Research Article Genomic Analysis Unravels Reduced ...downloads.hindawi.com/journals/bmri/2016/8137012.pdf · Isolation and Cultivation of Bacteria. Samples from the surface of e

Research ArticleGenomic Analysis Unravels Reduced InorganicSulfur Compound Oxidation of Heterotrophic AcidophilicAcidicaldus sp Strain DX-1

Yuanyuan Liu12 Hongying Yang1 Xian Zhang3 Yunhua Xiao3

Xue Guo3 and Xueduan Liu3

1School of Materials and Metallurgy Northeastern University Shenyang China2CNMC Luanshya Copper Mines Plc (CLM) Luanshya Zambia3School of Minerals Processing and Bioengineering Central South University Changsha China

Correspondence should be addressed to Hongying Yang yanghysmmneueducn

Received 14 January 2016 Revised 28 March 2016 Accepted 11 April 2016

Academic Editor Thomas Lufkin

Copyright copy 2016 Yuanyuan Liu et al This is an open access article distributed under the Creative Commons Attribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Although reduced inorganic sulfur compound (RISC) oxidation in many chemolithoautotrophic sulfur oxidizers has beeninvestigated in recent years there is little information about RISC oxidation in heterotrophic acidophiles In this study Acidicaldussp strain DX-1 a heterotrophic sulfur-oxidizing acidophile was isolated Its genome was sequenced and then used for comparativegenomics Furthermore real-time quantitative PCR was performed to identify the expression of genes involved in the RISCoxidation Gene encoding thiosulfate quinone oxidoreductase was present in Acidicaldus sp strain DX-1 while no candidate geneswith significant similarity to tetrathionate hydrolase were found Additionally there were genes encoding heterodisulfide reductasecomplex which was proposed to play a crucial role in oxidizing cytoplasmic sulfur Like many heterotrophic sulfur oxidizersAcidicaldus sp strain DX-1 had no genes encoding enzymes essential for the direct oxidation of sulfite An indirect oxidationof sulfite via adenosine-51015840-phosphosulfate was proposed in Acidicaldus strain DX-1 However compared to other closely relatedbacteria Acidiphilium cryptum and Acidiphilium multivorum which harbored the genes encoding Sox system almost all of thesegenes were not detected in Acidicaldus sp strain DX-1 This study might provide some references for the future study of RISCoxidation in heterotrophic sulfur-oxidizing acidophiles

1 Introduction

Due to the evolutionary importance and applied perspectivesof extreme acidophiles (optimal growth at or below pH30) researchers have paid much attention to these microor-ganisms [1ndash3] Extreme acidophiles are widely used in thebioprocessing of minerals and bioremediation of acidic andmetal-enriched water [4ndash6] Many chemolithoautotrophicacidophiles such as Leptospirillum spp and Sulfolobus metal-licus can accelerate the dissolution of sulfide minerals byoxidizing ferrous iron or reduced inorganic sulfur compound(RISC) [7] In addition to obligate autotrophs many het-erotrophic andmixotrophic acidophiles also play key roles iniron and sulfur cycling such as Ferrimicrobium acidiphilumSulfobacillus spp Thermoplasma sp and Acidiphilium spp[7ndash12]

Species from the Acidicaldus genus are moderatelythermophilic and obligate heterotrophic acidophiles withinthe Alphaproteobacteria class The type species AcidicaldusorganivoransY008 whichwas isolated from a geothermal sitein Yellowstone National Park is a member of facultativelyanaerobes and can grow by ferric iron respiration in theanaerobic environment [13] The closest phylogenetic rela-tives of Ac organivorans Y008 are acidophilic heterotrophsincluding Acidiphilium [14] Acidisphaera [15] and Acetobac-ter [16] Previous studies showed thatAcidicaldus organivorus(the synonym of Ac organivorans) harbored some uniquephysiological characteristics which differed from other aci-dophilic heterotrophs Compared to Acidisphaera rubrifa-ciens which grows at pH 45ndash50 and optimal tempera-ture 30ndash35∘C Acidicaldus organivorus requires a lower pH(25ndash30) and higher temperature (optima 50ndash55∘C) Ac

Hindawi Publishing CorporationBioMed Research InternationalVolume 2016 Article ID 8137012 8 pageshttpdxdoiorg10115520168137012

2 BioMed Research International

organivorus can oxidize elemental sulfur to sulfate thoughit cannot perform autotrophic growth on sulfur in organic-free media Additionally Ac organivorus can catalyze thedissimilatory reduction of ferric iron whereas the type strainof As rubrifaciens does not grow by ferric iron respiration inthe absence of oxygen [13]

Although knowledge in the last decade has greatlyadvanced our understanding on the acidophilic bacteria itis scarce to attempt to study the physiology and genetics ofthe heterotrophic sulfur-oxidizing acidophiles Compared toautotrophic sulfur-oxidizing bacteria metabolisms of theseheterotrophs are more versatile [17] They can not only useorganic matters as energy sources but also obtain energyderived from the oxidation of elemental sulfur or RISCThesetraits can confer the heterotrophic sulfur-oxidizing bacteriadual contributions to microbial communities in bioleachingsystems (i) while organic matters inhibit the growth ofsome facultative autotrophic bacteria [18 19] heterotrophswhich can consume the organic matters in the microbialcommunities might relieve the inhibiting effect of organicmatters on the autotrophs (ii) RISC oxidation would acceler-ate dissolution of acid soluble metal sulfides In this study wechose a strain isolated from Dexing Copper Mine (JiangxiChina) to explore its physiologic and genetic properties Thegenome sequence of this strain was acquired using the wholegenome sequencing and comparative genomics was thenperformed aiming to propose its putative RISC oxidationmodel

2 Materials and Methods

21 Isolation and Cultivation of Bacteria Samples fromthe surface of effusion pool were inoculated in 9K liquidmedia [20] supplemented with 5 gL elemental sulfur 45(wv) ferrous sulfate and 002 yeast extract (Oxoid UK)Strains were purified by repeated single colony (in triplicate)isolation on 9K plates solidified with 002 yeast extractand grown at 45∘C in 9K liquid media pH 30 with 002(wv) yeast extract and 10mM glucose All procedures wereoperated aseptically

22 DNA Extraction 16S rRNA Gene Amplification and Phy-logenetic Analysis At later exponential phase (generally 4thday) strain DX-1 was harvested by centrifugation (12000 gfor 10min at 4∘C) Genomic DNA was extracted from thepelleted cells using TIANamp Bacteria DNA Kit (TiangenBiotech China) according to the manufacturerrsquos instructionand finally was resuspended in TE buffer 16S rRNA genesequence was PCR amplified from the genomicDNA extractsof strain DX-1 Amplification was performed in 50120583L reac-tion mixtures containing 1 120583L of DNA extracts 1 120583L eachof 10mM forward and reverse primers 25 120583L of universalTaq PCRMaster Mix (Tiangen Biotech China) and 22120583L ofdeionized water The PCR conditions for amplification wereas follows 94∘C for 4min then 32 cycles of 94∘C for 30 s 55∘Cfor 30 s and 72∘C for 45 s followed by a final extension at72∘C for 10min PCR product of 16S rRNA gene was purifieddirectly with the QIAquick PCR Purification Kit (QiagenGermany) and sequenced

16S rRNA gene sequence of strain DX-1 was aligned withother acidophilic Alphaproteobacteria sequences from theGenBank database using the CLUSTAL program [21] Thisalignment was used to make a distance matrix Phylogenetictrees were constructed using the neighbor joining methodby Molecular Evolutionary Genetics Analysis 52 (MEGAversion 52) [22] Bootstrap analysis was carried out on 1000replicate input data sets

23 Genome Sequencing Assembly and AnnotationGenomic library construction sequencing and assemblywere performed according to previous methods [23] Giventhe high GC content of genome of Acidicaldus spp morethan 600Mb pair-ends reads with a depth of over 200-fold coverage were obtained After genome assembly 375scaffolds were acquired using SOAPdenovo package [24]Thecompleteness (9534) of strain DX-1 genome was estimatedusing the CheckM [25] Coding sequences (CDSs) were thenpredicted with the ORF finders Glimmer [26] All CDSswere annotated by comparison with the public availabledatabases nonredundant NCBI [27] and KEGG [28] usingthe annotation software BLAST [29] The unassigned CDSswere further annotated using the HMMPfam program [30]And the hidden Markov models for the protein domainswere obtained from the Pfam database [31] The softwareprograms tRNAscan-SE and RNAmmer were used for theidentifications of tRNA and rRNA respectively [32 33]

24 Comparative Genomics The genomes of Ap cryptum JF-5 and Ap multivorum AIU301 were retrieved from the NCBIdatabase Orthologs between Acidicaldus strain DX-1 Apcryptum JF-5 and Ap multivorum AIU301 were detected viaan all-versus-all reciprocal BLASTP search against their ownprotein sets respectively [29] The best sequence similaritieswere obtained using two cut-off values 119864-value le 1119890minus05 andminimal coverage by local alignment = 70

25 RNA Extraction and Real-Time Quantitative PCR Analy-sis To investigate the transcript profiles of genes associatedwith RISC oxidationAcidicaldus sp strainDX-1 was culturedat 45∘C in 9K liquid media pH 30 with 002 (wv)yeast extract and 10mM glucose And the additional 1(wv) elemental sulfur (S0) was added in another groupMicrobial cells were harvested at mid-exponential growthphase according to bacterial growth curve Total RNA wasextracted using TRIzol reagent (Invitrogen Carlsbad USA)treated with RNase-free DNase I (Qiagen Valencia USA)and purified with RNeasy Kit (Qiagen Valencia USA)Subsequently single-stranded cDNA was synthesized withReverTra Ace qPCR RT Kit (Toyobo Japan) accordingto the manufacturerrsquos protocol The cDNA was stored atminus80∘C which was used for further RT-qPCR analysis Allexperiments under the same conditions were performed intriplicateThe gene expression level with fold change ge 1 wereupregulated and otherwise downregulated

Specific primers targeting selected genes putativelyinvolved in RISC oxidation were designed for real-timePCR analysis (Table 1) The real-time PCR amplification wasperformed with iCycler iQ Real-Time PCR detection system

BioMed Research International 3

Table 1 Primers used for real-time quantitative PCR in this study

Targeted gene Primers Product size [bp] Melting temp [∘C] Primer sequence

hdrA FwdRev 262 55 GCACCGGCTTCACCCATTTC

AGCTGCTCGCGGATCTCCAT

hdrB FwdRev 184 55 ACTCGACCTGGTATGATTGCTGC

TTGCCGATCCACTGGCTCTT

hdrC FwdRev 161 55 CACGGCGTGGGAGGTCAATC

CGGCGAGCCAGTCTTCGTAAT

hdrB2 FwdRev 201 55 ACAACGAACACGCGAAAGAGG

GACGGACGTACATGCAGCCATA

rhd FwdRev 238 55 CCCAACGAGGGCAAGGACGG

AGAGGCGGAGCAGCCACCAG

doxD FwdRev 103 55 CAACTGGATGGCGCACAAA

CGCATAGAGCAGCGGGAAA

sat FwdRev 119 55 GACCTTCTCGAAAGCCAGAGC

TTGCGGGCAAGCCAAACC

sqr FwdRev 182 56 CGATTTCGGCGACTCGGGTGT

GCTGGCGGAGTAGGAATTTCTCAT

sqr2 FwdRev 258 55 AAACCGGGTGCGCTTCGT

TGCGGCTCCTTCGGATTGC

(Bio-Rad Laboratories Inc Hercules USA) 25120583L reactionmixtures contained 125 120583L SYBR Green Real-Time PCRMaster Mix (Toyobo Co Ltd Osaka Japan) 05 120583L single-stranded cDNA 1 120583L each of 10 120583M forward and reverseprimers and 10 120583L deionizedwaterThe specific amplificationprotocol was as follows 95∘C for 5min 40 cycles of 95∘C for20 s 55∘C for 15 s 72∘C for 15 s and a final incubation of 72∘Cfor 10minThe expression of each gene was determined fromtriplicate reactions in a single real-time PCR amplificationTo standardize the quantification of the selected target genes16S rRNA and glyceraldehyde 3-phosphate dehydrogenase(gapdh) were used as transcription controls to regulate therandom and systematic errors The expressions of selectedgenes in the medium with S0 and without S0 were calculatedfor further analysis

26 Nucleotide Sequence Accession Number The draftgenome sequence of Acidicaldus strain DX-1 has been depos-ited at DDBJEMBLGenBank under accession numberJPYW00000000

3 Results and Discussion

31 Isolation and Phylogenetic Analysis Several strains(named DX-1 DX-5 DX-20 and DX-22) from Dexing Cop-per Mine sampling sites which showed similar colony andcellular morphologies were isolated on solid medium with002 yeast extract All of these strains grew as small whiteround to convex-shaped colonies Considering that 16S rRNAsequence analysis showed 100 sequence identities only one(strain DX-1) was selected for further analysis The rootedphylogenetic tree indicated that 16S rRNA gene of strain DX-1 was assigned into a phyletic cluster with Acidicaldus spp(Figure 1) Furthermore 16S rRNAgene of strainDX-1 shared99 sequence identity with that of type strain Acidicaldus

organivorans Y008 [13] indicating that strain DX-1 belongsto Acidicaldus species

32 Genome Assembly and Annotation The draft genomesequence of Acidicaldus sp strain DX-1 contained2990377 bp with GC content of 6848 distributed in376 scaffolds which ranged from 1000 bp to 67370 bpGiven the high sequence coverage (200-fold) it was likelyto identify most genes in the draft genome of Acidicaldussp strain DX-1 Results showed that genome of Acidicaldussp strain DX-1 harbored 3259 predicted coding sequences(CDSs) which represented 8983 of the genome 1 rRNAoperon and 43 tRNA genes (Table 2) The number of CDSsin this strain was less than that in Acidiphilium multivorumAIU301 but more than that in Acidiphilium cryptum JF-5 andAcetobacter pasteurianus

33 Hydrogen Sulfide Oxidation Phototrophic bacteria suchas Allochromatium vinosum and some Chlorobium spp cananaerobically oxidize hydrogen sulfide to sulfur via a flav-ocytochrome 119888-sulfide dehydrogenase [34] In this processcytochrome 119888

550is used as electron acceptor for energy

production However flavocytochrome 119888 in A vinosum isnot required for phototrophic growth with hydrogen sulfideTherefore sulfide quinone reductase (SQR) is considered tobe essential for growth of A vinosum with hydrogen sulfideIn chemotrophic bacteria such as some Acidithiobacillusspp SQR is also responsible for the oxidation of hydrogensulfide [35] In Acidicaldus sp strain DX-1 no candidategenes encoding flavocytochrome 119888-sulfide dehydrogenasewere identified while two genes encoding SQR were found(Table S1 see Supplementary Material available online athttpdxdoiorg10115520168137012) One putative SQRshared 64 amino acid similarity with that ofAt ferrooxidansATCC 53993 and the other shared 72 amino acid similaritywith that of Bradyrhizobium oligotrophicum S58 Both of


Table 2 General features of Acidicaldus sp strain DX-1 in comparison with other heterotrophic acidophiles

Organism Acidicaldus sp strain DX-1 Acidiphilium cryptumJF-5

Acidiphiliummultivorum AIU301 Acetobacter pasteurianus

Isolated from Acid effusion of milltailing Acidic Sediments Pyritic acid mine

drainageSpontaneous cocoa bean

heap fermentation

Temperature range Moderate thermophilic(50sim55∘C) Mesophilic (30sim35∘C) Mesophilic (30ndash35∘C) Mesophilic (25ndash30∘C)

pH range 25ndash30 30ndash35 30ndash35 54ndash63Nutrition type Heterotrophic Heterotrophic Heterotrophic HeterotrophicOxygenrequirement Facultatively anaerobic Facultatively

anaerobicFacultativelyanaerobic Obligately aerobic

Fe(III) reduction Yes Yes Yes NoSulfur oxidation Yes No No NoGenome size (Mb) 299 339 375 291GC content 6848 6799 6758 5304Protein-codinggenes 3259 3063 3448 2875

rRNA operon 1 2 2 5Number of tRNAs 43 47 48 57

Acidisphaera rubrifaciens strain HS-AP3 (NR_037119)

Acidisphaera sp MS-Y2 (AB669479)

Acidisphaera sp nju-AMDS1 (FJ915153)

Rhodopila globiformis 7950 (NR_037120)

Rhodovastum atsumiense strain G2-11 (NR_112776)

Acidisoma sp K16 (FR874240)

Acidisoma tundrae WM1 NR_042705

Acidisoma sibirica (KF241161)

Acidisoma sibiricum TPB621 (AM947654)

Acidiphilium multivorum (NR_074327)

Acidiphilium cryptum JF-5 (NR_074281)

Acidiphilium sp DC1 (EF556241)

Acidiphilium sp BGR 59 (GU167993)

Bacterium AO5 (EF151282)

Acidicaldus sp MK6 (JQ247723)

Acidicaldus sp T163 (AM749786)

Acidicaldus sp strain DX-1

Acidicaldus organivorans Y008 (NR_042752)

100100

67

63

55

63

100

58

100

5875

100

100

100

001

Figure 1 Phylogenetic tree of 16S rRNA genes showing the relationship of strain DX-1 (in bold) to other acidophilic 120572-ProteobacteriaPhylogenetic tree was constructed based on an alignment of 1283 bp using the neighbor joining method The scale bar represents 001nucleotide substitutions per 100 And the database accession numbers of the gene sequences used are given in parentheses AcidisphaerarubrifaciensHS-AP3 was used to root the tree

them had a small NADH binding domain within a largerFAD binding domain These results suggested that SQRmight be responsible for the oxidation of hydrogen sulfide inAcidicaldus sp strain DX-1

34 S4I Pathway In some strains of the genus Acidithiobacil-lus the membrane-bound thiosulfate quinone oxidoreduc-tase (TQO) and tetrathionate hydrolase (TetH) are respon-sible for the S

4I pathway [36 37] In At ferrooxidans TQO

which is constituted of subunits DoxA and DoxD catalyzesthe conversion of thiosulfate to tetrathionate and TetH cat-alyzes the hydrolysis of tetrathionate to generate sulfur sulfateand thiosulfate The consecutive reactions catalyzed by TetHand TQO promote the RISC oxidation in At ferrooxidans[38] One ortholog of doxDA encoding TQOwas identified inAcidicaldus sp strain DX-1 which shared 61 similarity withthat in At ferrooxidans (Table S1) Further analysis revealed


that the putative TQO had conserved DoxD domain (PfamPF04173) and DoxA domain (Pfam PF07680) Althoughprevious experiments indicated that Ac organivorans Y008can grow on tetrathionate overlay medium [13] no candidategenes with significant similarity to TetH were found in thedraft genome of Acidicaldus strain DX-1 Future analyses willbe necessary to determine whether TQO indeed catalyzesthiosulfate to tetrathionate and TetH gene is on the portionof the missing draft genome of Acidicaldus sp strain DX-1

35 Sox Pathway In the alphaproteobacterium Paracoccuspantotrophus the periplasmic Sox system encoded by 15genes [39] are comprised of four subunits including SoxXASoxYZ SoxB and Sox(CD)

2 Each Sox subunit directing its

own function was elaborated in previous studies [40] BothAcidiphilium cryptum andAcidiphiliummultivorum have onegene cluster of soxXYZABCD to code for four periplasmicproteins However no candidate genes encoding Sox systemwere identified in the genome of Acidicaldus sp strain DX-1 Considering the Sox system was absent S

4I pathway was

probably the sole way of further oxidation of thiosulfate inperiplasm

36 Sulfur Oxidation The cytoplasmic sulfur oxygenasereductase (SOR) which mediates biological oxidation ofinorganic sulfur can catalyze the disproportionation reactionof sulfur to generate sulfite thiosulfate and hydrogen sulfide[23 38 40ndash42] Sulfur dioxygenase (SDO) is proposed tobe an important elemental sulfur oxidation enzyme in thegenus Acidithiobacillus [43] and the relevant gene of SDOand its enzyme activity have been identified inAt caldus [41]Result showed that the genes sor and sdo were not identifiedin heterotroph Acidicaldus sp strain DX-1 Another enzymedirecting sulfur oxidation is the cytoplasmic heterodisulfidereductase complex [37] which catalyzes the oxidation ofsulfane sulfate (RSSH) to produce sulfite In At caldus RSSHis the product of thio proteins (RSH) with a sulfur atom inthe catalysis of thiosulfate by rhodanese (TST) [41] Resultsshowed that one ortholog of TSTwas found inAcidicaldus spstrain DX-1 Additionally compared to other heterodisulfidereductase complex reported in previous studies [38 44 45]only two copies of hdrB gene one cope of each HdrACsubunit and dsrE gene were distributed in the draft genomeof Acidicaldus sp strain DX-1 (Table S1) We cannot confirmwhether other components were present based on the draftgenome alone The putative HdrA subunit was flavoproteinthat contained FAD binding site and conserved residues (C-X-G-X-R-D-X

6ndash8-C-S-X2-C-C) for binding of Fe-S clusterwhich shared 72 sequence similarity with that of Atferrooxidans Additionally the putative HdrB having onetypical cysteine-rich regions was distributed in the Hdr genecluster and the HdrC subunit having the 4Fe-4S ferredoxiniron-sulfur binding domain shared 74 and 71 sequencesimilarities with that of At ferrooxidans respectively

37 Sulfite Oxidation Another important step in the bio-logical RISC oxidation was sulfite oxidation which wasinvolved in two different pathways In these models sulfitewas (i) directly oxidized to sulfate which was catalyzed by

a molybdenum-containing sulfite acceptor oxidoreductaseor (ii) indirectly oxidized by the intermediate adenosine-51015840-phosphosulfate (APS) [40] For indirect sulfite oxidation sul-fite was catalyzed by APS reductase to produce APS and thenoxidized to generate sulfate by sulfate adenylyltransferase(SAT) Most studies support the fact that the indirect sulfiteoxidation exists in bothAt ferrooxidans andAt caldus whichlack gene encoding APS reductase [36 38] In Acidicaldus spstrain DX-1 genes coding for sulfite acceptor oxidoreductaseand APS reductase were not found However a putativegene encoding SAT which has a conservative phosphoadeno-sine phosphosulfate (PAPS) reductase family domain wasidentified in Acidicaldus sp strain DX-1 (Table S1) Thusindirect sulfite oxidation might also play an important rolein Acidicaldus sp strain DX-1

38 Terminal Oxidases in RISC Oxidation In chemolithoau-totrophic sulfur-oxidizing bacteria the RISC oxidationclosely links with electron transfer through terminal oxi-dases In At ferrooxidans electrons from RISC oxidation aretransferred via the quinol pool (QH

2) (i) either directly to

terminal oxidase bd or bo3 to produce a proton gradient orindirectly through a bc1 complex and cytochrome 119888 or a highpotential iron-sulfur protein (HiPIP) to aa3 oxidase wherethe concentration of O

2is low or (ii) to NADH complex I

to generate reducing power [38] Genomic analysis showedthat Acidicaldus sp strain DX-1 had one copy of bd ubiquinoloxidase genes (cydAB) one gene cluster encoding bc1 com-plex and a gene cluster encoding the aa3 oxidase (TableS2) Genes encoding 14 subunits of NADH complex I werealso identified in its genome However no candidate genesencoding cytochrome bo3 ubiquinol oxidase were foundTherefore a putative electron transfer chain in Acidicaldussp strain DX-1 was proposed electrons from SQR HDR andTQO were transferred via the QH

2(i) either to bd oxidase or

bc1 complex to produce the proton gradient or (ii) to NADHcomplex I to generate reducing power Additionally electronsin bc1 complex were probably transferred via cytochrome 119888to the aa3 oxidase where the concentration of O

2is low to

produce the proton gradient

39 Expression of Key Genes Involved in RISC OxidationGenomic analysis provided evidence that most genes asso-ciated with RISC oxidation in Acidicaldus sp strain DX-1were similar to that in other acidophilic sulfur oxidizersFurthermore the expressions of relevant genes in bothorganic matter and organic matter supplemented with sulfur(S0) medium were validated by real-time quantitative PCR(Figure 2) Results indicated that all selected genes wereupregulated in organic matter + S0 culture suggesting thatthese encoding proteins are likely involved in the RISCoxidation in this strain Genes encoding TST and threesubunits of HdrABC complex for Acidicaldus strain DX-1were significantly upregulated while hdrB2 gene has rela-tively lower expression The conserved family domains ofeach HdrABC subunit and change of gene expression patternstrongly suggested that the HdrABC complex was concludedto oxidize cytoplasmic sulfur in Acidicaldus sp strain DX-1 In particular genes encoding HdrABC complex were not


hdrA hdrB hdrC hdrB2 rhd doxD sat sqr sqr2RISC oxidation related genes

00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)

Figure 2 RT-qPCR results depicting the expression difference of targeted genes involved in RISC oxidation in Acidicaldus sp strainDX-1 (in organic matter supplemented with sulfur (S0) medium or without sulfur) These genes used in this experiment (the encodingproteins and genomic loci are shown in parentheses) include hdrA (pyridine nucleotidedisulfide oxidoreductase scaffold254 1-941) hdrB(heterodisulfide reductase subunit B homolog scaffold254 827-2329) hdrC (iron-sulfur cluster-binding protein scaffold254 2500-3246)hdrB2 (heterodisulfide reductase subunit B homolog scaffold9 22130-22789) rhd (rhodanese thiosulfate sulfurtransferase scaffold15315026-15202) doxD (thiosulfate quinone oxidoreductase scaffold68 10659-11696) sat (sulfate adenylyltransferase scaffold217 14172-14891)sqr (sulfide quinone reductase scaffold18 14834-16117) and sqr2 (sulfide quinone reductase scaffold92 4297-5430)

Figure 3 Genome-based model of RISC oxidation in Acidicaldus sp strain DX-1 The figure was adapted from previous sulfur oxidationmodels [23 38] RISC oxidation involves various enzymes and a number of electron carriers The solid lines denote the oxidation of RISCcatalyzed by various enzymes and the dashed lines denote the direction of electron transfer SQR sulfide quinone reductase TQO thiosulfatequinone oxidoreductase TST rhodanese HdrABC heterodisulfide reductase complex SAT sulfate adenylyltransferase bd terminal oxidasebd bc1 terminal oxidase bc1 complex NADH NADH complex I aa3 cytochrome 119888 oxidase aa3-type QH2 quinol pool and CycAcytochrome c


found in the closely related bacteria Ap cryptum JF-5 andAp multivorum AIU301 which might be the reason whymany strains of Acidiphilium spp could not directly oxidizesulfur Additionally compared with sqr gene sqr2 genewas significantly upregulated indicating its importance tometabolize the periplasmic sulfide which might be generatedfrom other unknown metabolic pathways

4 Conclusions

In acidophilic microbial communities heterotrophic sulfur-oxidizing bacteria have versatile functions which not onlycan utilize numerous organic matters as energy sourcesbut can also acquire energy from the oxidation of RISCIn this study we isolated a heterotrophic sulfur-oxidizingbacterium Acidicaldus sp strain DX-1 from the effusion ofmill tailings in Dexing Copper Mine Comparative genomicsand RT-qPCR analysis revealed that several genes associatedwith RISC oxidation in Acidicaldus sp strain DX-1 weresimilar to other acidophilic sulfur-oxidizing bacteria Basedon the aforementioned analyses a model for RISC oxidationin Acidicaldus sp strain DX-1 was hypothesized (Figure 3)which might provide new insights and guides for the RISCoxidation of heterotrophs in the future

Competing Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors would like to thank Dr Yili Liang in CentralSouth University for proofreading the paper

References

[1] M Dopson and D B Johnson ldquoBiodiversity metabolism andapplications of acidophilic sulfur-metabolizing microorgan-ismsrdquo Environmental Microbiology vol 14 no 10 pp 2620ndash2631 2012

[2] C Baker-Austin and M Dopson ldquoLife in acid pH homeostasisin acidophilesrdquo Trends in Microbiology vol 15 no 4 pp 165ndash171 2007

[3] J P Cardenas J Valdes R Quatrini F Duarte and D SHolmes ldquoLessons from the genomes of extremely acidophilicbacteria and archaea with special emphasis on bioleachingmicroorganismsrdquo Applied Microbiology and Biotechnology vol88 no 3 pp 605ndash620 2010

[4] D B Johnson M-A Dziurla A Kolmert and K B HallbergldquoThe microbiology of acid mine drainage genesis and biotreat-ment review articlerdquo South African Journal of Science vol 98no 5-6 pp 249ndash255 2002

[5] X Zhang J Niu Y Liang X Liu and H Yin ldquoMetagenome-scale analysis yields insights into the structure and functionof microbial communities in a copper bioleaching heaprdquo BMCGenetics vol 17 no 1 article 21 2016

[6] Y Xiao Y Xu W Dong et al ldquoThe complicated substratesenhance the microbial diversity and zinc leaching efficiency

in sphalerite bioleaching systemrdquo Applied Microbiology andBiotechnology vol 99 no 23 pp 10311ndash10322 2015

[7] K B Hallberg and D B Johnson ldquoBiodiversity of acidophilicprokaryotesrdquo Advances in Applied Microbiology vol 49 pp 37ndash84 2001

[8] D B Johnson P Bacelar-Nicolau N Okibe AThomas and KB Hallberg ldquoFerrimicrobium acidiphilum gen nov sp nov andFerrithrix thermotolerans gen nov sp nov heterotrophic iron-oxidizing extremely acidophilic actinobacteriardquo InternationalJournal of Systematic and Evolutionary Microbiology vol 59 no5 pp 1082ndash1089 2009

[9] H R Watling F A Perrot and D W Shiers ldquoComparisonof selected characteristics of Sulfobacillus species and reviewof their occurrence in acidic and bioleaching environmentsrdquoHydrometallurgy vol 93 no 1-2 pp 57ndash65 2008

[10] A Segerer T A Langworthy and K O Stetter ldquoThermoplasmaacidophilum andThermoplasma volcanium sp nov from Solfa-tara fieldsrdquo Systematic and Applied Microbiology vol 10 no 2pp 161ndash171 1988

[11] D B Johnson and T A M Bridge ldquoReduction of ferric ironby acidophilic heterotrophic bacteria evidence for constitutiveand inducible enzyme systems in Acidiphilium spprdquo Journal ofApplied Microbiology vol 92 no 2 pp 315ndash321 2002

[12] R Guay and M Silver ldquoThiobacillus acidophilus sp nov isola-tion and some physiological characteristicsrdquo Canadian Journalof Microbiology vol 21 no 3 pp 281ndash288 1975

[13] D B Johnson B Stallwood S Kimura and K B HallbergldquoIsolation and characterization of Acidicaldus organivorus gennov sp nov a novel sulfur-oxidizing ferric iron-reducingthermo-acidophilic heterotrophic Proteobacteriumrdquo Archives ofMicrobiology vol 185 no 3 pp 212ndash221 2006

[14] A P Harrison ldquoAcidiphilium cryptum gen nov sp novheterotrophic bacterium from acidic mineral environmentsrdquoInternational Journal of Systematic Bacteriology vol 31 pp 327ndash332 1981

[15] A Hiraishi Y Matsuzawa T Kanbe and N WakaoldquoAcidisphaera rubrifaciens gen nov sp nov an aerobicbacteriochlorophyll-containing bacterium isolated fromacidic environmentsrdquo International Journal of Systematic andEvolutionary Microbiology vol 50 no 4 pp 1539ndash1546 2000

[16] Y Azuma A Hosoyama M Matsutani et al ldquoWhole-genomeanalyses reveal genetic instability of Acetobacter pasteurianusrdquoNucleic Acids Research vol 37 no 17 pp 5768ndash5783 2009

[17] D B Johnson and F F Roberto ldquoHeterotrophic acidophiles andtheir roles in the bioleaching of sulfide mineralsrdquo in BiominingTheory Microbes and Industrial Processes Biotechnology Intel-ligence Unit pp 259ndash279 Springer Berlin Germany 1997

[18] Q Li Y Tian X Fu et al ldquoThe community dynamics ofmajor bioleaching microorganisms during chalcopyrite leach-ing under the effect of organicsrdquo Current Microbiology vol 63no 2 pp 164ndash172 2011

[19] J Peng R Zhang Q Zhang L Zhang andH Zhou ldquoScreeningand characterization of Acidiphilium sp PJH and its role inbioleachingrdquoTransactions ofNonferrousMetals Society of Chinavol 18 no 6 pp 1443ndash1449 2008

[20] N P Marhual N Pradhan R N Kar L B Sukla and BK Mishra ldquoDifferential bioleaching of copper by mesophilicand moderately thermophilic acidophilic consortium enrichedfrom same copper mine water samplerdquo Bioresource Technologyvol 99 no 17 pp 8331ndash8336 2008

[21] J D Thompson T J Gibson F Plewniak F Jeanmougin andD G Higgins ldquoThe CLUSTAL X windows interface flexible


strategies for multiple sequence alignment aided by qualityanalysis toolsrdquoNucleic Acids Research vol 25 no 24 pp 4876ndash4882 1997

[22] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[23] H Yin X Zhang X Li et al ldquoWhole-genome sequencingreveals novel insights into sulfur oxidation in the extremophileAcidithiobacillus thiooxidansrdquo BMC Microbiology vol 14 no 1article 179 2014

[24] R Luo B Liu Y Xie et al ldquoSOAPdenovo2 an empiricallyimproved memory-efficient short-read de novo assemblerrdquoGigaScience vol 1 article 18 2012

[25] D H Parks M Imelfort C T Skennerton P Hugenholtzand G W Tyson ldquoCheckM assessing the quality of microbialgenomes recovered from isolates single cells and metageno-mesrdquo Genome Research vol 25 no 7 pp 1043ndash1055 2015

[26] A L Delcher K A Bratke E C Powers and S L SalzbergldquoIdentifying bacterial genes and endosymbiont DNA withGlimmerrdquo Bioinformatics vol 23 no 6 pp 673ndash679 2007

[27] D L Wheeler T Barrett D A Benson et al ldquoDatabaseresources of the national center for biotechnology informationrdquoNucleic Acids Research vol 35 no 1 pp D5ndashD12 2007

[28] M Kanehisa and S Goto ldquoKEGG kyoto encyclopedia of genesand genomesrdquo Nucleic Acids Research vol 28 no 1 pp 27ndash302000

[29] S F Altschul T L Madden A A Schaffer et al ldquoGappedBLAST and PSI-BLAST a new generation of protein databasesearch programsrdquo Nucleic Acids Research vol 25 no 17 pp3389ndash3402 1997

[30] R D Finn J Tate J Mistry et al ldquoThe Pfam protein familiesdatabaserdquoNucleic Acids Research vol 36 no 1 pp D281ndashD2882008

[31] A Bateman L Coin R Durbin et al ldquoThe Pfam proteinfamilies databaserdquo Nucleic Acids Research vol 32 pp D138ndashD141 2004

[32] T M Lowe and S R Eddy ldquotRNAscan-SE a programfor improved detection of transfer RNA genes in genomicsequencerdquo Nucleic Acids Research vol 25 no 5 pp 955ndash9641997

[33] K Lagesen P Hallin E A Roslashdland H-H Staeligrfeldt T Rognesand DW Ussery ldquoRNAmmer consistent and rapid annotationof ribosomal RNA genesrdquo Nucleic Acids Research vol 35 no 9pp 3100ndash3108 2007

[34] JMVisser G AHDe Jong L A Robertson and J G KuenenldquoA novel membrane-bound flavocytochrome c sulfide dehydro-genase from the colourless sulfur bacterium Thiobacillus spW5rdquo Archives of Microbiology vol 167 no 5 pp 295ndash301 1997

[35] S Wakai M Tsujita M Kikumoto M A Manchur TKanao and K Kamimura ldquoPurification and characterizationof sulfidequinone oxidoreductase from an acidophilic iron-oxidizing bacterium Acidithiobacillus ferrooxidansrdquo BioscienceBiotechnology and Biochemistry vol 71 no 11 pp 2735ndash27422007

[36] S Mangold J Valdes D S Holmes and M Dopson ldquoSulfurmetabolism in the extreme acidophile acidithiobacillus caldusrdquoFrontiers in Microbiology vol 2 article 17 2011

[37] J Valdes I Pedroso R Quatrini et al ldquoAcidithiobacillusferrooxidans metabolism from genome sequence to industrialapplicationsrdquo BMC Genomics vol 9 no 1 article 597 2008

[38] R Quatrini C Appia-Ayme Y Denis E Jedlicki D S HolmesandV Bonnefoy ldquoExtending themodels for iron and sulfur oxi-dation in the extreme acidophileAcidithiobacillus ferrooxidansrdquoBMC Genomics vol 10 article 394 2009

[39] C G Friedrich F Bardischewsky D Rother A Quentmeierand J Fischer ldquoProkaryotic sulfur oxidationrdquo Current Opinionin Microbiology vol 8 no 3 pp 253ndash259 2005

[40] C G Friedrich D Rother F Bardischewsky A Ouentmeierand J Fischer ldquoOxidation of reduced inorganic sulfur com-pounds by bacteria emergence of a common mechanismrdquoApplied and EnvironmentalMicrobiology vol 67 no 7 pp 2873ndash2882 2001

[41] L Chen Y Ren J Lin X Liu X Pang and J LinldquoAcidithiobacillus caldus sulfur oxidation model based on tran-scriptome analysis between the wild type and sulfur oxygenasereductase defective mutantrdquo PLoS ONE vol 7 no 9 Article IDe39470 2012

[42] M Liljeqvist O I Rzhepishevska and M Dopson ldquoGeneidentification and substrate regulation provide insights intosulfur accumulation during bioleaching with the psychro-tolerant acidophile Acidithiobacillus ferrivoransrdquo Applied andEnvironmental Microbiology vol 79 no 3 pp 951ndash957 2013

[43] P Ramırez N Guiliani L Valenzuela S Beard and CA Jerez ldquoDifferential protein expression during growth ofAcidithiobacillus ferooxidans on ferrous iron sulfur com-pounds or metal sulfidesrdquo Applied and Environmental Micro-biology vol 70 no 8 pp 4491ndash4498 2004

[44] L-J Liu Y Stockdreher T Koch et al ldquoThiosulfate transfermediated by DsrETusA homologs from acidothermophilicsulfur-oxidizing archaeonMetallosphaera cuprinardquoThe Journalof Biological Chemistry vol 289 no 39 pp 26949ndash26959 2014

[45] Y Stockdreher S S Venceslau M Josten H-G Sahl I A CPereira and C Dahl ldquoCytoplasmic sulfurtransferases in thepurple sulfur bacterium Allochromatium vinosum evidence forsulfur transfer from DsrEFH to DsrCrdquo PLoS ONE vol 7 no 7Article ID e40785 2012

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


organivorus can oxidize elemental sulfur to sulfate thoughit cannot perform autotrophic growth on sulfur in organic-free media Additionally Ac organivorus can catalyze thedissimilatory reduction of ferric iron whereas the type strainof As rubrifaciens does not grow by ferric iron respiration inthe absence of oxygen [13]

Although knowledge in the last decade has greatlyadvanced our understanding on the acidophilic bacteria itis scarce to attempt to study the physiology and genetics ofthe heterotrophic sulfur-oxidizing acidophiles Compared toautotrophic sulfur-oxidizing bacteria metabolisms of theseheterotrophs are more versatile [17] They can not only useorganic matters as energy sources but also obtain energyderived from the oxidation of elemental sulfur or RISCThesetraits can confer the heterotrophic sulfur-oxidizing bacteriadual contributions to microbial communities in bioleachingsystems (i) while organic matters inhibit the growth ofsome facultative autotrophic bacteria [18 19] heterotrophswhich can consume the organic matters in the microbialcommunities might relieve the inhibiting effect of organicmatters on the autotrophs (ii) RISC oxidation would acceler-ate dissolution of acid soluble metal sulfides In this study wechose a strain isolated from Dexing Copper Mine (JiangxiChina) to explore its physiologic and genetic properties Thegenome sequence of this strain was acquired using the wholegenome sequencing and comparative genomics was thenperformed aiming to propose its putative RISC oxidationmodel

2 Materials and Methods

21 Isolation and Cultivation of Bacteria Samples fromthe surface of effusion pool were inoculated in 9K liquidmedia [20] supplemented with 5 gL elemental sulfur 45(wv) ferrous sulfate and 002 yeast extract (Oxoid UK)Strains were purified by repeated single colony (in triplicate)isolation on 9K plates solidified with 002 yeast extractand grown at 45∘C in 9K liquid media pH 30 with 002(wv) yeast extract and 10mM glucose All procedures wereoperated aseptically

22 DNA Extraction 16S rRNA Gene Amplification and Phy-logenetic Analysis At later exponential phase (generally 4thday) strain DX-1 was harvested by centrifugation (12000 gfor 10min at 4∘C) Genomic DNA was extracted from thepelleted cells using TIANamp Bacteria DNA Kit (TiangenBiotech China) according to the manufacturerrsquos instructionand finally was resuspended in TE buffer 16S rRNA genesequence was PCR amplified from the genomicDNA extractsof strain DX-1 Amplification was performed in 50120583L reac-tion mixtures containing 1 120583L of DNA extracts 1 120583L eachof 10mM forward and reverse primers 25 120583L of universalTaq PCRMaster Mix (Tiangen Biotech China) and 22120583L ofdeionized water The PCR conditions for amplification wereas follows 94∘C for 4min then 32 cycles of 94∘C for 30 s 55∘Cfor 30 s and 72∘C for 45 s followed by a final extension at72∘C for 10min PCR product of 16S rRNA gene was purifieddirectly with the QIAquick PCR Purification Kit (QiagenGermany) and sequenced

16S rRNA gene sequence of strain DX-1 was aligned withother acidophilic Alphaproteobacteria sequences from theGenBank database using the CLUSTAL program [21] Thisalignment was used to make a distance matrix Phylogenetictrees were constructed using the neighbor joining methodby Molecular Evolutionary Genetics Analysis 52 (MEGAversion 52) [22] Bootstrap analysis was carried out on 1000replicate input data sets

23 Genome Sequencing Assembly and AnnotationGenomic library construction sequencing and assemblywere performed according to previous methods [23] Giventhe high GC content of genome of Acidicaldus spp morethan 600Mb pair-ends reads with a depth of over 200-fold coverage were obtained After genome assembly 375scaffolds were acquired using SOAPdenovo package [24]Thecompleteness (9534) of strain DX-1 genome was estimatedusing the CheckM [25] Coding sequences (CDSs) were thenpredicted with the ORF finders Glimmer [26] All CDSswere annotated by comparison with the public availabledatabases nonredundant NCBI [27] and KEGG [28] usingthe annotation software BLAST [29] The unassigned CDSswere further annotated using the HMMPfam program [30]And the hidden Markov models for the protein domainswere obtained from the Pfam database [31] The softwareprograms tRNAscan-SE and RNAmmer were used for theidentifications of tRNA and rRNA respectively [32 33]

24 Comparative Genomics The genomes of Ap cryptum JF-5 and Ap multivorum AIU301 were retrieved from the NCBIdatabase Orthologs between Acidicaldus strain DX-1 Apcryptum JF-5 and Ap multivorum AIU301 were detected viaan all-versus-all reciprocal BLASTP search against their ownprotein sets respectively [29] The best sequence similaritieswere obtained using two cut-off values 119864-value le 1119890minus05 andminimal coverage by local alignment = 70

25 RNA Extraction and Real-Time Quantitative PCR Analy-sis To investigate the transcript profiles of genes associatedwith RISC oxidationAcidicaldus sp strainDX-1 was culturedat 45∘C in 9K liquid media pH 30 with 002 (wv)yeast extract and 10mM glucose And the additional 1(wv) elemental sulfur (S0) was added in another groupMicrobial cells were harvested at mid-exponential growthphase according to bacterial growth curve Total RNA wasextracted using TRIzol reagent (Invitrogen Carlsbad USA)treated with RNase-free DNase I (Qiagen Valencia USA)and purified with RNeasy Kit (Qiagen Valencia USA)Subsequently single-stranded cDNA was synthesized withReverTra Ace qPCR RT Kit (Toyobo Japan) accordingto the manufacturerrsquos protocol The cDNA was stored atminus80∘C which was used for further RT-qPCR analysis Allexperiments under the same conditions were performed intriplicateThe gene expression level with fold change ge 1 wereupregulated and otherwise downregulated

Specific primers targeting selected genes putativelyinvolved in RISC oxidation were designed for real-timePCR analysis (Table 1) The real-time PCR amplification wasperformed with iCycler iQ Real-Time PCR detection system















CGCATAGAGCAGCGGGAAA


TTGCGGGCAAGCCAAACC




TGCGGCTCCTTCGGATTGC
















heap fermentation
























100100

67

63

55

63

100

58

100

5875

100

100

100

001











4I pathway was













2is low to





00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)





4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology















CGCATAGAGCAGCGGGAAA


TTGCGGGCAAGCCAAACC




TGCGGCTCCTTCGGATTGC
















heap fermentation
























100100

67

63

55

63

100

58

100

5875

100

100

100

001











4I pathway was













2is low to





00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)





4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology







heap fermentation
























100100

67

63

55

63

100

58

100

5875

100

100

100

001











4I pathway was













2is low to





00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)





4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology






4I pathway was













2is low to





00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)





4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



00

05

10

15

20

25

Relat

ive e

xpre

ssio

n (w

ithS0 w

ithou

tS0)





4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



4 Conclusions


Competing Interests


Acknowledgments


References
























































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology








Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

Documents

Research Article Genomic Analysis Unravels Reduced ...downloads.hindawi.com/journals/bmri/2016/8137012.pdf · Isolation and Cultivation of Bacteria. Samples from the surface of e