeuritic regener-ation and synaptic reconstruction induced by withanolide ArdquoBritish Journal of Pharmacology vol 144 no 7 pp 961ndash9712005

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology